The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP020992	Xanthomonas citri pv. phaseoli var. fuscans strain CFBP4885 chromosome, complete genome	5012288	524490	534866	5012288		Enterobacteria_phage(42.86%)	9	NA	NA
WP_005913435.1|524490_525447_-	glycosyltransferase family 2 protein	NA	A0A192Y8W7	Salmonella_phage	27.1	1.8e-25
WP_022559978.1|526326_527271_-	electron transfer flavoprotein subunit alpha/FixB family protein	NA	NA	NA	NA	NA
WP_022559977.1|527270_528017_-	electron transfer flavoprotein subunit beta/FixA family protein	NA	NA	NA	NA	NA
WP_005913448.1|528236_529292_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	47.1	1.4e-82
WP_022559976.1|529343_530231_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	57.5	1.5e-93
WP_016851441.1|530227_530785_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	48.9	6.6e-44
WP_007962671.1|530781_531681_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.2	4.1e-27
WP_022559975.1|532021_533188_+	nucleotide sugar dehydrogenase	NA	M1HZB2	Paramecium_bursaria_Chlorella_virus	58.6	2.5e-117
WP_022559974.1|533462_534866_-	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	30.0	1.1e-47
>prophage 2
NZ_CP020992	Xanthomonas citri pv. phaseoli var. fuscans strain CFBP4885 chromosome, complete genome	5012288	835174	907690	5012288	tRNA,transposase	uncultured_virus(42.86%)	51	NA	NA
WP_022559824.1|835174_835933_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_003484215.1|836077_836485_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_022559823.1|836741_838226_-	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_080720623.1|838283_838541_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022559822.1|838607_839303_+	YafY family transcriptional regulator	NA	NA	NA	NA	NA
WP_007967459.1|839361_840018_+	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_007967457.1|840246_840654_+	RNA-binding S4 domain-containing protein	NA	NA	NA	NA	NA
WP_022559821.1|840777_843024_-	catalase/peroxidase HPI	NA	NA	NA	NA	NA
WP_007967453.1|843486_844101_-	DUF937 domain-containing protein	NA	NA	NA	NA	NA
WP_033480935.1|844378_847000_-	DNA mismatch repair protein MutS	NA	A0A1V0SGG8	Hokovirus	22.7	7.5e-29
WP_011345585.1|847749_848976_+|transposase	IS256-like element ISXax1 family transposase	transposase	A0A218MNI5	uncultured_virus	50.3	2.2e-52
WP_080720965.1|849341_850409_-	DUF3883 domain-containing protein	NA	NA	NA	NA	NA
WP_033481769.1|850761_851121_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022559818.1|851417_852167_-	abortive infection family protein	NA	NA	NA	NA	NA
WP_033481766.1|852300_857913_+	DUF3320 domain-containing protein	NA	NA	NA	NA	NA
WP_022559816.1|858116_858854_-	DNA/RNA non-specific endonuclease	NA	NA	NA	NA	NA
WP_033481768.1|859546_862360_+	RHS repeat protein	NA	NA	NA	NA	NA
WP_011345585.1|862666_863893_+|transposase	IS256-like element ISXax1 family transposase	transposase	A0A218MNI5	uncultured_virus	50.3	2.2e-52
WP_022559814.1|864174_864636_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022559813.1|865129_865873_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157838201.1|866377_866713_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022559811.1|867036_867516_+	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_022559810.1|867586_867778_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101853664.1|868150_868567_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022559808.1|868559_869972_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022559807.1|870050_871328_+	abortive infection family protein	NA	NA	NA	NA	NA
WP_131701856.1|871328_871925_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048481474.1|871934_872465_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022559805.1|872979_873741_+	HEPN domain-containing protein	NA	NA	NA	NA	NA
WP_022559804.1|874234_875212_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022559803.1|875257_875602_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_022559802.1|875784_876111_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022559801.1|876369_877968_+	MobA/MobL family protein	NA	NA	NA	NA	NA
WP_022559800.1|878012_878375_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007975311.1|883623_884604_+|transposase	IS5-like element ISXfu2 family transposase	transposase	A0A077K814	Ralstonia_phage	59.5	1.1e-97
WP_011345585.1|885498_886725_-|transposase	IS256-like element ISXax1 family transposase	transposase	A0A218MNI5	uncultured_virus	50.3	2.2e-52
WP_033481713.1|886831_887098_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_022559798.1|887637_889566_+	alpha-L-fucosidase	NA	NA	NA	NA	NA
WP_033481711.1|889733_890087_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022559797.1|890324_892889_-	glycoside hydrolase family 2 protein	NA	L0N6M2	Herpes_simplex_virus	27.3	1.1e-29
WP_022559796.1|892885_894097_-	arabinogalactan endo-1,4-beta-galactosidase	NA	NA	NA	NA	NA
WP_022559795.1|894286_896980_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_033481709.1|897499_898885_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_022559793.1|899022_900528_+	CoA-acylating methylmalonate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_022559792.1|900538_901720_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_022559791.1|901716_902514_+	enoyl-CoA hydratase	NA	NA	NA	NA	NA
WP_022559790.1|902513_903701_+	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_022559789.1|903871_904759_+	3-hydroxyisobutyrate dehydrogenase	NA	NA	NA	NA	NA
WP_022559788.1|904978_905944_+	cation transporter	NA	NA	NA	NA	NA
WP_022559787.1|906084_906288_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007975311.1|906709_907690_-|transposase	IS5-like element ISXfu2 family transposase	transposase	A0A077K814	Ralstonia_phage	59.5	1.1e-97
>prophage 3
NZ_CP020992	Xanthomonas citri pv. phaseoli var. fuscans strain CFBP4885 chromosome, complete genome	5012288	1362880	1373648	5012288	tRNA	Micromonas_pusilla_virus(16.67%)	7	NA	NA
WP_022559539.1|1362880_1364557_+	2-polyprenylphenol 6-hydroxylase	NA	G8DDN0	Micromonas_pusilla_virus	29.7	1.1e-41
WP_007966767.1|1364644_1365286_+	transcriptional repressor LexA	NA	A0A1W6JNS2	Morganella_phage	40.2	2.4e-13
WP_003481871.1|1365458_1366493_+	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	61.3	5.1e-114
WP_007966764.1|1366790_1367279_+	recombination regulator RecX	NA	NA	NA	NA	NA
WP_022559538.1|1367380_1370029_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	40.0	1.7e-84
WP_003481884.1|1370168_1370381_+	carbon storage regulator CsrA	NA	J7I430	Pseudomonas_phage	76.5	1.3e-13
WP_033481262.1|1371689_1373648_+	PAS domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	42.0	1.6e-12
>prophage 4
NZ_CP020992	Xanthomonas citri pv. phaseoli var. fuscans strain CFBP4885 chromosome, complete genome	5012288	1519220	1575181	5012288	tRNA,integrase,transposase	Ralstonia_phage(26.67%)	49	1566452:1566505	1575972:1576025
WP_011345585.1|1519220_1520447_-|transposase	IS256-like element ISXax1 family transposase	transposase	A0A218MNI5	uncultured_virus	50.3	2.2e-52
WP_022559471.1|1521193_1522927_-	glycosidase	NA	NA	NA	NA	NA
WP_022559470.1|1523170_1525357_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022559469.1|1525353_1526832_+	MFS transporter	NA	NA	NA	NA	NA
WP_080720900.1|1526726_1528505_+	cyclomaltodextrin glucanotransferase	NA	NA	NA	NA	NA
WP_022559467.1|1528588_1529719_-	LacI family transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	26.7	2.2e-14
WP_033481495.1|1530031_1531936_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	36.3	3.6e-126
WP_077708941.1|1531984_1532527_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	35.2	1.5e-13
WP_002811096.1|1532773_1532971_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_003484828.1|1532981_1533341_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_007974727.1|1533591_1534587_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	35.6	3.0e-31
WP_022559465.1|1534701_1537080_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_002811076.1|1537101_1537401_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	38.9	4.7e-12
WP_005995911.1|1537381_1537738_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011051691.1|1538403_1539045_+	polysaccharide export protein	NA	NA	NA	NA	NA
WP_087945331.1|1539026_1540466_+	GumC family protein	NA	NA	NA	NA	NA
WP_022559463.1|1540708_1542172_+	undecaprenyl-phosphate glucose phosphotransferase	NA	NA	NA	NA	NA
WP_007965996.1|1542254_1543556_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022559462.1|1543552_1544644_+	acyltransferase family protein	NA	NA	NA	NA	NA
WP_099770784.1|1544687_1545746_+	acyltransferase family protein	NA	NA	NA	NA	NA
WP_005920309.1|1545813_1546956_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_022559460.1|1546952_1548002_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_033481496.1|1548019_1549510_+	lipopolysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_022559458.1|1549573_1550770_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_007965984.1|1550807_1551602_+	polysaccharide pyruvyl transferase family protein	NA	A0A1V0SAR6	Catovirus	36.5	7.0e-23
WP_080720901.1|1551609_1552401_+	WecB/TagA/CpsF family glycosyltransferase	NA	NA	NA	NA	NA
WP_007965982.1|1552435_1552897_+	cupin domain-containing protein	NA	A0A291AU44	Pandoravirus	41.5	1.8e-18
WP_033481497.1|1554204_1555203_+	3-oxoacyl-ACP synthase	NA	NA	NA	NA	NA
WP_022559455.1|1555202_1556051_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_022559454.1|1556047_1557007_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_022559453.1|1556997_1558152_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_007974702.1|1558129_1558741_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022559451.1|1558730_1559987_+	glycosyl transferase	NA	NA	NA	NA	NA
WP_033481506.1|1560022_1561939_-	1-deoxy-D-xylulose-5-phosphate synthase	NA	NA	NA	NA	NA
WP_022559449.1|1562372_1563029_-	HNH endonuclease	NA	F5B475	Synechococcus_phage	40.2	3.0e-11
WP_007965969.1|1563281_1565075_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_007974695.1|1565113_1565590_-	LEA type 2 family protein	NA	NA	NA	NA	NA
WP_007965965.1|1565701_1566238_-	lipocalin family protein	NA	A0A2I2L3Z7	Orpheovirus	33.1	9.0e-14
1566452:1566505	attL	TTGAAAATCCCCGTGTCGGCGGTTCGATTCCGTCCTCGGCCACCATATCCAAGC	NA	NA	NA	NA
WP_022559448.1|1566506_1567157_-|integrase	site-specific integrase	integrase	K4PAZ9	Burkholderia_phage	52.0	6.1e-41
WP_022559447.1|1567164_1567353_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007975311.1|1567584_1568565_-|transposase	IS5-like element ISXfu2 family transposase	transposase	A0A077K814	Ralstonia_phage	59.5	1.1e-97
WP_022559446.1|1569211_1569622_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022557821.1|1569873_1570857_-|transposase	IS5-like element ISXfu1 family transposase	transposase	A0A077K814	Ralstonia_phage	59.9	8.2e-98
WP_131701847.1|1570935_1571130_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022557821.1|1571262_1572246_-|transposase	IS5-like element ISXfu1 family transposase	transposase	A0A077K814	Ralstonia_phage	59.9	8.2e-98
WP_127459505.1|1572409_1572943_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022559445.1|1572911_1573091_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022559443.1|1573507_1574065_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007975311.1|1574200_1575181_+|transposase	IS5-like element ISXfu2 family transposase	transposase	A0A077K814	Ralstonia_phage	59.5	1.1e-97
1575972:1576025	attR	TTGAAAATCCCCGTGTCGGCGGTTCGATTCCGTCCTCGGCCACCATATCCAAGC	NA	NA	NA	NA
>prophage 5
NZ_CP020992	Xanthomonas citri pv. phaseoli var. fuscans strain CFBP4885 chromosome, complete genome	5012288	1604028	1702044	5012288	tRNA,transposase	Ralstonia_phage(33.33%)	55	NA	NA
WP_007975311.1|1604028_1605009_-|transposase	IS5-like element ISXfu2 family transposase	transposase	A0A077K814	Ralstonia_phage	59.5	1.1e-97
WP_022559423.1|1606278_1607850_-	S8/S53 family peptidase	NA	A0A1V0SLL0	Klosneuvirus	38.7	8.1e-71
WP_022559422.1|1608314_1610672_+	hypothetical protein	NA	NA	NA	NA	NA
WP_123766567.1|1610685_1610886_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033481662.1|1611143_1613960_+	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	26.2	5.0e-47
WP_022559420.1|1614358_1618717_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022559419.1|1618713_1620300_+	family 43 glycosylhydrolase	NA	NA	NA	NA	NA
WP_096035582.1|1620615_1622961_+	S9 family peptidase	NA	NA	NA	NA	NA
WP_022559416.1|1626496_1628872_+	glycoside hydrolase family 127 protein	NA	NA	NA	NA	NA
WP_022559415.1|1629068_1629473_-	type I toxin-antitoxin system SymE family toxin	NA	NA	NA	NA	NA
WP_123766566.1|1631631_1632138_-	hypothetical protein	NA	NA	NA	NA	NA
WP_131701599.1|1632134_1632389_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007975311.1|1632567_1633548_+|transposase	IS5-like element ISXfu2 family transposase	transposase	A0A077K814	Ralstonia_phage	59.5	1.1e-97
WP_022559410.1|1638038_1639943_-	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	36.7	4.6e-113
WP_007970851.1|1640182_1640806_+	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
WP_005917071.1|1640802_1641309_+	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	41.1	6.2e-25
WP_003489798.1|1641367_1641853_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003489796.1|1642085_1642370_+	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	57.0	1.1e-18
WP_022559409.1|1642366_1644145_+	gamma-glutamyltransferase	NA	NA	NA	NA	NA
WP_022559408.1|1644434_1646195_+	cellulase precursor	NA	NA	NA	NA	NA
WP_005931906.1|1646496_1647129_-	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_080720939.1|1647322_1649839_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_096035810.1|1649838_1650957_+	phytase	NA	NA	NA	NA	NA
WP_022559405.1|1650953_1652333_+	metallophosphoesterase family protein	NA	NA	NA	NA	NA
WP_022559404.1|1652706_1653414_+	glycosyl transferase	NA	NA	NA	NA	NA
WP_022559403.1|1653765_1655262_-	aminotransferase class III-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_022559402.1|1655384_1655816_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_022559401.1|1655971_1657042_+|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_022559400.1|1657123_1658269_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	45.6	1.4e-85
WP_003489768.1|1658400_1658754_+	preprotein translocase subunit YajC	NA	NA	NA	NA	NA
WP_080720938.1|1658920_1660789_+	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_003489762.1|1660848_1661817_+	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	29.5	2.0e-27
WP_022559396.1|1663243_1663801_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007975311.1|1664534_1665515_-|transposase	IS5-like element ISXfu2 family transposase	transposase	A0A077K814	Ralstonia_phage	59.5	1.1e-97
WP_007975311.1|1665884_1666865_+|transposase	IS5-like element ISXfu2 family transposase	transposase	A0A077K814	Ralstonia_phage	59.5	1.1e-97
WP_145958732.1|1667029_1667290_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022559393.1|1667763_1668405_+	DUF1629 domain-containing protein	NA	NA	NA	NA	NA
WP_011345585.1|1668968_1670195_-|transposase	IS256-like element ISXax1 family transposase	transposase	A0A218MNI5	uncultured_virus	50.3	2.2e-52
WP_022559391.1|1675390_1676041_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046833752.1|1676276_1677413_-	carbohydrate porin	NA	NA	NA	NA	NA
WP_022559389.1|1677726_1679448_-	PTS fructose transporter subunit IIB'BC	NA	NA	NA	NA	NA
WP_022559388.1|1679600_1680557_-	1-phosphofructokinase	NA	NA	NA	NA	NA
WP_022559387.1|1680553_1683070_-	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	29.3	1.5e-10
WP_022559386.1|1683231_1684227_+	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_007969992.1|1684564_1687735_-	multidrug efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_022559385.1|1687747_1689052_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_007962520.1|1689066_1689726_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_033481697.1|1690004_1695014_+	glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_033481698.1|1695515_1695812_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022559381.1|1696081_1697083_-	NADP-dependent oxidoreductase	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	27.0	1.3e-05
WP_022559380.1|1697307_1698096_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_022559379.1|1698144_1699227_-	alkene reductase	NA	NA	NA	NA	NA
WP_022559378.1|1699358_1699934_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_022559377.1|1700074_1700929_+	oxidoreductase	NA	NA	NA	NA	NA
WP_007975311.1|1701063_1702044_+|transposase	IS5-like element ISXfu2 family transposase	transposase	A0A077K814	Ralstonia_phage	59.5	1.1e-97
>prophage 6
NZ_CP020992	Xanthomonas citri pv. phaseoli var. fuscans strain CFBP4885 chromosome, complete genome	5012288	1985293	1996088	5012288	coat,transposase	Xanthomonas_phage(41.67%)	16	NA	NA
WP_011345585.1|1985293_1986520_-|transposase	IS256-like element ISXax1 family transposase	transposase	A0A218MNI5	uncultured_virus	50.3	2.2e-52
WP_022559212.1|1987244_1988471_+|transposase	IS256-like element ISXax1 family transposase	transposase	A0A218MNI5	uncultured_virus	50.3	2.2e-52
WP_022559210.1|1988805_1989201_-	filamentous phage Phi Lf replication initiation protein II	NA	A0A077JCZ5	Xanthomonas_phage	76.2	4.5e-47
WP_022559209.1|1989328_1989553_+	hypothetical protein	NA	A0A1D6ZIV2	Xanthomonas_phage	78.5	2.1e-17
WP_022559208.1|1989549_1989732_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022559207.1|1989724_1990834_+	phage-related protein	NA	S0F3I3	Stenotrophomonas_phage	75.0	1.0e-160
WP_022559206.1|1990830_1991127_+	DNA-binding protein	NA	B1NI78	Stenotrophomonas_phage	66.3	1.9e-26
WP_080720657.1|1991158_1991320_+|coat	coat protein	coat	NA	NA	NA	NA
WP_005918133.1|1991265_1991382_+|coat	Phi-Lf prophage-derived minor coat protein	coat	NA	NA	NA	NA
WP_005918131.1|1991413_1991542_+|coat	Phi-Lf prophage-derived major coat protein	coat	NA	NA	NA	NA
WP_080720658.1|1991638_1992712_+	attachment protein	NA	Q9XJ91	Xanthomonas_phage	66.6	5.2e-45
WP_022559204.1|1992722_1993043_+	hypothetical protein	NA	Q4LAU3	Stenotrophomonas_phage	44.2	3.5e-21
WP_022559203.1|1993044_1994367_+	filamentous phage protein I	NA	Q4LAU4	Stenotrophomonas_phage	56.5	1.2e-131
WP_022559202.1|1994386_1994698_-	hypothetical protein	NA	A0A1W6DXV7	Xanthomonas_phage	92.2	1.0e-49
WP_033481018.1|1994764_1995103_-	phage-like protein	NA	Q38057	Xanthomonas_phage	74.1	8.3e-42
WP_022559200.1|1995284_1996088_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	25.6	2.0e-09
>prophage 7
NZ_CP020992	Xanthomonas citri pv. phaseoli var. fuscans strain CFBP4885 chromosome, complete genome	5012288	2306437	2390187	5012288	tRNA,transposase	uncultured_virus(27.27%)	53	NA	NA
WP_022559048.1|2306437_2307850_-|tRNA	histidine--tRNA ligase	tRNA	A0A2K9L6G5	Tupanvirus	28.4	4.6e-41
WP_022559047.1|2307957_2308719_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_022559046.1|2308804_2309548_-	murein L,D-transpeptidase catalytic domain family protein	NA	NA	NA	NA	NA
WP_022559045.1|2309648_2310953_-	threonine synthase	NA	NA	NA	NA	NA
WP_022559044.1|2311114_2311429_+	EthD family reductase	NA	NA	NA	NA	NA
WP_046121197.1|2311503_2312478_-	homoserine kinase	NA	NA	NA	NA	NA
WP_022559042.1|2312519_2315027_-	bifunctional aspartate kinase/homoserine dehydrogenase I	NA	NA	NA	NA	NA
WP_157768139.1|2315120_2315270_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022559040.1|2315713_2316214_-	tryptophan-rich sensory protein	NA	NA	NA	NA	NA
WP_011345585.1|2316985_2318212_+|transposase	IS256-like element ISXax1 family transposase	transposase	A0A218MNI5	uncultured_virus	50.3	2.2e-52
WP_022559038.1|2319201_2320185_-|transposase	IS5-like element ISXfu1 family transposase	transposase	A0A077K814	Ralstonia_phage	59.6	2.4e-97
WP_080720978.1|2320224_2320413_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022559037.1|2324804_2325155_+	type I toxin-antitoxin system SymE family toxin	NA	NA	NA	NA	NA
WP_123766554.1|2325523_2325910_-	hypothetical protein	NA	NA	NA	NA	NA
WP_123766553.1|2326086_2326494_-	hypothetical protein	NA	NA	NA	NA	NA
WP_131701857.1|2326490_2327099_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007975311.1|2327101_2328082_+|transposase	IS5-like element ISXfu2 family transposase	transposase	A0A077K814	Ralstonia_phage	59.5	1.1e-97
WP_145958483.1|2328185_2328470_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022557821.1|2328491_2329475_+|transposase	IS5-like element ISXfu1 family transposase	transposase	A0A077K814	Ralstonia_phage	59.9	8.2e-98
WP_011345585.1|2329553_2330780_+|transposase	IS256-like element ISXax1 family transposase	transposase	A0A218MNI5	uncultured_virus	50.3	2.2e-52
WP_033481602.1|2344419_2346120_-	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	NA	NA	NA	NA
WP_033481600.1|2346851_2348810_+	poly-beta-1,6 N-acetyl-D-glucosamine export porin PgaA	NA	NA	NA	NA	NA
WP_022559032.1|2348791_2350690_+	poly-beta-1,6-N-acetyl-D-glucosamine N-deacetylase PgaB	NA	NA	NA	NA	NA
WP_022559031.1|2350693_2351947_+	poly-beta-1,6 N-acetyl-D-glucosamine synthase	NA	NA	NA	NA	NA
WP_022559030.1|2351943_2352390_+	poly-beta-1,6-N-acetyl-D-glucosamine biosynthesis protein PgaD	NA	NA	NA	NA	NA
WP_022559029.1|2352974_2354507_+	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_033481610.1|2355087_2355372_+	DUF4190 domain-containing protein	NA	NA	NA	NA	NA
WP_022559026.1|2355368_2356142_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_007965740.1|2356147_2357203_+	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_022559025.1|2357199_2358252_+	UDP-N-acetylmuramate dehydrogenase	NA	NA	NA	NA	NA
WP_099770954.1|2358287_2359157_+	DMT family transporter	NA	NA	NA	NA	NA
WP_022559023.1|2359300_2360005_+	aspartate/glutamate racemase family protein	NA	NA	NA	NA	NA
WP_022559022.1|2362338_2363604_-	flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase	NA	NA	NA	NA	NA
WP_080720948.1|2363806_2365036_+	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_003481988.1|2365032_2365599_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_022559020.1|2365781_2366768_-	cellulase family glycosylhydrolase	NA	NA	NA	NA	NA
WP_022559019.1|2367216_2369073_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_022559018.1|2369271_2370834_-	sodium/solute symporter	NA	A0A240F465	Aeromonas_phage	41.0	3.6e-87
WP_022559017.1|2371091_2373704_-	glycoside hydrolase family 3 protein	NA	NA	NA	NA	NA
WP_022559016.1|2374138_2376094_+	DUF839 domain-containing protein	NA	NA	NA	NA	NA
WP_007965756.1|2376305_2376929_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022559014.1|2376932_2377277_-	type II toxin-antitoxin system prevent-host-death family antitoxin	NA	NA	NA	NA	NA
WP_022559013.1|2377433_2378948_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_022559012.1|2378944_2379325_-	aspartate 1-decarboxylase	NA	NA	NA	NA	NA
WP_007965764.1|2379492_2380335_-	pantoate--beta-alanine ligase	NA	NA	NA	NA	NA
WP_022559011.1|2380331_2381147_-	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	A0A0N7HVJ8	Ostreococcus_lucimarinus_virus	34.6	4.2e-31
WP_007965767.1|2381182_2381668_-	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_007965770.1|2381671_2383039_-	polynucleotide adenylyltransferase PcnB	NA	A0A1B1IVF3	uncultured_Mediterranean_phage	38.4	1.2e-25
WP_022559009.1|2383648_2384566_-	GTP cyclohydrolase I FolE2	NA	NA	NA	NA	NA
WP_022559008.1|2384602_2385751_-	N-acetylmuramoyl-L-alanine amidase	NA	M1IEI0	Bacillus_phage	40.6	1.4e-08
WP_080720949.1|2385970_2386189_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022559006.1|2386632_2387106_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011345585.1|2388960_2390187_+|transposase	IS256-like element ISXax1 family transposase	transposase	A0A218MNI5	uncultured_virus	50.3	2.2e-52
>prophage 8
NZ_CP020992	Xanthomonas citri pv. phaseoli var. fuscans strain CFBP4885 chromosome, complete genome	5012288	2977015	3031050	5012288	integrase,transposase	uncultured_virus(44.44%)	47	3005221:3005235	3034986:3035000
WP_011345585.1|2977015_2978242_-|transposase	IS256-like element ISXax1 family transposase	transposase	A0A218MNI5	uncultured_virus	50.3	2.2e-52
WP_127171639.1|2981062_2981437_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007975311.1|2981911_2982892_+|transposase	IS5-like element ISXfu2 family transposase	transposase	A0A077K814	Ralstonia_phage	59.5	1.1e-97
WP_022558664.1|2983147_2983543_+	type I toxin-antitoxin system SymE family toxin	NA	NA	NA	NA	NA
WP_080720975.1|2983644_2984802_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_003490678.1|2984971_2985649_-	response regulator transcription factor	NA	Q6XM27	Feldmannia_irregularis_virus	27.4	7.4e-05
WP_033481811.1|2985674_2986151_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022558661.1|2986337_2987225_-	30S ribosomal protein S6--L-glutamate ligase	NA	A0A1D7SR78	Cyanophage	32.4	2.7e-31
WP_007962333.1|2987721_2989854_+	glycogen debranching protein GlgX	NA	NA	NA	NA	NA
WP_003490669.1|2990487_2990880_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_003490667.1|2990970_2991363_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033481809.1|2991473_2992133_-	thermonuclease family protein	NA	NA	NA	NA	NA
WP_011345585.1|2993023_2994250_-|transposase	IS256-like element ISXax1 family transposase	transposase	A0A218MNI5	uncultured_virus	50.3	2.2e-52
WP_022558657.1|2994354_2995305_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080720970.1|2995376_2995973_-	hypothetical protein	NA	NA	NA	NA	NA
WP_131701854.1|2995999_2996227_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022558656.1|2996394_2998035_-	MobA/MobL family protein	NA	NA	NA	NA	NA
WP_022558655.1|2998377_2998746_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_022558654.1|2998890_2999202_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080720971.1|2999309_2999639_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022558652.1|2999655_2999850_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022558651.1|2999863_3000754_-	MobA/MobL family protein	NA	NA	NA	NA	NA
WP_033481790.1|3000843_3001356_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033481788.1|3001380_3002505_-	DUF4062 domain-containing protein	NA	NA	NA	NA	NA
WP_022558648.1|3002564_3003002_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022558645.1|3004241_3004562_+	helix-turn-helix transcriptional regulator	NA	F8TVE5	EBPR_siphovirus	32.3	8.3e-07
WP_022558644.1|3004582_3005446_+	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
3005221:3005235	attL	TGCGCGGCAAAGCGC	NA	NA	NA	NA
WP_022558643.1|3005503_3005938_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011345585.1|3005991_3007218_+|transposase	IS256-like element ISXax1 family transposase	transposase	A0A218MNI5	uncultured_virus	50.3	2.2e-52
WP_131701852.1|3007322_3007523_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022558642.1|3007801_3009697_-	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_022558641.1|3010120_3011302_-	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_033481816.1|3011294_3013394_-	DEAD/DEAH box helicase	NA	NA	NA	NA	NA
WP_033481814.1|3013396_3015790_-	class I SAM-dependent DNA methyltransferase	NA	Q6NE04	Leptospira_phage	32.2	5.3e-106
WP_011345585.1|3015963_3017190_+|transposase	IS256-like element ISXax1 family transposase	transposase	A0A218MNI5	uncultured_virus	50.3	2.2e-52
WP_022558638.1|3017532_3018771_-	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_022558637.1|3018712_3019342_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033481352.1|3019665_3020034_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_022558635.1|3020034_3021366_+	HipA domain-containing protein	NA	NA	NA	NA	NA
WP_022558634.1|3021569_3021779_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022558633.1|3021912_3024483_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080720850.1|3024515_3025112_-	DUF1629 domain-containing protein	NA	NA	NA	NA	NA
WP_033481347.1|3025490_3026660_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022558631.1|3026802_3027198_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_080720848.1|3027625_3028015_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022558630.1|3028048_3029326_-	SidA/IucD/PvdA family monooxygenase	NA	NA	NA	NA	NA
WP_033481345.1|3029676_3031050_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
3034986:3035000	attR	GCGCTTTGCCGCGCA	NA	NA	NA	NA
>prophage 9
NZ_CP020992	Xanthomonas citri pv. phaseoli var. fuscans strain CFBP4885 chromosome, complete genome	5012288	3338502	3404451	5012288	protease,integrase,transposase,holin	Bacillus_phage(26.67%)	54	3338399:3338416	3352114:3352131
3338399:3338416	attL	TCCCCCTCTCTCCGCCAG	NA	NA	NA	NA
WP_022558465.1|3338502_3340035_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_022558464.1|3340071_3340359_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022558463.1|3340358_3340829_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011345585.1|3341057_3342284_+|transposase	IS256-like element ISXax1 family transposase	transposase	A0A218MNI5	uncultured_virus	50.3	2.2e-52
WP_022558462.1|3343224_3344637_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033481895.1|3344629_3345256_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022558460.1|3345840_3346482_+	type III effector protein	NA	NA	NA	NA	NA
WP_011345585.1|3346608_3347835_-|transposase	IS256-like element ISXax1 family transposase	transposase	A0A218MNI5	uncultured_virus	50.3	2.2e-52
WP_022558459.1|3348811_3349171_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007975311.1|3349526_3350507_+|transposase	IS5-like element ISXfu2 family transposase	transposase	A0A077K814	Ralstonia_phage	59.5	1.1e-97
WP_022558458.1|3350610_3350874_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033481215.1|3350863_3351697_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033481214.1|3352903_3353350_-	molybdenum cofactor biosynthesis protein MoaE	NA	NA	NA	NA	NA
3352114:3352131	attR	TCCCCCTCTCTCCGCCAG	NA	NA	NA	NA
WP_016849059.1|3353346_3353592_-	MoaD/ThiS family protein	NA	NA	NA	NA	NA
WP_022558453.1|3353588_3354086_-	cyclic pyranopterin monophosphate synthase MoaC	NA	NA	NA	NA	NA
WP_007968987.1|3354111_3354492_-	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_022558452.1|3354488_3355520_-	GTP 3',8-cyclase MoaA	NA	NA	NA	NA	NA
WP_007973306.1|3355519_3356269_-	MBL fold metallo-hydrolase	NA	A0A0A0RUN7	Bacillus_phage	26.0	1.4e-09
WP_022558451.1|3356268_3357018_-	3-deoxy-D-manno-octulosonic acid kinase	NA	NA	NA	NA	NA
WP_022558450.1|3357038_3358088_+	glycosyltransferase family 9 protein	NA	NA	NA	NA	NA
WP_022558449.1|3358278_3358683_-	hypothetical protein	NA	A0A1C9C5K8	Heterosigma_akashiwo_virus	35.9	1.1e-16
WP_007968980.1|3359225_3359930_+	serine/threonine-protein phosphatase	NA	NA	NA	NA	NA
WP_022558448.1|3360226_3360961_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	40.6	1.1e-35
WP_022558447.1|3360969_3361422_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	52.9	1.8e-39
WP_007968977.1|3361449_3362106_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022558446.1|3362118_3362886_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_022558445.1|3362882_3364061_+	lytic transglycosylase domain-containing protein	NA	NA	NA	NA	NA
WP_033481213.1|3364690_3366661_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_002806049.1|3367299_3367572_-	HU family DNA-binding protein	NA	A7KV42	Bacillus_phage	64.0	2.2e-21
WP_022558443.1|3367785_3370257_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.2	2.2e-224
WP_003483788.1|3370400_3371687_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	59.9	5.3e-137
WP_002806026.1|3371812_3372439_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	57.4	1.0e-56
WP_007968966.1|3372531_3373824_-	trigger factor	NA	NA	NA	NA	NA
WP_005927840.1|3376659_3377421_+	Bax inhibitor-1/YccA family protein	NA	NA	NA	NA	NA
WP_003483762.1|3377566_3378574_-	isocitrate dehydrogenase	NA	NA	NA	NA	NA
WP_022558442.1|3378800_3379196_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_033481211.1|3379192_3379501_-	glutaredoxin 3	NA	A0A2L0UZG6	Agrobacterium_phage	43.2	2.7e-07
WP_033481216.1|3379650_3381297_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_003483753.1|3381479_3382169_+	phosphate regulon transcriptional regulatory protein PhoB	NA	W8CYM9	Bacillus_phage	35.7	1.0e-33
WP_080720753.1|3382226_3383570_+	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	33.3	6.5e-29
WP_022558438.1|3383682_3385785_+	polyphosphate kinase 1	NA	NA	NA	NA	NA
WP_022558437.1|3385955_3387482_+	exopolyphosphatase	NA	NA	NA	NA	NA
WP_022558436.1|3387693_3388830_+	glycosyltransferase family 1 protein	NA	NA	NA	NA	NA
WP_022558435.1|3388810_3389353_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_007973708.1|3389753_3390497_+	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_007968939.1|3390685_3391105_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007968937.1|3393069_3393894_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_003483730.1|3394089_3395556_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	39.9	4.1e-85
WP_022558434.1|3395586_3396333_-	CvpA family protein	NA	NA	NA	NA	NA
WP_022558433.1|3396546_3397623_-	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_022558432.1|3397690_3398989_-	bifunctional tetrahydrofolate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_007968929.1|3399318_3399963_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_022558431.1|3400056_3402216_-	S46 family peptidase	NA	NA	NA	NA	NA
WP_022558430.1|3402369_3404451_-|holin	phospholipase C, phosphocholine-specific	holin	NA	NA	NA	NA
>prophage 10
NZ_CP020992	Xanthomonas citri pv. phaseoli var. fuscans strain CFBP4885 chromosome, complete genome	5012288	3834099	3919153	5012288	protease,transposase	Erwinia_phage(13.33%)	59	NA	NA
WP_022558205.1|3834099_3835467_-|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A2H5BJT2	Erwinia_phage	29.1	1.5e-41
WP_003482763.1|3835567_3836119_-|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_022558204.1|3836315_3837233_-	tyrosine recombinase XerC	NA	S5M872	Bacillus_phage	26.8	1.3e-12
WP_080720608.1|3837413_3838094_-	DUF484 family protein	NA	NA	NA	NA	NA
WP_022558203.1|3838081_3838936_-	diaminopimelate epimerase	NA	NA	NA	NA	NA
WP_022558202.1|3838925_3839180_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003482768.1|3839236_3839635_-	YbaN family protein	NA	NA	NA	NA	NA
WP_022558201.1|3839997_3842133_-	S9 family peptidase	NA	F2Y2Z7	Organic_Lake_phycodnavirus	25.4	3.9e-28
WP_022558200.1|3842242_3843427_+	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_007973684.1|3843817_3845911_-	S9 family peptidase	NA	NA	NA	NA	NA
WP_022558199.1|3845978_3846290_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003482775.1|3846668_3847238_+	lipocalin family protein	NA	NA	NA	NA	NA
WP_005916857.1|3847347_3848313_-	YafY family transcriptional regulator	NA	NA	NA	NA	NA
WP_005916853.1|3848861_3849662_+	DUF481 domain-containing protein	NA	NA	NA	NA	NA
WP_022558197.1|3849987_3850902_-	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
WP_022558196.1|3850932_3851670_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_007965004.1|3851700_3852753_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	33.5	1.1e-18
WP_022558195.1|3852757_3853426_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_022558194.1|3853586_3855524_-	glucans biosynthesis glucosyltransferase MdoH	NA	NA	NA	NA	NA
WP_080949381.1|3856166_3856400_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022558192.1|3856590_3858240_-	M28 family peptidase	NA	NA	NA	NA	NA
WP_022558191.1|3859862_3861350_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	56.9	8.3e-126
WP_022558190.1|3861562_3862987_+	cellulase family glycosylhydrolase	NA	G0YQI7	Erwinia_phage	33.6	2.1e-54
WP_022558189.1|3863238_3865443_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	65.7	3.5e-11
WP_033480915.1|3866162_3868904_-	PAS domain S-box protein	NA	G3MA91	Bacillus_virus	29.2	2.1e-10
WP_022558187.1|3869007_3871887_+	insulinase family protein	NA	NA	NA	NA	NA
WP_003489747.1|3872448_3873378_+	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_080720618.1|3873876_3874866_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033480916.1|3875361_3876114_-	endonuclease	NA	NA	NA	NA	NA
WP_022558184.1|3877262_3878936_+	alpha,alpha-trehalase TreA	NA	NA	NA	NA	NA
WP_022558183.1|3879281_3879974_+	AIM24 family protein	NA	NA	NA	NA	NA
WP_033480917.1|3880288_3881191_-	magnesium transporter CorA family protein	NA	NA	NA	NA	NA
WP_080720610.1|3881574_3882441_+	type III secretion system effector protein	NA	NA	NA	NA	NA
WP_022558181.1|3882527_3883904_-	D-serine/D-alanine/glycine transporter	NA	NA	NA	NA	NA
WP_022558180.1|3884322_3884538_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022558179.1|3884839_3885619_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_099770902.1|3885719_3886604_-	DMT family transporter	NA	NA	NA	NA	NA
WP_033480919.1|3886792_3887677_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022558176.1|3887882_3888440_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033480931.1|3888667_3888862_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022558175.1|3889208_3891083_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	31.5	6.3e-14
WP_022558174.1|3891588_3892680_+	DUF1615 domain-containing protein	NA	NA	NA	NA	NA
WP_022558173.1|3893036_3895364_+	S9 family peptidase	NA	NA	NA	NA	NA
WP_022558171.1|3895764_3896100_-	DUF3817 domain-containing protein	NA	NA	NA	NA	NA
WP_080720613.1|3898232_3898700_+	DUF4126 domain-containing protein	NA	NA	NA	NA	NA
WP_033480932.1|3898813_3899209_-	VOC family protein	NA	NA	NA	NA	NA
WP_022558168.1|3899280_3900255_-	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_033480933.1|3900392_3901172_-	SPFH domain-containing protein	NA	A0A2D2W2L0	Stenotrophomonas_phage	68.1	3.1e-92
WP_022558167.1|3901528_3903115_+	SDR family oxidoreductase	NA	M1NLX1	Moumouvirus	27.8	5.0e-36
WP_022558166.1|3903203_3903515_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033480920.1|3903761_3904706_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_022558164.1|3904755_3905490_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_131701248.1|3905988_3906387_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099770788.1|3907035_3908018_-|transposase	IS5-like element ISXfu1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.2	9.7e-99
WP_022558162.1|3908133_3908940_+	peptidoglycan-binding protein	NA	NA	NA	NA	NA
WP_011345585.1|3910691_3911918_-|transposase	IS256-like element ISXax1 family transposase	transposase	A0A218MNI5	uncultured_virus	50.3	2.2e-52
WP_080720994.1|3915405_3915795_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007975311.1|3916584_3917565_-|transposase	IS5-like element ISXfu2 family transposase	transposase	A0A077K814	Ralstonia_phage	59.5	1.1e-97
WP_011345585.1|3917926_3919153_-|transposase	IS256-like element ISXax1 family transposase	transposase	A0A218MNI5	uncultured_virus	50.3	2.2e-52
>prophage 11
NZ_CP020992	Xanthomonas citri pv. phaseoli var. fuscans strain CFBP4885 chromosome, complete genome	5012288	4379236	4448248	5012288	protease,transposase	Ralstonia_phage(37.5%)	52	NA	NA
WP_022557821.1|4379236_4380220_+|transposase	IS5-like element ISXfu1 family transposase	transposase	A0A077K814	Ralstonia_phage	59.9	8.2e-98
WP_033481912.1|4380284_4380500_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022557884.1|4380543_4380732_-	CsbD family protein	NA	NA	NA	NA	NA
WP_022557883.1|4380973_4382140_-	HDOD domain-containing protein	NA	NA	NA	NA	NA
WP_033481916.1|4382349_4382880_+	SRPBCC family protein	NA	NA	NA	NA	NA
WP_007975311.1|4382994_4383975_-|transposase	IS5-like element ISXfu2 family transposase	transposase	A0A077K814	Ralstonia_phage	59.5	1.1e-97
WP_022557881.1|4384342_4384654_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022557880.1|4384650_4385721_-	M4 family metallopeptidase	NA	NA	NA	NA	NA
WP_022557879.1|4385830_4386487_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_033481677.1|4386720_4387191_+	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_033481685.1|4387474_4391197_+|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_003487911.1|4391578_4391977_+	host attachment protein	NA	NA	NA	NA	NA
WP_022557876.1|4391997_4392327_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_007962295.1|4392859_4394350_+	glycine betaine/L-proline transporter ProP	NA	Q6JIH2	Burkholderia_virus	31.4	1.4e-53
WP_022557875.1|4394685_4395159_-	SRPBCC domain-containing protein	NA	NA	NA	NA	NA
WP_033481679.1|4395329_4396121_+	EcsC family protein	NA	NA	NA	NA	NA
WP_040092218.1|4396298_4396955_+	DUF938 domain-containing protein	NA	NA	NA	NA	NA
WP_022557872.1|4397205_4398987_-	carboxypeptidase regulatory-like domain-containing protein	NA	NA	NA	NA	NA
WP_080720951.1|4399144_4401481_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033481682.1|4401399_4402599_-	membrane protein	NA	NA	NA	NA	NA
WP_007962713.1|4402642_4403539_-	DUF58 domain-containing protein	NA	NA	NA	NA	NA
WP_007962712.1|4403552_4404545_-	MoxR family ATPase	NA	NA	NA	NA	NA
WP_033481683.1|4404676_4405495_-	DUF4159 domain-containing protein	NA	NA	NA	NA	NA
WP_007962710.1|4405491_4406826_-	TldD/PmbA family protein	NA	NA	NA	NA	NA
WP_007970327.1|4406840_4408436_-	TldD/PmbA family protein	NA	NA	NA	NA	NA
WP_080950217.1|4408438_4409008_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080720925.1|4409167_4410748_-	TldD/PmbA family protein	NA	NA	NA	NA	NA
WP_022557868.1|4411150_4411540_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022557867.1|4411788_4412799_-	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	37.5	1.6e-48
WP_016849085.1|4413064_4414267_-	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_080720924.1|4414366_4416562_+	TonB-dependent receptor	NA	A0A1B0VCF0	Salmonella_phage	41.2	1.1e-68
WP_022557865.1|4416768_4417065_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033481593.1|4418149_4419679_+	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_022557862.1|4419856_4420252_+	DUF779 domain-containing protein	NA	NA	NA	NA	NA
WP_022557861.1|4420357_4420537_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080720923.1|4420778_4421087_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022557859.1|4421086_4422046_+	Ku protein	NA	NA	NA	NA	NA
WP_022557858.1|4422182_4423349_-	FMN-dependent L-lactate dehydrogenase LldD	NA	NA	NA	NA	NA
WP_022557857.1|4423596_4424829_+	serine hydrolase	NA	NA	NA	NA	NA
WP_033481588.1|4424914_4426114_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_022557855.1|4426110_4426743_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_033481586.1|4427793_4428342_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007970760.1|4428480_4428879_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022557853.1|4428875_4432223_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_033481584.1|4432504_4433713_+	trans-2-enoyl-CoA reductase family protein	NA	NA	NA	NA	NA
WP_022557851.1|4434286_4435309_-	sugar kinase	NA	NA	NA	NA	NA
WP_007964720.1|4435594_4438375_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_022557850.1|4438740_4442607_+	secreted protein	NA	NA	NA	NA	NA
WP_011345585.1|4442997_4444224_-|transposase	IS256-like element ISXax1 family transposase	transposase	A0A218MNI5	uncultured_virus	50.3	2.2e-52
WP_099771153.1|4444790_4446026_+|transposase	IS256-like element ISXax1 family transposase	transposase	A0A218MNI5	uncultured_virus	49.5	1.6e-50
WP_080720993.1|4446291_4446675_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022557821.1|4447264_4448248_-|transposase	IS5-like element ISXfu1 family transposase	transposase	A0A077K814	Ralstonia_phage	59.9	8.2e-98
>prophage 12
NZ_CP020992	Xanthomonas citri pv. phaseoli var. fuscans strain CFBP4885 chromosome, complete genome	5012288	4552532	4616302	5012288	protease,tRNA,transposase	Synechococcus_phage(10.0%)	48	NA	NA
WP_003482177.1|4552532_4553225_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_007968187.1|4553443_4554784_+	outer membrane protein transport protein	NA	NA	NA	NA	NA
WP_033481283.1|4555048_4555750_+	2OG-Fe(II) oxygenase	NA	E3SK61	Synechococcus_phage	47.2	1.0e-17
WP_022557784.1|4555934_4557062_+	PA0069 family radical SAM protein	NA	NA	NA	NA	NA
WP_033481282.1|4557185_4557551_-	DUF1330 domain-containing protein	NA	NA	NA	NA	NA
WP_022557782.1|4557599_4558325_-	YafY family transcriptional regulator	NA	NA	NA	NA	NA
WP_022557781.1|4558625_4560086_+	cardiolipin synthase	NA	NA	NA	NA	NA
WP_005912451.1|4560160_4560430_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007968197.1|4560437_4561205_+	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_022557780.1|4561457_4561865_-	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_005912449.1|4562367_4562781_-	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_005912447.1|4562784_4563207_-	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_005912445.1|4563253_4564015_-	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_005921855.1|4564101_4564770_-	energy transducer TonB	NA	NA	NA	NA	NA
WP_022557779.1|4564923_4566117_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_022557778.1|4566394_4567201_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_022557777.1|4567385_4568222_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_022557776.1|4568289_4570734_-	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	34.7	1.6e-113
WP_022557775.1|4570848_4571955_-	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_005912436.1|4572988_4574089_-	DNA polymerase III subunit beta	NA	A0A0A8IL17	Aurantimonas_phage	37.1	1.1e-53
WP_022557774.1|4574365_4575694_-	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
WP_002805908.1|4575936_4576077_+	50S ribosomal protein L34	NA	NA	NA	NA	NA
WP_007968218.1|4576115_4576553_+	ribonuclease P protein component	NA	NA	NA	NA	NA
WP_022560505.1|4576578_4578303_+	membrane protein insertase YidC	NA	NA	NA	NA	NA
WP_022560504.1|4579880_4581221_+|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE	tRNA	NA	NA	NA	NA
WP_022560503.1|4581382_4582240_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_022560502.1|4582431_4584732_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_033481512.1|4584877_4585972_+	glycerophosphodiester phosphodiesterase	NA	NA	NA	NA	NA
WP_033481510.1|4586091_4586877_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_005912402.1|4587215_4588172_-	TerC family protein	NA	K4F9T9	Cronobacter_phage	31.4	1.3e-31
WP_007968235.1|4588436_4589603_+	class I SAM-dependent rRNA methyltransferase	NA	NA	NA	NA	NA
WP_022560498.1|4589721_4590042_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022560497.1|4590329_4591586_+	dipeptidase precursor	NA	NA	NA	NA	NA
WP_022560496.1|4592065_4593376_+	MFS transporter	NA	NA	NA	NA	NA
WP_022560495.1|4593401_4594571_+	glycerate kinase	NA	W6LM47	Streptococcus_phage	39.0	4.0e-43
WP_022560494.1|4597974_4598364_+	DUF2628 domain-containing protein	NA	NA	NA	NA	NA
WP_022560493.1|4599203_4601678_+	glycoside hydrolase family 92 protein	NA	NA	NA	NA	NA
WP_017154798.1|4604137_4604530_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017154799.1|4604669_4604924_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011153925.1|4604920_4605550_-	AAA family ATPase	NA	A2I303	Vibrio_virus	44.2	3.8e-40
WP_108702726.1|4605578_4605845_-	hypothetical protein	NA	A0A0P0ZG22	Escherichia_phage	60.0	1.1e-15
WP_017158359.1|4606032_4606314_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007975311.1|4606437_4607418_-|transposase	IS5-like element ISXfu2 family transposase	transposase	A0A077K814	Ralstonia_phage	59.5	1.1e-97
WP_011345585.1|4608259_4609486_+|transposase	IS256-like element ISXax1 family transposase	transposase	A0A218MNI5	uncultured_virus	50.3	2.2e-52
WP_022560489.1|4610062_4610905_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022557731.1|4612216_4612471_-	plasmid stability protein	NA	NA	NA	NA	NA
WP_022560487.1|4612682_4613276_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	48.6	6.8e-39
WP_022560486.1|4613272_4616302_+|transposase	Tn3 family transposase	transposase	NA	NA	NA	NA
>prophage 13
NZ_CP020992	Xanthomonas citri pv. phaseoli var. fuscans strain CFBP4885 chromosome, complete genome	5012288	4647391	4679825	5012288	tail,transposase	Ralstonia_phage(44.44%)	20	NA	NA
WP_007968268.1|4647391_4647928_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_007968270.1|4647988_4648516_-|tail	phage tail protein	tail	A0A0U4JYA4	Arthrobacter_phage	28.0	1.0e-09
WP_007968272.1|4648584_4649136_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_022560461.1|4649396_4654184_+	autotransporter domain-containing protein	NA	F5B3Z3	Synechococcus_phage	45.8	3.4e-19
WP_033481432.1|4654533_4657938_+	exodeoxyribonuclease V subunit gamma	NA	NA	NA	NA	NA
WP_022560459.1|4657934_4661957_+	exodeoxyribonuclease V subunit beta	NA	S5MMD7	Bacillus_phage	21.5	7.0e-10
WP_022560458.1|4662159_4664598_+	AAA family ATPase	NA	A0A0N9S864	Staphylococcus_phage	43.6	8.0e-09
WP_022560457.1|4665169_4666564_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005912356.1|4666665_4666764_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022560456.1|4666912_4668838_-	M61 family metallopeptidase	NA	NA	NA	NA	NA
WP_003482333.1|4669028_4669361_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022560454.1|4670914_4671658_-	glucose 1-dehydrogenase	NA	A0A0M4JSW6	Mollivirus	28.8	5.0e-15
WP_033481799.1|4671742_4672315_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_022560452.1|4672435_4673005_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_022560451.1|4673067_4673544_+	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_007975311.1|4674373_4675354_-|transposase	IS5-like element ISXfu2 family transposase	transposase	A0A077K814	Ralstonia_phage	59.5	1.1e-97
WP_033481960.1|4675854_4676121_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022557821.1|4676562_4677546_-|transposase	IS5-like element ISXfu1 family transposase	transposase	A0A077K814	Ralstonia_phage	59.9	8.2e-98
WP_007975311.1|4677676_4678657_+|transposase	IS5-like element ISXfu2 family transposase	transposase	A0A077K814	Ralstonia_phage	59.5	1.1e-97
WP_007975311.1|4678844_4679825_+|transposase	IS5-like element ISXfu2 family transposase	transposase	A0A077K814	Ralstonia_phage	59.5	1.1e-97
>prophage 14
NZ_CP020992	Xanthomonas citri pv. phaseoli var. fuscans strain CFBP4885 chromosome, complete genome	5012288	4923835	4985053	5012288	plate,transposase	uncultured_virus(28.57%)	37	NA	NA
WP_007964038.1|4923835_4924339_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_022560320.1|4924343_4926227_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_022560319.1|4926190_4927231_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_022560318.1|4927286_4930031_+	type VI secretion system ATPase TssH	NA	H6X3M6	Enterobacteria_phage	29.4	6.7e-81
WP_022560317.1|4930244_4930742_+	hypothetical protein	NA	NA	NA	NA	NA
WP_123766583.1|4930875_4931370_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011345585.1|4931546_4932773_+|transposase	IS256-like element ISXax1 family transposase	transposase	A0A218MNI5	uncultured_virus	50.3	2.2e-52
WP_033481378.1|4932923_4933187_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022560316.1|4933499_4935527_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022560315.1|4935931_4936675_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007967121.1|4937292_4938597_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022560314.1|4938667_4939969_-	histidine-type phosphatase	NA	NA	NA	NA	NA
WP_022560313.1|4940072_4942958_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_033481384.1|4943423_4944494_-	DUF4880 domain-containing protein	NA	NA	NA	NA	NA
WP_022560311.1|4944490_4945018_-	RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_033481379.1|4945367_4945907_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_033481380.1|4945885_4948405_+	serine/threonine protein kinase	NA	A0A2P1EMR8	Moumouvirus	29.2	8.0e-12
WP_007967108.1|4948448_4948763_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022560308.1|4948992_4950324_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_022560307.1|4950473_4952441_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	28.7	5.1e-38
WP_022560306.1|4952437_4952986_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022560304.1|4953269_4954577_+	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_007967095.1|4955158_4956493_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_022560303.1|4956474_4957755_+	type VI secretion system protein TssL	NA	NA	NA	NA	NA
WP_033481381.1|4957751_4961282_+	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_033481382.1|4961278_4961854_+	type VI secretion system-associated protein TagF	NA	NA	NA	NA	NA
WP_022560300.1|4962571_4966261_+	protein kinase	NA	Q0N495	Clanis_bilineata_nucleopolyhedrovirus	29.9	9.2e-09
WP_022560299.1|4966257_4966719_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033481383.1|4966715_4968392_+	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	NA	NA	NA	NA
WP_022560297.1|4968403_4975531_+	filamentous hemagglutinin N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_022560296.1|4975580_4976624_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_003487371.1|4976933_4977224_-	DUF2782 domain-containing protein	NA	NA	NA	NA	NA
WP_022560295.1|4977300_4980105_+	DNA polymerase I	NA	A0A218MKQ4	uncultured_virus	30.1	9.6e-67
WP_022560294.1|4980944_4981844_-	oxygen-dependent coproporphyrinogen oxidase	NA	NA	NA	NA	NA
WP_007967074.1|4982280_4982847_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033481385.1|4982843_4983560_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099770788.1|4984070_4985053_-|transposase	IS5-like element ISXfu1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.2	9.7e-99
