The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP021001	Xanthomonas citri pv. phaseoli var. fuscans strain CFBP6166 chromosome, complete genome	5025712	239501	305450	5025712	protease,transposase,integrase,holin	Bacillus_phage(26.67%)	54	291822:291839	305537:305554
WP_022558430.1|239501_241583_+|holin	phospholipase C, phosphocholine-specific	holin	NA	NA	NA	NA
WP_022558431.1|241736_243896_+	S46 family peptidase	NA	NA	NA	NA	NA
WP_007968929.1|243989_244634_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_022558432.1|244963_246262_+	bifunctional tetrahydrofolate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_022558433.1|246329_247406_+	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_022558434.1|247619_248366_+	CvpA family protein	NA	NA	NA	NA	NA
WP_003483730.1|248396_249863_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	39.9	4.1e-85
WP_007968937.1|250058_250883_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_007968939.1|252847_253267_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007973708.1|253455_254199_-	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_022558435.1|254599_255142_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_022558436.1|255122_256259_-	glycosyltransferase family 1 protein	NA	NA	NA	NA	NA
WP_022558437.1|256470_257997_-	exopolyphosphatase	NA	NA	NA	NA	NA
WP_022558438.1|258167_260270_-	polyphosphate kinase 1	NA	NA	NA	NA	NA
WP_080720753.1|260382_261726_-	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	33.3	6.5e-29
WP_003483753.1|261783_262473_-	phosphate regulon transcriptional regulatory protein PhoB	NA	W8CYM9	Bacillus_phage	35.7	1.0e-33
WP_033481216.1|262655_264302_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_033481211.1|264451_264760_+	glutaredoxin 3	NA	A0A2L0UZG6	Agrobacterium_phage	43.2	2.7e-07
WP_022558442.1|264756_265152_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_003483762.1|265378_266386_+	isocitrate dehydrogenase	NA	NA	NA	NA	NA
WP_005927840.1|266531_267293_-	Bax inhibitor-1/YccA family protein	NA	NA	NA	NA	NA
WP_007968966.1|270128_271421_+	trigger factor	NA	NA	NA	NA	NA
WP_002806026.1|271513_272140_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	57.4	1.0e-56
WP_003483788.1|272265_273552_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	59.9	5.3e-137
WP_022558443.1|273695_276167_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.2	2.2e-224
WP_002806049.1|276380_276653_+	HU family DNA-binding protein	NA	A7KV42	Bacillus_phage	64.0	2.2e-21
WP_033481213.1|277291_279262_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_022558445.1|279891_281070_-	lytic transglycosylase domain-containing protein	NA	NA	NA	NA	NA
WP_022558446.1|281066_281834_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_007968977.1|281846_282503_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022558447.1|282530_282983_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	52.9	1.8e-39
WP_022558448.1|282991_283726_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	40.6	1.1e-35
WP_007968980.1|284022_284727_-	serine/threonine-protein phosphatase	NA	NA	NA	NA	NA
WP_022558449.1|285269_285674_+	hypothetical protein	NA	A0A1C9C5K8	Heterosigma_akashiwo_virus	35.9	1.1e-16
WP_022558450.1|285864_286914_-	glycosyltransferase family 9 protein	NA	NA	NA	NA	NA
WP_022558451.1|286934_287684_+	3-deoxy-D-manno-octulosonic acid kinase	NA	NA	NA	NA	NA
WP_007973306.1|287683_288433_+	MBL fold metallo-hydrolase	NA	A0A0A0RUN7	Bacillus_phage	26.0	1.4e-09
WP_022558452.1|288432_289464_+	GTP 3',8-cyclase MoaA	NA	NA	NA	NA	NA
WP_007968987.1|289460_289841_+	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_022558453.1|289866_290364_+	cyclic pyranopterin monophosphate synthase MoaC	NA	NA	NA	NA	NA
WP_016849059.1|290360_290606_+	MoaD/ThiS family protein	NA	NA	NA	NA	NA
WP_033481214.1|290602_291049_+	molybdenum cofactor biosynthesis protein MoaE	NA	NA	NA	NA	NA
291822:291839	attL	CTGGCGGAGAGAGGGGGA	NA	NA	NA	NA
WP_033481215.1|292255_293089_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022558458.1|293078_293342_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007975311.1|293445_294426_-|transposase	IS5-like element ISXfu2 family transposase	transposase	A0A077K814	Ralstonia_phage	59.5	1.1e-97
WP_022558459.1|294781_295141_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011345585.1|296117_297344_+|transposase	IS256-like element ISXax1 family transposase	transposase	A0A218MNI5	uncultured_virus	50.3	2.2e-52
WP_022558460.1|297470_298112_-	type III effector protein	NA	NA	NA	NA	NA
WP_033481895.1|298696_299323_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022558462.1|299315_300728_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011345585.1|301668_302895_-|transposase	IS256-like element ISXax1 family transposase	transposase	A0A218MNI5	uncultured_virus	50.3	2.2e-52
WP_022558463.1|303123_303594_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022558464.1|303593_303881_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022558465.1|303917_305450_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
305537:305554	attR	CTGGCGGAGAGAGGGGGA	NA	NA	NA	NA
>prophage 2
NZ_CP021001	Xanthomonas citri pv. phaseoli var. fuscans strain CFBP6166 chromosome, complete genome	5025712	607284	665762	5025712	tRNA,transposase,integrase	uncultured_virus(44.44%)	51	593525:593540	658627:658642
593525:593540	attL	CGGCGCGCTGGATGCG	NA	NA	NA	NA
WP_022558626.1|607284_608043_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_007964565.1|608265_609060_-	thiazole synthase	NA	NA	NA	NA	NA
WP_022558627.1|609109_609310_-	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_033481344.1|609498_611283_+	autotransporter domain-containing esterase	NA	NA	NA	NA	NA
WP_033481345.1|611727_613101_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_022558630.1|613451_614729_+	SidA/IucD/PvdA family monooxygenase	NA	NA	NA	NA	NA
WP_080720848.1|614762_615152_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022558631.1|615579_615975_+	H-NS histone family protein	NA	NA	NA	NA	NA
WP_033481347.1|616117_617287_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080720850.1|617665_618262_+	DUF1629 domain-containing protein	NA	NA	NA	NA	NA
WP_022558633.1|618294_620865_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022558634.1|620998_621208_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022558635.1|621411_622743_-	HipA domain-containing protein	NA	NA	NA	NA	NA
WP_033481352.1|622743_623112_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_022558637.1|623435_624065_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022558638.1|624006_625245_+	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_011345585.1|625587_626814_-|transposase	IS256-like element ISXax1 family transposase	transposase	A0A218MNI5	uncultured_virus	50.3	2.2e-52
WP_033481814.1|626987_629381_+	class I SAM-dependent DNA methyltransferase	NA	Q6NE04	Leptospira_phage	32.2	5.3e-106
WP_033481816.1|629383_631483_+	DEAD/DEAH box helicase	NA	NA	NA	NA	NA
WP_022558641.1|631475_632657_+	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_022558642.1|633080_634976_+	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_131701852.1|635254_635455_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011345585.1|635559_636786_-|transposase	IS256-like element ISXax1 family transposase	transposase	A0A218MNI5	uncultured_virus	50.3	2.2e-52
WP_022558643.1|636839_637274_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022558644.1|637331_638195_-	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_022558645.1|638215_638536_-	helix-turn-helix transcriptional regulator	NA	F8TVE5	EBPR_siphovirus	32.3	8.3e-07
WP_022558648.1|639775_640213_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033481788.1|640272_641397_+	DUF4062 domain-containing protein	NA	NA	NA	NA	NA
WP_033481790.1|641421_641934_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022558651.1|642023_642914_+	MobA/MobL family protein	NA	NA	NA	NA	NA
WP_022558652.1|642927_643122_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080720971.1|643138_643468_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022558654.1|643575_643887_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022558655.1|644031_644400_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_022558656.1|644742_646383_+	MobA/MobL family protein	NA	NA	NA	NA	NA
WP_131701854.1|646550_646778_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080720970.1|646804_647401_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022558657.1|647472_648423_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011345585.1|648527_649754_+|transposase	IS256-like element ISXax1 family transposase	transposase	A0A218MNI5	uncultured_virus	50.3	2.2e-52
WP_033481809.1|650644_651304_+	thermonuclease family protein	NA	NA	NA	NA	NA
WP_003490667.1|651414_651807_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003490669.1|651897_652290_+	H-NS histone family protein	NA	NA	NA	NA	NA
WP_007962333.1|652923_655056_-	glycogen debranching protein GlgX	NA	NA	NA	NA	NA
WP_022558661.1|655552_656440_+	30S ribosomal protein S6--L-glutamate ligase	NA	A0A1D7SR78	Cyanophage	32.4	2.7e-31
WP_033481811.1|656626_657103_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003490678.1|657128_657806_+	response regulator transcription factor	NA	Q6XM27	Feldmannia_irregularis_virus	27.4	7.4e-05
WP_080720975.1|657975_659133_+	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
658627:658642	attR	CGCATCCAGCGCGCCG	NA	NA	NA	NA
WP_022558664.1|659234_659630_-	type I toxin-antitoxin system SymE family toxin	NA	NA	NA	NA	NA
WP_007975311.1|659885_660866_-|transposase	IS5-like element ISXfu2 family transposase	transposase	A0A077K814	Ralstonia_phage	59.5	1.1e-97
WP_127171639.1|661340_661715_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011345585.1|664535_665762_+|transposase	IS256-like element ISXax1 family transposase	transposase	A0A218MNI5	uncultured_virus	50.3	2.2e-52
>prophage 3
NZ_CP021001	Xanthomonas citri pv. phaseoli var. fuscans strain CFBP6166 chromosome, complete genome	5025712	1227402	1315678	5025712	protease,transposase	Ralstonia_phage(17.65%)	56	NA	NA
WP_003486879.1|1227402_1228098_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_022558994.1|1228282_1230298_-	M13 family metallopeptidase	NA	NA	NA	NA	NA
WP_022558995.1|1230481_1232581_-	M13 family metallopeptidase	NA	E3T4I7	Cafeteria_roenbergensis_virus	30.7	6.7e-73
WP_022558996.1|1232965_1235107_-	metallopeptidase	NA	A0A1V0SHG2	Klosneuvirus	27.7	3.4e-72
WP_048481479.1|1235419_1237180_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_022557821.1|1237293_1238277_+|transposase	IS5-like element ISXfu1 family transposase	transposase	A0A077K814	Ralstonia_phage	59.9	8.2e-98
WP_007963962.1|1238391_1241454_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_022558998.1|1241813_1244615_-	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	35.6	1.1e-14
WP_007963958.1|1244952_1245804_+	iron-sulfur cluster carrier protein ApbC	NA	Q8JL10	Natrialba_phage	27.0	7.1e-05
WP_022558999.1|1245900_1246470_+	dCTP deaminase	NA	S5VM63	Pseudomonas_phage	70.6	4.1e-73
WP_022559000.1|1246626_1246812_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003486900.1|1247057_1247225_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005912999.1|1247252_1247687_-	HIT family protein	NA	NA	NA	NA	NA
WP_007963954.1|1247683_1248346_-	dienelactone hydrolase family protein	NA	NA	NA	NA	NA
WP_022559001.1|1248631_1248892_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022559002.1|1248888_1249965_+	DUF262 domain-containing protein	NA	A0A0R6PKN1	Moraxella_phage	35.8	1.4e-50
WP_033481761.1|1249965_1250703_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022559004.1|1250699_1251758_+	DNA cytosine methyltransferase	NA	A0A0R6PG08	Moraxella_phage	55.8	1.7e-104
WP_022559005.1|1251711_1252155_-	very short patch repair endonuclease	NA	E5E3X5	Burkholderia_phage	38.8	9.7e-14
WP_011345585.1|1252592_1253819_-|transposase	IS256-like element ISXax1 family transposase	transposase	A0A218MNI5	uncultured_virus	50.3	2.2e-52
WP_022559006.1|1255673_1256147_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080720949.1|1256590_1256809_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022559008.1|1257028_1258177_+	N-acetylmuramoyl-L-alanine amidase	NA	M1IEI0	Bacillus_phage	40.6	1.4e-08
WP_022559009.1|1258213_1259131_+	GTP cyclohydrolase I FolE2	NA	NA	NA	NA	NA
WP_007965770.1|1259740_1261108_+	polynucleotide adenylyltransferase PcnB	NA	A0A1B1IVF3	uncultured_Mediterranean_phage	38.4	1.2e-25
WP_007965767.1|1261111_1261597_+	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_022559011.1|1261632_1262448_+	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	A0A0N7HVJ8	Ostreococcus_lucimarinus_virus	34.6	4.2e-31
WP_007965764.1|1262444_1263287_+	pantoate--beta-alanine ligase	NA	NA	NA	NA	NA
WP_022559012.1|1263454_1263835_+	aspartate 1-decarboxylase	NA	NA	NA	NA	NA
WP_022559013.1|1263831_1265346_+	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_022559014.1|1265502_1265847_+	type II toxin-antitoxin system prevent-host-death family antitoxin	NA	NA	NA	NA	NA
WP_007965756.1|1265850_1266474_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022559016.1|1266685_1268641_-	DUF839 domain-containing protein	NA	NA	NA	NA	NA
WP_022559017.1|1269075_1271688_+	glycoside hydrolase family 3 protein	NA	NA	NA	NA	NA
WP_022559018.1|1271945_1273508_+	sodium/solute symporter	NA	A0A240F465	Aeromonas_phage	41.0	3.6e-87
WP_022559019.1|1273706_1275563_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_022559020.1|1276011_1276998_+	cellulase family glycosylhydrolase	NA	NA	NA	NA	NA
WP_003481988.1|1277180_1277747_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_080720948.1|1277743_1278973_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_022559022.1|1279175_1280441_+	flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase	NA	NA	NA	NA	NA
WP_022559023.1|1282774_1283479_-	aspartate/glutamate racemase family protein	NA	NA	NA	NA	NA
WP_099770954.1|1283622_1284492_-	DMT family transporter	NA	NA	NA	NA	NA
WP_022559025.1|1284527_1285580_-	UDP-N-acetylmuramate dehydrogenase	NA	NA	NA	NA	NA
WP_007965740.1|1285576_1286632_-	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_022559026.1|1286637_1287411_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_033481610.1|1287407_1287692_-	DUF4190 domain-containing protein	NA	NA	NA	NA	NA
WP_022559029.1|1288272_1289805_-	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_022559030.1|1290389_1290836_-	poly-beta-1,6-N-acetyl-D-glucosamine biosynthesis protein PgaD	NA	NA	NA	NA	NA
WP_022559031.1|1290832_1292086_-	poly-beta-1,6 N-acetyl-D-glucosamine synthase	NA	NA	NA	NA	NA
WP_022559032.1|1292089_1293988_-	poly-beta-1,6-N-acetyl-D-glucosamine N-deacetylase PgaB	NA	NA	NA	NA	NA
WP_033481600.1|1293969_1295928_-	poly-beta-1,6 N-acetyl-D-glucosamine export porin PgaA	NA	NA	NA	NA	NA
WP_033481602.1|1296659_1298360_+	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	NA	NA	NA	NA
WP_011345585.1|1311999_1313226_-|transposase	IS256-like element ISXax1 family transposase	transposase	A0A218MNI5	uncultured_virus	50.3	2.2e-52
WP_022557821.1|1313304_1314288_-|transposase	IS5-like element ISXfu1 family transposase	transposase	A0A077K814	Ralstonia_phage	59.9	8.2e-98
WP_145958483.1|1314309_1314594_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007975311.1|1314697_1315678_-|transposase	IS5-like element ISXfu2 family transposase	transposase	A0A077K814	Ralstonia_phage	59.5	1.1e-97
>prophage 4
NZ_CP021001	Xanthomonas citri pv. phaseoli var. fuscans strain CFBP6166 chromosome, complete genome	5025712	1490846	1544519	5025712	tRNA,protease,transposase	Ralstonia_phage(27.27%)	51	NA	NA
WP_007975311.1|1490846_1491827_-|transposase	IS5-like element ISXfu2 family transposase	transposase	A0A077K814	Ralstonia_phage	59.5	1.1e-97
WP_011345585.1|1492388_1493615_+|transposase	IS256-like element ISXax1 family transposase	transposase	A0A218MNI5	uncultured_virus	50.3	2.2e-52
WP_099421717.1|1494381_1494987_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033481747.1|1495023_1496547_-	FkbM family methyltransferase	NA	NA	NA	NA	NA
WP_033481745.1|1496543_1497167_-	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_033481744.1|1497156_1498302_-	Rieske 2Fe-2S domain-containing protein	NA	NA	NA	NA	NA
WP_017154665.1|1498305_1498959_-	acetyltransferase	NA	NA	NA	NA	NA
WP_033481743.1|1498955_1499690_-	SDR family oxidoreductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	26.8	1.7e-07
WP_007962158.1|1499686_1500451_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_033481742.1|1500447_1501485_-	ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
WP_003482998.1|1501490_1501712_-	acyl carrier protein	NA	NA	NA	NA	NA
WP_033481740.1|1501776_1502886_-	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	NA	NA	NA	NA
WP_033481738.1|1503004_1504489_-	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_003482992.1|1504481_1504865_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_033481737.1|1504873_1506277_-	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_003482986.1|1506493_1507126_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_033481736.1|1507194_1507761_-	PilZ domain-containing protein	NA	NA	NA	NA	NA
WP_008575949.1|1507760_1508054_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003482976.1|1508062_1508476_-	flagellar export chaperone FliS	NA	NA	NA	NA	NA
WP_033481735.1|1508626_1509952_-	flagellar filament capping protein FliD	NA	NA	NA	NA	NA
WP_127459501.1|1509932_1510214_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007962409.1|1510221_1511421_-	flagellin	NA	NA	NA	NA	NA
WP_007975311.1|1511606_1512587_+|transposase	IS5-like element ISXfu2 family transposase	transposase	A0A077K814	Ralstonia_phage	59.5	1.1e-97
WP_003482970.1|1512900_1514106_-	flagellar hook-associated protein FlgL	NA	NA	NA	NA	NA
WP_033481772.1|1514105_1515980_-	flagellar hook-associated protein FlgK	NA	NA	NA	NA	NA
WP_007971975.1|1515991_1517170_-	flagellar assembly peptidoglycan hydrolase FlgJ	NA	A0A0A7RU71	Clostridium_phage	41.9	5.5e-16
WP_007971976.1|1517171_1518290_-	flagellar basal body P-ring protein FlgI	NA	NA	NA	NA	NA
WP_007971977.1|1518300_1518993_-	flagellar basal body L-ring protein FlgH	NA	NA	NA	NA	NA
WP_003482961.1|1519031_1519817_-	flagellar basal-body rod protein FlgG	NA	NA	NA	NA	NA
WP_019300290.1|1520579_1521335_-	flagellar basal-body rod protein FlgF	NA	NA	NA	NA	NA
WP_003482957.1|1521479_1522703_-	flagellar hook protein FlgE	NA	NA	NA	NA	NA
WP_003482955.1|1522734_1523400_-	flagellar basal body rod modification protein FlgD	NA	NA	NA	NA	NA
WP_003482953.1|1523437_1523845_-	flagellar basal body rod protein FlgC	NA	NA	NA	NA	NA
WP_033481774.1|1523848_1524250_-	flagellar basal body rod protein FlgB	NA	NA	NA	NA	NA
WP_003482947.1|1524571_1525516_-	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	30.0	5.6e-27
WP_007975311.1|1525708_1526689_-|transposase	IS5-like element ISXfu2 family transposase	transposase	A0A077K814	Ralstonia_phage	59.5	1.1e-97
WP_123766556.1|1526763_1526991_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022559119.1|1526989_1527634_+	flagellar basal body P-ring formation protein FlgA	NA	NA	NA	NA	NA
WP_003482943.1|1527700_1528012_+	flagellar biosynthesis anti-sigma factor FlgM	NA	NA	NA	NA	NA
WP_003482942.1|1528027_1528360_+	flagella protein	NA	NA	NA	NA	NA
WP_022559120.1|1528526_1529753_+	sensory protein of a two component system	NA	NA	NA	NA	NA
WP_007964288.1|1529879_1531601_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_046121200.1|1531604_1533698_-	PAS domain S-box protein	NA	NA	NA	NA	NA
WP_080720667.1|1534127_1536644_+	EAL domain-containing protein	NA	G3MA91	Bacillus_virus	34.1	5.5e-13
WP_022559123.1|1537603_1537891_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005914458.1|1537977_1539168_-	chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	32.2	3.1e-14
WP_007964280.1|1539314_1539929_-	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_022559124.1|1539928_1541065_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_022559125.1|1541061_1541520_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_005914463.1|1541773_1542094_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	1.0e-12
WP_022559128.1|1542236_1544519_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	45.0	1.3e-175
>prophage 5
NZ_CP021001	Xanthomonas citri pv. phaseoli var. fuscans strain CFBP6166 chromosome, complete genome	5025712	1681562	1691022	5025712	transposase,coat	Xanthomonas_phage(45.45%)	15	NA	NA
WP_022559200.1|1681562_1682366_+	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	25.6	2.0e-09
WP_033481018.1|1682547_1682886_+	phage-like protein	NA	Q38057	Xanthomonas_phage	74.1	8.3e-42
WP_022559202.1|1682952_1683264_+	hypothetical protein	NA	A0A1W6DXV7	Xanthomonas_phage	92.2	1.0e-49
WP_022559203.1|1683283_1684606_-	filamentous phage protein I	NA	Q4LAU4	Stenotrophomonas_phage	56.5	1.2e-131
WP_022559204.1|1684607_1684928_-	hypothetical protein	NA	Q4LAU3	Stenotrophomonas_phage	44.2	3.5e-21
WP_080720658.1|1684938_1686012_-	attachment protein	NA	Q9XJ91	Xanthomonas_phage	66.6	5.2e-45
WP_005918131.1|1686108_1686237_-|coat	Phi-Lf prophage-derived major coat protein	coat	NA	NA	NA	NA
WP_005918133.1|1686268_1686385_-|coat	Phi-Lf prophage-derived minor coat protein	coat	NA	NA	NA	NA
WP_080720657.1|1686330_1686492_-|coat	coat protein	coat	NA	NA	NA	NA
WP_022559206.1|1686523_1686820_-	DNA-binding protein	NA	B1NI78	Stenotrophomonas_phage	66.3	1.9e-26
WP_022559207.1|1686816_1687926_-	phage-related protein	NA	S0F3I3	Stenotrophomonas_phage	75.0	1.0e-160
WP_022559208.1|1687918_1688101_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022559209.1|1688097_1688322_-	hypothetical protein	NA	A0A1D6ZIV2	Xanthomonas_phage	78.5	2.1e-17
WP_022559210.1|1688449_1688845_+	filamentous phage Phi Lf replication initiation protein II	NA	A0A077JCZ5	Xanthomonas_phage	76.2	4.5e-47
WP_011345585.1|1689795_1691022_+|transposase	IS256-like element ISXax1 family transposase	transposase	A0A218MNI5	uncultured_virus	50.3	2.2e-52
>prophage 6
NZ_CP021001	Xanthomonas citri pv. phaseoli var. fuscans strain CFBP6166 chromosome, complete genome	5025712	1963449	2045087	5025712	tRNA,transposase	uncultured_Mediterranean_phage(37.5%)	52	NA	NA
WP_022559372.1|1963449_1964289_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1INV8	uncultured_Mediterranean_phage	39.8	6.3e-14
WP_007972342.1|1964520_1965825_+	DUF445 family protein	NA	NA	NA	NA	NA
WP_022559373.1|1965968_1970063_+	response regulator	NA	A0A1V0SGX0	Hokovirus	28.9	1.2e-57
WP_007962775.1|1970096_1971083_+	response regulator	NA	W8CYM9	Bacillus_phage	27.6	1.3e-05
WP_022559374.1|1971646_1973083_+	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_022559375.1|1973277_1973700_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022559376.1|1973696_1974047_-	oxidoreductase	NA	NA	NA	NA	NA
WP_007975311.1|1974273_1975254_-|transposase	IS5-like element ISXfu2 family transposase	transposase	A0A077K814	Ralstonia_phage	59.5	1.1e-97
WP_022559377.1|1975388_1976243_-	oxidoreductase	NA	NA	NA	NA	NA
WP_022559378.1|1976383_1976959_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_022559379.1|1977090_1978173_+	alkene reductase	NA	NA	NA	NA	NA
WP_022559380.1|1978221_1979010_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_022559381.1|1979234_1980236_+	NADP-dependent oxidoreductase	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	27.0	1.3e-05
WP_033481698.1|1980505_1980802_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033481697.1|1981303_1986313_-	glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_007962520.1|1986591_1987251_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_022559385.1|1987265_1988570_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_007969992.1|1988582_1991753_+	multidrug efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_022559386.1|1992090_1993086_-	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_022559387.1|1993247_1995764_+	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	29.3	1.5e-10
WP_022559388.1|1995760_1996717_+	1-phosphofructokinase	NA	NA	NA	NA	NA
WP_022559389.1|1996869_1998591_+	PTS fructose transporter subunit IIB'BC	NA	NA	NA	NA	NA
WP_046833752.1|1998904_2000041_+	carbohydrate porin	NA	NA	NA	NA	NA
WP_022559391.1|2000276_2000927_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011345585.1|2006122_2007349_+|transposase	IS256-like element ISXax1 family transposase	transposase	A0A218MNI5	uncultured_virus	50.3	2.2e-52
WP_158525803.1|2007912_2008083_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011345585.1|2008149_2009376_+|transposase	IS256-like element ISXax1 family transposase	transposase	A0A218MNI5	uncultured_virus	50.3	2.2e-52
WP_080948419.1|2009366_2009891_-	DUF1629 domain-containing protein	NA	NA	NA	NA	NA
WP_145958732.1|2010364_2010625_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007975311.1|2010789_2011770_-|transposase	IS5-like element ISXfu2 family transposase	transposase	A0A077K814	Ralstonia_phage	59.5	1.1e-97
WP_007975311.1|2012139_2013120_+|transposase	IS5-like element ISXfu2 family transposase	transposase	A0A077K814	Ralstonia_phage	59.5	1.1e-97
WP_022559396.1|2013853_2014411_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003489762.1|2015837_2016806_-	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	29.5	2.0e-27
WP_080720938.1|2016865_2018734_-	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_003489768.1|2018900_2019254_-	preprotein translocase subunit YajC	NA	NA	NA	NA	NA
WP_022559400.1|2019385_2020531_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	45.6	1.4e-85
WP_022559401.1|2020612_2021683_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_022559402.1|2021838_2022270_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_022559403.1|2022392_2023889_+	aminotransferase class III-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_022559404.1|2024240_2024948_-	glycosyl transferase	NA	NA	NA	NA	NA
WP_022559405.1|2025321_2026701_-	metallophosphoesterase family protein	NA	NA	NA	NA	NA
WP_096035810.1|2026697_2027816_-	phytase	NA	NA	NA	NA	NA
WP_080720939.1|2027815_2030332_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_005931906.1|2030525_2031158_+	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_022559408.1|2031459_2033220_-	cellulase precursor	NA	NA	NA	NA	NA
WP_022559409.1|2033509_2035288_-	gamma-glutamyltransferase	NA	NA	NA	NA	NA
WP_003489796.1|2035284_2035569_-	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	57.0	1.1e-18
WP_003489798.1|2035801_2036287_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005917071.1|2036345_2036852_-	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	41.1	6.2e-25
WP_007970851.1|2036848_2037472_-	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
WP_022559410.1|2037711_2039616_+	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	36.7	4.6e-113
WP_007975311.1|2044106_2045087_-|transposase	IS5-like element ISXfu2 family transposase	transposase	A0A077K814	Ralstonia_phage	59.5	1.1e-97
>prophage 7
NZ_CP021001	Xanthomonas citri pv. phaseoli var. fuscans strain CFBP6166 chromosome, complete genome	5025712	2072645	2111148	5025712	transposase,integrase	Ralstonia_phage(83.33%)	36	2101629:2101683	2111149:2111203
WP_007975311.1|2072645_2073626_+|transposase	IS5-like element ISXfu2 family transposase	transposase	A0A077K814	Ralstonia_phage	59.5	1.1e-97
WP_080720940.1|2074363_2074630_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022559424.1|2074540_2074837_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033481652.1|2074929_2076570_-	DUF5597 domain-containg protein	NA	NA	NA	NA	NA
WP_022559426.1|2076566_2078906_-	S9 family peptidase	NA	NA	NA	NA	NA
WP_022559427.1|2078895_2080482_-	APC family permease	NA	NA	NA	NA	NA
WP_022559428.1|2080545_2082411_-	DUF885 family protein	NA	NA	NA	NA	NA
WP_022559429.1|2082407_2084225_-	DUF885 family protein	NA	NA	NA	NA	NA
WP_022559430.1|2084342_2085542_-	aminopeptidase P family protein	NA	NA	NA	NA	NA
WP_022559431.1|2085538_2087155_-	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_022559432.1|2087365_2088274_-	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
WP_080720942.1|2088270_2089605_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_022559434.1|2089576_2089822_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022559435.1|2089818_2091096_-	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_022559436.1|2091095_2092034_-	proline racemase	NA	NA	NA	NA	NA
WP_007965956.1|2092194_2092911_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_033481654.1|2093116_2094727_+	signal recognition particle-docking protein FtsY	NA	NA	NA	NA	NA
WP_022559439.1|2095073_2096147_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_008571381.1|2096170_2096446_+	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_007965960.1|2096821_2098444_-	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_022559440.1|2098775_2099234_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005914053.1|2099666_2099867_+	general stress protein	NA	NA	NA	NA	NA
WP_022559441.1|2100104_2100959_+	excinuclease Cho	NA	NA	NA	NA	NA
WP_005914051.1|2101113_2101389_-	hypothetical protein	NA	NA	NA	NA	NA
2101629:2101683	attL	GGCTTGGATATGGTGGCCGAGGACGGAATCGAACCGCCGACACGGGGATTTTCAA	NA	NA	NA	NA
WP_033481656.1|2101982_2102246_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007975311.1|2102473_2103454_-|transposase	IS5-like element ISXfu2 family transposase	transposase	A0A077K814	Ralstonia_phage	59.5	1.1e-97
WP_022559443.1|2103589_2104147_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022559445.1|2104563_2104743_+	hypothetical protein	NA	NA	NA	NA	NA
WP_127459505.1|2104711_2105245_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022557821.1|2105408_2106392_+|transposase	IS5-like element ISXfu1 family transposase	transposase	A0A077K814	Ralstonia_phage	59.9	8.2e-98
WP_131701847.1|2106524_2106719_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022557821.1|2106797_2107781_+|transposase	IS5-like element ISXfu1 family transposase	transposase	A0A077K814	Ralstonia_phage	59.9	8.2e-98
WP_131705194.1|2107852_2108443_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007975311.1|2109089_2110070_+|transposase	IS5-like element ISXfu2 family transposase	transposase	A0A077K814	Ralstonia_phage	59.5	1.1e-97
WP_022559447.1|2110301_2110490_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022559448.1|2110497_2111148_+|integrase	site-specific integrase	integrase	K4PAZ9	Burkholderia_phage	52.0	6.1e-41
2111149:2111203	attR	GGCTTGGATATGGTGGCCGAGGACGGAATCGAACCGCCGACACGGGGATTTTCAA	NA	NA	NA	NA
>prophage 8
NZ_CP021001	Xanthomonas citri pv. phaseoli var. fuscans strain CFBP6166 chromosome, complete genome	5025712	2303973	2314741	5025712	tRNA	uncultured_Caudovirales_phage(16.67%)	7	NA	NA
WP_033481262.1|2303973_2305932_-	PAS domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	42.0	1.6e-12
WP_003481884.1|2307240_2307453_-	carbon storage regulator CsrA	NA	J7I430	Pseudomonas_phage	76.5	1.3e-13
WP_022559538.1|2307592_2310241_-|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	40.0	1.7e-84
WP_007966764.1|2310342_2310831_-	recombination regulator RecX	NA	NA	NA	NA	NA
WP_003481871.1|2311128_2312163_-	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	61.3	5.1e-114
WP_007966767.1|2312335_2312977_-	transcriptional repressor LexA	NA	A0A1W6JNS2	Morganella_phage	40.2	2.4e-13
WP_022559539.1|2313064_2314741_-	2-polyprenylphenol 6-hydroxylase	NA	G8DDN0	Micromonas_pusilla_virus	29.7	1.1e-41
>prophage 9
NZ_CP021001	Xanthomonas citri pv. phaseoli var. fuscans strain CFBP6166 chromosome, complete genome	5025712	2729699	2790778	5025712	protease,transposase	Tupanvirus(16.67%)	52	NA	NA
WP_022559762.1|2729699_2732540_-|protease	autotransporter serine protease	protease	A0A1V0SBG2	Catovirus	24.3	3.9e-07
WP_022559763.1|2732696_2733872_+	acetyl-CoA C-acyltransferase	NA	NA	NA	NA	NA
WP_003489455.1|2733994_2734336_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022559764.1|2734564_2734891_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022559765.1|2734998_2736708_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	37.5	9.5e-17
WP_022559766.1|2736946_2737504_+	polymer-forming cytoskeletal protein	NA	NA	NA	NA	NA
WP_003489443.1|2737500_2737866_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007967364.1|2738104_2739127_+	ligase-associated DNA damage response exonuclease	NA	NA	NA	NA	NA
WP_022559767.1|2739123_2739357_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022559768.1|2739353_2740958_+	ATP-dependent DNA ligase	NA	A0A2H4JD86	uncultured_Caudovirales_phage	29.0	2.4e-09
WP_022559769.1|2740954_2743456_+	ligase-associated DNA damage response DEXH box helicase	NA	NA	NA	NA	NA
WP_022559770.1|2743445_2744090_+	ligase-associated DNA damage response endonuclease PdeM	NA	NA	NA	NA	NA
WP_022559771.1|2744117_2745389_-	FAD-dependent monooxygenase	NA	NA	NA	NA	NA
WP_003488188.1|2745484_2745691_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	70.1	9.3e-20
WP_003488190.1|2745778_2746531_-	S-methyl-5'-thioinosine phosphorylase	NA	NA	NA	NA	NA
WP_003488192.1|2746613_2747168_-	hypoxanthine-guanine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_022559772.1|2747167_2748172_-	beta-N-acetylhexosaminidase	NA	NA	NA	NA	NA
WP_022559773.1|2748289_2749867_-	cryptochrome/photolyase family protein	NA	E3T4R9	Cafeteria_roenbergensis_virus	28.0	6.9e-46
WP_033481246.1|2750047_2751082_-	NAD(P)-binding protein	NA	NA	NA	NA	NA
WP_033481244.1|2751098_2751782_-	DsbA family oxidoreductase	NA	NA	NA	NA	NA
WP_022559776.1|2751998_2752496_-	CYTH domain-containing protein	NA	NA	NA	NA	NA
WP_033481243.1|2752671_2754006_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	F5CA72	Streptococcus_phi-m46.1-like_phage	27.2	5.0e-29
WP_022559778.1|2754165_2754888_+	hybrid sensor histidine kinase/response regulator	NA	NA	NA	NA	NA
WP_022559779.1|2755285_2756008_-	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_022559780.1|2756240_2757140_-	GTPase Era	NA	NA	NA	NA	NA
WP_022559781.1|2757136_2757817_-	ribonuclease III	NA	A0A2K9L8W0	Tupanvirus	29.5	1.7e-17
WP_016850781.1|2757806_2758214_-	DUF4845 domain-containing protein	NA	NA	NA	NA	NA
WP_007970507.1|2758214_2759015_-	signal peptidase I	NA	NA	NA	NA	NA
WP_007967401.1|2759112_2760918_-	elongation factor 4	NA	A0A2K9L6L3	Tupanvirus	41.2	1.6e-22
WP_022559782.1|2761085_2762663_-|protease	DegQ family serine endoprotease	protease	A0A1B1IT49	uncultured_Mediterranean_phage	29.9	1.6e-26
WP_022559783.1|2762772_2763666_-	sigma-E factor negative regulatory protein	NA	NA	NA	NA	NA
WP_022559784.1|2763662_2764283_-	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
WP_022559785.1|2764518_2766600_+	fatty acid oxidation complex, subunit alpha fadj protein	NA	NA	NA	NA	NA
WP_157768171.1|2766725_2766863_-	hypothetical protein	NA	NA	NA	NA	NA
WP_123766548.1|2766875_2767229_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022559786.1|2767279_2767573_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_007975311.1|2768602_2769583_+|transposase	IS5-like element ISXfu2 family transposase	transposase	A0A077K814	Ralstonia_phage	59.5	1.1e-97
WP_007975311.1|2769919_2770900_+|transposase	IS5-like element ISXfu2 family transposase	transposase	A0A077K814	Ralstonia_phage	59.5	1.1e-97
WP_022559787.1|2771321_2771525_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022559788.1|2771665_2772631_-	cation transporter	NA	NA	NA	NA	NA
WP_022559789.1|2772850_2773738_-	3-hydroxyisobutyrate dehydrogenase	NA	NA	NA	NA	NA
WP_022559790.1|2773908_2775096_-	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_022559791.1|2775095_2775893_-	enoyl-CoA hydratase	NA	NA	NA	NA	NA
WP_022559792.1|2775889_2777071_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_022559793.1|2777081_2778587_-	CoA-acylating methylmalonate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_033481709.1|2778724_2780110_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_022559795.1|2780629_2783323_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_022559796.1|2783512_2784724_+	arabinogalactan endo-1,4-beta-galactosidase	NA	NA	NA	NA	NA
WP_022559797.1|2784720_2787285_+	glycoside hydrolase family 2 protein	NA	L0N6M2	Herpes_simplex_virus	27.3	1.1e-29
WP_033481711.1|2787522_2787876_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022559798.1|2788043_2789972_-	alpha-L-fucosidase	NA	NA	NA	NA	NA
WP_033481713.1|2790511_2790778_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 10
NZ_CP021001	Xanthomonas citri pv. phaseoli var. fuscans strain CFBP6166 chromosome, complete genome	5025712	2998626	3039017	5025712	protease,transposase	uncultured_virus(33.33%)	29	NA	NA
WP_011345585.1|2998626_2999853_+|transposase	IS256-like element ISXax1 family transposase	transposase	A0A218MNI5	uncultured_virus	50.3	2.2e-52
WP_046830891.1|2999865_3000513_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039731143.1|3000512_3001259_-	abortive infection family protein	NA	NA	NA	NA	NA
WP_022557849.1|3001554_3002781_-|transposase	IS256-like element ISXax1 family transposase	transposase	A0A218MNI5	uncultured_virus	50.3	2.2e-52
WP_157858990.1|3002872_3003109_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022557849.1|3004060_3005287_+|transposase	IS256-like element ISXax1 family transposase	transposase	A0A218MNI5	uncultured_virus	50.3	2.2e-52
WP_007963395.1|3005476_3005785_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_022559915.1|3005791_3006055_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022559916.1|3006833_3007364_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080720930.1|3007491_3007875_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057668590.1|3008928_3009147_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080720927.1|3009188_3010235_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022559919.1|3010600_3011191_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_007962497.1|3011261_3011975_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_123766547.1|3012228_3012441_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022559921.1|3015736_3017029_-	adenylosuccinate synthase	NA	A0A2R8FF47	Brazilian_cedratvirus	38.0	2.0e-75
WP_022559922.1|3017591_3018056_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007962453.1|3018278_3019142_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_007972198.1|3019141_3020269_-|protease	FtsH protease activity modulator HflK	protease	NA	NA	NA	NA
WP_005996155.1|3020967_3021354_-	response regulator	NA	W8CYM9	Bacillus_phage	31.8	5.6e-10
WP_003483926.1|3021850_3022750_-	DnaJ domain-containing protein	NA	A0A2L0UZR4	Agrobacterium_phage	28.0	7.0e-19
WP_022559923.1|3023161_3023638_-	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
WP_003483924.1|3023800_3024283_+	peroxiredoxin	NA	A0A1D8KSL1	Synechococcus_phage	38.3	7.0e-26
WP_003483923.1|3024325_3024886_+	bacterioferritin	NA	NA	NA	NA	NA
WP_033481616.1|3025233_3027654_-	penicillin-binding protein 1C	NA	NA	NA	NA	NA
WP_007962234.1|3028058_3029006_-	glycerophosphodiester phosphodiesterase family protein	NA	A0A0S2MYI4	Enterococcus_phage	36.0	3.8e-07
WP_022559926.1|3029153_3032141_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_033481614.1|3032363_3037286_-	alpha-2-macroglobulin family protein	NA	NA	NA	NA	NA
WP_007975311.1|3038036_3039017_-|transposase	IS5-like element ISXfu2 family transposase	transposase	A0A077K814	Ralstonia_phage	59.5	1.1e-97
>prophage 11
NZ_CP021001	Xanthomonas citri pv. phaseoli var. fuscans strain CFBP6166 chromosome, complete genome	5025712	3135166	3146935	5025712		Enterobacteria_phage(37.5%)	10	NA	NA
WP_005913455.1|3135166_3136513_+	phosphomannomutase/phosphoglucomutase	NA	A0A127AWJ1	Bacillus_phage	27.1	7.5e-33
WP_022559974.1|3136559_3137963_+	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	30.0	1.1e-47
WP_022559975.1|3138237_3139404_-	nucleotide sugar dehydrogenase	NA	M1HZB2	Paramecium_bursaria_Chlorella_virus	58.6	2.5e-117
WP_007962671.1|3139744_3140644_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.2	4.1e-27
WP_016851441.1|3140640_3141198_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	48.9	6.6e-44
WP_022559976.1|3141194_3142082_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	57.5	1.5e-93
WP_005913448.1|3142133_3143189_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	47.1	1.4e-82
WP_022559977.1|3143408_3144155_+	electron transfer flavoprotein subunit beta/FixA family protein	NA	NA	NA	NA	NA
WP_022559978.1|3144154_3145099_+	electron transfer flavoprotein subunit alpha/FixB family protein	NA	NA	NA	NA	NA
WP_005913435.1|3145978_3146935_+	glycosyltransferase family 2 protein	NA	A0A192Y8W7	Salmonella_phage	27.1	1.8e-25
>prophage 12
NZ_CP021001	Xanthomonas citri pv. phaseoli var. fuscans strain CFBP6166 chromosome, complete genome	5025712	3683056	3744274	5025712	transposase,plate	Ralstonia_phage(28.57%)	37	NA	NA
WP_099770788.1|3683056_3684038_+|transposase	IS5-like element ISXfu1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.2	9.7e-99
WP_033481385.1|3684549_3685266_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007967074.1|3685262_3685829_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022560294.1|3686265_3687165_+	oxygen-dependent coproporphyrinogen oxidase	NA	NA	NA	NA	NA
WP_022560295.1|3688004_3690809_-	DNA polymerase I	NA	A0A218MKQ4	uncultured_virus	30.1	9.6e-67
WP_003487371.1|3690885_3691176_+	DUF2782 domain-containing protein	NA	NA	NA	NA	NA
WP_022560296.1|3691485_3692529_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_022560297.1|3692578_3699706_-	filamentous hemagglutinin N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_033481383.1|3699717_3701394_-	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	NA	NA	NA	NA
WP_022560299.1|3701390_3701852_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022560300.1|3701848_3705538_-	protein kinase	NA	Q0N495	Clanis_bilineata_nucleopolyhedrovirus	29.9	9.2e-09
WP_033481382.1|3706255_3706831_-	type VI secretion system-associated protein TagF	NA	NA	NA	NA	NA
WP_033481381.1|3706827_3710358_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_022560303.1|3710354_3711635_-	type VI secretion system protein TssL	NA	NA	NA	NA	NA
WP_007967095.1|3711616_3712951_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_022560304.1|3713532_3714840_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_022560306.1|3715123_3715672_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022560307.1|3715668_3717636_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	28.7	5.1e-38
WP_022560308.1|3717785_3719117_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_007967108.1|3719346_3719661_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033481380.1|3719704_3722224_-	serine/threonine protein kinase	NA	A0A2P1EMR8	Moumouvirus	29.2	8.0e-12
WP_033481379.1|3722202_3722742_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_022560311.1|3723091_3723619_+	RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_033481384.1|3723615_3724686_+	DUF4880 domain-containing protein	NA	NA	NA	NA	NA
WP_022560313.1|3725151_3728037_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_022560314.1|3728140_3729442_+	histidine-type phosphatase	NA	NA	NA	NA	NA
WP_007967121.1|3729512_3730817_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022560315.1|3731434_3732178_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022560316.1|3732582_3734610_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033481378.1|3734922_3735186_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011345585.1|3735336_3736563_-|transposase	IS256-like element ISXax1 family transposase	transposase	A0A218MNI5	uncultured_virus	50.3	2.2e-52
WP_123766583.1|3736739_3737234_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022560317.1|3737367_3737865_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022560318.1|3738078_3740823_-	type VI secretion system ATPase TssH	NA	H6X3M6	Enterobacteria_phage	29.4	6.7e-81
WP_022560319.1|3740878_3741919_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_022560320.1|3741882_3743766_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_007964038.1|3743770_3744274_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
>prophage 13
NZ_CP021001	Xanthomonas citri pv. phaseoli var. fuscans strain CFBP6166 chromosome, complete genome	5025712	3970502	4011084	5025712	tail,transposase	Ralstonia_phage(33.33%)	25	NA	NA
WP_011345585.1|3970502_3971729_-|transposase	IS256-like element ISXax1 family transposase	transposase	A0A218MNI5	uncultured_virus	50.3	2.2e-52
WP_022560442.1|3972237_3973857_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022560443.1|3973960_3974359_-	DUF2384 domain-containing protein	NA	NA	NA	NA	NA
WP_046121223.1|3975122_3975815_-	DUF2306 domain-containing protein	NA	NA	NA	NA	NA
WP_022560447.1|3975845_3976748_-	ribosomal large subunit pseudouridine synthase	NA	NA	NA	NA	NA
WP_022560449.1|3977080_3978658_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022560450.1|3979134_3979971_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007975311.1|3980408_3981389_-|transposase	IS5-like element ISXfu2 family transposase	transposase	A0A077K814	Ralstonia_phage	59.5	1.1e-97
WP_022557821.1|3981526_3982510_+|transposase	IS5-like element ISXfu1 family transposase	transposase	A0A077K814	Ralstonia_phage	59.9	8.2e-98
WP_033481960.1|3982951_3983218_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007975311.1|3983718_3984699_+|transposase	IS5-like element ISXfu2 family transposase	transposase	A0A077K814	Ralstonia_phage	59.5	1.1e-97
WP_022560451.1|3985528_3986005_-	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_022560452.1|3986067_3986637_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_033481799.1|3986757_3987330_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_022560454.1|3987414_3988158_+	glucose 1-dehydrogenase	NA	A0A0M4JSW6	Mollivirus	28.8	5.0e-15
WP_003482333.1|3989711_3990044_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022560456.1|3990234_3992160_+	M61 family metallopeptidase	NA	NA	NA	NA	NA
WP_005912356.1|3992308_3992407_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022560457.1|3992508_3993903_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022560458.1|3994474_3996913_-	AAA family ATPase	NA	A0A0N9S864	Staphylococcus_phage	43.6	8.0e-09
WP_022560459.1|3997115_4001138_-	exodeoxyribonuclease V subunit beta	NA	S5MMD7	Bacillus_phage	21.5	7.0e-10
WP_033481432.1|4001134_4004539_-	exodeoxyribonuclease V subunit gamma	NA	NA	NA	NA	NA
WP_022560461.1|4004888_4009676_-	autotransporter domain-containing protein	NA	F5B3Z3	Synechococcus_phage	45.8	3.4e-19
WP_007968272.1|4009936_4010488_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_007968270.1|4010556_4011084_+|tail	phage tail protein	tail	A0A0U4JYA4	Arthrobacter_phage	28.0	1.0e-09
>prophage 14
NZ_CP021001	Xanthomonas citri pv. phaseoli var. fuscans strain CFBP6166 chromosome, complete genome	5025712	4042770	4106541	5025712	tRNA,protease,transposase	Enterobacteria_phage(10.0%)	48	NA	NA
WP_022560486.1|4042770_4045800_-|transposase	Tn3 family transposase	transposase	NA	NA	NA	NA
WP_022560487.1|4045796_4046390_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	48.6	6.8e-39
WP_022557731.1|4046601_4046856_+	plasmid stability protein	NA	NA	NA	NA	NA
WP_022560489.1|4048167_4049010_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011345585.1|4049586_4050813_-|transposase	IS256-like element ISXax1 family transposase	transposase	A0A218MNI5	uncultured_virus	50.3	2.2e-52
WP_007975311.1|4051654_4052635_+|transposase	IS5-like element ISXfu2 family transposase	transposase	A0A077K814	Ralstonia_phage	59.5	1.1e-97
WP_017158359.1|4052758_4053040_-	hypothetical protein	NA	NA	NA	NA	NA
WP_108702726.1|4053227_4053494_+	hypothetical protein	NA	A0A0P0ZG22	Escherichia_phage	60.0	1.1e-15
WP_011153925.1|4053522_4054152_+	AAA family ATPase	NA	A2I303	Vibrio_virus	44.2	3.8e-40
WP_017154799.1|4054148_4054403_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017154798.1|4054542_4054935_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022560493.1|4057394_4059869_-	glycoside hydrolase family 92 protein	NA	NA	NA	NA	NA
WP_022560494.1|4060708_4061098_-	DUF2628 domain-containing protein	NA	NA	NA	NA	NA
WP_022560495.1|4064501_4065671_-	glycerate kinase	NA	W6LM47	Streptococcus_phage	39.0	4.0e-43
WP_022560496.1|4065696_4067007_-	MFS transporter	NA	NA	NA	NA	NA
WP_022560497.1|4067486_4068743_-	dipeptidase precursor	NA	NA	NA	NA	NA
WP_022560498.1|4069030_4069351_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007968235.1|4069469_4070636_-	class I SAM-dependent rRNA methyltransferase	NA	NA	NA	NA	NA
WP_005912402.1|4070900_4071857_+	TerC family protein	NA	K4F9T9	Cronobacter_phage	31.4	1.3e-31
WP_033481510.1|4072195_4072981_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_033481512.1|4073100_4074195_-	glycerophosphodiester phosphodiesterase	NA	NA	NA	NA	NA
WP_022560502.1|4074340_4076641_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_022560503.1|4076832_4077690_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_022560504.1|4077851_4079192_-|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE	tRNA	NA	NA	NA	NA
WP_022560505.1|4080769_4082494_-	membrane protein insertase YidC	NA	NA	NA	NA	NA
WP_007968218.1|4082519_4082957_-	ribonuclease P protein component	NA	NA	NA	NA	NA
WP_002805908.1|4082995_4083136_-	50S ribosomal protein L34	NA	NA	NA	NA	NA
WP_022557774.1|4083378_4084707_+	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
WP_005912436.1|4084983_4086084_+	DNA polymerase III subunit beta	NA	A0A0A8IL17	Aurantimonas_phage	37.1	1.1e-53
WP_022557775.1|4087117_4088224_+	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_022557776.1|4088338_4090783_+	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	34.7	1.6e-113
WP_022557777.1|4090850_4091687_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_022557778.1|4091871_4092678_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_022557779.1|4092955_4094149_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_005921855.1|4094302_4094971_+	energy transducer TonB	NA	NA	NA	NA	NA
WP_005912445.1|4095057_4095819_+	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_005912447.1|4095865_4096288_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_005912449.1|4096291_4096705_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_022557780.1|4097207_4097615_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_007968197.1|4097867_4098635_-	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_005912451.1|4098642_4098912_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022557781.1|4098986_4100447_-	cardiolipin synthase	NA	NA	NA	NA	NA
WP_022557782.1|4100747_4101473_+	YafY family transcriptional regulator	NA	NA	NA	NA	NA
WP_033481282.1|4101521_4101887_+	DUF1330 domain-containing protein	NA	NA	NA	NA	NA
WP_022557784.1|4102010_4103138_-	PA0069 family radical SAM protein	NA	NA	NA	NA	NA
WP_033481283.1|4103322_4104024_-	2OG-Fe(II) oxygenase	NA	E3SK61	Synechococcus_phage	47.2	1.0e-17
WP_007968187.1|4104288_4105629_-	outer membrane protein transport protein	NA	NA	NA	NA	NA
WP_003482177.1|4105848_4106541_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
>prophage 15
NZ_CP021001	Xanthomonas citri pv. phaseoli var. fuscans strain CFBP6166 chromosome, complete genome	5025712	4209659	4276070	5025712	protease,transposase	Ralstonia_phage(37.5%)	48	NA	NA
WP_022557821.1|4209659_4210643_+|transposase	IS5-like element ISXfu1 family transposase	transposase	A0A077K814	Ralstonia_phage	59.9	8.2e-98
WP_022557821.1|4210825_4211809_+|transposase	IS5-like element ISXfu1 family transposase	transposase	A0A077K814	Ralstonia_phage	59.9	8.2e-98
WP_080720993.1|4212398_4212782_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022557849.1|4213047_4214274_-|transposase	IS256-like element ISXax1 family transposase	transposase	A0A218MNI5	uncultured_virus	50.3	2.2e-52
WP_011345585.1|4214840_4216067_+|transposase	IS256-like element ISXax1 family transposase	transposase	A0A218MNI5	uncultured_virus	50.3	2.2e-52
WP_022557850.1|4216457_4220324_-	secreted protein	NA	NA	NA	NA	NA
WP_007964720.1|4220689_4223470_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_022557851.1|4223755_4224778_+	sugar kinase	NA	NA	NA	NA	NA
WP_033481584.1|4225351_4226560_-	trans-2-enoyl-CoA reductase family protein	NA	NA	NA	NA	NA
WP_022557853.1|4226841_4230189_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_007970760.1|4230185_4230584_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033481586.1|4230722_4231271_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022557855.1|4232321_4232954_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_033481588.1|4232950_4234150_-	sensor histidine kinase	NA	NA	NA	NA	NA
WP_022557857.1|4234235_4235468_-	serine hydrolase	NA	NA	NA	NA	NA
WP_022557858.1|4235715_4236882_+	FMN-dependent L-lactate dehydrogenase LldD	NA	NA	NA	NA	NA
WP_022557859.1|4237018_4237978_-	Ku protein	NA	NA	NA	NA	NA
WP_080720923.1|4237977_4238286_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022557861.1|4238527_4238707_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022557862.1|4238812_4239208_-	DUF779 domain-containing protein	NA	NA	NA	NA	NA
WP_033481593.1|4239385_4240915_-	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_022557865.1|4241999_4242296_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080720924.1|4242502_4244698_-	TonB-dependent receptor	NA	A0A1B0VCF0	Salmonella_phage	41.2	1.1e-68
WP_016849085.1|4244797_4246000_+	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_022557867.1|4246265_4247276_+	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	37.5	1.6e-48
WP_022557868.1|4247524_4247914_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080720925.1|4248316_4249897_+	TldD/PmbA family protein	NA	NA	NA	NA	NA
WP_080950217.1|4250056_4250626_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007970327.1|4250628_4252224_+	TldD/PmbA family protein	NA	NA	NA	NA	NA
WP_007962710.1|4252238_4253573_+	TldD/PmbA family protein	NA	NA	NA	NA	NA
WP_033481683.1|4253569_4254388_+	DUF4159 domain-containing protein	NA	NA	NA	NA	NA
WP_007962712.1|4254519_4255512_+	MoxR family ATPase	NA	NA	NA	NA	NA
WP_007962713.1|4255525_4256422_+	DUF58 domain-containing protein	NA	NA	NA	NA	NA
WP_033481682.1|4256465_4257665_+	membrane protein	NA	NA	NA	NA	NA
WP_080720951.1|4257583_4259920_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022557872.1|4260077_4261859_+	carboxypeptidase regulatory-like domain-containing protein	NA	NA	NA	NA	NA
WP_040092218.1|4262109_4262766_-	DUF938 domain-containing protein	NA	NA	NA	NA	NA
WP_033481679.1|4262943_4263735_-	EcsC family protein	NA	NA	NA	NA	NA
WP_022557875.1|4263905_4264379_+	SRPBCC domain-containing protein	NA	NA	NA	NA	NA
WP_007962295.1|4264714_4266205_-	glycine betaine/L-proline transporter ProP	NA	Q6JIH2	Burkholderia_virus	31.4	1.4e-53
WP_022557876.1|4266737_4267067_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_003487911.1|4267087_4267486_-	host attachment protein	NA	NA	NA	NA	NA
WP_033481685.1|4267867_4271590_-|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_033481677.1|4271873_4272344_-	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_022557879.1|4272577_4273234_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_022557880.1|4273343_4274414_+	M4 family metallopeptidase	NA	NA	NA	NA	NA
WP_022557881.1|4274410_4274722_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007975311.1|4275089_4276070_+|transposase	IS5-like element ISXfu2 family transposase	transposase	A0A077K814	Ralstonia_phage	59.5	1.1e-97
>prophage 16
NZ_CP021001	Xanthomonas citri pv. phaseoli var. fuscans strain CFBP6166 chromosome, complete genome	5025712	4739903	4824957	5025712	protease,transposase	uncultured_virus(13.33%)	58	NA	NA
WP_011345585.1|4739903_4741130_+|transposase	IS256-like element ISXax1 family transposase	transposase	A0A218MNI5	uncultured_virus	50.3	2.2e-52
WP_007975311.1|4741491_4742472_+|transposase	IS5-like element ISXfu2 family transposase	transposase	A0A077K814	Ralstonia_phage	59.5	1.1e-97
WP_080720994.1|4743261_4743651_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011345585.1|4747138_4748365_+|transposase	IS256-like element ISXax1 family transposase	transposase	A0A218MNI5	uncultured_virus	50.3	2.2e-52
WP_022558162.1|4750116_4750923_-	peptidoglycan-binding protein	NA	NA	NA	NA	NA
WP_099770788.1|4751038_4752020_+|transposase	IS5-like element ISXfu1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.2	9.7e-99
WP_022558164.1|4753566_4754301_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_033480920.1|4754350_4755295_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_022558166.1|4755541_4755853_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022558167.1|4755941_4757528_-	SDR family oxidoreductase	NA	M1NLX1	Moumouvirus	27.8	5.0e-36
WP_033480933.1|4757884_4758664_+	SPFH domain-containing protein	NA	A0A2D2W2L0	Stenotrophomonas_phage	68.1	3.1e-92
WP_022558168.1|4758801_4759776_+	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_033480932.1|4759847_4760243_+	VOC family protein	NA	NA	NA	NA	NA
WP_080720613.1|4760356_4760824_-	DUF4126 domain-containing protein	NA	NA	NA	NA	NA
WP_022558171.1|4762956_4763292_+	DUF3817 domain-containing protein	NA	NA	NA	NA	NA
WP_022558173.1|4763692_4766020_-	S9 family peptidase	NA	NA	NA	NA	NA
WP_022558174.1|4766376_4767468_-	DUF1615 domain-containing protein	NA	NA	NA	NA	NA
WP_022558175.1|4767973_4769848_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	31.5	6.3e-14
WP_033480931.1|4770194_4770389_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022558176.1|4770616_4771174_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033480919.1|4771379_4772264_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099770902.1|4772452_4773337_+	DMT family transporter	NA	NA	NA	NA	NA
WP_022558179.1|4773437_4774217_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_022558180.1|4774518_4774734_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022558181.1|4775152_4776529_+	D-serine/D-alanine/glycine transporter	NA	NA	NA	NA	NA
WP_080720610.1|4776615_4777482_-	type III secretion system effector protein	NA	NA	NA	NA	NA
WP_033480917.1|4777865_4778768_+	magnesium transporter CorA family protein	NA	NA	NA	NA	NA
WP_022558183.1|4779082_4779775_-	AIM24 family protein	NA	NA	NA	NA	NA
WP_022558184.1|4780120_4781794_-	alpha,alpha-trehalase TreA	NA	NA	NA	NA	NA
WP_033480916.1|4782942_4783695_+	endonuclease	NA	NA	NA	NA	NA
WP_080720618.1|4784190_4785180_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003489747.1|4785678_4786608_-	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_022558187.1|4787169_4790049_-	insulinase family protein	NA	NA	NA	NA	NA
WP_033480915.1|4790152_4792894_+	PAS domain S-box protein	NA	G3MA91	Bacillus_virus	29.2	2.1e-10
WP_022558189.1|4793613_4795818_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	65.7	3.5e-11
WP_022558190.1|4796069_4797494_-	cellulase family glycosylhydrolase	NA	G0YQI7	Erwinia_phage	33.6	2.1e-54
WP_022558191.1|4797706_4799194_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	56.9	8.3e-126
WP_022558192.1|4800816_4802466_+	M28 family peptidase	NA	NA	NA	NA	NA
WP_127459433.1|4802656_4802905_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022558194.1|4803532_4805470_+	glucans biosynthesis glucosyltransferase MdoH	NA	NA	NA	NA	NA
WP_022558195.1|4805630_4806299_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_007965004.1|4806303_4807356_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	33.5	1.1e-18
WP_022558196.1|4807386_4808124_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_022558197.1|4808154_4809069_+	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
WP_005916853.1|4809394_4810195_-	DUF481 domain-containing protein	NA	NA	NA	NA	NA
WP_005916857.1|4810743_4811709_+	YafY family transcriptional regulator	NA	NA	NA	NA	NA
WP_003482775.1|4811818_4812388_-	lipocalin family protein	NA	NA	NA	NA	NA
WP_022558199.1|4812766_4813078_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007973684.1|4813145_4815239_+	S9 family peptidase	NA	NA	NA	NA	NA
WP_022558200.1|4815629_4816814_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_022558201.1|4816923_4819059_+	S9 family peptidase	NA	F2Y2Z7	Organic_Lake_phycodnavirus	25.4	3.9e-28
WP_003482768.1|4819421_4819820_+	YbaN family protein	NA	NA	NA	NA	NA
WP_022558202.1|4819876_4820131_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022558203.1|4820120_4820975_+	diaminopimelate epimerase	NA	NA	NA	NA	NA
WP_080720608.1|4820962_4821643_+	DUF484 family protein	NA	NA	NA	NA	NA
WP_022558204.1|4821823_4822741_+	tyrosine recombinase XerC	NA	S5M872	Bacillus_phage	26.8	1.3e-12
WP_003482763.1|4822937_4823489_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_022558205.1|4823589_4824957_+|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A2H5BJT2	Erwinia_phage	29.1	1.5e-41
