The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	0	10943	4678113		Catovirus(100.0%)	9	NA	NA
WP_001295377.1|1604_1994_-	glycine cleavage system protein GcvH	NA	NA	NA	NA	NA
WP_000068689.1|2019_3114_-	glycine cleavage system aminomethyltransferase GcvT	NA	NA	NA	NA	NA
WP_001192149.1|3568_4771_-	FAD-dependent 2-octaprenylphenol hydroxylase	NA	NA	NA	NA	NA
WP_000111149.1|4896_6075_-	2-octaprenyl-6-methoxyphenyl hydroxylase	NA	NA	NA	NA	NA
WP_000193689.1|6071_7388_-	Xaa-Pro aminopeptidase	NA	NA	NA	NA	NA
WP_000027236.1|7413_7992_-	YecA family protein	NA	NA	NA	NA	NA
WP_001276011.1|8158_8488_+	cell division protein ZapA	NA	NA	NA	NA	NA
WP_001574944.1|8733_9330_+	5-formyltetrahydrofolate cyclo-ligase	NA	NA	NA	NA	NA
WP_001151627.1|9710_10943_-	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	47.9	1.8e-102
>prophage 2
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	22132	22789	4678113		Bacillus_virus(100.0%)	1	NA	NA
WP_000956921.1|22132_22789_+	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	29.2	4.3e-10
>prophage 3
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	30805	32278	4678113		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_000379526.1|30805_32278_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	33.2	1.2e-47
>prophage 4
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	38096	39251	4678113		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001062140.1|38096_39251_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	63.9	1.5e-130
>prophage 5
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	56558	57644	4678113		Geobacillus_virus(100.0%)	1	NA	NA
WP_000976289.1|56558_57644_+	membrane-bound lytic murein transglycosylase MltC	NA	A0A0H3V0Q1	Geobacillus_virus	39.0	5.8e-12
>prophage 6
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	79549	80428	4678113		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_000089254.1|79549_80428_-	carbon-nitrogen hydrolase family protein	NA	M1HPY5	Paramecium_bursaria_Chlorella_virus	28.4	3.5e-07
>prophage 7
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	83827	85300	4678113		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_000437138.1|83827_85300_+	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	30.8	1.3e-43
>prophage 8
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	100725	105866	4678113		uncultured_Caudovirales_phage(50.0%)	6	NA	NA
WP_001238438.1|100725_102369_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	56.7	1.1e-09
WP_000439335.1|102675_103170_-	TIGR00645 family protein	NA	NA	NA	NA	NA
WP_000433046.1|103449_103965_-	RNA helicase	NA	NA	NA	NA	NA
WP_000936450.1|104056_104467_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000665661.1|104453_104858_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001677275.1|104981_105866_+	SDR family oxidoreductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	48.6	3.0e-67
>prophage 9
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	111807	117512	4678113		Staphylococcus_phage(33.33%)	5	NA	NA
WP_000013100.1|111807_112635_+	2,5-didehydrogluconate reductase DkgA	NA	A0A2H4PQR8	Staphylococcus_phage	46.0	8.6e-64
WP_000818493.1|112831_114286_+	DASS family sodium-coupled anion symporter	NA	NA	NA	NA	NA
WP_000128242.1|114330_114786_+	HIT family protein	NA	Q5YEY9	Rock_bream_iridovirus	36.8	2.4e-20
WP_000525384.1|114943_115138_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001274458.1|115340_117512_-	YgiQ family radical SAM protein	NA	M1QSD9	Pseudomonas_phage	70.8	2.0e-104
>prophage 10
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	123349	127049	4678113		Bacillus_virus(50.0%)	3	NA	NA
WP_001281910.1|123349_125608_-	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	36.0	1.0e-87
WP_000998803.1|125718_126585_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000731552.1|126656_127049_-	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	48.1	1.6e-20
>prophage 11
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	130364	132257	4678113		Bacillus_virus(100.0%)	1	NA	NA
WP_000195318.1|130364_132257_-	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	34.8	5.3e-93
>prophage 12
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	136657	138498	4678113		Erwinia_phage(50.0%)	2	NA	NA
WP_000831522.1|136657_137329_+	DUF1190 family protein	NA	A0A173GEW8	Erwinia_phage	44.9	9.8e-34
WP_000442833.1|137334_138498_+	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	42.9	1.4e-88
>prophage 13
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	144254	144908	4678113		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001076978.1|144254_144908_-	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	43.8	1.6e-44
>prophage 14
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	148959	150393	4678113		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_000867680.1|148959_150393_-	bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE	NA	A0A1B1IUK5	uncultured_Mediterranean_phage	29.2	2.3e-40
>prophage 15
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	155621	172485	4678113	tRNA	Sinorhizobium_phage(14.29%)	14	NA	NA
WP_000708447.1|155621_156863_+	multifunctional CCA addition/repair protein	NA	A0A0F6YPT7	Sinorhizobium_phage	47.9	6.5e-92
WP_001281933.1|156966_157788_-	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_000355776.1|157885_158245_-	bifunctional dihydroneopterin aldolase/7,8-dihydroneopterin epimerase	NA	NA	NA	NA	NA
WP_001272784.1|158351_158963_+	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_001264394.1|159212_160226_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.5	2.8e-109
WP_001144069.1|160453_160669_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_000918865.1|160903_162649_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.4	2.1e-72
WP_001519776.1|162798_164646_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.4e-35
WP_000237776.1|164769_165276_-	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
WP_000213760.1|165556_166324_-	siderophore-interacting protein	NA	NA	NA	NA	NA
WP_000983441.1|166555_167203_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000478462.1|167199_168768_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	33.5	2.2e-12
WP_000094642.1|169155_170676_-	PAS domain-containing methyl-accepting chemotaxis protein	NA	A0A1B0V854	Salmonella_phage	47.8	8.4e-33
WP_122038271.1|171054_172485_+	putrescine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	29.3	1.0e-32
>prophage 16
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	178675	179644	4678113		Enterobacteria_phage(100.0%)	1	NA	NA
WP_001098833.1|178675_179644_+	TerC family protein	NA	I7HPH5	Enterobacteria_phage	34.9	5.0e-39
>prophage 17
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	192839	195134	4678113		Tetraselmis_virus(100.0%)	1	NA	NA
WP_000867321.1|192839_195134_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.2	9.7e-158
>prophage 18
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	201046	202192	4678113		Streptococcus_phage(100.0%)	1	NA	NA
WP_000706464.1|201046_202192_-	glycerate 2-kinase	NA	W6LM47	Streptococcus_phage	40.6	3.5e-47
>prophage 19
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	212879	219528	4678113		Streptococcus_phage(25.0%)	9	NA	NA
WP_000812295.1|212879_213743_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	42.6	1.5e-50
WP_000249224.1|213806_215849_+	penicillin-binding protein activator	NA	NA	NA	NA	NA
WP_000057285.1|215806_216202_+	YraN family protein	NA	NA	NA	NA	NA
WP_000893481.1|216223_216814_+	DnaA initiator-associating protein DiaA	NA	A0A067XQR2	Caulobacter_phage	31.9	7.1e-12
WP_000643280.1|216823_217399_+	divisome-associated lipoprotein YraP	NA	NA	NA	NA	NA
WP_001530791.1|217465_218101_-	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_000037599.1|218231_218750_+	protein/nucleic acid deglycase	NA	A0A0N7KVR4	Yellowstone_lake_phycodnavirus	28.2	9.0e-11
WP_000380404.1|218729_219173_-	YhbP family protein	NA	NA	NA	NA	NA
WP_000928383.1|219210_219528_+	GIY-YIG nuclease family protein	NA	S6DF82	Invertebrate_iridovirus	50.0	6.5e-12
>prophage 20
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	226664	228554	4678113		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_000807252.1|226664_228554_-	DEAD/DEAH family ATP-dependent RNA helicase	NA	A0A0N9Q9J4	Chrysochromulina_ericina_virus	30.8	7.7e-52
>prophage 21
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	234089	240746	4678113		Cafeteria_roenbergensis_virus(50.0%)	4	NA	NA
WP_000133064.1|234089_236768_-	translation initiation factor IF-2	NA	E3T4N3	Cafeteria_roenbergensis_virus	26.3	1.9e-24
WP_001031038.1|236792_238295_-	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_000105461.1|238322_238775_-	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_000207646.1|239402_240746_+	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	93.7	4.8e-64
>prophage 22
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	243932	246820	4678113	protease	Pandoravirus(50.0%)	2	NA	NA
WP_000764713.1|243932_244781_-	dihydropteroate synthase	NA	S4W084	Pandoravirus	30.3	1.4e-21
WP_001107481.1|244885_246820_-|protease	ATP-dependent zinc metalloprotease FtsH	protease	G8DDJ2	Micromonas_pusilla_virus	43.3	9.2e-117
>prophage 23
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	253542	255033	4678113		Indivirus(50.0%)	2	NA	NA
WP_001047354.1|253542_254514_+	octaprenyl diphosphate synthase	NA	A0A1V0SE37	Indivirus	25.8	7.8e-08
WP_000444167.1|254745_255033_+	DNA-binding transcriptional regulator SfsB	NA	A0A2I7S995	Vibrio_phage	68.7	3.5e-17
>prophage 24
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	259142	274049	4678113		Staphylococcus_phage(25.0%)	17	NA	NA
WP_000531566.1|259142_259955_-	phospholipid ABC transporter ATP-binding protein MlaF	NA	G3M9Y6	Bacillus_virus	30.2	9.7e-20
WP_000922742.1|260167_261145_+	calcium/sodium antiporter	NA	A0A2D1GNI8	Pseudoalteromonas_phage	22.9	1.5e-06
WP_000018617.1|261158_262145_+	arabinose-5-phosphate isomerase KdsD	NA	A0A2P0VNK5	Tetraselmis_virus	31.2	1.1e-38
WP_000030032.1|262165_262732_+	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	74.3	7.9e-53
WP_000047845.1|262728_263304_+	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_000669770.1|263272_263827_+	lipopolysaccharide ABC transporter substrate-binding protein LptA	NA	NA	NA	NA	NA
WP_000224104.1|263833_264559_+	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	7.1e-22
WP_000809020.1|264606_266040_+	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_001176589.1|266062_266350_+	ribosome hibernation promoting factor	NA	NA	NA	NA	NA
WP_000609332.1|266467_266959_+	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
WP_000243749.1|267004_267859_+	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	28.4	1.4e-05
WP_000216797.1|267855_268128_+	PTS phosphocarrier protein NPr	NA	NA	NA	NA	NA
WP_000602193.1|268377_269010_+	PhoP regulatory network protein YrbL	NA	NA	NA	NA	NA
WP_000044648.1|269084_269813_-	monofunctional biosynthetic peptidoglycan transglycosylase	NA	NA	NA	NA	NA
WP_000719822.1|269809_270463_-	isoprenoid biosynthesis glyoxalase ElbB	NA	NA	NA	NA	NA
WP_000809819.1|270689_273026_-	aerobic respiration two-component sensor histidine kinase ArcB	NA	A0A1V0SGX0	Hokovirus	30.6	6.0e-38
WP_001176879.1|273119_274049_-	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	34.2	1.5e-16
>prophage 25
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	280815	281919	4678113		Salmonella_phage(100.0%)	1	NA	NA
WP_000184323.1|280815_281919_+	DUF1016 domain-containing protein	NA	A0A0U2BZN7	Salmonella_phage	87.4	5.5e-74
>prophage 26
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	286708	290743	4678113	protease	Burkholderia_virus(50.0%)	4	NA	NA
WP_000108071.1|286708_288199_-	sialic acid transporter NanT	NA	Q6JIH2	Burkholderia_virus	21.9	2.7e-07
WP_001029665.1|288314_289208_-	N-acetylneuraminate lyase	NA	NA	NA	NA	NA
WP_000382926.1|289342_290134_-	transcriptional regulator NanR	NA	NA	NA	NA	NA
WP_000366112.1|290242_290743_-|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	55.8	2.5e-26
>prophage 27
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	295611	296979	4678113	protease	uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_000716690.1|295611_296979_+|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	26.3	2.7e-22
>prophage 28
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	303976	305245	4678113		Oenococcus_phage(100.0%)	1	NA	NA
WP_000433393.1|303976_305245_-	SLC13/DASS family transporter	NA	Q6A201	Oenococcus_phage	33.0	1.1e-59
>prophage 29
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	323701	324745	4678113		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_000913396.1|323701_324745_-	rod shape-determining protein	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
>prophage 30
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	336829	340211	4678113		Ostreococcus_lucimarinus_virus(50.0%)	3	NA	NA
WP_000642611.1|336829_337714_+	adenine-specific DNA-methyltransferase	NA	M4QNN5	Ostreococcus_lucimarinus_virus	32.8	1.3e-25
WP_000620015.1|337796_337961_+	DUF2556 domain-containing protein	NA	NA	NA	NA	NA
WP_001145332.1|338111_340211_+	bifunctional diguanylate cyclase/phosphodiesterase	NA	G3MA91	Bacillus_virus	33.5	7.1e-22
>prophage 31
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	354147	358467	4678113	tRNA	Pandoravirus(33.33%)	6	NA	NA
WP_001065812.1|354147_354720_-	L-threonylcarbamoyladenylate synthase type 1 TsaC	NA	A0A291ATS8	Pandoravirus	27.3	9.9e-11
WP_001129712.1|354724_355267_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000460663.1|355293_355767_-	DUF494 domain-containing protein	NA	NA	NA	NA	NA
WP_000124519.1|355738_356863_-	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_000114987.1|356994_357504_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	41.1	6.7e-19
WP_001285173.1|357519_358467_+|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	35.9	6.5e-07
>prophage 32
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	378360	383931	4678113		Tupanvirus(33.33%)	7	NA	NA
WP_000031748.1|378360_379545_-	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.5	2.6e-13
WP_000124693.1|379616_381731_-	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	27.5	8.1e-58
WP_001138043.1|381827_382298_-	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_001319024.1|382393_382768_-	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_000903399.1|382893_383181_-	sulfurtransferase complex subunit TusB	NA	NA	NA	NA	NA
WP_000820705.1|383188_383545_-	sulfurtransferase complex subunit TusC	NA	NA	NA	NA	NA
WP_001268011.1|383544_383931_-	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	40.6	2.1e-20
>prophage 33
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	389890	391798	4678113		Tupanvirus(100.0%)	1	NA	NA
WP_000634748.1|389890_391798_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	33.7	2.2e-75
>prophage 34
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	396383	400380	4678113		environmental_Halophage(50.0%)	3	NA	NA
WP_000269312.1|396383_398471_+	membrane protein	NA	H9YQA8	environmental_Halophage	89.1	4.2e-67
WP_000190037.1|398513_399731_-	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
WP_000601880.1|399816_400380_-	aminodeoxychorismate synthase component 2	NA	A0A0P0IKJ1	Acinetobacter_phage	56.3	3.2e-62
>prophage 35
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	417888	418725	4678113		Vibrio_phage(100.0%)	1	NA	NA
WP_000742132.1|417888_418725_-	adenine-specific DNA-methyltransferase	NA	A0A1S6L1V5	Vibrio_phage	48.7	1.9e-66
>prophage 36
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	435763	439526	4678113		Bacillus_phage(66.67%)	3	NA	NA
WP_001265689.1|435763_437383_+	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	53.3	1.2e-141
WP_001253818.1|437457_438810_-	two-component system sensor histidine kinase EnvZ	NA	W8CYF6	Bacillus_phage	22.9	9.5e-12
WP_001157751.1|438806_439526_-	two-component system response regulator OmpR	NA	W8CYM9	Bacillus_phage	34.7	3.5e-29
>prophage 37
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	446138	447065	4678113	transposase	Sodalis_phage(100.0%)	1	NA	NA
WP_000235956.1|446138_447065_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	51.1	4.4e-69
>prophage 38
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	453125	455519	4678113		Iris_mild_mosaic_virus(100.0%)	1	NA	NA
WP_000082262.1|453125_455519_-	maltodextrin phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	40.2	4.7e-14
>prophage 39
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	460575	463691	4678113		Ralstonia_phage(50.0%)	2	NA	NA
WP_001105533.1|460575_461790_-	RtcB family protein	NA	A0A1L7N133	Ralstonia_phage	60.6	1.6e-135
WP_000013013.1|462137_463691_-	TROVE domain-containing protein	NA	R4TL80	Halovirus	25.9	4.4e-29
>prophage 40
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	477926	480374	4678113		Dickeya_phage(100.0%)	1	NA	NA
WP_000993424.1|477926_480374_-	glycogen phosphorylase	NA	A0A140XAG6	Dickeya_phage	82.1	3.6e-33
>prophage 41
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	502013	503821	4678113		Enterococcus_phage(50.0%)	2	NA	NA
WP_000073555.1|502013_502754_-	glycerophosphodiester phosphodiesterase	NA	A0A0S2MYI4	Enterococcus_phage	24.0	4.1e-09
WP_000907840.1|502750_503821_-	sn-glycerol-3-phosphate import ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	32.5	2.0e-20
>prophage 42
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	507231	509431	4678113		Streptococcus_phage(33.33%)	4	NA	NA
WP_000174964.1|507231_507600_-	type II toxin-antitoxin system death-on-curing family toxin	NA	E4ZFM2	Streptococcus_phage	28.9	8.6e-08
WP_000481003.1|507596_507824_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_000416114.1|507948_508662_-	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivF	NA	G9BWD6	Planktothrix_phage	30.7	3.7e-15
WP_000082080.1|508663_509431_-	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivG	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.4	5.8e-14
>prophage 43
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	515221	526884	4678113		Dickeya_phage(28.57%)	12	NA	NA
WP_000159621.1|515221_516076_-	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	42.3	7.0e-45
WP_001081707.1|516321_517377_-	cell division protein FtsX	NA	NA	NA	NA	NA
WP_000617729.1|517369_518038_-	cell division ATP-binding protein FtsE	NA	A0A2H4PQG7	Staphylococcus_phage	24.6	1.9e-13
WP_001118683.1|518040_519516_-	signal recognition particle-docking protein FtsY	NA	NA	NA	NA	NA
WP_000743277.1|519641_520238_+	16S rRNA (guanine(966)-N(2))-methyltransferase	NA	NA	NA	NA	NA
WP_001576503.1|520224_520497_+	DUF1145 family protein	NA	NA	NA	NA	NA
WP_000042852.1|520518_520890_-	DUF2500 domain-containing protein	NA	NA	NA	NA	NA
WP_000964735.1|521031_521658_+	lysoplasmalogenase	NA	A0A140XAH6	Dickeya_phage	64.6	3.8e-32
WP_000106653.1|521738_523937_+	Zn(II)/Cd(II)/Pb(II) translocating P-type ATPase ZntA	NA	E4ZFI9	Streptococcus_phage	36.0	5.0e-111
WP_000789678.1|524136_525780_+	methyl-accepting chemotaxis citrate transducer	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.4	2.3e-12
WP_001541054.1|525803_526049_-	sulfurtransferase TusA	NA	A0A140XB86	Dickeya_phage	83.3	6.1e-10
WP_001519906.1|526218_526884_+	7-cyano-7-deazaguanine/7-aminomethyl-7- deazaguanine transporter	NA	A0A2I7SAW6	Vibrio_phage	54.9	2.8e-57
>prophage 44
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	532251	534993	4678113		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000202481.1|532251_534993_-	ribosome-associated ATPase/putative transporter RbbA	NA	A0A2H4PQG7	Staphylococcus_phage	29.5	4.6e-21
>prophage 45
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	543237	545280	4678113		Indivirus(100.0%)	1	NA	NA
WP_000184178.1|543237_545280_-	oligopeptidase A	NA	A0A1V0SD92	Indivirus	23.2	3.6e-47
>prophage 46
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	559995	560898	4678113		Burkholderia_virus(100.0%)	1	NA	NA
WP_000968869.1|559995_560898_+	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	24.5	3.4e-05
>prophage 47
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	589627	591621	4678113		Bacillus_virus(50.0%)	2	NA	NA
WP_000103563.1|589627_590641_-	dipeptide ABC transporter ATP binding subunit DppF	NA	G3M9Y6	Bacillus_virus	28.9	9.6e-17
WP_001196509.1|590637_591621_-	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.3	3.3e-14
>prophage 48
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	609772	618955	4678113	transposase	Escherichia_phage(25.0%)	11	NA	NA
WP_000148453.1|609772_612106_-	molybdopterin guanine dinucleotide-containing S/N-oxide reductase	NA	A0A077SK27	Escherichia_phage	30.4	9.8e-73
WP_000747548.1|612258_612921_+	OmpA family lipoprotein	NA	NA	NA	NA	NA
WP_000804678.1|613139_614114_+	glyoxylate/hydroxypyruvate reductase GhrB	NA	M1HST2	Paramecium_bursaria_Chlorella_virus	27.1	5.4e-17
WP_000190524.1|614163_614874_-	DUF3053 domain-containing protein	NA	NA	NA	NA	NA
WP_000455790.1|615312_615603_+	HTH-type transcriptional regulator	NA	NA	NA	NA	NA
WP_000014594.1|615890_616103_+	RNA chaperone/antiterminator CspA	NA	A0A1W6JNX5	Morganella_phage	72.9	2.7e-22
WP_000047147.1|616276_616816_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000533912.1|617186_617672_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000965886.1|617659_617947_-	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_000702452.1|618124_618592_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001541099.1|618763_618955_-|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	69.8	1.5e-19
>prophage 49
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	623148	624144	4678113		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
WP_001182581.1|623148_624144_+	acyltransferase	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	26.8	8.3e-13
>prophage 50
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	650590	652441	4678113		Tupanvirus(100.0%)	1	NA	NA
WP_000582387.1|650590_652441_-	selenocysteine-specific translation elongation factor	NA	A0A2K9KZ60	Tupanvirus	24.3	2.2e-11
>prophage 51
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	676290	685792	4678113		Rhizobium_phage(16.67%)	9	NA	NA
WP_001273795.1|676290_676542_-	glutaredoxin 3	NA	V9QKN6	Rhizobium_phage	53.4	2.2e-15
WP_001156179.1|676628_677060_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_000116576.1|677307_678852_+	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_001214125.1|678861_680145_+	murein hydrolase activator EnvC	NA	G9BW84	Planktothrix_phage	30.3	6.1e-08
WP_001135519.1|680148_681111_+	divergent polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_000798202.1|681097_682132_-	glycosyltransferase	NA	A0A1V0SAH6	Catovirus	31.3	1.4e-07
WP_000645990.1|682425_683451_-	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	84.6	2.1e-19
WP_001213790.1|683460_684657_-	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	30.0	1.9e-35
WP_000587775.1|684859_685792_+	ADP-glyceromanno-heptose 6-epimerase	NA	E3SL51	Synechococcus_phage	37.2	5.5e-35
>prophage 52
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	700170	704724	4678113		uncultured_Mediterranean_phage(25.0%)	7	NA	NA
WP_001171884.1|700170_700650_+	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	43.8	1.2e-28
WP_001114515.1|700677_701487_-	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	F8WPX6	Bacillus_phage	31.8	1.3e-24
WP_001051798.1|701584_701752_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_001519051.1|701772_702009_-	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_000380129.1|702226_702892_-	JAB domain-containing protein	NA	NA	NA	NA	NA
WP_001575134.1|703064_704288_+	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	34.1	9.4e-43
WP_000717792.1|704268_704724_+	dUTP diphosphatase	NA	Q2NP83	Xanthomonas_phage	60.1	1.2e-48
>prophage 53
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	710702	715728	4678113		Pseudomonas_phage(33.33%)	4	NA	NA
WP_001241846.1|710702_712388_-	NAD-dependent DNA ligase LigB	NA	F8SJM3	Pseudomonas_phage	21.7	1.2e-19
WP_000046966.1|712644_713268_+	guanylate kinase	NA	K4JYM5	Abalone_herpesvirus	35.6	2.8e-19
WP_000135058.1|713322_713598_+	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_000280481.1|713616_715728_+	bifunctional GTP diphosphokinase/guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase	NA	A0A291L9W9	Bordetella_phage	34.5	4.8e-10
>prophage 54
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	719977	721369	4678113		environmental_Halophage(100.0%)	1	NA	NA
WP_000115436.1|719977_721369_+	xanthine/proton symporter XanP	NA	H9YQ34	environmental_Halophage	96.6	3.0e-69
>prophage 55
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	730453	736349	4678113		Wolbachia_phage(50.0%)	3	NA	NA
WP_000774140.1|730453_731491_+	virulence RhuM family protein	NA	Q9JMN3	Wolbachia_phage	43.4	5.5e-68
WP_000984806.1|732789_733407_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001143034.1|733481_736349_+	intestinal colonization autotransporter adhesin MisL	NA	A0A2L1IV18	Escherichia_phage	44.3	5.0e-95
>prophage 56
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	740201	746241	4678113	transposase	Paramecium_bursaria_Chlorella_virus(33.33%)	4	NA	NA
WP_000131287.1|740201_742928_-	magnesium-translocating P-type ATPase	NA	M1HXH2	Paramecium_bursaria_Chlorella_virus	24.4	2.1e-34
WP_000392700.1|743147_743843_-	MgtC family protein	NA	G3MA03	Bacillus_virus	42.4	2.8e-15
WP_000535970.1|744354_745257_+	EamA family transporter	NA	NA	NA	NA	NA
WP_000749540.1|745299_746241_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	53.4	4.7e-66
>prophage 57
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	754605	755988	4678113		Pandoravirus(100.0%)	1	NA	NA
WP_001270471.1|754605_755988_+	glycoside hydrolase family 1 protein	NA	A0A0B5JD41	Pandoravirus	28.9	2.0e-41
>prophage 58
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	769016	773973	4678113		Micromonas_pusilla_virus(50.0%)	5	NA	NA
WP_000168439.1|769016_770705_-	acetolactate synthase large subunit	NA	G8DDL3	Micromonas_pusilla_virus	30.7	4.2e-57
WP_001541152.1|770811_770910_-	ilvB operon leader peptide IvbL	NA	NA	NA	NA	NA
WP_000117642.1|771543_771633_+	type I toxin-antitoxin system toxin TisB	NA	NA	NA	NA	NA
WP_001531658.1|771725_772586_+	EamA family transporter	NA	NA	NA	NA	NA
WP_000828735.1|772788_773973_+	multidrug efflux MFS transporter EmrD	NA	S4TR35	Salmonella_phage	24.3	4.4e-13
>prophage 59
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	782476	783428	4678113		Synechococcus_phage(50.0%)	2	NA	NA
WP_001246919.1|782476_782905_-	heat shock chaperone IbpB	NA	A0A1D8KPX5	Synechococcus_phage	38.2	1.7e-15
WP_001532742.1|783014_783428_-	heat shock chaperone IbpA	NA	A0A1D7SU06	Cyanophage	37.0	1.0e-17
>prophage 60
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	791071	804882	4678113		Brazilian_cedratvirus(20.0%)	10	NA	NA
WP_000888535.1|791071_791689_-	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	A0A2R8FG22	Brazilian_cedratvirus	29.8	1.8e-10
WP_000724474.1|791694_793095_-	c-type cytochrome	NA	NA	NA	NA	NA
WP_000595416.1|793284_793917_-	molecular chaperone TorD	NA	NA	NA	NA	NA
WP_000790657.1|793909_796462_-	trimethylamine-N-oxide reductase TorA	NA	A0A077SK27	Escherichia_phage	31.2	4.8e-73
WP_001230254.1|796451_797636_-	pentaheme c-type cytochrome TorC	NA	NA	NA	NA	NA
WP_001562512.1|797765_798458_+	two-component system response regulator TorR	NA	W8CYM9	Bacillus_phage	28.0	3.8e-17
WP_001202049.1|798430_799471_-	TMAO reductase system periplasmic protein TorT	NA	NA	NA	NA	NA
WP_000106946.1|799550_802286_+	TMAO reductase system sensor histidine kinase/response regulator TorS	NA	A0A1V0SGX0	Hokovirus	31.2	2.1e-34
WP_000253524.1|802311_803649_-	MFS transporter	NA	NA	NA	NA	NA
WP_000704735.1|803733_804882_-	galactonate dehydratase	NA	Q6A202	Oenococcus_phage	33.4	8.0e-52
>prophage 61
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	809730	819521	4678113		Oenococcus_phage(25.0%)	9	NA	NA
WP_000975838.1|809730_810924_+	mandelate racemase/muconate lactonizing enzyme family protein	NA	Q6A202	Oenococcus_phage	32.7	6.2e-47
WP_001054589.1|811038_811935_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000072047.1|811953_814368_-	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	34.6	2.2e-115
WP_000060081.1|814396_815470_-	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_000673474.1|815617_816718_-	DNA polymerase III subunit beta	NA	B4UTW9	Rhizobium_phage	34.7	4.1e-53
WP_000059095.1|816722_818123_-	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
WP_000831330.1|818783_818924_+	50S ribosomal protein L34	NA	NA	NA	NA	NA
WP_000239725.1|818940_819300_+	ribonuclease P protein component	NA	NA	NA	NA	NA
WP_001307474.1|819263_819521_+	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	56.7	5.4e-17
>prophage 62
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	826515	833407	4678113		Moraxella_phage(33.33%)	7	NA	NA
WP_001521829.1|826515_827853_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	37.1	3.1e-63
WP_000078087.1|828021_828687_+	6-phosphogluconate phosphatase	NA	NA	NA	NA	NA
WP_000377800.1|828781_829507_-	phosphate signaling complex protein PhoU	NA	NA	NA	NA	NA
WP_000063118.1|829521_830295_-	phosphate ABC transporter ATP-binding protein PstB	NA	W8CYL7	Bacillus_phage	30.6	2.0e-14
WP_000212197.1|830381_831272_-	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_000741630.1|831271_832231_-	phosphate ABC transporter permease PstC	NA	NA	NA	NA	NA
WP_000867130.1|832366_833407_-	phosphate ABC transporter substrate-binding protein PstS	NA	M4QHS4	Cyanophage	36.2	4.1e-47
>prophage 63
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	837815	841204	4678113		Paramecium_bursaria_Chlorella_virus(50.0%)	2	NA	NA
WP_000334052.1|837815_839645_-	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	43.7	6.2e-131
WP_000934851.1|839833_841204_-	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A0N7G7I9	Chrysochromulina_ericina_virus	38.7	8.7e-37
>prophage 64
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	854088	855081	4678113		Heterosigma_akashiwo_virus(100.0%)	1	NA	NA
WP_000845123.1|854088_855081_+	aspartate--ammonia ligase	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	37.3	3.2e-49
>prophage 65
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	858374	862392	4678113		Paramecium_bursaria_Chlorella_virus(50.0%)	3	NA	NA
WP_000102338.1|858374_860243_+	low affinity potassium transporter Kup	NA	M1I6H8	Paramecium_bursaria_Chlorella_virus	30.6	1.5e-63
WP_000715944.1|860459_860879_+	D-ribose pyranase	NA	NA	NA	NA	NA
WP_000339359.1|860886_862392_+	ribose ABC transporter ATP-binding protein RbsA	NA	A0A2H4PQG7	Staphylococcus_phage	24.6	5.1e-14
>prophage 66
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	877785	879432	4678113		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_001012569.1|877785_879432_+	acetolactate synthase 2 catalytic subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	31.5	3.1e-65
>prophage 67
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	884792	885134	4678113		Pseudomonas_phage(100.0%)	1	NA	NA
WP_000560824.1|884792_885134_+	XRE family transcriptional regulator	NA	A0A2D1GR59	Pseudomonas_phage	38.5	1.7e-05
>prophage 68
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	888574	893995	4678113		Bacillus_phage(33.33%)	4	NA	NA
WP_001238842.1|888574_890599_+	ATP-dependent DNA helicase Rep	NA	A7KV33	Bacillus_phage	37.3	1.1e-112
WP_001089447.1|890638_892120_-	guanosine-5'-triphosphate,3'-diphosphate diphosphatase	NA	NA	NA	NA	NA
WP_000047525.1|892256_893522_-	ATP-dependent RNA helicase RhlB	NA	E3T5E1	Cafeteria_roenbergensis_virus	31.7	3.7e-42
WP_001280776.1|893665_893995_+	thioredoxin TrxA	NA	A0A1V0SD63	Indivirus	38.5	4.2e-14
>prophage 69
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	898119	903623	4678113		Enterobacteria_phage(40.0%)	6	NA	NA
WP_000866685.1|898119_899250_+	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	27.7	2.3e-27
WP_000011238.1|899246_900509_+	UDP-N-acetyl-D-mannosamine dehydrogenase	NA	M1H3J6	Paramecium_bursaria_Chlorella_virus	27.0	1.2e-24
WP_000822143.1|900508_901576_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.1	1.4e-98
WP_000676080.1|901608_901833_+	sugar nucleotidyltransferase	NA	I7I009	Enterobacteria_phage	52.2	2.0e-07
WP_001145156.1|901810_902488_+	dTDP-4-amino-4,6-dideoxy-D-galactose acyltransferase	NA	NA	NA	NA	NA
WP_000612080.1|902492_903623_+	dTDP-4-amino-4,6-dideoxygalactose transaminase	NA	A0A0F7LAY0	uncultured_marine_virus	40.9	3.3e-18
>prophage 70
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	921061	924978	4678113		Bacillus_phage(100.0%)	3	NA	NA
WP_000132878.1|921061_921964_+	tyrosine recombinase XerC	NA	A0A142F1N9	Bacillus_phage	31.0	5.9e-26
WP_001213560.1|921963_922680_+	5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase YigB	NA	NA	NA	NA	NA
WP_000383436.1|922815_924978_+	DNA helicase II	NA	A7KV33	Bacillus_phage	37.1	1.7e-116
>prophage 71
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	929854	931684	4678113		Catovirus(100.0%)	1	NA	NA
WP_001664819.1|929854_931684_+	ATP-dependent DNA helicase RecQ	NA	A0A1V0SBK0	Catovirus	37.4	5.9e-81
>prophage 72
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	945936	949371	4678113		Ostreococcus_lucimarinus_virus(50.0%)	4	NA	NA
WP_000187554.1|945936_947577_+	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	M4R0M8	Ostreococcus_lucimarinus_virus	28.5	3.4e-40
WP_000508972.1|947782_948037_+	Sec-independent protein translocase subunit TatA	NA	NA	NA	NA	NA
WP_000459612.1|948040_948589_+	Sec-independent protein translocase subunit TatB	NA	NA	NA	NA	NA
WP_000257554.1|948591_949371_+	Sec-independent protein translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	30.7	1.5e-25
>prophage 73
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	960298	960913	4678113		Streptococcus_phage(100.0%)	1	NA	NA
WP_000378897.1|960298_960913_+	IMPACT family protein	NA	A0A1X9I5T8	Streptococcus_phage	39.3	6.2e-19
>prophage 74
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	973358	976145	4678113		Enterococcus_phage(100.0%)	1	NA	NA
WP_000249966.1|973358_976145_+	DNA polymerase I	NA	A0A0C5K9B9	Enterococcus_phage	27.0	1.3e-47
>prophage 75
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	981502	982552	4678113		Ectocarpus_siliculosus_virus(100.0%)	1	NA	NA
WP_000146192.1|981502_982552_-	two-component system sensor histidine kinase NtrB	NA	Q8QKV7	Ectocarpus_siliculosus_virus	27.0	4.1e-10
>prophage 76
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	1000990	1003785	4678113		Staphylococcus_phage(50.0%)	3	NA	NA
WP_000268244.1|1000990_1001887_-	sulfolactaldehyde 3-reductase	NA	D2K0C8	Staphylococcus_phage	99.2	3.4e-66
WP_001520529.1|1002051_1002948_+	sugar kinase	NA	NA	NA	NA	NA
WP_000059693.1|1002981_1003785_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.8	7.6e-25
>prophage 77
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	1011984	1015035	4678113		Escherichia_phage(100.0%)	1	NA	NA
WP_077906447.1|1011984_1015035_-	formate dehydrogenase-N subunit alpha	NA	A0A077SK27	Escherichia_phage	24.1	4.6e-06
>prophage 78
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	1032829	1037056	4678113		Bacillus_thuringiensis_phage(33.33%)	6	NA	NA
WP_000122629.1|1032829_1033450_+	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	58.4	7.1e-63
WP_076607052.1|1033456_1034209_+	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_000133442.1|1034220_1034616_+	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_000338671.1|1034736_1034940_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000580402.1|1034987_1036361_-	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.6	7.2e-15
WP_001033731.1|1036357_1037056_-	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
>prophage 79
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	1050119	1051655	4678113		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001167248.1|1050119_1051655_+	autoinducer 2 ABC transporter ATP-binding protein LsrA	NA	A0A2H4PQG7	Staphylococcus_phage	30.0	6.3e-20
>prophage 80
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	1062487	1067098	4678113		Paramecium_bursaria_Chlorella_virus(50.0%)	5	NA	NA
WP_000084285.1|1062487_1063333_-	aquaporin	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.6	2.0e-15
WP_000051370.1|1063731_1063971_+	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
WP_000872918.1|1064192_1064678_-	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_000139637.1|1064770_1065700_-	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_001293360.1|1065766_1067098_-	HslU--HslV peptidase ATPase subunit	NA	W6AS21	Erwinia_phage	28.3	2.4e-44
>prophage 81
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	1085192	1086452	4678113		Aeromonas_phage(100.0%)	1	NA	NA
WP_042444383.1|1085192_1086452_+	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	53.4	1.6e-101
>prophage 82
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	1094549	1097724	4678113		Synechococcus_phage(50.0%)	2	NA	NA
WP_000424866.1|1094549_1095212_-	fructose-6-phosphate aldolase	NA	A0A0E3F0E2	Synechococcus_phage	34.1	2.5e-29
WP_001128487.1|1095222_1097724_-	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	27.4	3.6e-12
>prophage 83
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	1118840	1120685	4678113		Acinetobacter_phage(100.0%)	1	NA	NA
WP_000591405.1|1118840_1120685_+	TonB-dependent vitamin B12 receptor BtuB	NA	A0A0P0I887	Acinetobacter_phage	30.0	2.2e-11
>prophage 84
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	1129337	1132431	4678113		uncultured_Mediterranean_phage(50.0%)	3	NA	NA
WP_000023069.1|1129337_1130288_-	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	32.5	6.0e-29
WP_001541267.1|1130496_1130670_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000031748.1|1131246_1132431_+	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.5	2.6e-13
>prophage 85
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	1136547	1150503	4678113		Chrysochromulina_ericina_virus(25.0%)	10	NA	NA
WP_000263105.1|1136547_1140576_+	DNA-directed RNA polymerase subunit beta	NA	A0A0N9R0J7	Chrysochromulina_ericina_virus	29.0	9.4e-23
WP_000653965.1|1140652_1144876_+	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	27.1	5.0e-67
WP_001576436.1|1144917_1145241_+	membrane protein	NA	NA	NA	NA	NA
WP_012543419.1|1145246_1145591_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000400600.1|1145971_1147000_+	type III secretion system effector arginine glycosyltransferase SseK1	NA	Q8HAB2	Salmonella_phage	60.5	5.2e-103
WP_001526923.1|1147322_1147511_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000847563.1|1147661_1148795_-	2-iminoacetate synthase ThiH	NA	NA	NA	NA	NA
WP_000944083.1|1148791_1149562_-	thiazole synthase	NA	NA	NA	NA	NA
WP_001166833.1|1149563_1149764_-	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_000999759.1|1149744_1150503_-	HesA/MoeB/ThiF family protein	NA	A0A1V0SAV8	Catovirus	28.5	3.5e-11
>prophage 86
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	1155858	1157621	4678113		Klosneuvirus(50.0%)	3	NA	NA
WP_000362363.1|1155858_1156530_+	deoxyribonuclease V	NA	A0A1V0SJW5	Klosneuvirus	28.7	1.6e-20
WP_000940092.1|1156571_1157162_+	YjaG family protein	NA	NA	NA	NA	NA
WP_001044509.1|1157348_1157621_+	DNA-binding protein HU-alpha	NA	A7KV42	Bacillus_phage	57.8	5.5e-20
>prophage 87
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	1163101	1164691	4678113		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_001187494.1|1163101_1164691_-	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	47.4	1.2e-66
>prophage 88
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	1178582	1182266	4678113		Dickeya_phage(100.0%)	1	NA	NA
WP_000095957.1|1178582_1182266_+	methionine synthase	NA	A0A140XBC7	Dickeya_phage	90.2	1.3e-26
>prophage 89
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	1193601	1193949	4678113		Burkholderia_phage(100.0%)	1	NA	NA
WP_000615248.1|1193601_1193949_+	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	51.5	4.9e-21
>prophage 90
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	1206535	1207645	4678113		Mycoplasma_phage(100.0%)	1	NA	NA
WP_000179176.1|1206535_1207645_+	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	47.2	6.2e-17
>prophage 91
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	1214903	1215512	4678113		Lactococcus_phage(100.0%)	1	NA	NA
WP_000646079.1|1214903_1215512_+	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
>prophage 92
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	1222246	1224773	4678113		Salmonella_phage(50.0%)	2	NA	NA
WP_000918353.1|1222246_1223662_+	replicative DNA helicase DnaB	NA	A0A1B0VG30	Salmonella_phage	78.4	7.0e-199
WP_001147297.1|1223693_1224773_+	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	29.1	1.2e-28
>prophage 93
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	1228868	1232472	4678113		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_000357725.1|1228868_1231694_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	55.7	0.0e+00
WP_000168322.1|1231941_1232472_+	single-stranded DNA-binding protein SSB1	NA	A0A0A0P1Q9	Enterobacteria_phage	88.9	3.9e-54
>prophage 94
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	1254848	1256915	4678113		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_000358566.1|1254848_1256915_+	peptidase domain-containing ABC transporter	NA	F2Y2R6	Organic_Lake_phycodnavirus	23.7	6.3e-15
>prophage 95
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	1261802	1263152	4678113		Moraxella_phage(100.0%)	1	NA	NA
WP_000106907.1|1261802_1263152_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	71.4	6.7e-159
>prophage 96
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	1269370	1271329	4678113		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000083871.1|1269370_1271329_-	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	40.4	5.7e-90
>prophage 97
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	1281022	1289382	4678113		Escherichia_phage(25.0%)	8	NA	NA
WP_011233236.1|1281022_1283170_-	formate dehydrogenase H subunit alpha, selenocysteine-containing	NA	A0A077SK27	Escherichia_phage	24.5	1.0e-31
WP_000457031.1|1283524_1284433_-	lipid A hydroxylase LpxO	NA	H8ZJK8	Ostreococcus_tauri_virus	36.6	1.3e-33
WP_000602316.1|1284690_1285155_-	aminoalkylphosphonate N-acetyltransferase	NA	NA	NA	NA	NA
WP_001131305.1|1285276_1285720_-	VOC family metalloprotein YjdN	NA	NA	NA	NA	NA
WP_000056484.1|1285839_1286175_-	phnA family protein	NA	NA	NA	NA	NA
WP_000919710.1|1286642_1288145_+	proline/glycine betaine transporter ProP	NA	Q6JIH2	Burkholderia_virus	30.5	3.5e-55
WP_000844399.1|1288214_1288304_+	LpxT activity modulator PmrR	NA	NA	NA	NA	NA
WP_001212189.1|1288311_1289382_-	two-component system sensor histidine kinase PmrB	NA	W8CYF6	Bacillus_phage	25.3	6.0e-09
>prophage 98
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	1310014	1312075	4678113		Escherichia_phage(100.0%)	3	NA	NA
WP_000816143.1|1310014_1310641_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	92.3	2.9e-120
WP_000544915.1|1310633_1311407_+	dimethyl sulfoxide reductase anchor subunit	NA	A0A077SK59	Escherichia_phage	79.5	1.3e-103
WP_012543422.1|1311421_1312075_+	molecular chaperone	NA	A0A077SLS7	Escherichia_phage	73.5	1.6e-81
>prophage 99
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	1328502	1330486	4678113		Cronobacter_phage(50.0%)	2	NA	NA
WP_000027827.1|1328502_1328796_+	co-chaperone GroES	NA	K4F9I2	Cronobacter_phage	43.3	1.2e-12
WP_000729126.1|1328839_1330486_+	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	68.7	1.2e-189
>prophage 100
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	1335562	1336096	4678113		Morganella_phage(100.0%)	1	NA	NA
WP_001221670.1|1335562_1336096_-	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	54.8	1.2e-47
>prophage 101
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	1339823	1340801	4678113		Tupanvirus(100.0%)	1	NA	NA
WP_000004795.1|1339823_1340801_+	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9KZX5	Tupanvirus	29.1	1.3e-26
>prophage 102
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	1348525	1349071	4678113		Diachasmimorpha_longicaudata_entomopoxvirus(100.0%)	1	NA	NA
WP_001271546.1|1348525_1349071_+	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	41.6	4.5e-29
>prophage 103
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	1354091	1357277	4678113		Vibrio_phage(50.0%)	2	NA	NA
WP_000640373.1|1354091_1355411_+	N-acetylmuramoyl-L-alanine amidase AmiB	NA	A0A067ZJB6	Vibrio_phage	29.2	1.8e-15
WP_001122550.1|1355420_1357277_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	41.8	5.8e-60
>prophage 104
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	1362822	1367230	4678113		Pithovirus(50.0%)	3	NA	NA
WP_000527976.1|1362822_1364121_+	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.6	8.4e-66
WP_001177632.1|1364328_1364754_+	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_000076357.1|1364791_1367230_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.1	9.9e-68
>prophage 105
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	1372083	1373247	4678113		Ralstonia_phage(100.0%)	1	NA	NA
WP_000943930.1|1372083_1373247_+	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.8	2.0e-82
>prophage 106
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	1411286	1413042	4678113		uncultured_Caudovirales_phage(50.0%)	2	NA	NA
WP_000055079.1|1411286_1411817_-	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.3	4.2e-56
WP_000853764.1|1412043_1413042_-	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.4	1.3e-69
>prophage 107
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	1424965	1428210	4678113		uncultured_Caudovirales_phage(50.0%)	4	NA	NA
WP_000212724.1|1424965_1425208_+	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	51.2	5.6e-16
WP_000220582.1|1425197_1425482_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	71.3	1.7e-32
WP_001268859.1|1425485_1425950_-	anaerobic ribonucleoside-triphosphate reductase-activating protein	NA	K4F9T1	Cronobacter_phage	55.8	4.6e-51
WP_000187818.1|1426071_1428210_-	anaerobic ribonucleoside-triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	64.6	1.5e-266
>prophage 108
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	1431876	1438425	4678113	transposase	Enterobacteria_phage(33.33%)	7	NA	NA
WP_001181297.1|1431876_1432824_-	HTH-type transcriptional regulator TreR	NA	C6ZCU4	Enterobacteria_phage	21.5	1.2e-13
WP_105789234.1|1432968_1433067_+	mgtA regulatory leader peptide MgtL	NA	NA	NA	NA	NA
WP_000920861.1|1433207_1435916_+	magnesium-translocating P-type ATPase	NA	A0A1J0FA34	Only_Syngen_Nebraska_virus	25.2	2.6e-45
WP_000251085.1|1436031_1436478_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_000047544.1|1436552_1436939_-	2-iminobutanoate/2-iminopropanoate deaminase	NA	NA	NA	NA	NA
WP_000148570.1|1437015_1437477_-	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_000013055.1|1437489_1438425_-	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	39.2	6.5e-52
>prophage 109
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	1450534	1455481	4678113	tRNA	Klosneuvirus(50.0%)	3	NA	NA
WP_000416339.1|1450534_1453390_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	37.2	2.7e-141
WP_000207090.1|1453389_1453872_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_000397158.1|1453969_1455481_-	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.7	8.3e-49
>prophage 110
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	1463301	1464321	4678113		Acanthamoeba_polyphaga_mimivirus(100.0%)	1	NA	NA
WP_001708525.1|1463301_1464321_-	NAD(P)-dependent alcohol dehydrogenase	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	29.9	5.1e-42
>prophage 111
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	1499757	1500711	4678113	transposase	Sodalis_phage(100.0%)	1	NA	NA
WP_000749994.1|1499757_1500711_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	52.5	8.1e-66
>prophage 112
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	1503791	1512840	4678113		Liberibacter_phage(66.67%)	4	NA	NA
WP_000550712.1|1503791_1507058_-	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	27.6	1.2e-49
WP_000863534.1|1507152_1508457_-	type I restriction-modification protein specificity subunit	NA	NA	NA	NA	NA
WP_001029734.1|1508446_1510066_-	type I restriction-modification system subunit M	NA	A0A2H4UVW8	Bodo_saltans_virus	22.0	1.9e-06
WP_001206755.1|1511586_1512840_-	N-6 DNA methylase	NA	A0A220A2U5	Liberibacter_phage	30.9	4.0e-20
>prophage 113
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	1520716	1522378	4678113		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_001708480.1|1520716_1522378_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	72.3	6.0e-08
>prophage 114
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	1528109	1529168	4678113		Acanthamoeba_polyphaga_lentillevirus(100.0%)	1	NA	NA
WP_000075420.1|1528109_1529168_+	SIS domain-containing protein	NA	J3IZE6	Acanthamoeba_polyphaga_lentillevirus	23.6	2.0e-09
>prophage 115
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	1533422	1534702	4678113		Shigella_phage(50.0%)	2	NA	NA
WP_000799921.1|1533422_1534160_-	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	50.8	4.5e-64
WP_000098573.1|1534162_1534702_-	primosomal protein DnaT	NA	T1SA92	Salmonella_phage	65.6	2.2e-28
>prophage 116
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	1539684	1540749	4678113		Bacillus_virus(100.0%)	1	NA	NA
WP_000211206.1|1539684_1540749_-	GGDEF domain-containing protein	NA	G3MA91	Bacillus_virus	33.1	4.2e-15
>prophage 117
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	1544526	1547425	4678113		Streptococcus_phage(50.0%)	3	NA	NA
WP_000175965.1|1544526_1546116_+	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	25.2	3.1e-30
WP_000178963.1|1546517_1547135_+	molecular chaperone OsmY	NA	NA	NA	NA	NA
WP_000490276.1|1547263_1547425_+	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	66.0	1.8e-10
>prophage 118
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	1552972	1554295	4678113		Geobacillus_virus(100.0%)	1	NA	NA
WP_000477838.1|1552972_1554295_+	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	41.4	1.8e-79
>prophage 119
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	1562406	1567570	4678113		Enterococcus_phage(33.33%)	3	NA	NA
WP_001519486.1|1562406_1563639_+	multifunctional transcriptional regulator/nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase NadR	NA	A0A0C5K935	Enterococcus_phage	45.2	3.3e-88
WP_000046770.1|1563756_1565424_-	energy-dependent translational throttle protein EttA	NA	A0A1V0SKJ1	Klosneuvirus	26.7	1.7e-42
WP_000373272.1|1565632_1567570_+	murein transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	36.4	1.8e-11
>prophage 120
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	1571519	1572944	4678113		Ectocarpus_siliculosus_virus(100.0%)	1	NA	NA
WP_001219533.1|1571519_1572944_+	two-component system sensor histidine kinase CreC	NA	Q8QKV7	Ectocarpus_siliculosus_virus	22.7	7.9e-09
>prophage 121
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	1591694	1603998	4678113		Cyanophage(20.0%)	12	NA	NA
WP_000130175.1|1591694_1592648_+	transaldolase	NA	A0A127KNC6	Cyanophage	31.0	9.7e-11
WP_000380373.1|1592758_1593349_+	molybdopterin adenylyltransferase	NA	NA	NA	NA	NA
WP_000528525.1|1593405_1593972_-	acetate uptake transporter	NA	NA	NA	NA	NA
WP_001103477.1|1594121_1594835_-	acidic protein MsyB	NA	NA	NA	NA	NA
WP_001258084.1|1594870_1595275_-	DUF2541 family protein	NA	NA	NA	NA	NA
WP_001708501.1|1595623_1597540_+	molecular chaperone DnaK	NA	G8DDB7	Micromonas_pusilla_virus	49.1	4.0e-149
WP_001119009.1|1597625_1598765_+	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	36.0	4.2e-29
WP_000534911.1|1599045_1599993_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000026889.1|1600119_1600464_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001068132.1|1600524_1601058_-	glycoside hydrolase family 108 protein	NA	A0A0U2I1S0	Escherichia_phage	56.6	1.2e-53
WP_000860681.1|1601074_1601518_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000235795.1|1601898_1603998_+	chitinase	NA	A0A1L5JGH0	Plodia_interpunctella_granulovirus	28.5	9.5e-35
>prophage 122
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	1624150	1625644	4678113		Tetraselmis_virus(100.0%)	1	NA	NA
WP_000831880.1|1624150_1625644_+	sulfatase-like hydrolase/transferase	NA	A0A2P0VMN7	Tetraselmis_virus	30.6	9.1e-32
>prophage 123
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	1630209	1631376	4678113		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000681340.1|1630209_1631376_+	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	51.1	7.5e-90
>prophage 124
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	1637874	1640709	4678113	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_001674865.1|1637874_1640709_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A2K9L260	Tupanvirus	26.1	5.0e-79
>prophage 125
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	1659714	1660863	4678113		Halovirus(100.0%)	1	NA	NA
WP_000597280.1|1659714_1660863_+	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	33.1	3.4e-50
>prophage 126
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	1666400	1672040	4678113		Hepacivirus(50.0%)	4	NA	NA
WP_000355818.1|1666400_1667954_-	crotonobetaine/carnitine-CoA ligase	NA	Q75ZG1	Hepacivirus	24.4	5.8e-29
WP_001016213.1|1668016_1669234_-	L-carnitine CoA-transferase	NA	NA	NA	NA	NA
WP_000347134.1|1669345_1670488_-	crotonobetainyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000787073.1|1670522_1672040_-	L-carnitine/gamma-butyrobetaine antiporter	NA	A0A2I7QNT1	Vibrio_phage	22.2	1.4e-08
>prophage 127
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	1679793	1686106	4678113		Catovirus(33.33%)	5	NA	NA
WP_000066320.1|1679793_1681683_+	sulfatase-like hydrolase/transferase	NA	A0A1V0SA98	Catovirus	24.7	5.0e-27
WP_000600698.1|1682089_1682620_+	glutathione-regulated potassium-efflux system oxidoreductase KefF	NA	NA	NA	NA	NA
WP_000377163.1|1682612_1684475_+	glutathione-regulated potassium-efflux system protein KefC	NA	NA	NA	NA	NA
WP_000624379.1|1684672_1685152_+	type 3 dihydrofolate reductase	NA	A0A219UQN5	Bacillus_phage	47.1	2.3e-29
WP_000257211.1|1685257_1686106_-	bis(5'-nucleosyl)-tetraphosphatase (symmetrical)	NA	A0A0E3T919	Enterococcus_phage	47.8	5.8e-07
>prophage 128
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	1693835	1699267	4678113		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_001116966.1|1693835_1696742_-	RNA polymerase-associated protein RapA	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	37.1	2.9e-21
WP_000035721.1|1696915_1699267_-	DNA polymerase II	NA	A0A1B2RW58	Lymphocystis_disease_virus	25.5	4.2e-15
>prophage 129
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	1707041	1707749	4678113		Bacillus_virus(100.0%)	1	NA	NA
WP_000915966.1|1707041_1707749_-	thiamine ABC transporter ATP-binding protein ThiQ	NA	G3M9Y6	Bacillus_virus	38.3	8.2e-23
>prophage 130
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	1716117	1717689	4678113		Micromonas_sp._RCC1109_virus(100.0%)	1	NA	NA
WP_000082819.1|1716117_1717689_-	2-isopropylmalate synthase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	26.1	6.9e-06
>prophage 131
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	1749729	1750773	4678113		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_001217365.1|1749729_1750773_+	GMP reductase	NA	A0A0N9Q9A5	Chrysochromulina_ericina_virus	56.2	3.4e-102
>prophage 132
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	1755030	1755594	4678113		Sphingobium_phage(100.0%)	1	NA	NA
WP_000936326.1|1755030_1755594_+	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	A0A1W6DX33	Sphingobium_phage	30.0	2.6e-11
>prophage 133
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	1766679	1768104	4678113		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_001519338.1|1766679_1768104_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.1	1.2e-41
>prophage 134
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	1779443	1789147	4678113		Escherichia_phage(25.0%)	9	NA	NA
WP_000678254.1|1779443_1780211_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	35.7	1.7e-29
WP_001677216.1|1780240_1781035_-	adenosylmethionine decarboxylase	NA	NA	NA	NA	NA
WP_000829968.1|1781055_1781916_-	polyamine aminopropyltransferase	NA	NA	NA	NA	NA
WP_000846613.1|1782022_1782370_-	YacC family pilotin-like protein	NA	NA	NA	NA	NA
WP_000946053.1|1782571_1784182_+	multicopper oxidase CueO	NA	A0A0C6DWA2	Mamastrovirus	58.7	4.3e-19
WP_000829727.1|1784259_1786650_-	pyrroloquinoline quinone-dependent dehydrogenase	NA	NA	NA	NA	NA
WP_000683343.1|1786855_1787392_+	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	33.1	1.0e-17
WP_000651591.1|1787449_1788112_-	carbonate dehydratase	NA	NA	NA	NA	NA
WP_000150619.1|1788220_1789147_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	32.7	5.9e-21
>prophage 135
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	1799915	1801334	4678113		unidentified_phage(100.0%)	1	NA	NA
WP_000174622.1|1799915_1801334_-	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	37.8	1.4e-26
>prophage 136
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	1804350	1806825	4678113		Bodo_saltans_virus(100.0%)	1	NA	NA
WP_000938539.1|1804350_1806825_+	ATP-dependent helicase HrpB	NA	A0A2H4UU36	Bodo_saltans_virus	28.0	9.5e-34
>prophage 137
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	1812072	1812870	4678113		Planktothrix_phage(100.0%)	1	NA	NA
WP_001157197.1|1812072_1812870_+	Fe3+-hydroxamate ABC transporter ATP-binding protein FhuC	NA	G9BWD6	Planktothrix_phage	27.4	3.5e-14
>prophage 138
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	1826257	1826602	4678113		Lake_Baikal_phage(100.0%)	1	NA	NA
WP_001278668.1|1826257_1826602_+	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	50.5	1.0e-26
>prophage 139
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	1830585	1836412	4678113	protease	uncultured_Mediterranean_phage(50.0%)	3	NA	NA
WP_000753958.1|1830585_1832013_+|protease	serine endoprotease DegP	protease	A0A1B1IT49	uncultured_Mediterranean_phage	29.2	4.2e-26
WP_001708039.1|1832165_1833323_+	CdaR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000191141.1|1833379_1836412_-	viral enhancing factor	NA	A0A288QW20	Cyclophragma_undans_nucleopolyhedrovirus	25.8	1.2e-46
>prophage 140
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	1848635	1849394	4678113		Flavobacterium_phage(100.0%)	1	NA	NA
WP_000947413.1|1848635_1849394_+	(2E,6E)-farnesyl-diphosphate-specific ditrans,polycis-undecaprenyl-diphosphate synthase	NA	R9W0U9	Flavobacterium_phage	42.2	1.9e-25
>prophage 141
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	1858208	1862311	4678113		Emiliania_huxleyi_virus(50.0%)	2	NA	NA
WP_000569412.1|1858208_1858805_+	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	39.3	1.5e-25
WP_001294829.1|1858828_1862311_+	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.6	2.4e-208
>prophage 142
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	1876298	1877330	4678113		Planktothrix_phage(100.0%)	1	NA	NA
WP_000594021.1|1876298_1877330_-	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	5.5e-36
>prophage 143
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	1884302	1885106	4678113		Indivirus(100.0%)	1	NA	NA
WP_000154868.1|1884302_1885106_+	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	35.4	1.6e-38
>prophage 144
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	1889156	1893367	4678113		Lactobacillus_phage(33.33%)	5	NA	NA
WP_000644706.1|1889156_1890524_-	murein transglycosylase D	NA	A0A0A7NU10	Lactobacillus_phage	33.0	1.4e-10
WP_001052774.1|1890595_1891351_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000801238.1|1891385_1892108_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000917872.1|1892104_1892572_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.9	4.7e-51
WP_001670675.1|1892635_1893367_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.9	6.4e-39
>prophage 145
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	1898085	1900860	4678113		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_031622255.1|1898085_1900860_+	type IV secretion protein Rhs	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	41.1	2.4e-33
>prophage 146
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	1919025	1919604	4678113		Caulobacter_phage(100.0%)	1	NA	NA
WP_000284051.1|1919025_1919604_+	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	30.8	1.3e-13
>prophage 147
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	1922818	1923958	4678113		Mycobacterium_phage(100.0%)	1	NA	NA
WP_000528884.1|1922818_1923958_+	RNA ligase RtcB family protein	NA	A0A222ZM82	Mycobacterium_phage	30.2	1.9e-29
>prophage 148
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	1928730	1933052	4678113		Enterobacteria_phage(50.0%)	4	NA	NA
WP_001043667.1|1928730_1929783_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	58.8	2.6e-113
WP_001285275.1|1930065_1931169_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	39.8	6.9e-61
WP_000893239.1|1931180_1932428_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.9	5.5e-99
WP_001675096.1|1932782_1933052_+	DUF4102 domain-containing protein	NA	Q7M297	Enterobacteria_phage	63.8	1.4e-20
>prophage 149
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	1941141	1941414	4678113		Salmonella_phage(100.0%)	1	NA	NA
WP_001675688.1|1941141_1941414_-	hypothetical protein	NA	B8K1I9	Salmonella_phage	60.9	5.4e-07
>prophage 150
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	1953959	1954484	4678113		Shigella_phage(100.0%)	1	NA	NA
WP_000830239.1|1953959_1954484_+	outer membrane protein	NA	A0A088CE87	Shigella_phage	29.4	1.3e-09
>prophage 151
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	1962131	1971842	4678113		Streptococcus_phage(33.33%)	6	NA	NA
WP_000083300.1|1962131_1964435_+	gold/copper-translocating P-type ATPase GolT	NA	E4ZFI9	Streptococcus_phage	33.2	4.6e-91
WP_001020583.1|1964431_1964896_+	Au(I) sensor transcriptional regulator GolS	NA	NA	NA	NA	NA
WP_001159470.1|1964973_1965168_+	gold resistance metallochaperone GolB	NA	NA	NA	NA	NA
WP_000288507.1|1965459_1966713_+	MFS transporter	NA	NA	NA	NA	NA
WP_000910368.1|1966901_1968860_+	site-specific DNA-methyltransferase	NA	Q1MVP0	Enterobacteria_phage	32.1	2.2e-81
WP_077681940.1|1968869_1971842_+	type III restriction-modification system endonuclease	NA	Q71TG1	Escherichia_phage	26.2	3.5e-83
>prophage 152
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	1985257	1987144	4678113		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000010206.1|1985257_1987144_+	propionate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	29.2	9.1e-53
>prophage 153
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	2001773	2002886	4678113		Bacillus_phage(100.0%)	1	NA	NA
WP_000484083.1|2001773_2002886_+	diguanylate cyclase AdrA	NA	A0A127AWB9	Bacillus_phage	33.1	7.3e-18
>prophage 154
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	2006573	2016494	4678113		Bacillus_phage(60.0%)	7	NA	NA
WP_000964305.1|2006573_2007485_-	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	63.6	7.1e-104
WP_001219273.1|2007610_2008519_+	fructokinase	NA	NA	NA	NA	NA
WP_000755625.1|2008540_2009713_-	MFS transporter AraJ	NA	NA	NA	NA	NA
WP_001676513.1|2009885_2013026_-	exonuclease subunit SbcC	NA	G3MAB6	Bacillus_virus	26.9	3.4e-12
WP_001221260.1|2013022_2014225_-	exonuclease subunit SbcD	NA	A0A0A0PQ58	Bacillus_phage	24.9	1.3e-07
WP_000113921.1|2014439_2015129_+	phosphate response regulator transcription factor PhoB	NA	W8CYM9	Bacillus_phage	38.0	3.3e-37
WP_000893646.1|2015198_2016494_+	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	31.1	2.0e-27
>prophage 155
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	2024465	2028805	4678113	tRNA	uncultured_Mediterranean_phage(100.0%)	4	NA	NA
WP_000667302.1|2024465_2025593_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	45.8	9.5e-90
WP_000007628.1|2025615_2025948_+	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	33.0	3.7e-10
WP_000934811.1|2025975_2027823_+	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_000046629.1|2027833_2028805_+	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	38.1	2.3e-44
>prophage 156
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	2033485	2035148	4678113		Indivirus(50.0%)	2	NA	NA
WP_001150233.1|2033485_2034589_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	35.2	2.5e-50
WP_001021372.1|2034677_2035148_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	49.0	1.0e-29
>prophage 157
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	2044667	2045777	4678113		Bacillus_virus(100.0%)	1	NA	NA
WP_000928798.1|2044667_2045777_-	2-aminoethylphosphonate ABC transport system ATP-binding subunit PhnT	NA	G3M9Y6	Bacillus_virus	32.8	3.6e-25
>prophage 158
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	2066843	2072011	4678113	protease	Agrobacterium_phage(25.0%)	4	NA	NA
WP_000122257.1|2066843_2067467_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	63.9	2.9e-64
WP_000130314.1|2067718_2068990_+|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	56.5	5.6e-131
WP_001067723.1|2069175_2071530_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.5	1.6e-224
WP_001043544.1|2071738_2072011_+	DNA-binding protein HU-beta	NA	A7KV42	Bacillus_phage	58.4	1.9e-20
>prophage 159
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	2075304	2076000	4678113		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000817201.1|2075304_2076000_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	68.4	1.2e-87
>prophage 160
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	2080400	2083947	4678113		Bacillus_phage(100.0%)	2	NA	NA
WP_001235566.1|2080400_2082173_+	SmdA family multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.8	4.7e-51
WP_001256083.1|2082165_2083947_+	SmdB family multidrug efflux ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.9	5.4e-39
>prophage 161
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	2101566	2112598	4678113	transposase	Sodalis_phage(20.0%)	12	NA	NA
WP_000440504.1|2101566_2102502_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	52.1	1.6e-63
WP_000051161.1|2102571_2102739_-	pleiotropic regulatory protein RsmS	NA	NA	NA	NA	NA
WP_000926647.1|2102752_2103268_-	primosomal replication protein N''	NA	NA	NA	NA	NA
WP_001189860.1|2103348_2103726_+	DUF454 family protein	NA	NA	NA	NA	NA
WP_000127350.1|2103878_2104430_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	45.2	1.0e-28
WP_000121974.1|2104543_2106472_+	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	41.5	2.3e-43
WP_000467098.1|2106517_2106847_+	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_001195023.1|2106846_2107452_+	recombination protein RecR	NA	NA	NA	NA	NA
WP_001523272.1|2107562_2109437_+	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	36.9	1.7e-115
WP_001220237.1|2109794_2110439_+	adenylate kinase	NA	NA	NA	NA	NA
WP_001250083.1|2110667_2111630_+	ferrochelatase	NA	NA	NA	NA	NA
WP_000801777.1|2111626_2112598_-	acetyl esterase	NA	L7RDF8	Acanthamoeba_polyphaga_moumouvirus	27.9	1.7e-15
>prophage 162
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	2121698	2126917	4678113		uncultured_virus(50.0%)	5	NA	NA
WP_000083909.1|2121698_2124200_-	copper-exporting P-type ATPase CopA	NA	A0A218MNH6	uncultured_virus	37.2	5.1e-112
WP_001026760.1|2124309_2124726_+	HTH-type transcriptional regulator CueR	NA	NA	NA	NA	NA
WP_000561177.1|2124726_2125179_-	NfeD family protein	NA	NA	NA	NA	NA
WP_000906146.1|2125175_2126093_-	SPFH/Band 7/PHB domain protein	NA	NA	NA	NA	NA
WP_000140185.1|2126239_2126917_+	iron ABC transporter ATP-binding protein FetA	NA	G3M9Y6	Bacillus_virus	32.1	1.1e-21
>prophage 163
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	2130192	2130879	4678113		Planktothrix_phage(100.0%)	1	NA	NA
WP_001110598.1|2130192_2130879_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.5	2.1e-31
>prophage 164
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	2135732	2136749	4678113		Planktothrix_phage(100.0%)	1	NA	NA
WP_000569653.1|2135732_2136749_+	virulence-associated ABC transporter ATP-binding protein SfbB	NA	G9BWD6	Planktothrix_phage	38.6	3.3e-33
>prophage 165
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	2141220	2143002	4678113		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_001096865.1|2141220_2143002_+	glyoxylate carboligase	NA	A0A0P0CRC5	Ostreococcus_lucimarinus_virus	27.3	1.9e-39
>prophage 166
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	2150452	2151601	4678113		Streptococcus_phage(100.0%)	1	NA	NA
WP_000706327.1|2150452_2151601_+	glycerate 3-kinase	NA	W6LM47	Streptococcus_phage	39.0	2.7e-47
>prophage 167
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	2162873	2167306	4678113	tRNA	Moumouvirus(50.0%)	6	NA	NA
WP_000912376.1|2162873_2164259_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	35.5	1.1e-44
WP_000819118.1|2164302_2165127_-	DUF2145 domain-containing protein	NA	NA	NA	NA	NA
WP_001038574.1|2165123_2165561_-	STM0539 family protein	NA	NA	NA	NA	NA
WP_001143571.1|2165553_2166099_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000190281.1|2166225_2166438_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_000729165.1|2166439_2167306_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	36.5	4.2e-29
>prophage 168
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	2178516	2185366	4678113		Salmonella_phage(75.0%)	7	NA	NA
WP_001575778.1|2178516_2180169_-	hypothetical protein	NA	B9UDL6	Salmonella_phage	38.0	1.5e-83
WP_000703619.1|2180149_2181076_-	glycosyltransferase family 2 protein	NA	I1TED8	Salmonella_phage	97.0	1.1e-168
WP_000915523.1|2181072_2181435_-	GtrA family protein	NA	I1TED9	Salmonella_phage	100.0	3.9e-61
WP_108745541.1|2181857_2182067_-	copper-binding protein	NA	NA	NA	NA	NA
WP_000946040.1|2182302_2182632_-	GHKL domain-containing protein	NA	NA	NA	NA	NA
WP_000339616.1|2182970_2183825_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000195925.1|2184040_2185366_+	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	46.3	2.3e-103
>prophage 169
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	2201584	2207702	4678113		Tupanvirus(50.0%)	3	NA	NA
WP_000194136.1|2201584_2205469_+	enterobactin non-ribosomal peptide synthetase EntF	NA	A0A2K9KZV5	Tupanvirus	28.5	1.9e-60
WP_001139588.1|2205718_2206855_+	LPS O-antigen length regulator	NA	NA	NA	NA	NA
WP_001708462.1|2206907_2207702_-	iron-enterobactin ABC transporter ATP-binding protein	NA	A0A1V0SJ29	Klosneuvirus	23.9	2.2e-08
>prophage 170
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	2222174	2222792	4678113		uncultured_marine_virus(100.0%)	1	NA	NA
WP_001164756.1|2222174_2222792_-	transcriptional regulator	NA	A0A0F7L444	uncultured_marine_virus	51.3	3.0e-53
>prophage 171
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	2227375	2233923	4678113		Bacillus_virus(33.33%)	6	NA	NA
WP_000887641.1|2227375_2228941_+	alkyl hydroperoxide reductase subunit F	NA	G3MA85	Bacillus_virus	34.0	4.1e-43
WP_000377428.1|2229273_2229834_+	molecular chaperone	NA	NA	NA	NA	NA
WP_000064319.1|2229826_2232106_+	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	25.5	4.5e-46
WP_001250383.1|2232102_2232660_+	4Fe-4S dicluster domain-containing protein	NA	NA	NA	NA	NA
WP_000417098.1|2232659_2233427_+	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000278499.1|2233494_2233923_-	universal stress protein UspG	NA	A0A1W6JNV4	Morganella_phage	39.2	1.3e-18
>prophage 172
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	2249037	2250567	4678113		Morganella_phage(33.33%)	3	NA	NA
WP_000034826.1|2249037_2249247_+	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	5.9e-22
WP_000939753.1|2249304_2249688_-	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	48.6	1.7e-22
WP_000495782.1|2249778_2250567_+	deaminated glutathione amidase	NA	M1H2P4	Paramecium_bursaria_Chlorella_virus	23.9	1.3e-05
>prophage 173
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	2254522	2257008	4678113		Stx2-converting_phage(50.0%)	2	NA	NA
WP_000858711.1|2254522_2255734_-	D-alanyl-D-alanine carboxypeptidase DacA	NA	B6DZZ7	Stx2-converting_phage	49.7	3.4e-101
WP_001231306.1|2255874_2257008_-	endolytic peptidoglycan transglycosylase RlpA	NA	F5B3X9	Synechococcus_phage	53.2	4.8e-09
>prophage 174
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	2265235	2267818	4678113	tRNA	Staphylococcus_phage(100.0%)	1	NA	NA
WP_001157915.1|2265235_2267818_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	42.5	2.8e-185
>prophage 175
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	2278643	2283446	4678113		Organic_Lake_phycodnavirus(50.0%)	4	NA	NA
WP_000368034.1|2278643_2280323_-	molecular chaperone HscC	NA	F2Y0P3	Organic_Lake_phycodnavirus	36.2	6.2e-77
WP_000498876.1|2280398_2281637_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001207439.1|2281668_2282604_-	pyrimidine-specific ribonucleoside hydrolase RihA	NA	NA	NA	NA	NA
WP_000631369.1|2282720_2283446_-	glutamate/aspartate ABC transporter ATP binding protein GltL	NA	G9BWD6	Planktothrix_phage	36.3	8.7e-28
>prophage 176
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	2289346	2290432	4678113		Pseudomonas_phage(100.0%)	1	NA	NA
WP_000493272.1|2289346_2290432_-	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	45.6	6.6e-48
>prophage 177
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	2295048	2296713	4678113		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_000337038.1|2295048_2296713_-	asparagine synthase B	NA	A9YVS6	Ostreococcus_tauri_virus	38.8	1.0e-84
>prophage 178
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	2301367	2311580	4678113	tRNA	Vibrio_phage(25.0%)	7	NA	NA
WP_001023069.1|2301367_2303320_+	PTS N-acetyl glucosamine transporter subunit IIABC	NA	A0A2I7SAJ6	Vibrio_phage	48.6	2.9e-09
WP_001287181.1|2303530_2305198_+|tRNA	glutamine--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	96.0	0.0e+00
WP_001258803.1|2305858_2307265_+	chitoporin	NA	NA	NA	NA	NA
WP_000722258.1|2307314_2307647_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000057014.1|2307695_2309000_-	tricarballylate/proton symporter TcuC	NA	Q6JIH2	Burkholderia_virus	34.9	1.2e-59
WP_000811134.1|2309050_2310190_-	tricarballylate utilization protein TcuB	NA	NA	NA	NA	NA
WP_000228709.1|2310176_2311580_-	FAD-dependent tricarballylate dehydrogenase TcuA	NA	A0A2P0ZL82	Lactobacillus_phage	25.9	1.0e-08
>prophage 179
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	2322663	2323341	4678113		Bacillus_phage(100.0%)	1	NA	NA
WP_000186059.1|2322663_2323341_-	two-component system response regulator KdpE	NA	W8CYM9	Bacillus_phage	31.1	2.6e-26
>prophage 180
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	2326611	2334045	4678113		Paramecium_bursaria_Chlorella_virus(33.33%)	6	NA	NA
WP_000088026.1|2326611_2328660_-	potassium-transporting ATPase subunit KdpB	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	23.3	1.9e-27
WP_000730078.1|2328680_2330360_-	potassium-transporting ATPase subunit KdpA	NA	NA	NA	NA	NA
WP_001670793.1|2330359_2330449_-	K(+)-transporting ATPase subunit F	NA	NA	NA	NA	NA
WP_000401435.1|2330785_2330992_+	YbfA family protein	NA	NA	NA	NA	NA
WP_001142016.1|2331103_2332525_+	deoxyribodipyrimidine photo-lyase	NA	A0A1V0SGL1	Hokovirus	31.7	6.0e-57
WP_001041122.1|2332563_2334045_-	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	28.7	1.1e-45
>prophage 181
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	2337560	2338352	4678113		Kaumoebavirus(100.0%)	1	NA	NA
WP_001113969.1|2337560_2338352_+	endonuclease VIII	NA	A0A1V0CNR6	Kaumoebavirus	26.1	4.0e-10
>prophage 182
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	2364995	2368519	4678113		Vibrio_phage(33.33%)	4	NA	NA
WP_000345361.1|2364995_2365715_+	nicotinamide riboside transporter PnuC	NA	A0A126HGA3	Vibrio_phage	35.8	1.7e-23
WP_000951250.1|2365711_2366650_-	CDF family zinc transporter ZitB	NA	A0A1V0SED0	Indivirus	28.1	1.0e-25
WP_000784385.1|2366760_2367147_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001109233.1|2367466_2368519_+	3-deoxy-7-phosphoheptulonate synthase AroG	NA	A0A0B6VT43	Edwardsiella_phage	47.1	6.4e-80
>prophage 183
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	2372244	2373513	4678113		Oenococcus_phage(100.0%)	1	NA	NA
WP_000074120.1|2372244_2373513_+	SLC13/DASS family transporter	NA	Q6A201	Oenococcus_phage	26.4	7.0e-33
>prophage 184
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	2379185	2379962	4678113		Bacillus_virus(100.0%)	1	NA	NA
WP_001214701.1|2379185_2379962_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	25.5	2.9e-13
>prophage 185
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	2384270	2391888	4678113		Tupanvirus(33.33%)	8	NA	NA
WP_001265465.1|2384270_2385287_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	47.3	3.3e-81
WP_000885526.1|2385509_2386418_-	DUF2167 domain-containing protein	NA	NA	NA	NA	NA
WP_000096946.1|2386588_2388064_-	molybdate ABC transporter ATP-binding protein ModF	NA	W5SAS9	Pithovirus	30.2	4.4e-10
WP_001147418.1|2388131_2388920_-	molybdenum-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_000891513.1|2389048_2389198_+	multidrug efflux pump-associated protein, AcrZ family	NA	NA	NA	NA	NA
WP_000951416.1|2389364_2390138_+	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000604026.1|2390137_2390827_+	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_000891710.1|2390829_2391888_+	molybdenum ABC transporter ATP-binding protein ModC	NA	G9BWD6	Planktothrix_phage	34.3	5.1e-21
>prophage 186
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	2400345	2403774	4678113		Catovirus(50.0%)	3	NA	NA
WP_001095241.1|2400345_2401866_+	histidine ammonia-lyase	NA	A0A1V0S940	Catovirus	40.0	1.7e-81
WP_000767403.1|2401950_2402427_-	kinase inhibitor	NA	NA	NA	NA	NA
WP_000205515.1|2402484_2403774_-	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.6	7.7e-19
>prophage 187
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	2412980	2413889	4678113		Streptococcus_phage(100.0%)	1	NA	NA
WP_001246038.1|2412980_2413889_-	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	29.9	6.0e-26
>prophage 188
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	2425603	2434916	4678113		Anomala_cuprea_entomopoxvirus(25.0%)	8	NA	NA
WP_001287612.1|2425603_2427340_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	30.9	3.5e-19
WP_000743436.1|2427332_2428328_-	secretion protein HlyD	NA	NA	NA	NA	NA
WP_001025254.1|2428327_2429002_-	transcriptional regulator CecR	NA	NA	NA	NA	NA
WP_000007065.1|2429231_2430593_+	ATP-dependent RNA helicase RhlE	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	34.2	2.9e-53
WP_001218637.1|2430800_2432945_+	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	26.7	9.7e-43
WP_000386476.1|2432974_2433949_+	DNA-binding protein YbiB	NA	NA	NA	NA	NA
WP_000849089.1|2434104_2434365_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_000146332.1|2434649_2434916_-	DksA/TraR family C4-type zinc finger protein	NA	E5E4B1	Acinetobacter_phage	52.8	1.7e-13
>prophage 189
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	2438378	2443685	4678113		Planktothrix_phage(33.33%)	6	NA	NA
WP_000569093.1|2438378_2439101_-	glutamine ABC transporter ATP-binding protein GlnQ	NA	G9BWD6	Planktothrix_phage	43.2	1.9e-35
WP_001159076.1|2439097_2439757_-	glutamine ABC transporter permease GlnP	NA	NA	NA	NA	NA
WP_000838671.1|2439900_2440647_-	glutamine ABC transporter substrate-binding protein GlnH	NA	NA	NA	NA	NA
WP_000100805.1|2441123_2441627_-	DNA starvation/stationary phase protection protein Dps	NA	A0A222YYG6	Streptomyces_phage	23.0	7.1e-05
WP_001119554.1|2441929_2442817_-	threonine/homoserine exporter RhtA	NA	NA	NA	NA	NA
WP_000716763.1|2443169_2443685_+	outer membrane protein OmpX	NA	A5LH44	Enterobacteria_phage	34.2	1.1e-16
>prophage 190
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	2448670	2450263	4678113		Tupanvirus(100.0%)	1	NA	NA
WP_000961479.1|2448670_2450263_+	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	27.9	2.1e-58
>prophage 191
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	2454772	2457205	4678113		Citrobacter_phage(100.0%)	1	NA	NA
WP_000192661.1|2454772_2457205_-	glycyl radical protein	NA	A0A076YHZ7	Citrobacter_phage	43.5	2.1e-09
>prophage 192
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	2461526	2463398	4678113		Planktothrix_phage(100.0%)	1	NA	NA
WP_001120597.1|2461526_2463398_+	glutathione ABC transporter ATP-binding protein GsiA	NA	G9BWD6	Planktothrix_phage	28.5	1.3e-14
>prophage 193
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	2478923	2480929	4678113		Stx2-converting_phage(50.0%)	2	NA	NA
WP_000195712.1|2478923_2480126_+	serine-type D-Ala-D-Ala carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	47.1	2.4e-99
WP_000450103.1|2480170_2480929_-	DNA-binding transcriptional repressor DeoR	NA	A0A077SK06	Escherichia_phage	29.6	5.2e-15
>prophage 194
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	2488500	2497667	4678113		Vibrio_phage(25.0%)	11	NA	NA
WP_000495513.1|2488500_2488764_-	glutaredoxin, GrxA family	NA	A0A2I7SAE2	Vibrio_phage	70.5	5.9e-27
WP_001259131.1|2488933_2489224_+	YbjC family protein	NA	NA	NA	NA	NA
WP_000075300.1|2489207_2489930_+	nitroreductase NfsA	NA	NA	NA	NA	NA
WP_000684361.1|2489987_2490890_+	30S ribosomal protein S6--L-glutamate ligase	NA	A0A1D7SR78	Cyanophage	34.0	3.5e-34
WP_000624810.1|2490986_2491463_+	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_000125769.1|2491811_2492924_+	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_001000694.1|2493011_2494145_+	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.9	1.4e-29
WP_000105453.1|2494154_2495108_+	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_001061629.1|2495104_2495950_+	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_000505788.1|2496023_2496497_+	YbjO family protein	NA	NA	NA	NA	NA
WP_001149775.1|2496539_2497667_+	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	26.4	2.4e-24
>prophage 195
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	2504478	2507230	4678113		Planktothrix_phage(50.0%)	4	NA	NA
WP_000027186.1|2504478_2505207_-	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	35.8	5.1e-28
WP_001270724.1|2505436_2505952_-	lipoprotein	NA	NA	NA	NA	NA
WP_001160725.1|2506079_2506403_+	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_000645850.1|2506399_2507230_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	30.7	2.3e-08
>prophage 196
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	2510819	2512538	4678113		Yellowstone_lake_phycodnavirus(100.0%)	1	NA	NA
WP_000815309.1|2510819_2512538_-	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.4	2.2e-29
>prophage 197
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	2519323	2526636	4678113	integrase,protease	Dickeya_phage(16.67%)	7	2508061:2508075	2526854:2526868
2508061:2508075	attL	AGCCTGCGAGGAGAC	NA	NA	NA	NA
WP_001201751.1|2519323_2520442_+	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.9	1.4e-08
WP_000125875.1|2520438_2522385_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	43.1	2.0e-39
WP_000447499.1|2522514_2522736_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_000520789.1|2523059_2523380_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
WP_000934064.1|2523410_2525687_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
WP_001117984.1|2525899_2526097_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001539594.1|2526258_2526636_-|integrase	integrase	integrase	A0A077KET4	Ralstonia_phage	41.0	1.2e-20
2526854:2526868	attR	GTCTCCTCGCAGGCT	NA	NA	NA	NA
>prophage 198
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	2531249	2548083	4678113	tRNA	Bacillus_phage(25.0%)	10	NA	NA
WP_001202260.1|2531249_2532971_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	23.5	8.4e-13
WP_001044541.1|2532971_2534738_-	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	25.1	6.0e-22
WP_000537407.1|2534851_2535820_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	45.5	1.1e-62
WP_000228469.1|2536365_2536860_+	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_001680783.1|2536994_2541116_+	DNA translocase FtsK	NA	S5VNE3	Mycobacterium_phage	49.5	2.9e-88
WP_001519746.1|2541258_2541870_+	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_000067792.1|2541879_2543223_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.9	1.6e-80
WP_000886697.1|2543481_2544774_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	44.5	8.6e-95
WP_000850262.1|2545010_2547455_+	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	50.5	7.0e-223
WP_000213069.1|2547465_2548083_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	4.3e-76
>prophage 199
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	2552377	2557068	4678113		Tetraselmis_virus(100.0%)	4	NA	NA
WP_012539861.1|2552377_2553202_-	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.5	2.8e-22
WP_012543336.1|2553293_2553620_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001145562.1|2553750_2554710_+	SPI-2 type III secretion system effector SopD2	NA	NA	NA	NA	NA
WP_001292799.1|2554785_2557068_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	42.0	1.1e-161
>prophage 200
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	2561164	2562253	4678113		Streptococcus_phage(100.0%)	1	NA	NA
WP_000079590.1|2561164_2562253_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	46.5	2.8e-78
>prophage 201
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	2567309	2571873	4678113		Bacillus_phage(66.67%)	3	NA	NA
WP_000167332.1|2567309_2567594_+	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	4.1e-10
WP_000705774.1|2567823_2570088_+	ComEC family protein	NA	Q332C0	Clostridium_botulinum_C_phage	22.5	8.8e-10
WP_000551246.1|2570124_2571873_+	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	30.5	3.2e-60
>prophage 202
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	2577095	2640246	4678113	tRNA,protease,tail	Salmonella_phage(27.78%)	56	NA	NA
WP_001154025.1|2577095_2577899_+|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
WP_001288828.1|2577891_2579214_+	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_000060025.1|2579194_2579899_+	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_000572746.1|2579898_2584365_+	chromosome partition protein MukB	NA	NA	NA	NA	NA
WP_000925870.1|2584709_2586560_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000357052.1|2586819_2587368_+	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	1.2e-05
WP_001109471.1|2587395_2588043_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_000462653.1|2588104_2589295_-	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_000977709.1|2589479_2590571_-	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	51.7	1.7e-99
WP_000117867.1|2591164_2592565_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	35.8	4.5e-81
WP_000762342.1|2592765_2593227_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000544855.1|2593544_2594759_+	diaminopropionate ammonia-lyase	NA	NA	NA	NA	NA
WP_000893200.1|2595004_2596441_+	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_000191404.1|2596518_2597721_-	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001676370.1|2597915_2598326_-	enterohemolysin	NA	H6WRX0	Salmonella_phage	100.0	5.0e-33
WP_000274547.1|2598346_2598976_+	hypothetical protein	NA	A0A0U2RJZ0	Escherichia_phage	65.9	1.6e-75
WP_000729406.1|2598959_2599586_+	hypothetical protein	NA	A0A0U2RK03	Escherichia_phage	71.6	3.3e-92
WP_000583382.1|2599582_2601292_+|tail	tail fiber protein	tail	A0A0U2SAV1	Escherichia_phage	66.0	1.5e-91
WP_000143167.1|2601291_2601873_+|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	89.5	1.7e-95
WP_072100753.1|2601876_2602125_-|tail	phage tail protein	tail	A0A1B0VCD0	Salmonella_phage	66.2	2.1e-18
WP_001674638.1|2602350_2603319_+	SPI-2 type III secretion system effector SseI	NA	Q9MBL9	Phage_Gifsy-2	99.4	3.0e-193
WP_000334547.1|2603966_2604593_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	63.2	1.4e-66
WP_001525490.1|2604952_2605639_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000497441.1|2605909_2606101_-	DinI-like family protein	NA	S4TNM0	Salmonella_phage	95.2	6.2e-26
WP_000193790.1|2606527_2609140_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.8	6.3e-20
WP_000291723.1|2609347_2610358_+	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_001574119.1|2610523_2611066_+	cell division protein ZapC	NA	NA	NA	NA	NA
WP_000224079.1|2611062_2612172_-	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_001086485.1|2612270_2614379_+	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_000053044.1|2614391_2616299_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
WP_000333139.1|2616313_2617567_+	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_000433414.1|2617571_2619212_+	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_000759136.1|2619208_2619772_+	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_001537784.1|2620027_2620195_+	ribosome modulation factor	NA	NA	NA	NA	NA
WP_000227928.1|2620294_2620813_-	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_000156448.1|2620881_2622642_-|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000877172.1|2622827_2623280_+	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_001674965.1|2623351_2624404_-	porin OmpA	NA	NA	NA	NA	NA
WP_000288733.1|2624760_2625270_-	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_001202375.1|2625486_2626092_+	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_000950876.1|2626078_2628232_-	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001261222.1|2628250_2628697_-	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_000420505.1|2628820_2630875_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.6	8.5e-20
WP_000424187.1|2630910_2631369_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000847719.1|2631463_2632126_-	DUF2057 family protein	NA	NA	NA	NA	NA
WP_000975204.1|2632296_2632713_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_000561983.1|2632757_2633075_-	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_000140478.1|2633132_2634344_-	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000859416.1|2634558_2635107_+	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_000548080.1|2635132_2635912_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000072884.1|2635960_2636242_+	acylphosphatase	NA	NA	NA	NA	NA
WP_000904449.1|2636238_2636568_-	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000374046.1|2636654_2637314_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	52.4	2.7e-44
WP_000938186.1|2637932_2638613_-|protease	type III secretion system effector protease PipA	protease	Q9MBM0	Phage_Gifsy-2	71.0	2.2e-81
WP_001123028.1|2638832_2639708_-	SPI-2 type III secretion system effector PipB	NA	NA	NA	NA	NA
WP_016716169.1|2639925_2640246_+	hypothetical protein	NA	E5G6P3	Salmonella_phage	79.2	4.2e-11
>prophage 203
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	2646019	2646700	4678113		Bacillus_phage(100.0%)	1	NA	NA
WP_000698207.1|2646019_2646700_-	response regulator transcription factor HprR	NA	W8CYM9	Bacillus_phage	36.1	5.8e-34
>prophage 204
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	2660061	2662303	4678113		Phage_258-320(50.0%)	3	NA	NA
WP_001537781.1|2660061_2660424_-	anti-adapter protein IraM	NA	Q20GJ2	Phage_258-320	43.5	2.4e-23
WP_001284251.1|2661077_2661383_-	chaperone modulator CbpM	NA	NA	NA	NA	NA
WP_000420603.1|2661382_2662303_-	curved DNA-binding protein	NA	A0A1V0SIM1	Klosneuvirus	46.7	3.2e-11
>prophage 205
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	2668588	2668756	4678113		Enterobacteria_phage(100.0%)	1	NA	NA
WP_001273663.1|2668588_2668756_+	general stress protein	NA	Q9KX95	Enterobacteria_phage	92.6	1.4e-05
>prophage 206
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	2676718	2680342	4678113		Cronobacter_phage(33.33%)	3	NA	NA
WP_001575963.1|2676718_2677573_+	phosphate starvation-inducible protein PhoH	NA	R4II13	Cronobacter_phage	76.7	4.5e-92
WP_000433673.1|2677678_2678560_-	MurR/RpiR family transcriptional regulator	NA	A0A2P0VNK5	Tetraselmis_virus	28.9	3.3e-05
WP_000628085.1|2678845_2680342_-	sodium:solute symporter	NA	A0A240F3J2	Aeromonas_phage	22.9	1.3e-17
>prophage 207
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	2700854	2710547	4678113		Burkholderia_phage(33.33%)	11	NA	NA
WP_000208509.1|2700854_2701067_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
WP_024131109.1|2701077_2701266_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001080664.1|2701524_2702721_-	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	56.1	5.1e-110
WP_000107435.1|2703370_2703682_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000377050.1|2703761_2704457_+	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.1	6.2e-07
WP_001157315.1|2704530_2705961_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
WP_000785978.1|2705941_2706412_+	very short patch repair endonuclease	NA	E5E3X5	Burkholderia_phage	46.9	1.2e-30
WP_001212259.1|2706400_2707321_-	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_000929127.1|2707496_2708408_+	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_001178601.1|2708424_2708670_+	YodC family protein	NA	NA	NA	NA	NA
WP_001119826.1|2708834_2710547_+	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	37.4	1.6e-19
>prophage 208
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	2738234	2738987	4678113		Bacillus_virus(100.0%)	1	NA	NA
WP_001273034.1|2738234_2738987_+	L-cystine ABC transporter ATP-binding protein YecC	NA	G3M9Y6	Bacillus_virus	34.5	3.2e-25
>prophage 209
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	2747247	2747913	4678113		Sphingomonas_phage(100.0%)	1	NA	NA
WP_001677500.1|2747247_2747913_+	YecA family protein	NA	H9NBT7	Sphingomonas_phage	62.1	1.9e-05
>prophage 210
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	2763181	2767316	4678113		Bacillus_thuringiensis_phage(66.67%)	4	NA	NA
WP_000483281.1|2763181_2764843_+	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	26.2	9.0e-12
WP_000204362.1|2764996_2765863_+	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_000036389.1|2765859_2766909_+	chemotaxis response regulator protein-glutamate methylesterase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	1.0e-05
WP_000763861.1|2766926_2767316_+	chemotaxis protein CheY	NA	Q56AR1	Bacillus_thuringiensis_phage	30.4	2.2e-06
>prophage 211
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	2775268	2781828	4678113	tRNA	Tupanvirus(33.33%)	7	NA	NA
WP_001025369.1|2775268_2777002_-|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.6	9.8e-86
WP_000024794.1|2777238_2777808_+	VOC family protein	NA	NA	NA	NA	NA
WP_001185780.1|2777827_2778574_+	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_000569035.1|2778809_2779781_-|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_000019607.1|2779777_2780521_-	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.9	4.1e-25
WP_000252975.1|2780561_2780957_-	membrane protein	NA	NA	NA	NA	NA
WP_000639226.1|2781009_2781828_-	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	80.3	4.5e-57
>prophage 212
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	2785849	2793837	4678113		Bacillus_virus(50.0%)	9	NA	NA
WP_000022509.1|2785849_2786371_+	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.6e-10
WP_000716756.1|2786372_2786972_-	YebB family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_016697953.1|2787198_2787873_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000580335.1|2788232_2788844_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_000568508.1|2788852_2789863_+	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	26.4	2.4e-07
WP_000571521.1|2789941_2790727_-	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_000203023.1|2790723_2791479_-	zinc ABC transporter ATP-binding protein ZnuC	NA	G3M9Y6	Bacillus_virus	29.4	8.5e-18
WP_000939597.1|2791557_2792502_+	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_001184028.1|2792517_2793837_+	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	40.9	2.6e-14
>prophage 213
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	2797774	2799250	4678113		Cyanophage(100.0%)	1	NA	NA
WP_000301711.1|2797774_2799250_+	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	37.5	2.6e-79
>prophage 214
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	2807148	2827120	4678113	holin,integrase,tail,lysis	Salmonella_phage(26.67%)	22	2810841:2810870	2830462:2830491
WP_000944288.1|2807148_2807847_-	exodeoxyribonuclease X	NA	Q6UAU3	Klebsiella_phage	40.4	2.8e-07
WP_000100257.1|2807870_2808527_-	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_000856224.1|2808634_2808865_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	60.3	2.9e-14
WP_000168393.1|2809002_2809377_+	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000979694.1|2809377_2810253_+	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000722370.1|2810269_2810623_+	YebY family protein	NA	NA	NA	NA	NA
2810841:2810870	attL	ACAGGAATCGTATTCGGTCTCTTTTTATTT	NA	NA	NA	NA
WP_000087636.1|2811005_2812085_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	52.5	3.0e-101
WP_001575998.1|2812059_2812338_-	excisionase	NA	A0A2H4J5E1	uncultured_Caudovirales_phage	37.5	1.4e-10
WP_001237395.1|2812751_2814731_+	MBL fold metallo-hydrolase	NA	A0A2P0VMX1	Tetraselmis_virus	46.3	1.9e-162
WP_000972675.1|2815362_2815668_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000940753.1|2815731_2816331_+	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	82.9	4.7e-96
WP_000784710.1|2816327_2816555_+	DNA breaking-rejoining protein	NA	A0A0M4RU10	Salmonella_phage	66.7	2.2e-14
WP_001097218.1|2816684_2817374_+	antitermination protein	NA	I6PDF8	Cronobacter_phage	54.9	2.1e-60
WP_001574213.1|2817470_2817995_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000798708.1|2818368_2818818_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001574215.1|2819178_2819865_-	PipA/GogA/GtgA family type III secretion system effector	NA	Q9MBM0	Phage_Gifsy-2	99.6	1.8e-131
WP_001574216.1|2820140_2820470_+|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
WP_000984586.1|2820453_2820906_+	lysozyme	NA	A0A0M4R365	Salmonella_phage	97.3	2.3e-79
WP_001541990.1|2820923_2821403_+|lysis	lysis protein	lysis	Q56118	Enterobacteria_phage	77.0	1.4e-55
WP_000877926.1|2822297_2822831_-	superoxide dismutase [Cu-Zn]	NA	Q9MC02	Salmonella_phage	54.0	1.8e-46
WP_001152416.1|2822920_2823616_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	66.7	1.0e-89
WP_072100756.1|2826256_2827120_+	DUF1983 domain-containing protein	NA	K7PKJ2	Enterobacteria_phage	78.9	9.0e-48
2830462:2830491	attR	ACAGGAATCGTATTCGGTCTCTTTTTATTT	NA	NA	NA	NA
>prophage 215
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	2831530	2834255	4678113		Escherichia_phage(25.0%)	6	NA	NA
WP_077681935.1|2831530_2832025_-	RecE	NA	A0A0U2I1R6	Escherichia_phage	70.3	3.7e-22
WP_001013467.1|2832214_2832445_+	hypothetical protein	NA	Q8HA86	Salmonella_phage	93.7	6.1e-28
WP_001708489.1|2832498_2833032_+	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	43.0	1.6e-10
WP_000789530.1|2833288_2833456_-	lytic enzyme	NA	NA	NA	NA	NA
WP_001576014.1|2833520_2833709_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000348541.1|2833763_2834255_+	DUF1441 family protein	NA	Q9EYD0	Enterobacteria_phage	56.2	7.1e-42
>prophage 216
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	2844260	2849625	4678113		Bacteriophage(33.33%)	7	NA	NA
WP_001576019.1|2844260_2844530_-	hypothetical protein	NA	B6SCX2	Bacteriophage	47.9	3.1e-07
WP_001025515.1|2844902_2845322_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000030934.1|2845694_2846171_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000422882.1|2846500_2846896_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	32.8	9.2e-16
WP_000182071.1|2847579_2848302_+	SPI-1 type III secretion system guanine nucleotide exchange factor SopE2	NA	NA	NA	NA	NA
WP_001134856.1|2848586_2848751_+	membrane protein	NA	NA	NA	NA	NA
WP_000986173.1|2848974_2849625_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	50.9	7.2e-58
>prophage 217
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	2857131	2859180	4678113		Moraxella_phage(100.0%)	1	NA	NA
WP_001091237.1|2857131_2859180_+	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.5	8.0e-87
>prophage 218
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	2864557	2864767	4678113		Morganella_phage(100.0%)	1	NA	NA
WP_001062678.1|2864557_2864767_+	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	1.6e-22
>prophage 219
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	2872254	2873814	4678113		Moraxella_phage(100.0%)	1	NA	NA
WP_000421815.1|2872254_2873814_+	CNNM family cation transport protein YoaE	NA	A0A0R6PEZ3	Moraxella_phage	44.4	9.5e-40
>prophage 220
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	2877784	2885096	4678113	tRNA	Pandoravirus(33.33%)	7	NA	NA
WP_000978451.1|2877784_2879149_-	aminodeoxychorismate synthase component 1	NA	A0A0B5J984	Pandoravirus	34.5	3.6e-43
WP_000457328.1|2879229_2879409_+	YoaH family protein	NA	NA	NA	NA	NA
WP_000029550.1|2879414_2879759_-	RidA family protein	NA	NA	NA	NA	NA
WP_000128807.1|2879889_2881800_+	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	32.7	4.5e-92
WP_001221017.1|2881857_2882553_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_000290594.1|2882624_2883206_+	Slp family lipoprotein	NA	NA	NA	NA	NA
WP_000758418.1|2883410_2885096_+	long-chain-fatty-acid--CoA ligase FadD	NA	A0A2H4PQM9	Staphylococcus_phage	26.0	3.8e-34
>prophage 221
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	2920665	2923423	4678113		uncultured_Caudovirales_phage(50.0%)	2	NA	NA
WP_001037182.1|2920665_2922351_-	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	23.4	2.3e-23
WP_001518537.1|2922475_2923423_-	ribose-phosphate pyrophosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.8	8.6e-44
>prophage 222
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	2926770	2932428	4678113		Pseudomonas_phage(33.33%)	7	NA	NA
WP_000804703.1|2926770_2927853_+	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	41.6	8.7e-08
WP_000347310.1|2927852_2928686_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_000150669.1|2928682_2929072_+	SirB family protein	NA	NA	NA	NA	NA
WP_001257065.1|2929075_2929885_+	tetratricopeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_000811046.1|2929922_2930777_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	38.8	1.9e-45
WP_000148422.1|2930830_2931931_-	sodium-potassium/proton antiporter ChaA	NA	NA	NA	NA	NA
WP_001674919.1|2932197_2932428_+	putative cation transport regulator ChaB	NA	A0A1S5YE01	Mythimna_unipuncta_granulovirus	40.0	4.2e-05
>prophage 223
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	2942767	2944306	4678113		Escherichia_phage(100.0%)	1	NA	NA
WP_000702615.1|2942767_2944306_+	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	41.4	4.8e-20
>prophage 224
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	2948807	2955215	4678113		Synechococcus_phage(33.33%)	7	NA	NA
WP_001191156.1|2948807_2949650_-	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	48.8	7.5e-15
WP_001540172.1|2949700_2950159_-	YchJ family protein	NA	NA	NA	NA	NA
WP_001230575.1|2950269_2951175_+	patatin-like phospholipase RssA	NA	NA	NA	NA	NA
WP_000193432.1|2951265_2952279_+	two-component system response regulator RssB	NA	NA	NA	NA	NA
WP_000729450.1|2952481_2953390_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	47.5	8.2e-60
WP_001287383.1|2953521_2953935_-	DNA-binding transcriptional regulator H-NS	NA	NA	NA	NA	NA
WP_000068095.1|2954597_2955215_+	thymidine kinase	NA	A0A023W530	Serratia_phage	54.2	2.7e-54
>prophage 225
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	2963585	2966478	4678113		Planktothrix_phage(33.33%)	3	NA	NA
WP_000058857.1|2963585_2964593_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.3	1.3e-13
WP_000994698.1|2964589_2965594_+	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppF	NA	G3M9Y6	Bacillus_virus	29.1	8.1e-16
WP_000059074.1|2965641_2966478_+	ion transporter	NA	A0A1B0Y2S3	Lactobacillus_phage	42.4	1.0e-08
>prophage 226
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	2978146	2981104	4678113		Acinetobacter_phage(100.0%)	2	NA	NA
WP_001195280.1|2978146_2979505_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.7	2.3e-37
WP_000763488.1|2979508_2981104_-	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	39.1	2.0e-53
>prophage 227
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	2986085	2991424	4678113	protease	Chrysochromulina_ericina_virus(33.33%)	4	NA	NA
WP_000559310.1|2986085_2986847_-	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	22.2	7.5e-06
WP_000422082.1|2987084_2988131_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	29.5	1.6e-19
WP_000548616.1|2988172_2988424_-	YciN family protein	NA	NA	NA	NA	NA
WP_000513597.1|2988826_2991424_+	type I DNA topoisomerase	NA	A0A2K9L5F8	Tupanvirus	35.4	4.1e-88
>prophage 228
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	2996516	2997107	4678113		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001176284.1|2996516_2997107_-	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	48.4	2.9e-42
>prophage 229
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	3002691	3006870	4678113		Bacillus_virus(50.0%)	2	NA	NA
WP_001675620.1|3002691_3004674_-	cyclic di-GMP phosphodiesterase	NA	G3MA91	Bacillus_virus	31.5	2.9e-17
WP_000485050.1|3004935_3006870_-	exoribonuclease II	NA	A0A2H4UVB7	Bodo_saltans_virus	23.5	6.5e-06
>prophage 230
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	3012247	3013054	4678113		Bacillus_virus(100.0%)	1	NA	NA
WP_000230462.1|3012247_3013054_-	peptide ABC transporter ATP-binding protein SapF	NA	G3M9Y6	Bacillus_virus	27.4	4.6e-14
>prophage 231
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	3031542	3032412	4678113		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000456781.1|3031542_3032412_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	43.2	3.0e-51
>prophage 232
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	3035963	3036821	4678113		Streptococcus_phage(100.0%)	1	NA	NA
WP_012543356.1|3035963_3036821_-	helix-turn-helix domain-containing protein	NA	A0A1B0RXG1	Streptococcus_phage	28.1	2.0e-07
>prophage 233
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	3047035	3067496	4678113	tRNA,holin	Escherichia_phage(55.56%)	25	NA	NA
WP_000945041.1|3047035_3047551_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	54.5	1.7e-22
WP_001046799.1|3047808_3048372_+	DNA endonuclease SmrA	NA	NA	NA	NA	NA
WP_000945632.1|3048782_3049937_+	chemoreceptor protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	27.7	1.5e-10
WP_000387374.1|3050082_3051066_+	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_000123686.1|3051552_3052926_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.0	2.1e-51
WP_001156217.1|3052969_3053905_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	97.3	7.2e-144
WP_001676915.1|3054221_3054839_-	exodeoxyribonuclease	NA	A0A088CD28	Shigella_phage	41.9	2.5e-36
WP_000800272.1|3054866_3055184_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000560208.1|3055268_3055490_-	cell division protein FtsZ	NA	A0A0U2RTC4	Escherichia_phage	83.6	7.9e-33
WP_000004762.1|3055927_3056449_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085981757.1|3056556_3056712_-	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	48.9	2.6e-06
WP_001227859.1|3057096_3057564_-	helix-turn-helix domain-containing protein	NA	A0A0U2QW76	Escherichia_phage	66.9	1.0e-53
WP_001676916.1|3057836_3058166_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	51.7	6.5e-23
WP_001033796.1|3058327_3058882_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000556389.1|3058878_3059811_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000882662.1|3060180_3060393_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	95.7	2.5e-28
WP_000940751.1|3060916_3061516_+	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	82.9	5.5e-97
WP_000774470.1|3061515_3061806_+	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	76.0	5.1e-40
WP_000640113.1|3061802_3062339_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	70.9	1.4e-70
WP_000900605.1|3064509_3064905_+	tellurite resistance TerB family protein	NA	Q71TK7	Escherichia_phage	88.9	4.7e-44
WP_001688615.1|3064826_3065015_+	hypothetical protein	NA	Q8W636	Enterobacteria_phage	57.4	9.4e-11
WP_000445513.1|3065004_3065286_+|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	49.4	1.3e-16
WP_000802786.1|3065282_3065828_+	glycoside hydrolase family 108 protein	NA	A0A0U2S643	Escherichia_phage	83.4	2.3e-89
WP_000159240.1|3066673_3067012_+	EamA family transporter	NA	NA	NA	NA	NA
WP_001082296.1|3067061_3067496_-	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.1	9.4e-30
>prophage 234
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	3072608	3073598	4678113		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_000762206.1|3072608_3073598_-	D-lactate dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	42.5	1.2e-69
>prophage 235
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	3078390	3083804	4678113		Klosneuvirus(50.0%)	3	NA	NA
WP_001574290.1|3078390_3082293_+	ATP-dependent RNA helicase HrpA	NA	A0A1V0SIV3	Klosneuvirus	28.8	5.5e-52
WP_001098507.1|3082356_3083157_+	YdcF family protein	NA	NA	NA	NA	NA
WP_000527280.1|3083273_3083804_+	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	43.9	3.5e-18
>prophage 236
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	3087563	3088295	4678113		Planktothrix_phage(100.0%)	1	NA	NA
WP_001196340.1|3087563_3088295_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.2	3.4e-24
>prophage 237
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	3094835	3101925	4678113		Synechococcus_phage(33.33%)	5	NA	NA
WP_000842141.1|3094835_3095954_+	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	28.8	1.5e-31
WP_000528480.1|3096122_3097748_+	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	33.1	6.5e-07
WP_000414259.1|3097808_3098732_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000024100.1|3099024_3100368_+	VOC family protein	NA	NA	NA	NA	NA
WP_000933988.1|3100416_3101925_+	carboxylesterase/lipase family protein	NA	L7Y5U6	Megavirus	37.8	7.8e-31
>prophage 238
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	3108063	3110422	4678113		Chrysochromulina_ericina_virus(50.0%)	2	NA	NA
WP_000125686.1|3108063_3108831_-	SDR family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	27.2	5.4e-20
WP_000067286.1|3109168_3110422_+	D-galactonate dehydratase	NA	Q6A202	Oenococcus_phage	31.2	2.1e-45
>prophage 239
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	3122759	3124724	4678113		Phage_TP(100.0%)	1	NA	NA
WP_001249745.1|3122759_3124724_+	U32 family peptidase	NA	Q6DW11	Phage_TP	26.7	1.1e-21
>prophage 240
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	3142324	3144445	4678113		Salmonella_phage(100.0%)	1	NA	NA
WP_000692058.1|3142324_3144445_-	TonB-dependent receptor	NA	A0A1B0VCF0	Salmonella_phage	65.9	6.3e-135
>prophage 241
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	3152385	3153930	4678113		Escherichia_phage(100.0%)	1	NA	NA
WP_000702595.1|3152385_3153930_-	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	39.5	8.3e-20
>prophage 242
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	3162093	3163182	4678113		Enterobacteria_phage(100.0%)	1	NA	NA
WP_000769037.1|3162093_3163182_-	porin OmpD	NA	Q1MVN1	Enterobacteria_phage	75.1	4.0e-154
>prophage 243
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	3169548	3170559	4678113		Tupanvirus(100.0%)	1	NA	NA
WP_000642447.1|3169548_3170559_-	alcohol dehydrogenase AdhP	NA	A0A2K9L339	Tupanvirus	25.9	8.6e-26
>prophage 244
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	3206316	3207435	4678113		Enterobacteria_phage(100.0%)	1	NA	NA
WP_000758335.1|3206316_3207435_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	58.5	1.6e-113
>prophage 245
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	3216370	3216754	4678113		Streptococcus_phage(100.0%)	1	NA	NA
WP_000091194.1|3216370_3216754_+	MDR efflux pump AcrAB transcriptional activator MarA	NA	D0R0F8	Streptococcus_phage	32.3	4.7e-09
>prophage 246
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	3226058	3245340	4678113		Escherichia_phage(40.0%)	19	NA	NA
WP_000989267.1|3226058_3226262_+	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	2.9e-13
WP_001181268.1|3226328_3227795_-	mannitol dehydrogenase family protein	NA	G8DCZ3	Micromonas_pusilla_virus	30.0	7.3e-42
WP_000192118.1|3227938_3229318_-	MHS family MFS transporter	NA	Q6JIH2	Burkholderia_virus	25.8	5.7e-28
WP_000836486.1|3229371_3230391_-	Zn-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_000706266.1|3230401_3231616_-	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	28.7	2.0e-45
WP_000921389.1|3231737_3232064_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	52.9	2.2e-23
WP_001066440.1|3232215_3232557_+	DUF1283 family protein	NA	NA	NA	NA	NA
WP_000199997.1|3232592_3233153_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_000743121.1|3233193_3233904_-	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_000975516.1|3234007_3234316_+	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_001117613.1|3234472_3236911_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.7	1.6e-219
WP_000705278.1|3237009_3239445_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.2	3.9e-205
WP_000213062.1|3239455_3240073_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	1.6e-75
WP_000534697.1|3240074_3240932_+	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_001677205.1|3240974_3241589_+	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	37.8	1.1e-28
WP_000557304.1|3241893_3242604_+	osmoprotectant ABC transporter permease OsmY	NA	NA	NA	NA	NA
WP_001211193.1|3242632_3243535_+	osmoprotectant ABC transporter substrate-binding protein OsmX	NA	NA	NA	NA	NA
WP_000379673.1|3243544_3244192_+	osmoprotectant ABC transporter permease OsmW	NA	NA	NA	NA	NA
WP_000593089.1|3244191_3245340_+	osmoprotectant ABC transporter ATP-binding protein OsmV	NA	G9BWD6	Planktothrix_phage	33.9	2.2e-25
>prophage 247
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	3263054	3267477	4678113		Enterobacteria_phage(50.0%)	4	NA	NA
WP_000824320.1|3263054_3264206_+	porin OmpS2	NA	Q1MVN1	Enterobacteria_phage	58.8	2.1e-116
WP_076915553.1|3264358_3265885_+	amidohydrolase	NA	NA	NA	NA	NA
WP_077904888.1|3265939_3266065_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000732946.1|3266175_3267477_+	two-component system sensor histidine kinase RstB	NA	W8CYF6	Bacillus_phage	23.0	4.4e-14
>prophage 248
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	3289018	3290293	4678113	tRNA	Cronobacter_phage(100.0%)	1	NA	NA
WP_000168629.1|3289018_3290293_-|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	42.1	1.6e-85
>prophage 249
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	3297208	3297730	4678113		Salmonella_phage(100.0%)	1	NA	NA
WP_000826825.1|3297208_3297730_-	superoxide dismutase [Cu-Zn] SodC2	NA	Q9MC02	Salmonella_phage	59.8	8.9e-51
>prophage 250
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	3302805	3310229	4678113		Streptococcus_phage(20.0%)	8	NA	NA
WP_001081015.1|3302805_3303660_+	C40 family peptidase	NA	A0A1S5SEZ8	Streptococcus_phage	41.0	1.2e-15
WP_000007299.1|3303786_3304368_+	superoxide dismutase [Fe]	NA	Q56AR7	Bacillus_thuringiensis_phage	46.5	6.9e-44
WP_000102277.1|3304450_3304540_-	YnhF family membrane protein	NA	NA	NA	NA	NA
WP_000190993.1|3304835_3305861_+	HTH-type transcriptional repressor PurR	NA	C6ZCU4	Enterobacteria_phage	31.6	3.1e-31
WP_000269523.1|3305857_3306790_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001182316.1|3306902_3308108_+	Bcr/CflA family multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_000098879.1|3308397_3309546_+	cyclopropane fatty acyl phospholipid synthase	NA	A0A2K9L4K8	Tupanvirus	45.9	2.5e-85
WP_000493976.1|3309587_3310229_-	riboflavin synthase	NA	A0A2I2L4R9	Orpheovirus	38.3	8.8e-24
>prophage 251
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	3334121	3338460	4678113		Ectocarpus_siliculosus_virus(50.0%)	3	NA	NA
WP_001050774.1|3334121_3336884_+	two component system sensor kinase	NA	Q8QKV7	Ectocarpus_siliculosus_virus	27.2	7.9e-29
WP_000666335.1|3336914_3337553_+	two component system response regulator	NA	NA	NA	NA	NA
WP_000122311.1|3337731_3338460_+	MerR family transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	46.4	9.2e-46
>prophage 252
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	3356341	3359551	4678113		environmental_halophage(50.0%)	3	NA	NA
WP_000143859.1|3356341_3357562_-	cysteine desulfurase SufS	NA	Q2XUY6	environmental_halophage	40.8	1.7e-92
WP_000907942.1|3357558_3358830_-	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_000948904.1|3358804_3359551_-	Fe-S cluster assembly ATPase SufC	NA	A0A1V0SE00	Indivirus	24.2	2.5e-06
>prophage 253
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	3382064	3401693	4678113	tRNA	Tupanvirus(22.22%)	19	NA	NA
WP_000117499.1|3382064_3383705_+	medium-chain fatty-acid--CoA ligase	NA	A0A1V0SBX8	Catovirus	24.1	4.0e-20
WP_000069336.1|3383746_3386125_-	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	36.7	5.5e-172
WP_000370992.1|3386461_3387295_+	posphoenolpyruvate synthetase regulatory kinase/phosphorylase PpsR	NA	NA	NA	NA	NA
WP_001082196.1|3387450_3388497_+	3-deoxy-7-phosphoheptulonate synthase AroH	NA	S4W5F1	Pandoravirus	47.6	9.7e-81
WP_000089115.1|3388653_3388845_+	hemin uptake protein HemP	NA	NA	NA	NA	NA
WP_000175681.1|3388879_3390322_-	YdiU family protein	NA	NA	NA	NA	NA
WP_000562003.1|3390383_3391097_-	anti-FlhDC factor YdiV	NA	NA	NA	NA	NA
WP_001213256.1|3391410_3391875_-	lipoprotein	NA	A0A1V0DZX6	Clostridioides_phage	39.4	2.0e-14
WP_000080608.1|3391951_3392701_-	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	28.2	4.6e-08
WP_001181567.1|3392700_3393252_-	glutathione peroxidase	NA	NA	NA	NA	NA
WP_000954982.1|3393343_3394324_-	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
WP_001229266.1|3394526_3394826_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
WP_000672408.1|3394830_3397218_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_000018570.1|3397233_3398217_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	1.1e-33
WP_001386830.1|3398353_3398398_-|tRNA	phenylalanyl--tRNA ligase operon leader peptide	tRNA	NA	NA	NA	NA
WP_000124850.1|3398518_3398875_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_001124225.1|3398925_3399123_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_001574431.1|3399218_3399761_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.7	4.8e-15
WP_001144217.1|3399764_3401693_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.7	5.5e-130
>prophage 254
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	3414516	3416769	4678113		Tupanvirus(100.0%)	1	NA	NA
WP_000019109.1|3414516_3416769_+	catalase HPII	NA	A0A2K9L0T1	Tupanvirus	50.0	7.8e-144
>prophage 255
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	3422936	3423764	4678113		Bacillus_virus(100.0%)	1	NA	NA
WP_000174977.1|3422936_3423764_+	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	54.2	1.5e-71
>prophage 256
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	3430462	3431689	4678113		Klosneuvirus(100.0%)	1	NA	NA
WP_000059503.1|3430462_3431689_-	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	27.8	3.6e-26
>prophage 257
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	3435276	3437226	4678113		Streptococcus_phage(100.0%)	1	NA	NA
WP_001235873.1|3435276_3437226_-	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	28.7	2.4e-40
>prophage 258
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	3442111	3446236	4678113		Tupanvirus(50.0%)	4	NA	NA
WP_000184702.1|3442111_3442768_+	bifunctional nicotinamidase/pyrazinamidase	NA	A0A2K9L2K0	Tupanvirus	35.2	7.3e-18
WP_000389924.1|3442870_3444229_-	MFS transporter	NA	NA	NA	NA	NA
WP_000719104.1|3444364_3445123_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_000782139.1|3445252_3446236_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	22.4	9.7e-06
>prophage 259
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	3461538	3464958	4678113		Bacillus_phage(100.0%)	3	NA	NA
WP_000219715.1|3461538_3462825_+	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	36.3	1.3e-10
WP_016705258.1|3462969_3463170_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001708497.1|3463464_3464958_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	28.3	2.0e-10
>prophage 260
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	3485269	3485800	4678113		Escherichia_phage(100.0%)	1	NA	NA
WP_000929980.1|3485269_3485800_+	cytochrome b	NA	A0A0U2QLA7	Escherichia_phage	70.5	2.8e-36
>prophage 261
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	3490425	3493769	4678113		Enterobacterial_phage(50.0%)	5	NA	NA
WP_000789466.1|3490425_3490983_-	virulence membrane protein PagC	NA	Q9LA63	Enterobacterial_phage	32.5	2.2e-15
WP_001535993.1|3491794_3492058_+	virulence protein PagD	NA	NA	NA	NA	NA
WP_001537306.1|3492189_3492402_+	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_001532066.1|3492817_3493339_+	lipoprotein	NA	NA	NA	NA	NA
WP_000497451.1|3493529_3493769_+	virulence protein MsgA	NA	K7P6H1	Enterobacteria_phage	88.6	8.5e-33
>prophage 262
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	3497614	3498865	4678113		Phage_21(100.0%)	1	NA	NA
WP_000444508.1|3497614_3498865_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	1.1e-19
>prophage 263
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	3502392	3503763	4678113		Bodo_saltans_virus(100.0%)	1	NA	NA
WP_000423759.1|3502392_3503763_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	45.3	1.4e-108
>prophage 264
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	3510083	3512067	4678113		Bacillus_virus(50.0%)	2	NA	NA
WP_000531607.1|3510083_3511220_+	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	G3M9Y6	Bacillus_virus	34.0	2.1e-28
WP_000799391.1|3511203_3512067_+	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	26.2	2.0e-10
>prophage 265
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	3515653	3519379	4678113		Vibrio_phage(50.0%)	4	NA	NA
WP_001191856.1|3515653_3516475_-	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	33.5	1.0e-21
WP_000291330.1|3516493_3517405_-	N-acetylglucosamine kinase	NA	NA	NA	NA	NA
WP_000168092.1|3517433_3518678_-	lipoprotein-releasing ABC transporter permease subunit LolE	NA	NA	NA	NA	NA
WP_001033714.1|3518677_3519379_-	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	40.7	2.4e-35
>prophage 266
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	3525564	3525822	4678113		Erwinia_phage(100.0%)	1	NA	NA
WP_000800134.1|3525564_3525822_-	DUF1471 domain-containing protein	NA	A0A1B2IFR9	Erwinia_phage	37.1	2.1e-05
>prophage 267
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	3538983	3539625	4678113		Pseudomonas_phage(100.0%)	1	NA	NA
WP_000535396.1|3538983_3539625_-	dTMP kinase	NA	Q2Z0N0	Pseudomonas_phage	35.7	4.2e-26
>prophage 268
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	3542899	3544026	4678113		Ralstonia_phage(50.0%)	2	NA	NA
WP_000103754.1|3542899_3543136_-	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	45.2	1.5e-10
WP_000007236.1|3543291_3544026_-	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	33.5	1.7e-15
>prophage 269
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	3557834	3558785	4678113		Brevibacillus_phage(100.0%)	1	NA	NA
WP_000578682.1|3557834_3558785_-	flagellar assembly peptidoglycan hydrolase FlgJ	NA	S5M633	Brevibacillus_phage	31.8	2.8e-10
>prophage 270
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	3574796	3575042	4678113		Salmonella_phage(100.0%)	1	NA	NA
WP_001217763.1|3574796_3575042_+	DNA damage-inducible protein I	NA	H6WRY5	Salmonella_phage	52.6	4.1e-14
>prophage 271
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	3579701	3580622	4678113		Morganella_phage(100.0%)	1	NA	NA
WP_000163977.1|3579701_3580622_+	LpxL/LpxP family Kdo(2)-lipid IV(A) lauroyl/palmitoleoyl acyltransferasee	NA	A0A1W6JP29	Morganella_phage	40.5	1.1e-54
>prophage 272
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	3589685	3590225	4678113		Scale_drop_disease_virus(100.0%)	1	NA	NA
WP_000203944.1|3589685_3590225_-	O-acetyl-ADP-ribose deacetylase	NA	A0A0K1L687	Scale_drop_disease_virus	49.7	2.9e-28
>prophage 273
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	3594377	3595211	4678113		Pelagibacter_phage(100.0%)	1	NA	NA
WP_001137620.1|3594377_3595211_+	curli production assembly/transport protein CsgG	NA	M1ICK2	Pelagibacter_phage	40.5	3.3e-39
>prophage 274
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	3604352	3612509	4678113	integrase	Pseudomonas_phage(25.0%)	7	3603974:3603988	3610300:3610314
3603974:3603988	attL	AACATTAATTCCTCA	NA	NA	NA	NA
WP_001675175.1|3604352_3604643_+	DUF4102 domain-containing protein	NA	H2BDA3	Pseudomonas_phage	49.1	1.2e-07
WP_001676442.1|3605306_3606581_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	40.1	1.1e-73
WP_000042271.1|3606652_3606904_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001084817.1|3607382_3607880_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000072670.1|3608241_3608805_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000028416.1|3609215_3610097_+	toll/interleukin-1 receptor domain-containing protein	NA	A0A097BYB4	Enterococcus_phage	42.0	3.3e-29
WP_001127942.1|3610670_3612509_-	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	I1TR70	Cronobacter_phage	49.0	1.0e-32
3610300:3610314	attR	AACATTAATTCCTCA	NA	NA	NA	NA
>prophage 275
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	3624042	3624777	4678113		Cellulophaga_phage(100.0%)	1	NA	NA
WP_001095779.1|3624042_3624777_+	DNA-binding protein	NA	M1Q742	Cellulophaga_phage	39.3	2.2e-26
>prophage 276
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	3629987	3632299	4678113		Stenotrophomonas_phage(50.0%)	3	NA	NA
WP_000240779.1|3629987_3630206_-	AlpA family transcriptional regulator	NA	B7SYF9	Stenotrophomonas_phage	52.8	3.0e-08
WP_000166863.1|3630356_3631232_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001219023.1|3631774_3632299_+	peptidase	NA	G9L6C4	Escherichia_phage	77.7	1.3e-36
>prophage 277
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	3648564	3649380	4678113		Amsacta_moorei_entomopoxvirus(100.0%)	1	NA	NA
WP_000881542.1|3648564_3649380_-	energy-coupling factor ABC transporter ATP-binding protein	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	25.1	4.5e-09
>prophage 278
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	3662891	3663686	4678113		Only_Syngen_Nebraska_virus(100.0%)	1	NA	NA
WP_001000023.1|3662891_3663686_-	propanediol diffusion facilitator PduF	NA	A0A1J0F964	Only_Syngen_Nebraska_virus	27.2	1.2e-11
>prophage 279
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	3683387	3688314	4678113		Escherichia_phage(66.67%)	4	NA	NA
WP_000925044.1|3683387_3684560_-	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	88.2	2.1e-201
WP_001092553.1|3684683_3685448_-	thiosulfate reductase cytochrome B subunit	NA	NA	NA	NA	NA
WP_001016230.1|3685444_3686023_-	thiosulfate reductase electron transport protein PhsB	NA	A0A077SL61	Escherichia_phage	37.6	3.9e-23
WP_000028228.1|3686037_3688314_-	thiosulfate reductase PhsA	NA	A0A077SK27	Escherichia_phage	27.1	2.9e-37
>prophage 280
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	3697001	3697901	4678113		Cellulophaga_phage(100.0%)	1	NA	NA
WP_000886600.1|3697001_3697901_+	ATP phosphoribosyltransferase	NA	A0A0F7Q4B0	Cellulophaga_phage	100.0	1.7e-12
>prophage 281
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	3705342	3708152	4678113		Paramecium_bursaria_Chlorella_virus(50.0%)	2	NA	NA
WP_000704825.1|3705342_3706509_-	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	53.5	2.4e-112
WP_000043532.1|3706745_3708152_-	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.3	1.2e-36
>prophage 282
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	3711236	3712676	4678113		Hokovirus(100.0%)	1	NA	NA
WP_000009014.1|3711236_3712676_-	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	31.1	1.3e-54
>prophage 283
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	3717629	3730024	4678113		Enterobacteria_phage(33.33%)	12	NA	NA
WP_000770933.1|3717629_3718646_-	CDP-paratose 2-epimerase	NA	E3T4Y8	Cafeteria_roenbergensis_virus	27.1	2.1e-24
WP_000697758.1|3718642_3719482_-	CDP-paratose synthase	NA	NA	NA	NA	NA
WP_000126349.1|3719517_3720831_-	lipopolysaccharide biosynthesis protein RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
WP_000565913.1|3720857_3721937_-	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.5	1.7e-16
WP_000648783.1|3721941_3722715_-	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000018223.1|3722730_3723705_-	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
WP_000973709.1|3723710_3724262_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.0	1.3e-52
WP_000857535.1|3724262_3725141_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	65.5	2.1e-108
WP_001023658.1|3725188_3726088_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.0	5.1e-30
WP_000697846.1|3726087_3727173_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.6e-102
WP_000981469.1|3727549_3728443_-	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_001144948.1|3728620_3730024_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.5	4.0e-21
>prophage 284
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	3735581	3742287	4678113		Bacillus_phage(25.0%)	6	NA	NA
WP_000164198.1|3735581_3736952_-	phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	27.4	5.8e-33
WP_000605949.1|3737062_3738505_-	mannose-1-phosphate guanyltransferase	NA	A0A1V0SH58	Hokovirus	29.7	1.6e-49
WP_000699632.1|3738501_3739725_-	colanic acid biosynthesis fucosyltransferase WcaI	NA	NA	NA	NA	NA
WP_001574640.1|3739721_3740195_-	GDP-mannose mannosyl hydrolase	NA	NA	NA	NA	NA
WP_001041686.1|3740197_3741163_-	GDP-L-fucose synthase	NA	D1LW79	Prochlorococcus_phage	50.2	6.0e-85
WP_000048160.1|3741165_3742287_-	GDP-mannose 4,6-dehydratase	NA	M1HXY1	Acanthocystis_turfacea_Chlorella_virus	65.3	6.9e-133
>prophage 285
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	3747462	3756762	4678113		Streptococcus_phage(25.0%)	7	NA	NA
WP_000137220.1|3747462_3749622_-	tyrosine-protein kinase Wzc	NA	A0A1X9I5D6	Streptococcus_phage	30.8	5.4e-17
WP_000482226.1|3749618_3750068_-	low molecular weight protein-tyrosine-phosphatase Wzb	NA	NA	NA	NA	NA
WP_000978075.1|3750073_3751213_-	polysaccharide export protein	NA	NA	NA	NA	NA
WP_000454721.1|3751887_3753468_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	45.4	1.1e-38
WP_001252257.1|3753553_3755410_-	outer membrane assembly protein AsmA	NA	NA	NA	NA	NA
WP_001234783.1|3755448_3756030_-	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	43.2	9.3e-33
WP_000132082.1|3756120_3756762_-	uridine kinase	NA	A0A1V0SAA3	Catovirus	36.9	2.5e-34
>prophage 286
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	3767210	3773822	4678113		Bacillus_phage(66.67%)	4	NA	NA
WP_001210076.1|3767210_3770291_+	multidrug efflux RND transporter permease subunit MdtC	NA	S5VTK5	Leptospira_phage	23.1	6.0e-62
WP_000137818.1|3770287_3771700_+	MFS transporter	NA	NA	NA	NA	NA
WP_000870073.1|3771699_3773103_+	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	28.7	3.6e-30
WP_000137854.1|3773099_3773822_+	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.6	6.4e-31
>prophage 287
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	3778246	3779608	4678113	tRNA	Phage_TP(100.0%)	1	NA	NA
WP_001517981.1|3778246_3779608_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	95.4	2.3e-207
>prophage 288
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	3797220	3806391	4678113	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000195340.1|3797220_3799254_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	26.9	6.1e-55
WP_000703145.1|3799494_3799953_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	6.4e-53
WP_001197951.1|3800124_3800655_+	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000950414.1|3800711_3801179_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	89.7	4.3e-73
WP_000598637.1|3801225_3801945_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000272845.1|3801941_3803627_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	6.2e-279
WP_001240421.1|3803849_3804581_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.4	1.7e-100
WP_001261696.1|3804640_3804748_+	protein YohO	NA	NA	NA	NA	NA
WP_000824854.1|3804728_3805460_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000569168.1|3805443_3806391_-	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.8	2.8e-10
>prophage 289
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	3832446	3833967	4678113		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_000535913.1|3832446_3833967_-	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	31.9	1.0e-09
>prophage 290
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	3837926	3838595	4678113		Cellulophaga_phage(100.0%)	1	NA	NA
WP_001139611.1|3837926_3838595_-	GTP cyclohydrolase I FolE	NA	M1Q6X8	Cellulophaga_phage	56.3	4.1e-56
>prophage 291
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	3844034	3846026	4678113		Acinetobacter_phage(100.0%)	1	NA	NA
WP_000488245.1|3844034_3846026_-	catecholate siderophore receptor CirA	NA	A0A0P0I887	Acinetobacter_phage	37.9	6.7e-14
>prophage 292
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	3850142	3851000	4678113		Catovirus(100.0%)	1	NA	NA
WP_000873915.1|3850142_3851000_+	deoxyribonuclease IV	NA	A0A1V0SBL9	Catovirus	28.5	9.9e-23
>prophage 293
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	3861141	3861714	4678113		Clostridioides_phage(100.0%)	1	NA	NA
WP_000241015.1|3861141_3861714_+	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	A0A1V0DZX6	Clostridioides_phage	38.9	8.1e-13
>prophage 294
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	3867638	3881300	4678113		Vibrio_phage(40.0%)	11	NA	NA
WP_000203611.1|3867638_3869228_+	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	32.1	3.2e-19
WP_001094639.1|3869231_3869576_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000213396.1|3869966_3871157_-	Bcr/CflA family multidrug efflux MFS transporter	NA	S4TR35	Salmonella_phage	22.5	1.1e-19
WP_001234841.1|3871184_3871880_-	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
WP_000578115.1|3872031_3873792_+	DEAD/DEAH box helicase	NA	M4Q3N1	Vibrio_phage	41.6	3.2e-100
WP_000494192.1|3873916_3874201_+	50S ribosomal protein L25	NA	NA	NA	NA	NA
WP_000033431.1|3874308_3874929_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000050807.1|3874956_3875964_-	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	48.0	1.7e-82
WP_001135904.1|3876143_3876371_+	YejL family protein	NA	NA	NA	NA	NA
WP_000256145.1|3876402_3878163_+	cardiolipin transport protein PbgA	NA	NA	NA	NA	NA
WP_001676053.1|3878933_3881300_-	SPI-2 type III secretion system effector E3 ubiquitin transferase SspH2	NA	Q9MBL9	Phage_Gifsy-2	90.1	1.7e-72
>prophage 295
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	3891094	3891712	4678113		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_000888522.1|3891094_3891712_-	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	A0A2R8FG22	Brazilian_cedratvirus	29.8	3.1e-10
>prophage 296
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	3898785	3904601	4678113		Bacillus_phage(33.33%)	5	NA	NA
WP_000421577.1|3898785_3900429_-	multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	23.4	2.0e-11
WP_000884995.1|3900502_3901153_-	DNA oxidative demethylase AlkB	NA	NA	NA	NA	NA
WP_000975962.1|3901155_3902217_-	bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada	NA	A0A167R6J9	Powai_lake_megavirus	58.0	1.4e-18
WP_000784307.1|3902297_3903350_-	FAD:protein FMN transferase ApbE	NA	NA	NA	NA	NA
WP_000865521.1|3903464_3904601_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	58.6	1.5e-114
>prophage 297
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	3908767	3915980	4678113		Hokovirus(33.33%)	3	NA	NA
WP_000876084.1|3908767_3911614_-	two-component system sensor histidine kinase RcsC	NA	A0A1V0SGX0	Hokovirus	26.4	7.1e-41
WP_001281271.1|3911731_3914368_-	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	G3M9Z5	Bacillus_virus	30.7	4.3e-93
WP_000705590.1|3914777_3915980_-	mandelate racemase/muconate lactonizing enzyme family protein	NA	Q6A202	Oenococcus_phage	36.3	4.6e-58
>prophage 298
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	3919420	3926621	4678113		Pseudomonas_phage(50.0%)	6	NA	NA
WP_001076489.1|3919420_3921706_+	ribonucleoside-diphosphate reductase subunit alpha	NA	I3UMG3	Colwellia_phage	63.5	6.2e-282
WP_000332026.1|3921818_3922949_+	ribonucleoside-diphosphate reductase 1 subunit beta	NA	G9IAA3	Pseudomonas_phage	79.4	8.7e-176
WP_000533921.1|3922948_3923203_+	ferredoxin-like diferric-tyrosyl radical cofactor maintenance protein YfaE	NA	G9IAA2	Pseudomonas_phage	74.6	3.1e-25
WP_000660247.1|3923204_3924395_-	MFS transporter	NA	NA	NA	NA	NA
WP_000176719.1|3924556_3925435_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000858952.1|3925550_3926621_-	glycerophosphodiester phosphodiesterase	NA	A0A220BYK6	Staphylococcus_phage	46.0	5.1e-08
>prophage 299
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	3936211	3937417	4678113		Oenococcus_phage(100.0%)	1	NA	NA
WP_001530644.1|3936211_3937417_-	L-rhamnonate dehydratase	NA	Q6A202	Oenococcus_phage	28.3	3.5e-26
>prophage 300
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	3941064	3946073	4678113		Tupanvirus(50.0%)	4	NA	NA
WP_000879248.1|3941064_3941670_-	lipopolysaccharide core heptose(II)-phosphate phosphatase	NA	A0A2L1IV13	Escherichia_phage	43.8	1.9e-12
WP_001279291.1|3941968_3943108_+	UDP-4-amino-4-deoxy-L-arabinose aminotransferase	NA	A0A2K9L0G1	Tupanvirus	29.3	2.0e-31
WP_000458887.1|3943110_3944094_+	undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase	NA	A8CG95	Salmonella_phage	32.7	1.7e-34
WP_000648764.1|3944090_3946073_+	bifunctional UDP-4-amino-4-deoxy-L-arabinose formyltransferase/UDP-glucuronic acid oxidase ArnA	NA	A0A2K9KZK0	Tupanvirus	26.4	1.0e-22
>prophage 301
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	3958640	3959642	4678113		Bacillus_thuringiensis_phage(100.0%)	1	NA	NA
WP_000368558.1|3958640_3959642_+	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	25.9	1.4e-28
>prophage 302
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	3981310	3984596	4678113		Salmonella_phage(50.0%)	3	NA	NA
WP_000813882.1|3981310_3981910_+	5'-deoxynucleotidase	NA	A0A2L0V156	Salmonella_phage	38.6	7.0e-07
WP_001012856.1|3982015_3983842_-	SLC13 family permease	NA	NA	NA	NA	NA
WP_001555201.1|3983918_3984596_-	sugar phosphatase	NA	M1IMD4	Acanthocystis_turfacea_Chlorella_virus	33.3	9.3e-08
>prophage 303
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	3995404	3996424	4678113		Enterobacteria_phage(100.0%)	1	NA	NA
WP_000026949.1|3995404_3996424_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	27.7	3.2e-20
>prophage 304
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	4000152	4000926	4678113		Acanthocystis_turfacea_Chlorella_virus(100.0%)	1	NA	NA
WP_001293591.1|4000152_4000926_-	histidine ABC transporter ATP-binding protein HisP	NA	M1I0T9	Acanthocystis_turfacea_Chlorella_virus	29.1	1.7e-10
>prophage 305
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	4012357	4013875	4678113		Mollivirus(100.0%)	1	NA	NA
WP_000334205.1|4012357_4013875_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	44.0	6.3e-89
>prophage 306
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	4020376	4021513	4678113		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_000699176.1|4020376_4021513_-	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.1	3.8e-22
>prophage 307
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	4024516	4025302	4678113		Ralstonia_phage(50.0%)	2	NA	NA
WP_000433425.1|4024516_4024765_+	transcriptional regulator	NA	A0A0M4UV99	Ralstonia_phage	60.0	6.2e-18
WP_000118258.1|4024933_4025302_+	hypothetical protein	NA	H6SUH4	Campylobacter_virus	37.9	3.9e-08
>prophage 308
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	4032559	4033645	4678113		Pandoravirus(100.0%)	1	NA	NA
WP_000918457.1|4032559_4033645_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	47.8	9.1e-90
>prophage 309
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	4042825	4048878	4678113		Salmonella_virus(50.0%)	6	NA	NA
WP_000377779.1|4042825_4043767_+	membrane protein	NA	E7DYY8	Enterobacteria_phage	87.8	1.6e-146
WP_001576268.1|4045009_4045399_+	GtrA family protein	NA	A0A192Y6N5	Salmonella_phage	85.6	1.1e-50
WP_000703599.1|4045367_4045622_+	glycosyltransferase	NA	A8CG95	Salmonella_phage	79.5	3.1e-25
WP_000400616.1|4045639_4047562_+	acyltransferase	NA	A0A1R3Y5Q6	Salmonella_virus	77.3	5.6e-300
WP_105789228.1|4048551_4048695_-	hypothetical protein	NA	A0A1R3Y5S2	Salmonella_virus	82.9	1.7e-12
WP_105789229.1|4048710_4048878_-	hypothetical protein	NA	A0A1R3Y5S2	Salmonella_virus	63.5	1.3e-11
>prophage 310
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	4057568	4058489	4678113		Morganella_phage(100.0%)	1	NA	NA
WP_000484428.1|4057568_4058489_+	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	53.5	1.1e-75
>prophage 311
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	4079779	4089629	4678113		Lactobacillus_phage(25.0%)	9	NA	NA
WP_001109831.1|4079779_4080706_-	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	25.4	2.0e-08
WP_000765573.1|4080795_4081794_+	bile acid:sodium symporter	NA	NA	NA	NA	NA
WP_001519708.1|4081790_4082009_-	DUF3820 family protein	NA	NA	NA	NA	NA
WP_000433285.1|4082010_4084026_-	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	42.8	3.4e-146
WP_000983126.1|4084097_4085084_-	cell division protein ZipA	NA	NA	NA	NA	NA
WP_000255008.1|4085315_4086077_+	sulfate transporter CysZ	NA	NA	NA	NA	NA
WP_000036902.1|4086240_4087212_+	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	51.0	9.7e-75
WP_000487600.1|4087595_4087853_+	phosphocarrier protein Hpr	NA	NA	NA	NA	NA
WP_000623120.1|4087901_4089629_+	phosphoenolpyruvate-protein phosphotransferase PtsI	NA	A0A1V0SGR7	Hokovirus	31.1	7.4e-17
>prophage 312
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	4094955	4104507	4678113		Streptococcus_phage(20.0%)	11	NA	NA
WP_001093886.1|4094955_4095867_-	cysteine synthase B	NA	A0A1X9I5F1	Streptococcus_phage	41.8	1.7e-57
WP_000021063.1|4095934_4097032_-	sulfate/thiosulfate ABC transporter ATP-binding protein CysA	NA	G9BWD6	Planktothrix_phage	38.0	3.4e-28
WP_000852705.1|4097021_4097897_-	sulfate/thiosulfate ABC transporter permease CysW	NA	NA	NA	NA	NA
WP_000881744.1|4097896_4098730_-	sulfate/thiosulfate ABC transporter permease CysT	NA	NA	NA	NA	NA
WP_000290283.1|4098729_4099746_-	sulfate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000517460.1|4099903_4100695_-	SDR family oxidoreductase UcpA	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.6	1.5e-17
WP_000084583.1|4100932_4101832_-	porphyrinogen peroxidase	NA	S4VVJ7	Pandoravirus	33.3	3.8e-25
WP_000838971.1|4101926_4102502_-	RpoE-regulated lipoprotein	NA	NA	NA	NA	NA
WP_000842940.1|4102563_4103013_-	DUF2919 domain-containing protein	NA	NA	NA	NA	NA
WP_014344511.1|4102999_4103536_-	GNAT family acetyltransferase	NA	NA	NA	NA	NA
WP_000102880.1|4103637_4104507_+	N-acetylmuramoyl-L-alanine amidase AmiA	NA	A0A0N9SGH1	Paenibacillus_phage	31.9	2.8e-17
>prophage 313
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	4123965	4124916	4678113		Cyanophage(100.0%)	1	NA	NA
WP_001072447.1|4123965_4124916_+	transaldolase	NA	A0A127KNC6	Cyanophage	30.3	8.2e-10
>prophage 314
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	4143539	4144253	4678113		Synechococcus_phage(100.0%)	1	NA	NA
WP_001171630.1|4143539_4144253_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	M4R1E8	Synechococcus_phage	37.5	9.1e-38
>prophage 315
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	4147591	4148731	4678113		Streptococcus_phage(100.0%)	1	NA	NA
WP_000706370.1|4147591_4148731_-	glycerate kinase	NA	W6LM47	Streptococcus_phage	39.8	5.5e-45
>prophage 316
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	4154314	4159588	4678113		uncultured_Caudovirales_phage(25.0%)	6	NA	NA
WP_000132650.1|4154314_4154674_+	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	45.6	1.1e-18
WP_000100388.1|4154700_4155426_-	DnaA inactivator Hda	NA	NA	NA	NA	NA
WP_000198339.1|4155496_4156786_-	uracil permease	NA	Q9KX94	Enterobacteria_phage	36.6	6.6e-63
WP_000706208.1|4156873_4157500_-	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000130476.1|4157912_4158950_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SE90	Cyanophage	41.8	2.2e-69
WP_001028590.1|4158949_4159588_+	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	43.4	7.4e-31
>prophage 317
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	4166050	4166242	4678113		Escherichia_phage(100.0%)	1	NA	NA
WP_000075924.1|4166050_4166242_+	DUF2633 family protein	NA	G9L6F2	Escherichia_phage	84.1	6.4e-23
>prophage 318
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	4169441	4178678	4678113		Klosneuvirus(33.33%)	3	NA	NA
WP_000944174.1|4169441_4170908_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.7	4.0e-88
WP_000953167.1|4171068_4172418_+	exodeoxyribonuclease VII large subunit	NA	A0A2H4UVM9	Bodo_saltans_virus	35.6	4.4e-41
WP_071825578.1|4172579_4178678_-	fibronectin-binding autotransporter adhesin ShdA	NA	A0A2L1IV18	Escherichia_phage	25.8	3.5e-29
>prophage 319
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	4203082	4208262	4678113		Escherichia_phage(66.67%)	5	NA	NA
WP_000963846.1|4203082_4203514_-	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	37.1	1.1e-17
WP_000247780.1|4203634_4204498_-	4Fe-4S dicluster domain-containing protein	NA	NA	NA	NA	NA
WP_000544895.1|4204497_4205307_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000077435.1|4205299_4205929_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	55.9	3.6e-62
WP_071530728.1|4205925_4208262_-	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	38.4	5.4e-140
>prophage 320
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	4219129	4229205	4678113	tRNA	Mycoplasma_phage(16.67%)	12	NA	NA
WP_000133534.1|4219129_4220413_-	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	38.2	1.2e-35
WP_000523621.1|4220590_4220791_-	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_001124466.1|4220802_4221138_-	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_001196651.1|4221139_4222990_-	Fe-S protein assembly chaperone HscA	NA	A0A167RF67	Powai_lake_megavirus	39.1	2.7e-102
WP_000384398.1|4223002_4223518_-	co-chaperone HscB	NA	NA	NA	NA	NA
WP_000028952.1|4223713_4224037_-	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	48.6	4.1e-22
WP_000331704.1|4224065_4224452_-	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	78.9	2.4e-53
WP_000775263.1|4224479_4225694_-	IscS subfamily cysteine desulfurase	NA	A0A1X7C038	Faustovirus	32.6	1.2e-34
WP_001241346.1|4225874_4226369_-	Fe-S cluster assembly transcriptional regulator IscR	NA	NA	NA	NA	NA
WP_000940032.1|4226528_4227260_-|tRNA	tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ	tRNA	NA	NA	NA	NA
WP_000553472.1|4227378_4228182_+	inositol-1-monophosphatase	NA	NA	NA	NA	NA
WP_000174944.1|4228326_4229205_+	alpha/beta hydrolase	NA	A0A1C9C5K3	Heterosigma_akashiwo_virus	24.7	3.5e-15
>prophage 321
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	4236624	4237878	4678113		Aeromonas_phage(100.0%)	1	NA	NA
WP_000919178.1|4236624_4237878_-	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	53.0	1.3e-100
>prophage 322
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	4245093	4255085	4678113		Bacillus_phage(50.0%)	6	NA	NA
WP_000856793.1|4245093_4246554_+	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	28.8	1.7e-46
WP_000717694.1|4246602_4246941_-	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
WP_000625591.1|4247017_4248355_-	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	29.2	1.8e-10
WP_001054239.1|4248351_4249116_-	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
WP_001676035.1|4249117_4250548_-	two component system sensor histidine kinase QseE/GlrK	NA	W8CYF6	Bacillus_phage	26.1	1.5e-15
WP_000970028.1|4251197_4255085_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	57.6	8.0e-128
>prophage 323
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	4263669	4271515	4678113		Lactobacillus_phage(25.0%)	9	NA	NA
WP_001022463.1|4263669_4264596_+	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	24.4	3.0e-09
WP_001196291.1|4264633_4264894_+	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	53.5	4.9e-18
WP_000986043.1|4265005_4265386_-	holo-ACP synthase	NA	NA	NA	NA	NA
WP_000818972.1|4265385_4266117_-	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_000399381.1|4266128_4266857_-	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_000102230.1|4266868_4267774_-	GTPase Era	NA	NA	NA	NA	NA
WP_001068341.1|4267770_4268451_-	ribonuclease III	NA	A0A2K9L5P0	Tupanvirus	31.8	7.4e-21
WP_000002559.1|4268724_4269699_-	signal peptidase I	NA	NA	NA	NA	NA
WP_000790154.1|4269715_4271515_-	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	24.9	7.2e-23
>prophage 324
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	4276487	4382373	4678113	head,capsid,tail,portal,transposase,integrase,plate,terminase,tRNA,lysis	Salmonella_phage(75.0%)	93	4294861:4294875	4375341:4375355
WP_000083345.1|4276487_4277225_-|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
WP_000219174.1|4277354_4278689_+	ATP-dependent RNA helicase SrmB	NA	A0A1B1IS59	uncultured_Mediterranean_phage	29.7	1.6e-43
WP_001675040.1|4278706_4279606_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000188410.1|4279708_4280296_+	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_000627811.1|4280357_4280741_-	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	74.0	6.1e-33
WP_000179978.1|4281059_4281749_+	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	49.5	4.6e-55
WP_000997368.1|4281864_4282902_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001098733.1|4283105_4283525_+	thioredoxin TrxC	NA	A0A1J0GW78	Streptomyces_phage	39.0	5.9e-13
WP_000183642.1|4283597_4284278_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_000082648.1|4284331_4286992_+	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_000949286.1|4287106_4288462_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_001264473.1|4288506_4288830_+	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_000807815.1|4288826_4290128_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	30.6	1.8e-44
WP_000985655.1|4290231_4290687_-	DUF4385 domain-containing protein	NA	E3SMI8	Prochlorococcus_phage	49.3	3.9e-34
4294861:4294875	attL	TTTGAGTTCCCGGCC	NA	NA	NA	NA
WP_001235093.1|4296467_4299041_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.5	2.0e-127
WP_000992636.1|4299170_4299902_-	polyphenol oxidase	NA	NA	NA	NA	NA
WP_000079130.1|4299898_4300879_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_000197660.1|4301010_4301748_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_000178449.1|4302019_4302358_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_010989056.1|4302461_4302509_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000200077.1|4302608_4303769_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_000210984.1|4303729_4304638_-	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
WP_000225188.1|4304695_4305817_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_001168062.1|4305826_4306897_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.8	2.4e-90
WP_001212379.1|4307336_4307855_+	YfiR family protein	NA	NA	NA	NA	NA
WP_001030985.1|4307847_4309068_+	diguanylate cyclase DgcN	NA	A0A2K8I9Y5	Pseudomonas_phage	36.2	5.8e-08
WP_000065257.1|4309224_4309572_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_000469804.1|4309612_4310380_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000043266.1|4310424_4310973_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000256453.1|4310991_4311240_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000460052.1|4311492_4312854_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_001537507.1|4313019_4313811_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_127172650.1|4313830_4315117_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001287926.1|4315237_4315843_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001518875.1|4315877_4316468_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_001059151.1|4316591_4317470_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_000880965.1|4317555_4319217_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001203445.1|4319364_4319703_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_001112990.1|4319868_4320159_-	RnfH family protein	NA	NA	NA	NA	NA
WP_000242603.1|4320148_4320625_-	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_001518569.1|4320774_4321257_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	5.2e-29
WP_001708531.1|4321871_4333346_+	biofilm-associated protein BapA	NA	NA	NA	NA	NA
WP_000533863.1|4333410_4334820_+	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_000196151.1|4334816_4336997_+	type I secretion system permease/ATPase	NA	F2Y302	Organic_Lake_phycodnavirus	34.0	1.3e-18
WP_012543392.1|4337004_4338168_+	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_000980500.1|4338719_4338938_-	hypothetical protein	NA	E5G6Q4	Salmonella_phage	100.0	2.1e-38
WP_001102269.1|4339006_4340107_-	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	100.0	2.6e-201
WP_000980411.1|4340103_4340589_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	100.0	6.7e-77
WP_001677191.1|4340585_4343393_-|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	100.0	0.0e+00
WP_000763316.1|4343385_4343505_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	100.0	1.8e-15
WP_001280963.1|4343519_4343822_-|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	100.0	1.5e-45
WP_001207651.1|4343876_4344392_-|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	100.0	9.3e-93
WP_000046108.1|4344401_4345574_-|tail	phage tail sheath protein	tail	E5G6P7	Salmonella_phage	100.0	8.9e-224
WP_000974843.1|4345676_4345901_-	helix-turn-helix domain-containing protein	NA	E5G6P5	Salmonella_phage	100.0	1.5e-34
WP_000143187.1|4346770_4347346_-|tail	tail fiber assembly protein	tail	E5G6P1	Salmonella_phage	100.0	4.3e-107
WP_001274649.1|4347345_4349199_-|tail	phage tail protein	tail	E5G6P0	Salmonella_phage	100.0	0.0e+00
WP_001086804.1|4349195_4349801_-|tail	phage tail protein I	tail	E5G6N9	Salmonella_phage	100.0	1.3e-117
WP_000268332.1|4349793_4350702_-|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	100.0	5.4e-160
WP_000189373.1|4350688_4351048_-|plate	baseplate assembly protein	plate	E5G6N7	Salmonella_phage	100.0	1.1e-60
WP_001672413.1|4351044_4351623_-|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	100.0	1.4e-108
WP_000958562.1|4351700_4352552_+	hypothetical protein	NA	E5G6N5	Salmonella_phage	100.0	2.8e-163
WP_000343949.1|4352553_4353000_-	phage virion morphogenesis protein	NA	E5G6N4	Salmonella_phage	99.3	2.3e-71
WP_001039958.1|4352992_4353424_-|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	100.0	1.7e-76
WP_000196199.1|4353519_4353948_-|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	100.0	2.3e-68
WP_001069923.1|4353944_4354460_-	lysozyme	NA	E5G6N1	Salmonella_phage	100.0	5.3e-96
WP_000171565.1|4354440_4354656_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	100.0	5.9e-33
WP_000868184.1|4354659_4354863_-|tail	tail protein X	tail	E5G6M9	Salmonella_phage	100.0	3.8e-34
WP_000673537.1|4354862_4355327_-|head	head completion/stabilization protein	head	E5G6M8	Salmonella_phage	100.0	9.9e-86
WP_000059173.1|4355420_4356071_-|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	100.0	4.9e-115
WP_000730759.1|4356074_4357136_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	100.0	2.1e-195
WP_000216276.1|4357152_4357986_-|capsid	GPO family capsid scaffolding protein	capsid	E5G6M5	Salmonella_phage	100.0	3.1e-130
WP_001098395.1|4358128_4359895_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	97.1	0.0e+00
WP_001542203.1|4359894_4360935_+|portal	phage portal protein	portal	E5G6M3	Salmonella_phage	100.0	5.5e-201
WP_001284991.1|4361038_4362703_-	AIPR family protein	NA	E5G6M2	Salmonella_phage	100.0	0.0e+00
WP_001673609.1|4363016_4363694_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001217575.1|4363807_4364041_-	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
WP_001154433.1|4364051_4364240_-	hypothetical protein	NA	E5G6M0	Salmonella_phage	100.0	1.4e-27
WP_000017507.1|4364392_4366807_-	replication endonuclease	NA	E5G6L9	Salmonella_phage	100.0	0.0e+00
WP_000104187.1|4366803_4367661_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	100.0	6.8e-165
WP_000752613.1|4367657_4367885_-	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	100.0	2.7e-36
WP_001244219.1|4367884_4368118_-	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	100.0	1.7e-33
WP_000963474.1|4368185_4368527_-	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	100.0	1.2e-56
WP_000956190.1|4368490_4368691_-	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	100.0	2.4e-33
WP_000460848.1|4368698_4369208_-	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	100.0	1.5e-87
WP_000102105.1|4369241_4369484_-	Rha family transcriptional regulator	NA	A0A1S6KZZ6	Salmonella_phage	97.5	6.8e-38
WP_000932273.1|4369605_4370238_+	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	51.4	6.3e-59
WP_000218402.1|4370240_4371257_+|integrase	site-specific integrase	integrase	E5G6L0	Salmonella_phage	100.0	5.0e-199
WP_000360326.1|4371809_4372472_+	hypothetical protein	NA	E5G6K9	Salmonella_phage	100.0	3.4e-124
WP_001142974.1|4372733_4373327_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000445376.1|4373725_4374529_+	DUF3800 domain-containing protein	NA	Q19UP3	Mannheimia_phage	44.7	1.2e-62
WP_089113803.1|4375324_4376436_-|transposase	IS3-like element IS1351 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	25.6	7.6e-07
4375341:4375355	attR	TTTGAGTTCCCGGCC	NA	NA	NA	NA
WP_001221120.1|4377520_4378636_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_001111816.1|4378716_4382373_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.6	7.9e-45
>prophage 325
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	4402826	4406830	4678113		Klosneuvirus(50.0%)	4	NA	NA
WP_001095568.1|4402826_4404110_+	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	31.1	7.9e-32
WP_000531282.1|4404239_4405640_+	GABA permease	NA	NA	NA	NA	NA
WP_000126152.1|4405681_4406359_+	DNA-binding transcriptional regulator CsiR	NA	NA	NA	NA	NA
WP_000522406.1|4406380_4406830_-	peptidoglycan-binding protein LysM	NA	A0A090DBR9	Clostridium_phage	38.2	7.5e-06
>prophage 326
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	4413327	4416825	4678113		Bacillus_phage(33.33%)	3	NA	NA
WP_001275402.1|4413327_4413738_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	41.8	4.3e-16
WP_000246183.1|4413710_4415855_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	V9VI16	Lactococcus_phage	48.6	2.2e-196
WP_000777901.1|4415865_4416825_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A0M4S3B4	Mycobacterium_phage	71.8	1.8e-129
>prophage 327
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	4430218	4437591	4678113	tRNA	Acanthocystis_turfacea_Chlorella_virus(20.0%)	6	NA	NA
WP_000271292.1|4430218_4430785_-	fructose-1-phosphate/6-phosphogluconate phosphatase	NA	M1I5S4	Acanthocystis_turfacea_Chlorella_virus	28.1	5.5e-14
WP_000906486.1|4432044_4432230_-	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	4.9e-12
WP_000047242.1|4432464_4435095_-|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	38.1	1.0e-78
WP_001294863.1|4435330_4435831_-	recombination regulator RecX	NA	NA	NA	NA	NA
WP_000963150.1|4435947_4437009_-	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	63.8	3.0e-114
WP_000132239.1|4437093_4437591_-	nicotinamide-nucleotide amidase	NA	B5TK85	Pseudomonas_phage	51.6	4.4e-31
>prophage 328
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	4443498	4444464	4678113		Tetraselmis_virus(100.0%)	1	NA	NA
WP_001278208.1|4443498_4444464_+	arabinose-5-phosphate isomerase GutQ	NA	A0A2P0VNK5	Tetraselmis_virus	34.5	8.8e-36
>prophage 329
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	4468381	4469203	4678113		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_000083153.1|4468381_4469203_+	iron/manganese ABC transporter ATP-binding protein SitB	NA	A0A2R8FG22	Brazilian_cedratvirus	26.5	3.1e-13
>prophage 330
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	4502697	4504386	4678113		Vibrio_phage(100.0%)	1	NA	NA
WP_000848113.1|4502697_4504386_-	type III secretion system outer membrane ring protein InvG	NA	R9TEZ5	Vibrio_phage	27.8	3.9e-15
>prophage 331
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	4508245	4514045	4678113		Escherichia_phage(50.0%)	5	NA	NA
WP_000420452.1|4508245_4508902_+	Serine/threonine-protein phosphatase 2	NA	Q71TJ1	Escherichia_phage	47.9	7.8e-52
WP_000424949.1|4509146_4509641_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000445914.1|4509667_4510336_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001576333.1|4510909_4511320_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001005807.1|4511477_4514045_+	DNA mismatch repair protein MutS	NA	A0A1V0SC35	Catovirus	21.2	1.9e-29
>prophage 332
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	4520011	4530441	4678113		Escherichia_phage(50.0%)	12	NA	NA
WP_000209069.1|4520011_4520650_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.8e-85
WP_000912488.1|4520646_4521909_-	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.8	1.7e-132
WP_000206953.1|4521902_4522826_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	77.4	2.2e-116
WP_000613179.1|4523022_4523787_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	57.5	1.1e-70
WP_000423338.1|4523805_4524210_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001237181.1|4524380_4524974_+	UbiX family flavin prenyltransferase	NA	NA	NA	NA	NA
WP_000863168.1|4524973_4526401_+	UbiD family decarboxylase	NA	NA	NA	NA	NA
WP_000562964.1|4526411_4526648_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001708468.1|4526692_4527688_-	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	36.9	8.8e-31
WP_001272632.1|4527750_4528884_-	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	5.0e-06
WP_000253545.1|4529059_4529686_-	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.4	4.8e-35
WP_001221538.1|4529679_4530441_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.8	1.4e-57
>prophage 333
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	4533551	4535583	4678113		Tupanvirus(50.0%)	2	NA	NA
WP_001173663.1|4533551_4534157_-	adenylyl-sulfate kinase	NA	A0A2K9L4R9	Tupanvirus	39.6	1.3e-29
WP_001092251.1|4534143_4535583_-	sulfate adenylyltransferase subunit CysN	NA	A0A1V0SGC3	Hokovirus	26.5	2.7e-33
>prophage 334
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	4555538	4559364	4678113		Vibrio_phage(33.33%)	3	NA	NA
WP_001199961.1|4555538_4556210_-	7-carboxy-7-deazaguanine synthase QueE	NA	A0A2I7S8X1	Vibrio_phage	24.6	3.9e-14
WP_000036734.1|4556345_4557644_-	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	58.6	1.3e-130
WP_000210863.1|4557726_4559364_-	CTP synthase (glutamine hydrolyzing)	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	51.0	1.2e-154
>prophage 335
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	4570417	4575713	4678113		Erysipelothrix_phage(33.33%)	3	NA	NA
WP_000046849.1|4570417_4571713_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	28.0	1.4e-36
WP_000186394.1|4571770_4574527_+	two-component sensor histidine kinase BarA	NA	A0A1V0SGX0	Hokovirus	29.4	3.9e-52
WP_000706485.1|4574570_4575713_-	glycerate kinase	NA	W6LM47	Streptococcus_phage	40.6	2.6e-47
>prophage 336
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	4583132	4583981	4678113		Vibrio_phage(100.0%)	1	NA	NA
WP_000100463.1|4583132_4583981_+	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A2I7SAX1	Vibrio_phage	37.5	2.7e-41
>prophage 337
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	4588847	4589663	4678113		Bacillus_phage(100.0%)	1	NA	NA
WP_000881441.1|4588847_4589663_+	flap endonuclease Xni	NA	F8WQ40	Bacillus_phage	30.6	9.2e-10
>prophage 338
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	4601206	4617785	4678113	tRNA	environmental_halophage(16.67%)	10	NA	NA
WP_000991056.1|4601206_4602412_+	cysteine desulfurase CsdA	NA	Q2XUY6	environmental_halophage	36.0	7.3e-72
WP_000184194.1|4602411_4602855_+	cysteine desulfurase sulfur acceptor subunit CsdE	NA	NA	NA	NA	NA
WP_001752699.1|4603154_4604042_+	EamA family transporter RarD	NA	NA	NA	NA	NA
WP_000117748.1|4604093_4604900_-|tRNA	tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA	tRNA	S4VW33	Pandoravirus	32.8	6.5e-16
WP_000678626.1|4605009_4606107_-	murein transglycosylase A	NA	NA	NA	NA	NA
WP_000011919.1|4606606_4607860_-	N-acetylmuramoyl-L-alanine amidase	NA	E5DV68	Deep-sea_thermophilic_phage	28.9	1.9e-14
WP_000588964.1|4608092_4609424_+	amino-acid N-acetyltransferase	NA	NA	NA	NA	NA
WP_000155128.1|4609526_4611362_-	exodeoxyribonuclease V subunit alpha	NA	A0A2P0VMS9	Tetraselmis_virus	25.2	3.2e-18
WP_001000558.1|4611358_4614904_-	exodeoxyribonuclease V subunit beta	NA	A7KV33	Bacillus_phage	21.6	1.4e-09
WP_001138256.1|4614896_4617785_-	pitrilysin	NA	A0A1V0SJA4	Klosneuvirus	23.8	1.3e-61
>prophage 339
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	4623267	4630222	4678113		Cronobacter_phage(33.33%)	6	NA	NA
WP_000816247.1|4623267_4624062_-	thymidylate synthase	NA	R4IFY1	Cronobacter_phage	63.2	2.6e-118
WP_000204645.1|4624068_4624944_-	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_000957881.1|4625159_4627406_-	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	25.1	1.3e-10
WP_000564481.1|4627418_4627949_-	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_001274930.1|4628631_4629327_+	DNA mismatch repair endonuclease MutH	NA	NA	NA	NA	NA
WP_000895635.1|4629508_4630222_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	47.3	6.9e-46
>prophage 340
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	4641052	4643586	4678113		Aichi_virus(50.0%)	2	NA	NA
WP_000253650.1|4641052_4642471_-	sugar porter family MFS transporter	NA	O13311	Aichi_virus	26.7	3.5e-25
WP_000602485.1|4642824_4643586_-	2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.1	2.9e-18
>prophage 341
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	4658320	4658857	4678113		Enterobacteria_phage(100.0%)	1	NA	NA
WP_001038502.1|4658320_4658857_-	porin family protein	NA	A5LH44	Enterobacteria_phage	30.7	5.6e-16
>prophage 342
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	4662120	4669867	4678113	tRNA	Clostridium_phage(20.0%)	7	NA	NA
WP_000244328.1|4662120_4662879_-	peptidoglycan DD-metalloendopeptidase family protein	NA	I2E8W3	Clostridium_phage	39.5	1.2e-11
WP_000133994.1|4663143_4663689_+	isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_000003339.1|4663764_4665282_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	37.1	4.8e-89
WP_096059418.1|4665291_4666390_-	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	39.0	1.8e-05
WP_000813389.1|4666494_4668228_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	29.4	1.4e-63
WP_000745614.1|4668233_4668947_-	bifunctional protein-disulfide isomerase/oxidoreductase DsbC	NA	NA	NA	NA	NA
WP_000434302.1|4668970_4669867_-	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	28.9	1.4e-30
>prophage 343
NZ_CP018635	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991, complete genome	4678113	4673851	4675285	4678113		Pandoravirus(100.0%)	1	NA	NA
WP_001230141.1|4673851_4675285_+	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	26.2	8.8e-32
>prophage 1
NZ_CP018636	Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991 plasmid pSE56-3991, complete sequence	59373	28373	35281	59373	transposase	Escherichia_phage(33.33%)	8	NA	NA
WP_000925628.1|28373_28796_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	52.4	2.0e-29
WP_000457542.1|28795_30070_+	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	64.5	3.9e-156
WP_077681951.1|30151_31129_-	ParB/RepB/Spo0J family partition protein	NA	A0A1B0V750	Salmonella_phage	53.5	6.7e-84
WP_000427676.1|31125_32331_-	ParA family protein	NA	A0A077SL49	Escherichia_phage	69.3	1.5e-162
WP_000728919.1|32745_33687_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	54.7	4.7e-74
WP_000176303.1|33683_34289_-	DUF2913 family protein	NA	NA	NA	NA	NA
WP_001527010.1|34345_34681_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001541564.1|34864_35281_-	hypothetical protein	NA	O64348	Escherichia_phage	42.9	8.2e-07
