The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP020967	Xanthomonas phaseoli pv. phaseoli strain CFBP6164 chromosome, complete genome	5254225	381937	497861	5254225	head,terminase,tRNA,integrase,plate,holin,capsid,transposase,tail,portal	Stenotrophomonas_phage(39.53%)	111	415100:415159	441622:441687
WP_099770615.1|381937_383164_-|transposase	IS256-like element ISXax1 family transposase	transposase	A0A218MNI5	uncultured_virus	50.3	2.2e-52
WP_039571822.1|383817_384786_-	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	29.9	8.9e-28
WP_014090428.1|384900_386745_-	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_003489768.1|386935_387289_-	preprotein translocase subunit YajC	NA	NA	NA	NA	NA
WP_017157264.1|387420_388566_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	45.9	1.9e-85
WP_039571816.1|388647_389718_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_017157266.1|389871_390303_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_039571813.1|390424_391921_+	aminotransferase class III-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_039571807.1|392257_392965_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039571804.1|393340_394720_-	metallophosphoesterase family protein	NA	NA	NA	NA	NA
WP_039571802.1|394716_395838_-	phytase	NA	NA	NA	NA	NA
WP_039571799.1|395834_398393_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_039571797.1|398544_399177_+	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_039571795.1|399550_401311_-	glycoside hydrolase family 9 protein	NA	NA	NA	NA	NA
WP_039571790.1|401601_403380_-	gamma-glutamyltransferase	NA	NA	NA	NA	NA
WP_003489796.1|403376_403661_-	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	57.0	1.1e-18
WP_005931897.1|403892_404390_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008574388.1|404436_404943_-	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	41.1	4.8e-25
WP_039571826.1|404939_405563_-	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
WP_039571786.1|405802_407707_+	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	36.4	2.3e-112
WP_087944778.1|408331_409418_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	37.2	1.3e-43
WP_099770616.1|410333_410657_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011051331.1|410677_410944_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_080950371.1|411026_411194_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_039575256.1|411218_411551_-	XRE family transcriptional regulator	NA	A0A1I9L2L2	Xanthomonas_phage	62.4	1.5e-27
WP_080949173.1|412471_413524_-	type III secretion system YopJ family effector AvrBsT	NA	NA	NA	NA	NA
WP_087944778.1|413973_415060_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	37.2	1.3e-43
415100:415159	attL	GCCAACGCCGCTATCATCAACCCCGGACTCTAAACCTGGCCGCTACTCAGGGCGGGGGGA	NA	NA	NA	NA
WP_082331138.1|415690_416494_-	peptidoglycan-binding protein	NA	NA	NA	NA	NA
WP_127446496.1|417052_417643_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080948852.1|417688_418180_-	DUF4189 domain-containing protein	NA	NA	NA	NA	NA
WP_046735970.1|418198_419260_-	type IV secretion system protein	NA	NA	NA	NA	NA
WP_039571411.1|419360_420083_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039571408.1|420189_422643_-	VirB4 family type IV secretion/conjugal transfer ATPase	NA	NA	NA	NA	NA
WP_005914227.1|422744_423056_-	VirB3 family type IV secretion system protein	NA	NA	NA	NA	NA
WP_011051714.1|423048_423459_-	TrbC/VirB2 family protein	NA	NA	NA	NA	NA
WP_039571405.1|423516_424347_-	lytic transglycosylase domain-containing protein	NA	NA	NA	NA	NA
WP_022559478.1|424409_425450_-	P-type DNA transfer ATPase VirB11	NA	NA	NA	NA	NA
WP_039571402.1|425464_426634_-	TrbI/VirB10 family protein	NA	NA	NA	NA	NA
WP_039571399.1|426630_427398_-	TrbG/VirB9 family P-type conjugative transfer protein	NA	NA	NA	NA	NA
WP_039571396.1|427394_428426_-	type IV secretion system protein	NA	NA	NA	NA	NA
WP_039571393.1|428551_428962_-	TcpQ domain-containing protein	NA	NA	NA	NA	NA
WP_017155023.1|429294_430968_-	type IV secretory system conjugative DNA transfer family protein	NA	NA	NA	NA	NA
WP_011347916.1|431004_431247_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039571390.1|432125_434147_-	excinuclease ABC subunit UvrB	NA	NA	NA	NA	NA
WP_080948854.1|434301_434829_+	GspH/FimT family pseudopilin	NA	NA	NA	NA	NA
WP_039571383.1|435043_436273_-|integrase	integrase	integrase	V9IQN0	Stenotrophomonas_phage	53.2	5.3e-118
WP_039571379.1|436272_436491_-	hypothetical protein	NA	V9IQX6	Stenotrophomonas_phage	55.9	3.3e-15
WP_039571376.1|436487_436697_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039571374.1|436693_436966_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039571372.1|436962_437187_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039571370.1|437183_437456_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039571368.1|437448_437631_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039571365.1|437623_438049_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039571362.1|438127_438400_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039571357.1|438399_438687_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039571414.1|438683_438902_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099770619.1|441648_442751_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.7	2.0e-44
441622:441687	attR	TCCCCCCGCCCTGAGTAGCGGCCAGGTTTAGAGTCCGGGGTTGATGATAGCGGCGTTGGCCAACTG	NA	NA	NA	NA
WP_039575081.1|442980_443967_-	phage late control D family protein	NA	A0A2H4JAV0	uncultured_Caudovirales_phage	51.8	1.7e-90
WP_039575084.1|443963_444362_-|tail	phage tail protein	tail	V9IQX3	Stenotrophomonas_phage	61.4	4.6e-39
WP_039575087.1|444374_447245_-|tail	phage tail tape measure protein	tail	V9IQL1	Stenotrophomonas_phage	48.0	1.2e-194
WP_005922203.1|447274_447388_-|tail	GpE family phage tail protein	tail	A0A0M4R2P3	Salmonella_phage	68.6	4.2e-06
WP_039575090.1|447396_447699_-|tail	phage tail assembly protein	tail	V9IQM4	Stenotrophomonas_phage	67.4	4.9e-25
WP_039436037.1|447743_448253_-|tail	phage major tail tube protein	tail	V9IQX1	Stenotrophomonas_phage	80.5	3.6e-73
WP_039575092.1|448283_449450_-|tail	phage tail sheath protein	tail	E5FFG9	Burkholderia_phage	63.2	5.9e-135
WP_039575095.1|449461_449821_-	GPW/gp25 family protein	NA	V9IQW0	Stenotrophomonas_phage	66.9	1.5e-36
WP_039575098.1|449817_450381_-|plate	phage baseplate assembly protein V	plate	Q9ZXL0	Pseudomonas_virus	47.0	1.4e-25
WP_039575101.1|450441_451020_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039575104.1|451029_452535_-|tail	tail fiber protein	tail	V9IQX0	Stenotrophomonas_phage	46.6	1.0e-51
WP_039575106.1|452544_453090_-|tail	phage tail protein I	tail	V9IQK7	Stenotrophomonas_phage	54.7	4.6e-50
WP_099770620.1|453791_454879_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	37.2	1.3e-43
WP_080948856.1|455010_455457_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039575501.1|455478_455925_-	phage virion morphogenesis protein	NA	V9IQH0	Stenotrophomonas_phage	62.4	1.6e-40
WP_039575505.1|455912_456332_-|tail	phage tail protein	tail	A0A2H4J906	uncultured_Caudovirales_phage	63.7	8.2e-39
WP_039575507.1|456328_456817_-	hypothetical protein	NA	V9IQW8	Stenotrophomonas_phage	51.7	7.6e-28
WP_039575510.1|456816_457455_-	glycoside hydrolase family 19 protein	NA	V9IQK6	Stenotrophomonas_phage	61.5	2.1e-49
WP_005922189.1|457454_457730_-|holin	phage holin family protein	holin	V9IQV8	Stenotrophomonas_phage	59.8	1.3e-21
WP_005929454.1|457722_458079_-	membrane protein	NA	V9IQG9	Stenotrophomonas_phage	56.1	3.5e-22
WP_005917735.1|458083_458293_-|tail	tail protein X	tail	K4PAW7	Burkholderia_phage	59.4	7.0e-15
WP_039575513.1|458292_458760_-|head	head completion/stabilization protein	head	V9IQW6	Stenotrophomonas_phage	49.0	1.2e-30
WP_039575516.1|458858_459578_-|terminase	terminase endonuclease subunit	terminase	Q9ZXM2	Pseudomonas_virus	62.9	2.2e-68
WP_039575518.1|459581_460601_-|capsid	phage major capsid protein, P2 family	capsid	Q9ZXM3	Pseudomonas_virus	69.7	6.7e-135
WP_039575521.1|460647_461490_-|capsid	GPO family capsid scaffolding protein	capsid	A0A2H4J928	uncultured_Caudovirales_phage	53.1	2.9e-67
WP_039575524.1|463395_464409_+|portal	phage portal protein	portal	A0A2H4J922	uncultured_Caudovirales_phage	72.8	3.6e-141
WP_080950292.1|464434_464680_+	Com family DNA-binding transcriptional regulator	NA	V9IQK2	Stenotrophomonas_phage	52.5	1.1e-14
WP_039575527.1|464597_465308_+	site-specific DNA-methyltransferase	NA	V9IQV5	Stenotrophomonas_phage	76.8	2.9e-105
WP_039575529.1|465348_465984_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150116772.1|466023_469977_-	AHH domain-containing protein	NA	NA	NA	NA	NA
WP_039574939.1|470011_470668_-	DUF1629 domain-containing protein	NA	NA	NA	NA	NA
WP_099770619.1|471294_472396_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.7	2.0e-44
WP_087944778.1|472737_473824_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	37.2	1.3e-43
WP_046736097.1|474448_474880_-	type IV pilin protein	NA	NA	NA	NA	NA
WP_039567167.1|474882_478230_-	pilus assembly protein	NA	NA	NA	NA	NA
WP_046736096.1|478242_478797_-	pilus assembly protein	NA	NA	NA	NA	NA
WP_039567168.1|478793_479819_-	PilW family protein	NA	NA	NA	NA	NA
WP_046830565.1|479815_480283_-	type IV pilus modification protein PilV	NA	NA	NA	NA	NA
WP_046830564.1|480294_480867_-	GspH/FimT family pseudopilin	NA	NA	NA	NA	NA
WP_039567169.1|481035_482064_+	histidine kinase	NA	Q9EYF3	Enterobacteria_phage	34.6	1.7e-16
WP_017154671.1|482065_483451_-	LOG family protein	NA	NA	NA	NA	NA
WP_017154672.1|483557_486782_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_003485603.1|487407_488007_-	YhgN family NAAT transporter	NA	NA	NA	NA	NA
WP_017156109.1|488003_488747_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003485599.1|488743_489064_-	Grx4 family monothiol glutaredoxin	NA	NA	NA	NA	NA
WP_017158757.1|489185_489764_+	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	42.2	4.0e-36
WP_039567172.1|489905_491051_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_003485592.1|491047_491551_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	38.1	2.4e-16
WP_008570984.1|491609_491879_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039567174.1|491875_492763_+	carboxylating nicotinate-nucleotide diphosphorylase	NA	NA	NA	NA	NA
WP_039567176.1|492826_493885_+	DUF2272 domain-containing protein	NA	NA	NA	NA	NA
WP_039567177.1|494234_496349_-	polyribonucleotide nucleotidyltransferase	NA	NA	NA	NA	NA
WP_003485583.1|496517_496778_-	30S ribosomal protein S15	NA	NA	NA	NA	NA
WP_039567179.1|496934_497861_-|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
>prophage 3
NZ_CP020967	Xanthomonas phaseoli pv. phaseoli strain CFBP6164 chromosome, complete genome	5254225	792280	858516	5254225	transposase	Leptospira_phage(28.57%)	59	NA	NA
WP_011345585.1|792280_793507_+|transposase	IS256-like element ISXax1 family transposase	transposase	A0A218MNI5	uncultured_virus	50.3	2.2e-52
WP_039572805.1|793672_794644_+	FAD:protein FMN transferase	NA	NA	NA	NA	NA
WP_039572802.1|794640_796422_+	flavodoxin domain-containing protein	NA	NA	NA	NA	NA
WP_039572799.1|796665_797511_-	HutD family protein	NA	NA	NA	NA	NA
WP_033473544.1|797937_798270_-	helix-hairpin-helix domain-containing protein	NA	NA	NA	NA	NA
WP_039572796.1|798469_799963_+	M20 family metallopeptidase	NA	NA	NA	NA	NA
WP_039572794.1|800498_800771_+	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_039572791.1|800828_801848_+	phosphotransferase	NA	NA	NA	NA	NA
WP_039572787.1|801844_802555_+	nucleotidyltransferase family protein	NA	A0A1D7XFC1	Escherichia_phage	33.9	3.3e-08
WP_039572784.1|802775_803477_-	DnaA regulatory inactivator Hda	NA	NA	NA	NA	NA
WP_017157699.1|803473_804640_-	AI-2E family transporter	NA	NA	NA	NA	NA
WP_039572780.1|804636_805749_-	DUF2066 domain-containing protein	NA	NA	NA	NA	NA
WP_039572776.1|805879_806905_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	44.1	2.1e-72
WP_039572774.1|806922_807381_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039572812.1|807403_808021_+	DUF2238 domain-containing protein	NA	NA	NA	NA	NA
WP_039572771.1|808007_808676_+	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	35.7	1.0e-19
WP_039572769.1|808742_809570_+	DUF3108 domain-containing protein	NA	NA	NA	NA	NA
WP_039572766.1|809573_810257_+	DUF3108 domain-containing protein	NA	NA	NA	NA	NA
WP_017157707.1|810817_811141_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017157708.1|811137_812412_-	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_017157709.1|812663_812891_-	BolA family transcriptional regulator	NA	NA	NA	NA	NA
WP_039572763.1|812944_813946_+	KpsF/GutQ family sugar-phosphate isomerase	NA	E3T535	Cafeteria_roenbergensis_virus	24.9	1.4e-12
WP_007964352.1|813994_814543_+	HAD hydrolase family protein	NA	NA	NA	NA	NA
WP_017157711.1|814539_815115_+	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_039572760.1|815101_815674_+	lipopolysaccharide transport periplasmic protein LptA	NA	NA	NA	NA	NA
WP_008572666.1|815673_816393_+	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	34.3	5.6e-27
WP_039572758.1|816433_817873_+	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_005913379.1|817960_818278_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_017157714.1|818299_818758_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_039572756.1|818754_819705_+	HPr kinase/phosphorylase	NA	NA	NA	NA	NA
WP_017157715.1|819701_820574_+	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	30.5	7.8e-07
WP_017154797.1|821106_821499_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_005913389.1|821491_821761_+	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_046736080.1|823508_823862_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003487859.1|824176_825538_+	magnesium transporter	NA	NA	NA	NA	NA
WP_022558831.1|825679_826477_+	prolyl oligopeptidase family serine peptidase	NA	NA	NA	NA	NA
WP_039572808.1|826511_827528_-	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_087944778.1|827630_828718_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	37.2	1.3e-43
WP_039574290.1|830247_830958_+	type IV secretory pathway, TrbF protein	NA	NA	NA	NA	NA
WP_017164024.1|830984_831977_+	P-type conjugative transfer protein TrbG	NA	NA	NA	NA	NA
WP_099770623.1|831992_833351_+	TrbI/VirB10 family protein	NA	NA	NA	NA	NA
WP_017164026.1|833523_833730_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005997461.1|833740_833980_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033481882.1|834052_834301_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099770624.1|834302_836054_+	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	31.0	1.4e-28
WP_099770625.1|836142_839955_-	TAL effector repeat-containing protein	NA	NA	NA	NA	NA
WP_167389983.1|840117_840345_+|transposase	transposase	transposase	A0A077K814	Ralstonia_phage	72.2	1.7e-06
WP_046736133.1|840844_842122_-	lytic murein transglycosylase	NA	NA	NA	NA	NA
WP_039575730.1|843601_843979_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039575724.1|844554_844743_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039575722.1|844942_845542_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099770620.1|846161_847248_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	37.2	1.3e-43
WP_039575811.1|847588_847918_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080949026.1|848410_849253_-	type III effector	NA	NA	NA	NA	NA
WP_099770626.1|850247_851335_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	37.2	7.6e-44
WP_039574021.1|853073_854303_-	dipeptidase	NA	NA	NA	NA	NA
WP_039574018.1|854876_856265_-	amino acid permease	NA	NA	NA	NA	NA
WP_039574024.1|856676_857378_-	hypothetical protein	NA	A0A140XB77	Dickeya_phage	40.9	1.7e-17
WP_099770619.1|857414_858516_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.7	2.0e-44
>prophage 4
NZ_CP020967	Xanthomonas phaseoli pv. phaseoli strain CFBP6164 chromosome, complete genome	5254225	1140126	1240634	5254225	transposase	Leptospira_phage(31.82%)	89	NA	NA
WP_099770632.1|1140126_1141214_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	37.2	2.9e-43
WP_039571778.1|1141297_1143085_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	34.6	7.1e-15
WP_039571773.1|1143287_1143722_-	thiol-disulfide oxidoreductase DCC family protein	NA	NA	NA	NA	NA
WP_039571770.1|1143708_1144233_-	DUF4166 domain-containing protein	NA	NA	NA	NA	NA
WP_039571767.1|1144235_1145057_-	peptidoglycan editing factor PgeF	NA	NA	NA	NA	NA
WP_039571765.1|1145058_1146054_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_039571762.1|1146174_1147056_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_039571758.1|1147370_1148348_+	hypothetical protein	NA	A0A0N9SJH5	Pseudomonas_phage	41.0	1.7e-55
WP_039571756.1|1148366_1150007_-	NAD+ synthase	NA	A0A2L0UZF5	Agrobacterium_phage	37.8	4.9e-95
WP_039571753.1|1150029_1150401_-	endonuclease domain-containing protein	NA	NA	NA	NA	NA
WP_005921370.1|1151079_1151955_-	succinate--CoA ligase subunit alpha	NA	NA	NA	NA	NA
WP_039568282.1|1151979_1153149_-	ADP-forming succinate--CoA ligase subunit beta	NA	NA	NA	NA	NA
WP_039568284.1|1153380_1154994_+	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_046736059.1|1155324_1156719_+	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_080948799.1|1156915_1157062_-	serine/threonine protein kinase	NA	NA	NA	NA	NA
WP_039568289.1|1157123_1157243_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039568294.1|1157487_1159224_-	type IV-A pilus assembly ATPase PilB	NA	NA	NA	NA	NA
WP_039568290.1|1159288_1159744_-	pilin	NA	NA	NA	NA	NA
WP_039568292.1|1159853_1160294_-	pilin	NA	NA	NA	NA	NA
WP_011345585.1|1160587_1161814_-|transposase	IS256-like element ISXax1 family transposase	transposase	A0A218MNI5	uncultured_virus	50.3	2.2e-52
WP_039573972.1|1161985_1163242_+	type II secretion system F family protein	NA	NA	NA	NA	NA
WP_039573976.1|1163248_1164112_+	prepilin peptidase	NA	NA	NA	NA	NA
WP_007962470.1|1164122_1164734_+	dephospho-CoA kinase	NA	NA	NA	NA	NA
WP_157926032.1|1164915_1165986_+	RHS repeat protein	NA	NA	NA	NA	NA
WP_087944778.1|1166034_1167121_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	37.2	1.3e-43
WP_039575364.1|1167504_1168839_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_003490678.1|1168831_1169509_-	response regulator transcription factor	NA	Q6XM27	Feldmannia_irregularis_virus	27.4	7.4e-05
WP_167389979.1|1170184_1171102_-	30S ribosomal protein S6--L-glutamate ligase	NA	A0A1D7SR78	Cyanophage	32.0	3.6e-31
WP_039575367.1|1171563_1173696_+	glycogen debranching protein GlgX	NA	NA	NA	NA	NA
WP_017154750.1|1174154_1174547_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_017154749.1|1174637_1175030_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046830658.1|1175138_1175798_-	thermonuclease family protein	NA	NA	NA	NA	NA
WP_099770634.1|1176554_1177698_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	59.9	2.5e-90
WP_127446520.1|1177722_1178121_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039575701.1|1178718_1179198_-	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_099770635.1|1179553_1180641_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	37.2	1.3e-43
WP_039575752.1|1180795_1181020_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005997167.1|1181439_1182081_+	type III secretion system effector protein	NA	NA	NA	NA	NA
WP_099770636.1|1182956_1184183_-|transposase	IS256-like element ISXax1 family transposase	transposase	A0A218MNI5	uncultured_virus	50.3	2.2e-52
WP_087944778.1|1184590_1185677_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	37.2	1.3e-43
WP_157926033.1|1186064_1186268_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039575883.1|1186269_1186833_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139792597.1|1189227_1190322_+	hypothetical protein	NA	NA	NA	NA	NA
WP_139792599.1|1190441_1191365_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081027971.1|1192117_1192906_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032699504.1|1193036_1193276_+	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_039574818.1|1193287_1194157_+	ParA family protein	NA	A0A1S6L2E3	Mycobacterium_phage	25.3	5.0e-06
WP_039585026.1|1194140_1194401_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099770636.1|1194987_1196214_-|transposase	IS256-like element ISXax1 family transposase	transposase	A0A218MNI5	uncultured_virus	50.3	2.2e-52
WP_087944778.1|1196621_1197708_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	37.2	1.3e-43
WP_157926033.1|1198095_1198299_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039575883.1|1198300_1198864_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139792597.1|1201258_1202353_+	hypothetical protein	NA	NA	NA	NA	NA
WP_139792599.1|1202472_1203396_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081027971.1|1204148_1204937_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032699504.1|1205067_1205307_+	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_039574818.1|1205318_1206188_+	ParA family protein	NA	A0A1S6L2E3	Mycobacterium_phage	25.3	5.0e-06
WP_039585026.1|1206171_1206432_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011345585.1|1207018_1208245_-|transposase	IS256-like element ISXax1 family transposase	transposase	A0A218MNI5	uncultured_virus	50.3	2.2e-52
WP_003413142.1|1209459_1210020_+	DUF2857 domain-containing protein	NA	NA	NA	NA	NA
WP_081027972.1|1210023_1211220_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039570163.1|1211300_1212512_-	NgoFVII family restriction endonuclease	NA	NA	NA	NA	NA
WP_099770637.1|1212694_1213504_+	TIGR03761 family integrating conjugative element protein	NA	NA	NA	NA	NA
WP_039570158.1|1213500_1214046_+	DUF3158 family protein	NA	NA	NA	NA	NA
WP_039570156.1|1214114_1214483_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_011345585.1|1214536_1215763_+|transposase	IS256-like element ISXax1 family transposase	transposase	A0A218MNI5	uncultured_virus	50.3	2.2e-52
WP_039575246.1|1215974_1217981_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_039575248.1|1218111_1220133_+	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	28.2	5.0e-33
WP_087944778.1|1221657_1222744_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	37.2	1.3e-43
WP_082331110.1|1222777_1222987_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039574865.1|1223011_1223398_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039574863.1|1223493_1223937_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039574872.1|1224065_1224779_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039574862.1|1225073_1225871_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039584919.1|1225935_1226301_+	DUF3085 domain-containing protein	NA	NA	NA	NA	NA
WP_039574859.1|1226635_1227556_+	DUF3577 domain-containing protein	NA	NA	NA	NA	NA
WP_039574857.1|1227705_1228533_+	DUF945 domain-containing protein	NA	A0A2C9CYF8	Yersinia_phage	36.1	1.1e-42
WP_039574856.1|1228608_1229280_+	DUF3275 family protein	NA	NA	NA	NA	NA
WP_081027840.1|1229369_1229717_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039574854.1|1229726_1229987_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039574870.1|1230065_1230716_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039574852.1|1230789_1231899_+	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_039574850.1|1232063_1234361_+	DEAD/DEAH box helicase family protein	NA	NA	NA	NA	NA
WP_081027841.1|1234541_1235108_+	PilL N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_052760916.1|1235206_1235749_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081027842.1|1235761_1236481_+	TIGR03759 family integrating conjugative element protein	NA	NA	NA	NA	NA
WP_099770638.1|1236462_1237053_+	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_039574848.1|1237049_1237589_+	integrating conjugative element protein	NA	NA	NA	NA	NA
WP_087944778.1|1239547_1240634_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	37.2	1.3e-43
>prophage 5
NZ_CP020967	Xanthomonas phaseoli pv. phaseoli strain CFBP6164 chromosome, complete genome	5254225	1272502	1319830	5254225	integrase,transposase,tRNA	Leptospira_phage(25.0%)	37	1263899:1263913	1316080:1316094
1263899:1263913	attL	TCGGCTTCCAGGTGC	NA	NA	NA	NA
WP_007975311.1|1272502_1273483_-|transposase	IS5-like element ISXfu2 family transposase	transposase	A0A077K814	Ralstonia_phage	59.5	1.1e-97
WP_162292263.1|1274821_1275034_-	hypothetical protein	NA	Q38213	Escherichia_phage	40.9	1.3e-05
WP_046831123.1|1275685_1276108_+	TIGR03757 family integrating conjugative element protein	NA	NA	NA	NA	NA
WP_039570236.1|1276107_1277046_+	TIGR03756 family integrating conjugative element protein	NA	NA	NA	NA	NA
WP_087944778.1|1278033_1279121_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	37.2	1.3e-43
WP_039573955.1|1279652_1280000_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039573965.1|1280015_1281524_+	conjugal transfer protein TraG N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_081027917.1|1281543_1281924_-	DUF3742 family protein	NA	NA	NA	NA	NA
WP_039573952.1|1282149_1282908_+	type IV toxin-antitoxin system AbiEi family antitoxin	NA	NA	NA	NA	NA
WP_039573949.1|1282900_1283827_+	nucleotidyl transferase AbiEii/AbiGii toxin family protein	NA	NA	NA	NA	NA
WP_039573961.1|1283855_1284146_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046831379.1|1284249_1285155_-	sensor domain-containing diguanylate cyclase	NA	G3MA91	Bacillus_virus	34.1	8.0e-23
WP_011345585.1|1285238_1286465_+|transposase	IS256-like element ISXax1 family transposase	transposase	A0A218MNI5	uncultured_virus	50.3	2.2e-52
WP_039574478.1|1287008_1288937_+	TraI domain-containing protein	NA	NA	NA	NA	NA
WP_039574475.1|1289813_1291184_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039574471.1|1291180_1291840_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039574469.1|1291836_1292367_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081028040.1|1292525_1293044_-	DUF4189 domain-containing protein	NA	NA	NA	NA	NA
WP_039574466.1|1293081_1294224_-	type IV secretion system protein	NA	NA	NA	NA	NA
WP_039574464.1|1294255_1294903_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039574463.1|1295925_1297473_-	MASE1 domain-containing protein	NA	NA	NA	NA	NA
WP_039574462.1|1298651_1301915_+	ATP-binding domain-containing protein	NA	NA	NA	NA	NA
WP_039574459.1|1302179_1304060_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_167389980.1|1304056_1305250_+	UvrD-helicase domain-containing protein	NA	NA	NA	NA	NA
WP_099770620.1|1305246_1306333_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	37.2	1.3e-43
WP_046831121.1|1307257_1308055_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039575552.1|1308487_1309372_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_039434960.1|1309399_1309693_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_081027779.1|1309795_1310446_+	LysR family substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_039575549.1|1310516_1311518_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039575546.1|1311550_1311970_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011345585.1|1312163_1313390_+|transposase	IS256-like element ISXax1 family transposase	transposase	A0A218MNI5	uncultured_virus	50.3	2.2e-52
WP_039570975.1|1313491_1315372_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0U1UNT3	Pseudomonas_phage	50.6	6.2e-102
WP_014090904.1|1315804_1317589_-	autotransporter domain-containing esterase	NA	NA	NA	NA	NA
1316080:1316094	attR	GCACCTGGAAGCCGA	NA	NA	NA	NA
WP_017155443.1|1317776_1317977_+	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_033473827.1|1318026_1318821_+	thiazole synthase	NA	NA	NA	NA	NA
WP_025982204.1|1319071_1319830_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
>prophage 6
NZ_CP020967	Xanthomonas phaseoli pv. phaseoli strain CFBP6164 chromosome, complete genome	5254225	1623651	1631702	5254225		Enterobacteria_phage(42.86%)	7	NA	NA
WP_039573127.1|1623651_1624998_+	phosphomannomutase/phosphoglucomutase	NA	A0A127AWJ1	Bacillus_phage	26.2	4.8e-32
WP_017158250.1|1625044_1626448_+	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	29.8	1.9e-47
WP_017158251.1|1626750_1627917_-	nucleotide sugar dehydrogenase	NA	M1HV26	Paramecium_bursaria_Chlorella_virus	57.8	1.6e-116
WP_039573124.1|1628257_1629157_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	35.6	1.6e-26
WP_039573120.1|1629153_1629711_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	49.4	3.0e-44
WP_039573187.1|1629707_1630595_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	57.8	1.7e-94
WP_039573117.1|1630646_1631702_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	45.0	2.4e-79
>prophage 7
NZ_CP020967	Xanthomonas phaseoli pv. phaseoli strain CFBP6164 chromosome, complete genome	5254225	2178186	2214454	5254225	protease,plate,transposase	Ralstonia_phage(25.0%)	24	NA	NA
WP_039569528.1|2178186_2179521_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_039569531.1|2180022_2180913_-	aldo/keto reductase family oxidoreductase	NA	NA	NA	NA	NA
WP_017156336.1|2181159_2182041_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_039569551.1|2182099_2183428_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_039569533.1|2183747_2184296_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039569534.1|2184292_2186260_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	28.3	2.5e-37
WP_039569537.1|2186407_2187739_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_007967108.1|2187973_2188288_-	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_039569538.1|2188331_2190857_-	tetratricopeptide repeat protein	NA	A0A2P1EMR8	Moumouvirus	29.2	6.1e-12
WP_007967112.1|2190835_2191375_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_039569553.1|2191722_2192250_+	RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_033481384.1|2192246_2193317_+	FecR domain-containing protein	NA	NA	NA	NA	NA
WP_039569541.1|2193782_2196668_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_039569560.1|2196771_2198073_+	histidine-type phosphatase	NA	NA	NA	NA	NA
WP_039569543.1|2198142_2199447_+	endonuclease	NA	NA	NA	NA	NA
WP_039569562.1|2199843_2200377_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_039569544.1|2200539_2201946_+	amidase	NA	NA	NA	NA	NA
WP_039569563.1|2202245_2202980_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039569546.1|2203038_2203698_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_099770649.1|2205644_2206871_+|transposase	IS256-like element ISXax1 family transposase	transposase	A0A218MNI5	uncultured_virus	50.3	2.2e-52
WP_087944778.1|2207226_2208313_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	37.2	1.3e-43
WP_039571676.1|2208310_2208631_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039571674.1|2211566_2212607_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_039571681.1|2212570_2214454_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
>prophage 8
NZ_CP020967	Xanthomonas phaseoli pv. phaseoli strain CFBP6164 chromosome, complete genome	5254225	2384930	2460614	5254225	integrase,transposase	Leptospira_phage(27.27%)	50	2448433:2448462	2468013:2468042
WP_099770635.1|2384930_2386017_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	37.2	1.3e-43
WP_039575212.1|2386480_2386834_-	ribonuclease E inhibitor RraB	NA	NA	NA	NA	NA
WP_099770619.1|2387177_2388280_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.7	2.0e-44
WP_039574910.1|2388560_2388803_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039574912.1|2389083_2389602_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011345585.1|2390183_2391410_+|transposase	IS256-like element ISXax1 family transposase	transposase	A0A218MNI5	uncultured_virus	50.3	2.2e-52
WP_039569931.1|2391916_2392756_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039569889.1|2394656_2395229_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019300484.1|2395381_2395585_+	YdcH family protein	NA	NA	NA	NA	NA
WP_039569891.1|2396019_2397000_-	zinc-binding dehydrogenase	NA	NA	NA	NA	NA
WP_039569893.1|2397337_2400007_-	glycerol-3-phosphate 1-O-acyltransferase PlsB	NA	NA	NA	NA	NA
WP_039569895.1|2400006_2400978_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039569898.1|2401388_2402441_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_017161501.1|2402608_2405647_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_039569900.1|2405972_2409008_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_039569902.1|2409031_2410633_+	tryptophan 7-halogenase	NA	M4T1E3	Cyanophage	29.2	6.3e-47
WP_039569904.1|2411017_2411746_-	orotidine-5'-phosphate decarboxylase	NA	NA	NA	NA	NA
WP_039569906.1|2411742_2412708_-	5'-nucleotidase, lipoprotein e(P4) family	NA	NA	NA	NA	NA
WP_039569908.1|2413057_2413714_+	YceH family protein	NA	NA	NA	NA	NA
WP_039569910.1|2413877_2414729_-	radical SAM protein	NA	NA	NA	NA	NA
WP_039569912.1|2414736_2416098_-	STM4012 family radical SAM protein	NA	NA	NA	NA	NA
WP_039569915.1|2416094_2416937_-	STM4013/SEN3800 family hydrolase	NA	NA	NA	NA	NA
WP_039569933.1|2416905_2418000_-	STM4014 family protein	NA	NA	NA	NA	NA
WP_017155176.1|2418019_2418931_-	STM4015 family protein	NA	NA	NA	NA	NA
WP_039569917.1|2419073_2420195_+	AAA family ATPase	NA	A0A2H4PB07	Aphanizomenon_phage	28.9	4.3e-18
WP_039569919.1|2420191_2420605_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039569921.1|2420601_2422449_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039569922.1|2425247_2426282_-	DUF4272 domain-containing protein	NA	NA	NA	NA	NA
WP_017159712.1|2426333_2426870_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_007971162.1|2427432_2429409_-	DNA helicase Rep	NA	A7KV33	Bacillus_phage	37.2	8.2e-113
WP_017155167.1|2429617_2430247_+	thymidine kinase	NA	A0A023W530	Serratia_phage	55.6	6.7e-53
WP_039569926.1|2430675_2431920_+	GAF domain-containing sensor histidine kinase	NA	NA	NA	NA	NA
WP_039569936.1|2432082_2433684_-	glucan biosynthesis protein D	NA	NA	NA	NA	NA
WP_039569929.1|2433752_2434730_-	DUF4380 domain-containing protein	NA	NA	NA	NA	NA
WP_039569938.1|2435422_2436238_-	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	A0A127AWE5	Bacillus_phage	27.4	8.3e-19
WP_039575605.1|2442997_2444179_+	benzoate/H(+) symporter BenE family transporter	NA	NA	NA	NA	NA
WP_039575599.1|2444253_2446158_-	GAF domain-containing protein	NA	Q6XLU9	Feldmannia_irregularis_virus	27.4	1.1e-18
WP_039575597.1|2446154_2446748_-	biliverdin-producing heme oxygenase	NA	NA	NA	NA	NA
WP_039575594.1|2446847_2448113_-	tetracycline resistance MFS efflux pump	NA	NA	NA	NA	NA
2448433:2448462	attL	CCCTCATCCGCCCTTCGGGCACCTTCTCCC	NA	NA	NA	NA
WP_039575670.1|2448709_2450872_-	lytic murein transglycosylase	NA	NA	NA	NA	NA
WP_039575672.1|2451050_2451257_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017166597.1|2451473_2451863_-	YchJ family protein	NA	NA	NA	NA	NA
WP_039575686.1|2453050_2453410_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039575675.1|2453421_2453736_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039575679.1|2453816_2454587_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039575683.1|2454689_2455031_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_167389985.1|2455188_2456127_+	DNA phosphorothioation system sulfurtransferase DndC	NA	NA	NA	NA	NA
WP_099770620.1|2456123_2457210_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	37.2	1.3e-43
WP_011345585.1|2457429_2458656_+|transposase	IS256-like element ISXax1 family transposase	transposase	A0A218MNI5	uncultured_virus	50.3	2.2e-52
WP_039570001.1|2459060_2460614_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
2468013:2468042	attR	CCCTCATCCGCCCTTCGGGCACCTTCTCCC	NA	NA	NA	NA
>prophage 9
NZ_CP020967	Xanthomonas phaseoli pv. phaseoli strain CFBP6164 chromosome, complete genome	5254225	2485431	2549343	5254225	integrase,transposase	Leptospira_phage(33.33%)	54	2508640:2508655	2552210:2552225
WP_011345585.1|2485431_2486658_-|transposase	IS256-like element ISXax1 family transposase	transposase	A0A218MNI5	uncultured_virus	50.3	2.2e-52
WP_022560442.1|2487166_2488786_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022560443.1|2488889_2489288_-	DUF2384 domain-containing protein	NA	NA	NA	NA	NA
WP_046121223.1|2490051_2490744_-	DUF2306 domain-containing protein	NA	NA	NA	NA	NA
WP_022560447.1|2490774_2491677_-	ribosomal large subunit pseudouridine synthase	NA	NA	NA	NA	NA
WP_039567139.1|2492009_2493587_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099770635.1|2494510_2495597_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	37.2	1.3e-43
WP_127478984.1|2496206_2498603_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157926038.1|2498636_2498789_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039571082.1|2499904_2501956_-	IpaD/SipD/SspD family type III secretion system needle tip protein	NA	NA	NA	NA	NA
WP_039571080.1|2502049_2503069_-	hypothetical protein	NA	NA	NA	NA	NA
WP_127446621.1|2504209_2506804_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052756676.1|2506885_2507635_-	OmpA family protein	NA	NA	NA	NA	NA
WP_127446623.1|2507733_2508714_-	hypothetical protein	NA	NA	NA	NA	NA
2508640:2508655	attL	CAGCGAAAGCACCATC	NA	NA	NA	NA
WP_127447082.1|2508841_2510782_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039571070.1|2510904_2512083_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157926039.1|2512159_2513749_-	type III secretion system translocon subunit SctE	NA	NA	NA	NA	NA
WP_046735985.1|2514091_2514616_-	SycD/LcrH family type III secretion system chaperone	NA	NA	NA	NA	NA
WP_039571064.1|2514796_2515876_-	EscU/YscU/HrcU family type III secretion system export apparatus switch protein	NA	NA	NA	NA	NA
WP_052756675.1|2515872_2516643_-	type III secretion system export apparatus subunit SctT	NA	NA	NA	NA	NA
WP_039571061.1|2516642_2516909_-	type III secretion system export apparatus subunit SctS	NA	NA	NA	NA	NA
WP_039571059.1|2516911_2517604_-	EscR/YscR/HrcR family type III secretion system export apparatus protein	NA	NA	NA	NA	NA
WP_039571057.1|2517603_2518656_-	FliM/FliN family flagellar motor switch protein	NA	NA	NA	NA	NA
WP_052759834.1|2518652_2519822_-	hypothetical protein	NA	NA	NA	NA	NA
WP_127446625.1|2519844_2520297_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039571046.1|2520283_2521633_-	FliI/YscN family ATPase	NA	NA	NA	NA	NA
WP_127446626.1|2521635_2522046_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039571041.1|2522055_2524152_-	EscV/YscV/HrcV family type III secretion system export apparatus protein	NA	NA	NA	NA	NA
WP_039571039.1|2524401_2525517_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052756673.1|2525503_2527408_-	type III secretion system outer membrane ring subunit SctC	NA	NA	NA	NA	NA
WP_052756672.1|2527404_2527959_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_082331124.1|2528316_2529672_+	PrgH/EprH family type III secretion apparatus protein	NA	NA	NA	NA	NA
WP_080950357.1|2529668_2529974_+	type III secretion system needle filament subunit SctF	NA	NA	NA	NA	NA
WP_039571032.1|2530039_2530324_+	type III secretion system inner rod subunit SctI	NA	NA	NA	NA	NA
WP_127446628.1|2530330_2531212_+	type III secretion inner membrane ring lipoprotein SctJ	NA	NA	NA	NA	NA
WP_080949130.1|2531208_2531805_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039571029.1|2531776_2532451_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039571027.1|2532447_2532681_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039571026.1|2532862_2533177_+	DUF1153 domain-containing protein	NA	NA	NA	NA	NA
WP_039571024.1|2533176_2533992_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_127446629.1|2534100_2534322_+	hypothetical protein	NA	NA	NA	NA	NA
WP_127446630.1|2535460_2535751_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039575117.1|2535828_2536089_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039575118.1|2536078_2537314_+|integrase	tyrosine-type recombinase/integrase	integrase	Q5QBN6	Enterobacteria_phage	25.4	9.0e-17
WP_039575120.1|2537506_2538541_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074052318.1|2538863_2539160_-	hypothetical protein	NA	NA	NA	NA	NA
WP_127446631.1|2539686_2540094_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080948716.1|2540052_2541588_-	MASE1 domain-containing protein	NA	NA	NA	NA	NA
WP_150115861.1|2541962_2542703_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080950356.1|2542605_2543175_+	HD domain-containing protein	NA	A0A0M3LQS1	Mannheimia_phage	37.9	6.8e-12
WP_099770620.1|2543518_2544606_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	37.2	1.3e-43
WP_039574675.1|2546455_2547193_-	hypothetical protein	NA	NA	NA	NA	NA
WP_127447083.1|2547197_2548220_-	conjugal transfer protein TraN	NA	NA	NA	NA	NA
WP_022557821.1|2548359_2549343_+|transposase	IS5-like element ISXfu1 family transposase	transposase	A0A077K814	Ralstonia_phage	59.9	8.2e-98
2552210:2552225	attR	CAGCGAAAGCACCATC	NA	NA	NA	NA
>prophage 10
NZ_CP020967	Xanthomonas phaseoli pv. phaseoli strain CFBP6164 chromosome, complete genome	5254225	2553486	2603792	5254225	transposase,tail	Leptospira_phage(25.0%)	38	NA	NA
WP_099770634.1|2553486_2554630_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	59.9	2.5e-90
WP_039575802.1|2554761_2557194_-	type IV secretion system protein TraC	NA	NA	NA	NA	NA
WP_039575799.1|2557212_2557581_-	hypothetical protein	NA	NA	NA	NA	NA
WP_127446637.1|2557599_2558289_-	TraV family lipoprotein	NA	NA	NA	NA	NA
WP_052756682.1|2558361_2559534_-	TraB/VirB10 family protein	NA	NA	NA	NA	NA
WP_087944778.1|2559585_2560672_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	37.2	1.3e-43
WP_099770619.1|2560987_2562090_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.7	2.0e-44
WP_143707755.1|2562134_2562428_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052756667.1|2562451_2562763_-	hypothetical protein	NA	NA	NA	NA	NA
WP_127447084.1|2562755_2563361_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080948735.1|2563544_2563736_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039574563.1|2564154_2567802_-	urea carboxylase	NA	NA	NA	NA	NA
WP_039574561.1|2567885_2569685_-	allophanate hydrolase	NA	NA	NA	NA	NA
WP_039574558.1|2570034_2570511_-	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_039574571.1|2570574_2571144_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_017158948.1|2571260_2571833_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_039574556.1|2571917_2572661_+	glucose 1-dehydrogenase	NA	A0A0M4JSW6	Mollivirus	28.8	5.0e-15
WP_039574553.1|2573026_2573545_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080948736.1|2573972_2574242_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003482333.1|2574537_2574870_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039574551.1|2575184_2577110_+	M61 family metallopeptidase	NA	NA	NA	NA	NA
WP_039574546.1|2577459_2578848_-	nucleoside hydrolase	NA	NA	NA	NA	NA
WP_017156025.1|2579202_2579493_-	HigA family addiction module antidote protein	NA	M9MUN2	Rhodococcus_phage	52.5	2.8e-14
WP_046834789.1|2579888_2582396_-	AAA family ATPase	NA	A0A0N9S864	Staphylococcus_phage	44.9	3.7e-09
WP_039569010.1|2582583_2586570_-	exodeoxyribonuclease V subunit beta	NA	S5MMD7	Bacillus_phage	21.9	2.4e-10
WP_039569011.1|2586566_2589971_-	exodeoxyribonuclease V subunit gamma	NA	NA	NA	NA	NA
WP_046830503.1|2590323_2595099_-	autotransporter domain-containing protein	NA	F5B3Z3	Synechococcus_phage	50.5	9.4e-22
WP_017165353.1|2595360_2595912_+|tail	phage tail protein	tail	A0A0U4JQ24	Arthrobacter_phage	32.6	1.1e-11
WP_039569016.1|2595959_2596487_+|tail	phage tail protein	tail	A0A0U4JYA4	Arthrobacter_phage	34.3	4.5e-18
WP_039569019.1|2597091_2597640_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_017158959.1|2597658_2597946_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017156015.1|2598327_2599122_+	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	27.8	1.7e-08
WP_011349188.1|2599121_2599871_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_005912377.1|2599882_2600428_+	outer membrane lipid asymmetry maintenance protein MlaD	NA	NA	NA	NA	NA
WP_011349189.1|2600424_2601087_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_039569023.1|2601076_2601367_+	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_039569025.1|2601377_2602433_+	VacJ family lipoprotein	NA	NA	NA	NA	NA
WP_099770609.1|2602704_2603792_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	37.2	1.3e-43
>prophage 11
NZ_CP020967	Xanthomonas phaseoli pv. phaseoli strain CFBP6164 chromosome, complete genome	5254225	2655783	2723666	5254225	protease,transposase	Leptospira_phage(25.0%)	55	NA	NA
WP_087944778.1|2655783_2656871_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	37.2	1.3e-43
WP_039575336.1|2657331_2658099_-	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_039575338.1|2658106_2658376_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039575341.1|2658450_2659911_-	cardiolipin synthase	NA	NA	NA	NA	NA
WP_039575344.1|2660235_2660961_+	YafY family transcriptional regulator	NA	NA	NA	NA	NA
WP_017155966.1|2661010_2661376_+	DUF1330 domain-containing protein	NA	NA	NA	NA	NA
WP_046736051.1|2661500_2662628_-	PA0069 family radical SAM protein	NA	NA	NA	NA	NA
WP_039575347.1|2662813_2663515_-	2OG-Fe(II) oxygenase	NA	A0A1D8KQ73	Synechococcus_phage	44.7	5.1e-17
WP_011345782.1|2663794_2665135_-	outer membrane protein transport protein	NA	NA	NA	NA	NA
WP_017155963.1|2665356_2666049_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_039570005.1|2666155_2666476_+	DUF1820 family protein	NA	NA	NA	NA	NA
WP_039570007.1|2666475_2667483_+	D-2-hydroxyacid dehydrogenase family protein	NA	M1HUT5	Acanthocystis_turfacea_Chlorella_virus	29.6	2.5e-09
WP_039570009.1|2667630_2669163_-	S41 family peptidase	NA	A0A0R6PIZ1	Moraxella_phage	29.5	3.5e-26
WP_039570054.1|2669266_2670502_-	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A2H4J5G2	uncultured_Caudovirales_phage	32.0	4.6e-05
WP_017155960.1|2670662_2671319_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039570011.1|2671480_2673277_+	M28 family peptidase	NA	NA	NA	NA	NA
WP_039570013.1|2673589_2674033_-	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_039570056.1|2674330_2675464_-	glycoside hydrolase family 5 protein	NA	NA	NA	NA	NA
WP_039570014.1|2676085_2677138_-	glycoside hydrolase family 5 protein	NA	NA	NA	NA	NA
WP_039570016.1|2677267_2677675_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039570018.1|2677912_2678986_-	glycoside hydrolase family 5 protein	NA	NA	NA	NA	NA
WP_008572924.1|2679293_2680352_+	NAD(P)-dependent alcohol dehydrogenase	NA	A0A2K9L339	Tupanvirus	45.4	3.0e-77
WP_039570021.1|2680459_2681035_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080949214.1|2681078_2681450_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039570023.1|2681446_2682928_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_039570025.1|2683058_2687531_-	glutamate synthase large subunit	NA	NA	NA	NA	NA
WP_017154809.1|2687733_2688114_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017154810.1|2688170_2689448_+	DNA topoisomerase IB	NA	A0A0U2TSJ7	Niemeyer_virus	35.5	2.4e-41
WP_008572913.1|2689665_2690010_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039570027.1|2690388_2691258_-	NmrA/HSCARG family protein	NA	NA	NA	NA	NA
WP_039570029.1|2691421_2692297_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_039570058.1|2692499_2692886_+	BlaI/MecI/CopY family transcriptional regulator	NA	NA	NA	NA	NA
WP_039570031.1|2692889_2694635_+	M56 family metallopeptidase	NA	NA	NA	NA	NA
WP_157926040.1|2695316_2695499_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039570060.1|2695606_2695786_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039570062.1|2695776_2696343_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039570032.1|2696379_2697561_+	saccharopine dehydrogenase NADP-binding domain-containing protein	NA	NA	NA	NA	NA
WP_039570034.1|2697699_2698485_-	DUF1868 domain-containing protein	NA	NA	NA	NA	NA
WP_039570064.1|2698495_2701111_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_039570036.1|2701255_2702413_+	ROK family protein	NA	NA	NA	NA	NA
WP_080949219.1|2702602_2704747_+	avirulence protein	NA	NA	NA	NA	NA
WP_039570039.1|2705234_2706692_-	ribonuclease H-like domain-containing protein	NA	NA	NA	NA	NA
WP_039570041.1|2706688_2709184_-	DEAD/DEAH box helicase	NA	A0A1B1IUF6	uncultured_Mediterranean_phage	35.1	9.0e-08
WP_039570042.1|2709361_2710024_+	hemolysin III family protein	NA	NA	NA	NA	NA
WP_039570045.1|2710090_2710348_+	type II toxin-antitoxin system prevent-host-death family antitoxin	NA	NA	NA	NA	NA
WP_039570047.1|2710807_2711707_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_039570049.1|2711766_2712504_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_039570051.1|2712629_2713541_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_039570052.1|2713754_2714834_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099770620.1|2716135_2717222_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	37.2	1.3e-43
WP_039575748.1|2717565_2718183_-	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_046736103.1|2718665_2719646_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	62.3	4.7e-101
WP_099770656.1|2719972_2720392_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_022557821.1|2721398_2722382_+|transposase	IS5-like element ISXfu1 family transposase	transposase	A0A077K814	Ralstonia_phage	59.9	8.2e-98
WP_099770620.1|2722578_2723666_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	37.2	1.3e-43
>prophage 12
NZ_CP020967	Xanthomonas phaseoli pv. phaseoli strain CFBP6164 chromosome, complete genome	5254225	3830714	3887043	5254225	protease,transposase,holin	uncultured_virus(33.33%)	42	NA	NA
WP_011345585.1|3830714_3831941_-|transposase	IS256-like element ISXax1 family transposase	transposase	A0A218MNI5	uncultured_virus	50.3	2.2e-52
WP_011345585.1|3832456_3833683_+|transposase	IS256-like element ISXax1 family transposase	transposase	A0A218MNI5	uncultured_virus	50.3	2.2e-52
WP_008571649.1|3834656_3835754_+	OmpA family protein	NA	NA	NA	NA	NA
WP_007968908.1|3835945_3836461_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039575130.1|3836480_3837341_+	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_017156233.1|3837291_3837684_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_017156234.1|3837686_3838895_-	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	26.2	1.3e-20
WP_039575133.1|3838985_3840083_+	sulfate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_017156236.1|3840086_3840947_+	sulfate ABC transporter permease subunit CysT	NA	NA	NA	NA	NA
WP_039575136.1|3840943_3841897_+	sulfate ABC transporter permease subunit CysW	NA	NA	NA	NA	NA
WP_017156238.1|3841904_3842951_+	sulfate/molybdate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	32.7	1.2e-25
WP_017156239.1|3843217_3843934_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011345585.1|3844734_3845961_+|transposase	IS256-like element ISXax1 family transposase	transposase	A0A218MNI5	uncultured_virus	50.3	2.2e-52
WP_033473455.1|3846022_3847045_-	L-threonine 3-dehydrogenase	NA	NA	NA	NA	NA
WP_039571839.1|3847609_3849943_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_039571841.1|3850142_3852224_+|holin	phospholipase C, phosphocholine-specific	holin	NA	NA	NA	NA
WP_039571881.1|3852384_3854544_+	S46 family peptidase	NA	NA	NA	NA	NA
WP_039571843.1|3854635_3855280_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_039571846.1|3855496_3856045_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039571848.1|3856273_3857593_+	bifunctional tetrahydrofolate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_039571850.1|3857660_3858743_+	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_039571852.1|3858956_3859703_+	CvpA family protein	NA	NA	NA	NA	NA
WP_003483730.1|3859733_3861200_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	39.9	4.1e-85
WP_033473442.1|3861395_3862220_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_007968939.1|3864184_3864604_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007973708.1|3864792_3865536_-	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_011050667.1|3866096_3866639_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_039571861.1|3866619_3867756_-	glycosyltransferase family 1 protein	NA	NA	NA	NA	NA
WP_039571864.1|3868000_3869527_-	exopolyphosphatase	NA	NA	NA	NA	NA
WP_039571867.1|3869699_3871802_-	polyphosphate kinase 1	NA	NA	NA	NA	NA
WP_039571869.1|3871914_3873243_-	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	33.3	6.4e-29
WP_003483753.1|3873315_3874005_-	phosphate regulon transcriptional regulator PhoB	NA	W8CYM9	Bacillus_phage	35.7	1.0e-33
WP_039571885.1|3874187_3875834_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_017158114.1|3875983_3876292_+	glutaredoxin 3	NA	A0A2L0UZG6	Agrobacterium_phage	43.2	2.1e-07
WP_039571872.1|3876288_3876684_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_039571876.1|3877045_3878053_+	isocitrate dehydrogenase	NA	NA	NA	NA	NA
WP_017158117.1|3878191_3878953_-	Bax inhibitor-1/YccA family protein	NA	NA	NA	NA	NA
WP_039571877.1|3880132_3880777_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099770636.1|3881123_3882350_-|transposase	IS256-like element ISXax1 family transposase	transposase	A0A218MNI5	uncultured_virus	50.3	2.2e-52
WP_005913863.1|3883619_3884912_+	trigger factor	NA	NA	NA	NA	NA
WP_002806026.1|3885004_3885631_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	57.4	1.0e-56
WP_003483788.1|3885756_3887043_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	59.9	5.3e-137
>prophage 13
NZ_CP020967	Xanthomonas phaseoli pv. phaseoli strain CFBP6164 chromosome, complete genome	5254225	3959678	4034467	5254225	protease,transposase	Leptospira_phage(30.0%)	52	NA	NA
WP_017155763.1|3959678_3960806_+|protease	FtsH protease activity modulator HflK	protease	NA	NA	NA	NA
WP_003483929.1|3960805_3961669_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_039572834.1|3962293_3962758_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017154927.1|3963237_3964530_+	adenylosuccinate synthase	NA	A0A2R8FF47	Brazilian_cedratvirus	38.2	2.9e-74
WP_039572831.1|3964897_3967570_+	M1 family metallopeptidase	NA	A0A0P0IY26	Acinetobacter_phage	28.6	8.6e-81
WP_039572828.1|3967822_3968008_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039572826.1|3968262_3968976_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_039572824.1|3969047_3969638_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_080950255.1|3970003_3971050_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080950256.1|3971352_3972219_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039573061.1|3972355_3972739_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039573058.1|3973382_3974957_-	serine/threonine protein kinase	NA	NA	NA	NA	NA
WP_039573055.1|3975365_3976118_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039573077.1|3976468_3977224_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025981762.1|3977290_3977920_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_039573052.1|3978914_3979784_+	NAD(P)H-hydrate dehydratase	NA	NA	NA	NA	NA
WP_039573049.1|3980203_3981682_+	glycoside hydrolase family 30 protein	NA	NA	NA	NA	NA
WP_039573046.1|3981813_3983619_-	glycoside hydrolase family 15 protein	NA	NA	NA	NA	NA
WP_039573043.1|3983615_3984491_-	SDR family oxidoreductase	NA	A0A2N9QUX2	Trichoplusia_ni_ascovirus	52.7	2.7e-76
WP_039573041.1|3984941_3987296_-	glycoside hydrolase family 92 protein	NA	NA	NA	NA	NA
WP_039573035.1|3987715_3987895_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039573032.1|3987926_3988556_+	alpha-ketoglutarate-dependent dioxygenase AlkB	NA	NA	NA	NA	NA
WP_039573029.1|3988900_3990610_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_039573026.1|3990606_3990912_+	UBP-type zinc finger domain-containing protein	NA	NA	NA	NA	NA
WP_017157909.1|3992003_3992642_+	HD domain-containing protein	NA	NA	NA	NA	NA
WP_039573025.1|3992899_3995422_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	34.5	1.0e-152
WP_039573022.1|3996107_4002113_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039573019.1|4003205_4005503_-	xanthine dehydrogenase family protein molybdopterin-binding subunit	NA	NA	NA	NA	NA
WP_080949163.1|4005499_4006564_-	xanthine dehydrogenase family protein subunit M	NA	NA	NA	NA	NA
WP_039573015.1|4006560_4007139_-	2Fe-2S iron-sulfur cluster binding domain-containing protein	NA	NA	NA	NA	NA
WP_039573011.1|4007436_4008768_+	DUF763 domain-containing protein	NA	NA	NA	NA	NA
WP_039573008.1|4008764_4009358_+	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_017157901.1|4009420_4009765_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_039573006.1|4009924_4010428_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039573069.1|4010536_4010962_-	type II toxin-antitoxin system death-on-curing family toxin	NA	A0A1B3AYM0	Gordonia_phage	54.7	3.1e-09
WP_003490241.1|4010970_4011192_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_039573002.1|4011342_4011948_+	repressor LexA	NA	A0A1W6JNS2	Morganella_phage	38.5	2.5e-12
WP_017157897.1|4011949_4012603_+	translesion DNA synthesis-associated protein ImuA	NA	NA	NA	NA	NA
WP_017157896.1|4012612_4014031_+	DNA polymerase Y family protein	NA	NA	NA	NA	NA
WP_039572998.1|4014206_4017458_+	error-prone DNA polymerase	NA	A0A1B1PA77	Streptomyces_phage	24.9	2.7e-81
WP_017157893.1|4017604_4017790_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039573066.1|4017890_4019483_+	S9 family peptidase	NA	NA	NA	NA	NA
WP_039572996.1|4019692_4020511_+	HDOD domain-containing protein	NA	NA	NA	NA	NA
WP_039572994.1|4020938_4022891_+	oligopeptide transporter, OPT family	NA	NA	NA	NA	NA
WP_099770626.1|4023767_4024854_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	37.2	7.6e-44
WP_039575286.1|4024879_4025638_+	transporter	NA	NA	NA	NA	NA
WP_022559883.1|4025932_4028053_+	S9 family peptidase	NA	NA	NA	NA	NA
WP_087944778.1|4028211_4029299_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	37.2	1.3e-43
WP_080950379.1|4029700_4030918_-	peptidase	NA	NA	NA	NA	NA
WP_039575314.1|4031876_4032338_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039575317.1|4032469_4033195_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_099770609.1|4033379_4034467_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	37.2	1.3e-43
>prophage 14
NZ_CP020967	Xanthomonas phaseoli pv. phaseoli strain CFBP6164 chromosome, complete genome	5254225	4322280	4364077	5254225	protease,coat,transposase	Flavobacterium_phage(14.29%)	31	NA	NA
WP_039575401.1|4322280_4323627_-|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
WP_039575398.1|4323653_4324844_-	1-deoxy-D-xylulose-5-phosphate reductoisomerase	NA	NA	NA	NA	NA
WP_039575395.1|4324846_4325674_-	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_039575392.1|4325670_4326429_-	di-trans,poly-cis-decaprenylcistransferase	NA	R9W0U9	Flavobacterium_phage	32.6	1.0e-15
WP_005921623.1|4326446_4327004_-	ribosome recycling factor	NA	NA	NA	NA	NA
WP_005911727.1|4327205_4327928_-	UMP kinase	NA	NA	NA	NA	NA
WP_017155692.1|4328033_4329557_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	36.0	3.1e-19
WP_007962895.1|4329831_4330710_-	elongation factor Ts	NA	NA	NA	NA	NA
WP_017155694.1|4330879_4331677_-	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_046831341.1|4332132_4332846_-	molecular chaperone	NA	NA	NA	NA	NA
WP_039574794.1|4332848_4333181_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039574792.1|4333229_4334264_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_039574791.1|4334260_4336612_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_039574789.1|4336628_4337399_-	molecular chaperone	NA	NA	NA	NA	NA
WP_039574796.1|4337407_4337932_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_008576697.1|4338250_4339027_+	type I methionyl aminopeptidase	NA	NA	NA	NA	NA
WP_039583828.1|4339023_4341633_+	[protein-PII] uridylyltransferase	NA	NA	NA	NA	NA
WP_039574200.1|4341654_4342851_+	2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase	NA	NA	NA	NA	NA
WP_039574201.1|4343041_4343398_+	arsenate reductase	NA	NA	NA	NA	NA
WP_039574203.1|4343644_4344775_+	succinyl-diaminopimelate desuccinylase	NA	NA	NA	NA	NA
WP_157926046.1|4344782_4344938_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039574205.1|4345067_4346762_+	asparagine synthase B	NA	A0A0P0C1V4	Ostreococcus_lucimarinus_virus	39.0	1.2e-88
WP_039574208.1|4346829_4347882_-	right-handed parallel beta-helix repeat-containing protein	NA	NA	NA	NA	NA
WP_039574217.1|4348317_4350456_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_039574219.1|4350863_4353281_-	penicillin acylase family protein	NA	NA	NA	NA	NA
WP_017155709.1|4353376_4353913_+	bacterioferritin	NA	NA	NA	NA	NA
WP_087944778.1|4354141_4355228_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	37.2	1.3e-43
WP_015472346.1|4356745_4358989_-	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	35.0	1.0e-82
WP_080949137.1|4360006_4361020_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099770634.1|4361469_4362613_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	59.9	2.5e-90
WP_011345585.1|4362850_4364077_+|transposase	IS256-like element ISXax1 family transposase	transposase	A0A218MNI5	uncultured_virus	50.3	2.2e-52
>prophage 15
NZ_CP020967	Xanthomonas phaseoli pv. phaseoli strain CFBP6164 chromosome, complete genome	5254225	4667153	4677981	5254225	tRNA	Micromonas_pusilla_virus(16.67%)	7	NA	NA
WP_017155111.1|4667153_4668830_+	2-polyprenylphenol 6-hydroxylase	NA	G8DDN0	Micromonas_pusilla_virus	29.2	7.1e-41
WP_039570103.1|4668917_4669559_+	transcriptional repressor LexA	NA	A0A1W6JNS2	Morganella_phage	40.2	2.4e-13
WP_008574635.1|4669731_4670766_+	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	61.0	1.1e-113
WP_017155113.1|4671059_4671548_+	recombination regulator RecX	NA	NA	NA	NA	NA
WP_039570105.1|4671649_4674298_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	39.8	2.8e-84
WP_019300306.1|4674437_4674650_+	carbon storage regulator CsrA	NA	J7I430	Pseudomonas_phage	76.5	1.3e-13
WP_039570108.1|4676022_4677981_+	PAS domain-containing methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	39.1	9.6e-13
>prophage 16
NZ_CP020967	Xanthomonas phaseoli pv. phaseoli strain CFBP6164 chromosome, complete genome	5254225	5021527	5069357	5254225	transposase	Ralstonia_phage(50.0%)	33	NA	NA
WP_087944778.1|5021527_5022614_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	37.2	1.3e-43
WP_039573489.1|5023633_5025292_-	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_017154802.1|5025294_5025921_-	protein phosphatase CheZ	NA	NA	NA	NA	NA
WP_002813536.1|5025920_5026313_-	chemotaxis response regulator CheY	NA	NA	NA	NA	NA
WP_008576048.1|5026348_5027116_-	RNA polymerase sigma factor FliA	NA	NA	NA	NA	NA
WP_005918202.1|5027112_5027997_-	MinD/ParA family protein	NA	NA	NA	NA	NA
WP_039573484.1|5027983_5029675_-	flagellar biosynthesis protein FlhF	NA	NA	NA	NA	NA
WP_039573481.1|5030426_5032520_-	flagellar biosynthesis protein FlhA	NA	NA	NA	NA	NA
WP_039573479.1|5032516_5033647_-	flagellar biosynthesis protein FlhB	NA	NA	NA	NA	NA
WP_039573476.1|5033987_5036075_-	bifunctional diguanylate cyclase/phosphodiesterase	NA	G3MA91	Bacillus_virus	34.9	6.6e-20
WP_022557821.1|5039508_5040492_-|transposase	IS5-like element ISXfu1 family transposase	transposase	A0A077K814	Ralstonia_phage	59.9	8.2e-98
WP_008572484.1|5043958_5044750_-	flagellar biosynthetic protein FliR	NA	NA	NA	NA	NA
WP_005917968.1|5044763_5045033_-	flagellar biosynthetic protein FliQ	NA	NA	NA	NA	NA
WP_022557821.1|5045484_5046468_-|transposase	IS5-like element ISXfu1 family transposase	transposase	A0A077K814	Ralstonia_phage	59.9	8.2e-98
WP_005921349.1|5047129_5047975_-	flagellar type III secretion system pore protein FliP	NA	NA	NA	NA	NA
WP_039575627.1|5047976_5048384_-	flagellar biosynthetic protein FliO	NA	NA	NA	NA	NA
WP_039575625.1|5048380_5048719_-	flagellar motor switch protein FliN	NA	NA	NA	NA	NA
WP_039575621.1|5048715_5049729_-	flagellar motor switch protein FliM	NA	NA	NA	NA	NA
WP_033473880.1|5049739_5050267_-	flagellar basal body-associated FliL family protein	NA	NA	NA	NA	NA
WP_046831093.1|5050457_5051750_-	flagellar hook-length control protein FliK	NA	NA	NA	NA	NA
WP_017158028.1|5051746_5052202_-	flagellar export protein FliJ	NA	NA	NA	NA	NA
WP_005918170.1|5052205_5053582_-	FliI/YscN family ATPase	NA	NA	NA	NA	NA
WP_011347268.1|5053578_5054199_-	flagellar assembly protein FliH	NA	NA	NA	NA	NA
WP_017158030.1|5054195_5055185_-	flagellar motor switch protein FliG	NA	NA	NA	NA	NA
WP_039573936.1|5055195_5056920_-	flagellar M-ring protein FliF	NA	NA	NA	NA	NA
WP_017159591.1|5056933_5057305_-	flagellar hook-basal body complex protein FliE	NA	NA	NA	NA	NA
WP_039573933.1|5057734_5061229_-	glycosyltransferase	NA	K7QL84	Escherichia_phage	25.9	6.5e-12
WP_039573930.1|5061675_5061921_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022557821.1|5062024_5063007_-|transposase	IS5-like element ISXfu1 family transposase	transposase	A0A077K814	Ralstonia_phage	59.9	8.2e-98
WP_039572985.1|5064308_5065037_-	FkbM family methyltransferase	NA	NA	NA	NA	NA
WP_099770620.1|5065582_5066669_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	37.2	1.3e-43
WP_039575866.1|5067040_5068324_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022557821.1|5068373_5069357_+|transposase	IS5-like element ISXfu1 family transposase	transposase	A0A077K814	Ralstonia_phage	59.9	8.2e-98
>prophage 17
NZ_CP020967	Xanthomonas phaseoli pv. phaseoli strain CFBP6164 chromosome, complete genome	5254225	5205158	5242101	5254225	transposase	Xanthomonas_phage(50.0%)	38	NA	NA
WP_011345585.1|5205158_5206385_-|transposase	IS256-like element ISXax1 family transposase	transposase	A0A218MNI5	uncultured_virus	50.3	2.2e-52
WP_039575861.1|5206427_5207456_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157926051.1|5207775_5207946_+	hypothetical protein	NA	A0A1D6ZIU8	Xanthomonas_phage	53.5	9.7e-07
WP_022557821.1|5208130_5209114_+|transposase	IS5-like element ISXfu1 family transposase	transposase	A0A077K814	Ralstonia_phage	59.9	8.2e-98
WP_011345585.1|5209194_5210421_-|transposase	IS256-like element ISXax1 family transposase	transposase	A0A218MNI5	uncultured_virus	50.3	2.2e-52
WP_082336405.1|5211655_5211916_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039573924.1|5211967_5212624_-	conjugal transfer protein	NA	A0A077JBM8	Xanthomonas_phage	85.8	1.1e-101
WP_039573921.1|5212623_5213790_-	zonular occludens toxin	NA	A0A077JGB2	Xanthomonas_phage	92.0	9.8e-207
WP_039573919.1|5213786_5214104_-	DUF2523 domain-containing protein	NA	A0A077JCZ2	Xanthomonas_phage	98.1	3.4e-53
WP_039573917.1|5214103_5215603_-	hypothetical protein	NA	A0A077JDC5	Xanthomonas_phage	87.6	6.0e-217
WP_039573915.1|5215710_5215977_-	hypothetical protein	NA	A0A077JBM7	Xanthomonas_phage	77.3	2.8e-24
WP_039573912.1|5215982_5216183_-	hypothetical protein	NA	A0A077JGA5	Xanthomonas_phage	98.5	8.7e-31
WP_039573910.1|5216208_5216505_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167389986.1|5216831_5217377_-	replication endonuclease	NA	NA	NA	NA	NA
WP_167389982.1|5217540_5217681_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082331133.1|5217677_5217977_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039573907.1|5217976_5218159_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011345585.1|5219127_5220354_+|transposase	IS256-like element ISXax1 family transposase	transposase	A0A218MNI5	uncultured_virus	50.3	2.2e-52
WP_039575197.1|5221191_5222556_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_039575199.1|5222850_5223519_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_039575201.1|5223515_5224118_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_039575203.1|5224114_5224873_-	PIG-L family deacetylase	NA	NA	NA	NA	NA
WP_039575205.1|5224860_5225379_-	dehydrogenase	NA	NA	NA	NA	NA
WP_011345585.1|5226319_5227546_+|transposase	IS256-like element ISXax1 family transposase	transposase	A0A218MNI5	uncultured_virus	50.3	2.2e-52
WP_017159817.1|5228517_5229162_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017168787.1|5229693_5229996_+	type II toxin-antitoxin system PemK/MazF family toxin	NA	NA	NA	NA	NA
WP_039573578.1|5230065_5233041_-	conjugative relaxase	NA	V5UQN3	Mycobacterium_phage	27.7	3.8e-05
WP_039573575.1|5233054_5234629_-	type IV secretion system DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_011345595.1|5234632_5234830_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011345594.1|5234901_5235438_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011345593.1|5235441_5236062_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011345592.1|5236174_5236468_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_011345591.1|5236464_5236758_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039573570.1|5236831_5237227_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011345589.1|5237615_5238071_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039573563.1|5238067_5238775_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039573562.1|5238820_5239174_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011345585.1|5240874_5242101_-|transposase	IS256-like element ISXax1 family transposase	transposase	A0A218MNI5	uncultured_virus	50.3	2.2e-52
>prophage 1
NZ_CP020969	Xanthomonas phaseoli pv. phaseoli strain CFBP6164 plasmid pC, complete sequence	56017	0	2217	56017	transposase	Leptospira_phage(100.0%)	1	NA	NA
WP_087944778.1|1130_2217_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	37.2	1.3e-43
>prophage 2
NZ_CP020969	Xanthomonas phaseoli pv. phaseoli strain CFBP6164 plasmid pC, complete sequence	56017	10946	12440	56017		Bacillus_phage(100.0%)	1	NA	NA
WP_022560531.1|10946_12440_-	hypothetical protein	NA	A0A1B1P892	Bacillus_phage	22.4	6.0e-07
>prophage 3
NZ_CP020969	Xanthomonas phaseoli pv. phaseoli strain CFBP6164 plasmid pC, complete sequence	56017	16624	18665	56017		Enterobacteria_phage(50.0%)	4	NA	NA
WP_022560487.1|16624_17218_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	48.6	6.8e-39
WP_022557731.1|17429_17684_+	plasmid stability protein	NA	NA	NA	NA	NA
WP_022557732.1|17680_18097_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_033482006.1|18110_18665_+	plasmid pRiA4b ORF-3 family protein	NA	A0A2H4PDG5	Mycobacterium_phage	32.8	5.4e-22
>prophage 4
NZ_CP020969	Xanthomonas phaseoli pv. phaseoli strain CFBP6164 plasmid pC, complete sequence	56017	23784	34083	56017	transposase	Leptospira_phage(25.0%)	6	NA	NA
WP_087944778.1|23784_24871_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	37.2	1.3e-43
WP_007975350.1|24937_25396_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017172485.1|25709_26711_-	XcyI family restriction endonuclease	NA	NA	NA	NA	NA
WP_017172484.1|26707_27577_-	site-specific DNA-methyltransferase	NA	S4VZJ3	Pandoravirus	58.4	7.1e-93
WP_011345585.1|29101_30328_+|transposase	IS256-like element ISXax1 family transposase	transposase	A0A218MNI5	uncultured_virus	50.3	2.2e-52
WP_052758118.1|32064_34083_-	conjugative relaxase	NA	D9I5Y3	Acinetobacter_virus	27.2	6.8e-06
>prophage 5
NZ_CP020969	Xanthomonas phaseoli pv. phaseoli strain CFBP6164 plasmid pC, complete sequence	56017	40109	42945	56017	transposase	Leptospira_phage(33.33%)	3	NA	NA
WP_087944778.1|40109_41197_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	37.2	1.3e-43
WP_167389987.1|41193_41940_-|transposase	IS256 family transposase	transposase	A0A218MND5	uncultured_virus	61.7	7.8e-08
WP_022557821.1|41961_42945_+|transposase	IS5-like element ISXfu1 family transposase	transposase	A0A077K814	Ralstonia_phage	59.9	8.2e-98
>prophage 6
NZ_CP020969	Xanthomonas phaseoli pv. phaseoli strain CFBP6164 plasmid pC, complete sequence	56017	48045	50328	56017	transposase	Cronobacter_phage(50.0%)	2	NA	NA
WP_022560507.1|48045_48870_-	DUF945 domain-containing protein	NA	K4F5L3	Cronobacter_phage	42.1	1.0e-48
WP_087944778.1|49241_50328_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	37.2	1.3e-43
