The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP024443	Moraxella osloensis strain NP7 chromosome, complete genome	2389582	22434	98881	2389582	integrase,tRNA,transposase	Chrysochromulina_ericina_virus(14.29%)	60	40526:40543	99438:99455
WP_100269219.1|22434_23040_+|tRNA	tRNA threonylcarbamoyladenosine biosynthesis protein RimN	tRNA	NA	NA	NA	NA
WP_062332997.1|23252_23852_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_100269220.1|23995_25918_+	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	49.3	6.2e-150
WP_100269221.1|32327_34424_+	catalase	NA	A0A2K9L0T1	Tupanvirus	45.1	3.4e-125
WP_100269222.1|35014_35395_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_100269223.1|36668_39788_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100269224.1|39844_40951_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A286QQR2	Streptococcus_phage	29.7	1.6e-25
40526:40543	attL	TAGGTTGATGATTAGCTT	NA	NA	NA	NA
WP_100269225.1|41029_41800_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100269226.1|41803_44998_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100269227.1|45170_45404_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100269228.1|45829_46345_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100269229.1|47227_50530_-	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	24.9	7.6e-63
WP_100269230.1|50571_51279_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_115304568.1|51265_52234_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_158521995.1|52400_53012_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100269232.1|53016_55272_-	N-6 DNA methylase	NA	A0A220A2U4	Liberibacter_phage	26.2	9.0e-31
WP_100269233.1|55756_56155_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100269234.1|56375_57317_-	WG repeat-containing protein	NA	NA	NA	NA	NA
WP_100269235.1|57429_58137_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100269236.1|58151_58403_-	EexN family lipoprotein	NA	NA	NA	NA	NA
WP_100269237.1|58546_58978_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_100269238.1|59314_59518_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_100269239.1|59911_61303_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A2H4JAT5	uncultured_Caudovirales_phage	26.5	2.9e-24
WP_100269240.1|61711_62647_+	DNA/RNA non-specific endonuclease	NA	NA	NA	NA	NA
WP_100269241.1|62907_63282_+	DUF2147 domain-containing protein	NA	NA	NA	NA	NA
WP_100269242.1|63426_64752_-	ammonium transporter	NA	H8ZJB2	Ostreococcus_tauri_virus	31.2	8.7e-34
WP_007115809.1|64874_65213_-	P-II family nitrogen regulator	NA	NA	NA	NA	NA
WP_100270777.1|65937_67341_+	UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase	NA	NA	NA	NA	NA
WP_036594660.1|67462_68587_+	putative lipid II flippase FtsW	NA	NA	NA	NA	NA
WP_100269243.1|68583_69546_-|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	A0A222YZ70	Escherichia_phage	31.0	1.3e-10
WP_036594643.1|69538_69976_-	RNA polymerase-binding protein DksA	NA	NA	NA	NA	NA
WP_100269244.1|70201_71029_-	cAMP phosphodiesterase	NA	NA	NA	NA	NA
WP_062334850.1|71209_71668_-	transcriptional repressor	NA	NA	NA	NA	NA
WP_100269245.1|72014_72416_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100269246.1|72883_73759_+	F0F1 ATP synthase subunit A	NA	NA	NA	NA	NA
WP_100269247.1|73786_74047_+	F0F1 ATP synthase subunit C	NA	NA	NA	NA	NA
WP_062332969.1|74126_74597_+	F0F1 ATP synthase subunit B	NA	NA	NA	NA	NA
WP_100269248.1|74622_75225_+	F0F1 ATP synthase subunit delta	NA	NA	NA	NA	NA
WP_100269249.1|75272_76817_+	F0F1 ATP synthase subunit alpha	NA	NA	NA	NA	NA
WP_100269250.1|76958_77837_+	F0F1 ATP synthase subunit gamma	NA	NA	NA	NA	NA
WP_095356437.1|77862_79263_+	F0F1 ATP synthase subunit beta	NA	NA	NA	NA	NA
WP_100269251.1|79344_79761_+	F0F1 ATP synthase subunit epsilon	NA	NA	NA	NA	NA
WP_100269252.1|80006_81113_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q19ZT4	Mycobacterium_virus	37.3	1.1e-29
WP_007115827.1|81303_82011_+	response regulator	NA	W8CYM9	Bacillus_phage	36.6	1.4e-38
WP_100269253.1|82230_83925_+	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_100270778.1|84052_84232_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100269254.1|84342_85719_-	two-component sensor histidine kinase	NA	NA	NA	NA	NA
WP_100269255.1|85823_87137_+	valine--pyruvate transaminase	NA	NA	NA	NA	NA
WP_100269256.1|87192_87828_-	imidazole glycerol phosphate synthase subunit HisH	NA	NA	NA	NA	NA
WP_100269257.1|87999_88983_+	J domain-containing protein	NA	A0A0N9QPY2	Chrysochromulina_ericina_virus	26.2	4.8e-13
WP_062332934.1|89095_89422_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062332932.1|89522_90344_-	DUF305 domain-containing protein	NA	NA	NA	NA	NA
WP_100269258.1|90489_91155_-	DNA glycosylase	NA	NA	NA	NA	NA
WP_100269259.1|91156_92230_-	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_100269260.1|92226_93384_-	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_100269261.1|93721_95236_+	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.4	2.3e-51
WP_100269262.1|95258_95726_+	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_100269263.1|95850_97086_+	serine/threonine transporter SstT	NA	NA	NA	NA	NA
WP_065252976.1|97315_97726_-|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	64.2	3.3e-48
WP_100269264.1|97774_98881_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q9G0F2	Phage_Gifsy-1	35.4	2.7e-28
99438:99455	attR	TAGGTTGATGATTAGCTT	NA	NA	NA	NA
>prophage 2
NZ_CP024443	Moraxella osloensis strain NP7 chromosome, complete genome	2389582	465713	506444	2389582	tRNA,transposase	Psychrobacter_phage(11.11%)	34	NA	NA
WP_158521997.1|465713_466697_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_100269518.1|466822_467920_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_100269519.1|467989_469777_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_100269520.1|469903_470908_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100270802.1|471088_472453_+	MFS transporter	NA	NA	NA	NA	NA
WP_100269521.1|472590_473262_+	single-stranded DNA-binding protein	NA	M4SRQ0	Psychrobacter_phage	72.2	5.7e-42
WP_100269522.1|473389_474430_-	NADP(H)-dependent aldo-keto reductase	NA	NA	NA	NA	NA
WP_158522022.1|474776_475637_+	type II secretion system protein GspN	NA	NA	NA	NA	NA
WP_100270804.1|475722_476673_+	general secretion pathway protein	NA	NA	NA	NA	NA
WP_100269523.1|476756_479195_+	type II secretion system secretin GspD	NA	R9TEZ5	Vibrio_phage	31.6	3.6e-25
WP_100269524.1|479258_480155_+	FHA domain-containing protein	NA	NA	NA	NA	NA
WP_076773998.1|481018_482209_+	elongation factor Tu	NA	A0A142CJQ8	Brazilian_marseillevirus	27.4	1.1e-19
WP_100269525.1|482357_483476_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q5ULQ4	Lactobacillus_virus	30.7	1.6e-25
WP_100269526.1|483504_484002_+	ribosomal protein S18-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_100269527.1|483994_484810_-	arginyltransferase	NA	NA	NA	NA	NA
WP_065253253.1|484837_485629_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_100269528.1|485644_486643_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	41.5	6.9e-60
WP_100269529.1|487072_490210_+	DNA translocase FtsK	NA	G1D482	Mycobacterium_virus	46.2	4.0e-77
WP_100269530.1|490398_491505_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	S6AND0	Bacillus_phage	36.5	5.2e-24
WP_062333885.1|491676_491913_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100270805.1|491969_493730_-	NAD+ synthase	NA	A0A2L0UZF5	Agrobacterium_phage	38.0	3.4e-94
WP_100269531.1|494150_494405_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062333890.1|494442_494736_-	cell division protein ZapA	NA	NA	NA	NA	NA
WP_100269532.1|494796_495201_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100269533.1|495437_496178_+	UPF0149 family protein	NA	NA	NA	NA	NA
WP_100269534.1|496256_497450_+	acetylornithine deacetylase	NA	NA	NA	NA	NA
WP_100269535.1|497467_498817_+	M24 family metallopeptidase	NA	NA	NA	NA	NA
WP_158521998.1|498906_499392_-	arsenate reductase ArsC	NA	NA	NA	NA	NA
WP_100269537.1|499842_501315_+	sodium-dependent transporter	NA	NA	NA	NA	NA
WP_065252111.1|501362_501497_+	methionine/alanine import family NSS transporter small subunit	NA	NA	NA	NA	NA
WP_100269538.1|501539_503237_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_100269539.1|503423_503915_+	glutathione peroxidase	NA	A0A0M5HSM9	Turkeypox_virus	32.6	1.7e-14
WP_100269540.1|504652_505717_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_100269541.1|505925_506444_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP024443	Moraxella osloensis strain NP7 chromosome, complete genome	2389582	1393383	1472114	2389582	tRNA,transposase	uncultured_virus(15.0%)	59	NA	NA
WP_158521997.1|1393383_1394367_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_100270136.1|1394494_1396612_-	excinuclease ABC subunit UvrB	NA	NA	NA	NA	NA
WP_100270137.1|1397049_1398216_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	58.2	2.4e-120
WP_100270138.1|1398315_1399422_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	S6AND0	Bacillus_phage	38.7	2.8e-25
WP_100270139.1|1399537_1399849_+	DUF3144 domain-containing protein	NA	NA	NA	NA	NA
WP_100270140.1|1399957_1400317_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100270141.1|1400690_1401584_+	methylisocitrate lyase	NA	NA	NA	NA	NA
WP_100270142.1|1401674_1402847_+	2-methylcitrate synthase	NA	NA	NA	NA	NA
WP_100270143.1|1402945_1405552_+	Fe/S-dependent 2-methylisocitrate dehydratase AcnD	NA	NA	NA	NA	NA
WP_100270144.1|1405608_1407435_-	ATP-binding protein	NA	E5E3R2	Burkholderia_phage	21.7	1.2e-06
WP_100270145.1|1407621_1408887_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	54.3	2.2e-95
WP_100270146.1|1409180_1409867_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100270861.1|1410295_1410730_+	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	36.2	1.0e-20
WP_100270147.1|1411035_1412169_+	ribonucleotide-diphosphate reductase subunit beta	NA	A0A173GDC6	Erwinia_phage	70.0	3.8e-155
WP_100270148.1|1412209_1412470_+	2Fe-2S iron-sulfur cluster binding domain-containing protein	NA	NA	NA	NA	NA
WP_100270150.1|1412739_1414644_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.1	3.7e-38
WP_062334708.1|1414902_1415217_+	DUF493 domain-containing protein	NA	NA	NA	NA	NA
WP_100270151.1|1415339_1416650_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100270152.1|1416654_1417419_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100270153.1|1417647_1418571_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_100270154.1|1418572_1419922_+	DUF2868 domain-containing protein	NA	NA	NA	NA	NA
WP_100270155.1|1419924_1420482_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100270156.1|1420513_1422058_+	DUF3482 domain-containing protein	NA	A0A0R6PHS5	Moraxella_phage	51.2	5.8e-98
WP_100270157.1|1422222_1422921_+	VIT family protein	NA	NA	NA	NA	NA
WP_100270158.1|1423136_1424630_+	alanine:cation symporter family protein	NA	NA	NA	NA	NA
WP_100270159.1|1424719_1426075_-	MFS transporter	NA	NA	NA	NA	NA
WP_100270160.1|1426376_1427396_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_100270161.1|1427419_1427863_+	hemerythrin domain-containing protein	NA	NA	NA	NA	NA
WP_100270162.1|1427931_1430253_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.2	2.8e-51
WP_100270163.1|1431205_1432015_+	SIMPL domain-containing protein	NA	NA	NA	NA	NA
WP_100270164.1|1432094_1432613_-	peptidoglycan-associated lipoprotein Pal	NA	NA	NA	NA	NA
WP_100270165.1|1432879_1433437_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100270166.1|1433635_1435537_+	dihydroxy-acid dehydratase	NA	NA	NA	NA	NA
WP_100270167.1|1435841_1438514_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	36.9	5.2e-78
WP_100270168.1|1438577_1439369_+	glutathione-dependent disulfide-bond oxidoreductase	NA	NA	NA	NA	NA
WP_100270169.1|1439596_1440880_+	aspartate kinase	NA	NA	NA	NA	NA
WP_100270170.1|1441197_1441638_+	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	69.6	2.2e-10
WP_100270171.1|1441884_1443046_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	31.5	2.3e-22
WP_100270172.1|1443482_1444031_-	nucleoside deaminase	NA	NA	NA	NA	NA
WP_100270173.1|1444047_1444764_-	uracil-DNA glycosylase	NA	A0A0B4Q6M3	Equid_gammaherpesvirus	51.0	2.6e-48
WP_100270174.1|1444877_1445366_-	3-hydroxybutyryl-CoA dehydratase	NA	NA	NA	NA	NA
WP_100270175.1|1445897_1448186_+	ribonucleoside-diphosphate reductase subunit alpha	NA	I3UMG3	Colwellia_phage	66.3	3.5e-301
WP_158522012.1|1448383_1448548_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100270862.1|1448544_1450236_-	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_036601311.1|1450536_1450974_+	HIT domain-containing protein	NA	NA	NA	NA	NA
WP_100270863.1|1451012_1452362_+	adenylate/guanylate cyclase domain-containing protein	NA	A0A218MLZ2	uncultured_virus	28.0	2.9e-21
WP_100270176.1|1452504_1454742_-	NADP-dependent isocitrate dehydrogenase	NA	NA	NA	NA	NA
WP_100270177.1|1455118_1456180_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100270178.1|1457641_1459420_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	28.8	1.3e-56
WP_100270179.1|1459789_1460278_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100270180.1|1460440_1462375_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_100270181.1|1462670_1463927_+	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_100270182.1|1464039_1465746_+	response regulator	NA	NA	NA	NA	NA
WP_100270183.1|1465742_1466741_+	serine/threonine protein kinase	NA	Q77IW9	Helicoverpa_zea_single_nucleopolyhedrovirus	27.2	2.2e-05
WP_100270184.1|1467184_1468336_+	AAA family ATPase	NA	A0A292GDQ9	Xanthomonas_phage	36.0	5.0e-38
WP_100270485.1|1468468_1470208_-|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	91.5	5.6e-291
WP_100269454.1|1470287_1471196_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_100270185.1|1471335_1471707_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_100270186.1|1471703_1472114_-|transposase	transposase	transposase	A0A218MNG9	uncultured_virus	47.4	6.0e-26
>prophage 4
NZ_CP024443	Moraxella osloensis strain NP7 chromosome, complete genome	2389582	1876222	1951603	2389582	integrase,tRNA,transposase	uncultured_virus(33.33%)	56	1893516:1893530	1953363:1953377
WP_100270459.1|1876222_1876525_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC	tRNA	NA	NA	NA	NA
WP_100270460.1|1876582_1878079_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
WP_100270461.1|1878090_1879587_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB	tRNA	NA	NA	NA	NA
WP_100270462.1|1879887_1880163_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100270885.1|1880261_1880759_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_100270463.1|1880967_1881576_+	nitroreductase family protein	NA	NA	NA	NA	NA
WP_100270464.1|1881674_1883222_-	CYTH and CHAD domain-containing protein	NA	NA	NA	NA	NA
WP_100270465.1|1883519_1885031_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	26.8	2.1e-31
WP_100270886.1|1885027_1886212_-	DUF1615 family protein	NA	NA	NA	NA	NA
WP_100270466.1|1886778_1889196_+	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_100270467.1|1889222_1890125_+	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	NA	NA	NA	NA
WP_100270468.1|1890315_1890726_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100270469.1|1890967_1891867_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_100270470.1|1891900_1892632_-	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_100270471.1|1892779_1894105_-	glutamate-1-semialdehyde 2,1-aminomutase	NA	A0A1V0SKB7	Klosneuvirus	23.0	1.1e-07
1893516:1893530	attL	TCTTTGATGGCTTGC	NA	NA	NA	NA
WP_100270473.1|1894519_1895626_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q19ZT4	Mycobacterium_virus	30.8	7.7e-28
WP_100270887.1|1895732_1896044_-	NGG1p interacting factor NIF3	NA	NA	NA	NA	NA
WP_100270474.1|1896249_1896684_+	YeeE/YedE family protein	NA	NA	NA	NA	NA
WP_100270475.1|1896707_1897136_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095355811.1|1897142_1897802_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_100270476.1|1898066_1899794_+	GMC family oxidoreductase	NA	NA	NA	NA	NA
WP_100270477.1|1899840_1901268_+	coniferyl aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_100270478.1|1901399_1902644_-	DUF2236 domain-containing protein	NA	NA	NA	NA	NA
WP_004682132.1|1903638_1905474_-	3-hydroxyacyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_004682130.1|1905725_1906880_-	catalase family protein	NA	NA	NA	NA	NA
WP_004682128.1|1906961_1908551_-	Dyp-type peroxidase	NA	NA	NA	NA	NA
WP_004280952.1|1908797_1909367_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100270479.1|1909575_1910277_-|transposase	IS1 family transposase	transposase	A0A218MNG1	uncultured_virus	96.9	1.7e-68
WP_100270480.1|1910434_1910845_-	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	58.3	2.4e-35
WP_100270481.1|1910870_1912163_-	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	67.1	1.6e-149
WP_007117092.1|1912230_1912497_+	metalloregulator ArsR/SmtB family transcription factor	NA	A0A218MNF3	uncultured_virus	74.1	1.9e-28
WP_100270482.1|1912691_1912916_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100270483.1|1913345_1914167_-	crotonase/enoyl-CoA hydratase family protein	NA	NA	NA	NA	NA
WP_100270484.1|1914862_1915228_-	replication initiation protein	NA	NA	NA	NA	NA
WP_100270485.1|1915377_1917117_-|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	91.5	5.6e-291
WP_100270185.1|1917201_1917573_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_100270186.1|1917569_1917980_-|transposase	transposase	transposase	A0A218MNG9	uncultured_virus	47.4	6.0e-26
WP_100270486.1|1918416_1921671_-	type I-F CRISPR-associated helicase Cas3	NA	A0A2I7RCU8	Vibrio_phage	28.0	5.4e-45
WP_100270487.1|1921855_1923094_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100270488.1|1923090_1924062_+	type I-F CRISPR-associated protein Csy2	NA	NA	NA	NA	NA
WP_100270489.1|1924123_1925185_+	type I-F CRISPR-associated protein Csy3	NA	A0A2D0YYX4	Vibrio_phage	32.1	2.6e-25
WP_100270490.1|1925186_1925810_+	type I-F CRISPR-associated endoribonuclease Cas6/Csy4	NA	NA	NA	NA	NA
WP_050324603.1|1925868_1926837_+	type I-F CRISPR-associated endonuclease Cas1	NA	A0A2D0YFC9	Vibrio_phage	34.5	3.0e-44
WP_100269541.1|1930334_1930853_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_100269542.1|1930873_1931254_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_100270888.1|1935952_1936159_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_100270491.1|1936509_1937292_-	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_100270492.1|1937487_1938942_+	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_100270493.1|1939248_1940052_+	N-acyl homoserine lactonase family protein	NA	NA	NA	NA	NA
WP_100270494.1|1940266_1941409_+	iron-containing alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_100270495.1|1941646_1942564_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_100270496.1|1942793_1944005_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_100270497.1|1944136_1945354_+	CoA transferase	NA	NA	NA	NA	NA
WP_100270498.1|1945485_1946649_+	iron-containing alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_062332068.1|1946711_1947611_+	gluconolactonase	NA	NA	NA	NA	NA
WP_100270499.1|1948180_1951603_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
1953363:1953377	attR	TCTTTGATGGCTTGC	NA	NA	NA	NA
>prophage 1
NZ_CP024444	Moraxella osloensis strain NP7 plasmid pNP7-1, complete sequence	271709	2411	52802	271709	transposase	Mycobacterium_virus(18.18%)	53	NA	NA
WP_100270924.1|2411_3518_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q19ZT4	Mycobacterium_virus	32.3	4.5e-28
WP_100270925.1|4425_5496_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100270926.1|5649_6342_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100270928.1|7767_9174_+	replication initiation protein	NA	NA	NA	NA	NA
WP_100270929.1|9335_12116_-	class I SAM-dependent DNA methyltransferase	NA	Q6NE04	Leptospira_phage	39.9	9.3e-179
WP_100270930.1|12189_12597_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100270931.1|12723_13911_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100270932.1|13907_14141_-	antitoxin VbhA family protein	NA	NA	NA	NA	NA
WP_100270933.1|14170_14455_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100270934.1|14703_15036_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100270935.1|15271_15640_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100270936.1|15802_16909_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q19ZT4	Mycobacterium_virus	32.6	3.5e-28
WP_145958803.1|16944_17418_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100270938.1|17479_18229_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_100270939.1|18293_18593_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145958804.1|18834_19026_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100270940.1|19138_19762_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100270941.1|19803_20022_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100270942.1|20042_20249_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100270943.1|20616_21120_-	single-stranded DNA-binding protein	NA	E1ABY7	Pseudoalteromonas_phage	45.5	2.4e-16
WP_100270944.1|21166_22405_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100270945.1|22423_23137_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100270946.1|23318_23564_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100270947.1|23586_24672_-	hypothetical protein	NA	A0A0R6PC01	Moraxella_phage	27.8	2.4e-21
WP_158522023.1|24675_25977_-	RepB family plasmid replication initiator protein	NA	NA	NA	NA	NA
WP_100270949.1|26657_27410_+|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	34.2	1.8e-12
WP_100271148.1|27607_28216_+	recombinase family protein	NA	A0A286S1P7	Klebsiella_phage	46.0	1.4e-34
WP_100271149.1|28376_28640_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_100270950.1|28636_28969_+	type II toxin-antitoxin system MqsA family antitoxin	NA	NA	NA	NA	NA
WP_100270951.1|29190_30093_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_062335149.1|30247_30523_-	type II toxin-antitoxin system YafQ family toxin	NA	NA	NA	NA	NA
WP_100270952.1|30515_30812_-	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	NA	NA	NA	NA
WP_100270953.1|31110_31950_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_100270954.1|32083_32689_+	LysE family transporter	NA	NA	NA	NA	NA
WP_158522024.1|32799_33693_+	EamA family transporter	NA	NA	NA	NA	NA
WP_100270956.1|33699_34434_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_062335155.1|34441_34900_+	DMT family transporter	NA	NA	NA	NA	NA
WP_100270957.1|35044_35644_+	DJ-1/PfpI family protein	NA	NA	NA	NA	NA
WP_100270958.1|35852_36647_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_100271150.1|36668_37529_-	PhzF family phenazine biosynthesis protein	NA	NA	NA	NA	NA
WP_100270959.1|37668_39057_-	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_100270960.1|39179_40091_+	DMT family transporter	NA	NA	NA	NA	NA
WP_100270961.1|40153_40846_-	aspartate/glutamate racemase family protein	NA	NA	NA	NA	NA
WP_100270962.1|41066_42737_+	2-isopropylmalate synthase	NA	NA	NA	NA	NA
WP_158522025.1|42723_43440_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_100270964.1|44016_44880_-	DMT family transporter	NA	NA	NA	NA	NA
WP_100270965.1|45023_46418_+	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	29.7	4.9e-11
WP_100270966.1|46579_46855_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_100270967.1|46963_47647_+	DUF421 domain-containing protein	NA	NA	NA	NA	NA
WP_100270968.1|47958_48258_-	PaaI family thioesterase	NA	NA	NA	NA	NA
WP_100270969.1|48494_49421_-	class A beta-lactamase	NA	A0A1B0VBP7	Salmonella_phage	33.6	2.4e-30
WP_100270970.1|51203_51893_-|transposase	IS1 family transposase	transposase	A0A218MNG1	uncultured_virus	82.3	9.0e-59
WP_100270971.1|52049_52802_-|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	29.8	1.4e-09
>prophage 2
NZ_CP024444	Moraxella osloensis strain NP7 plasmid pNP7-1, complete sequence	271709	79651	123486	271709	transposase	Shigella_phage(18.18%)	41	NA	NA
WP_100270995.1|79651_80758_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A220NS37	Mycobacterium_phage	35.2	1.0e-27
WP_145958809.1|80829_81402_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100270997.1|81549_81969_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_100270998.1|82316_82658_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100270999.1|82951_83962_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145958810.1|84010_84958_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100271001.1|84971_85571_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145958811.1|85588_86539_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100271003.1|86813_88850_+	peptidoglycan DD-metalloendopeptidase family protein	NA	M4SJC7	Cyanophage	31.0	1.3e-09
WP_100271004.1|88894_89428_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100271005.1|89441_90008_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100271006.1|90194_91262_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100271007.1|91302_92358_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145958812.1|92435_92792_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100271009.1|92871_93093_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100271010.1|93142_93670_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100271011.1|93723_94347_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100271012.1|95341_96503_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	28.9	1.1e-19
WP_100271013.1|96668_97388_-	UTRA domain-containing protein	NA	NA	NA	NA	NA
WP_100271014.1|97587_99144_+	histidine ammonia-lyase	NA	A0A1V0S940	Catovirus	39.5	2.7e-79
WP_100271015.1|99176_100895_+	urocanate hydratase	NA	NA	NA	NA	NA
WP_100271016.1|101065_101740_+	flavin reductase family protein	NA	NA	NA	NA	NA
WP_100271017.1|101853_103278_+	cytosine permease	NA	NA	NA	NA	NA
WP_100271018.1|103476_104508_+	formimidoylglutamase	NA	NA	NA	NA	NA
WP_100271019.1|104526_105756_+	imidazolonepropionase	NA	NA	NA	NA	NA
WP_100271020.1|106247_107409_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	30.4	3.1e-19
WP_100271021.1|107621_108437_+	aminoglycoside 3'-phosphotransferase	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	51.9	1.5e-76
WP_100271022.1|108723_108969_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100271151.1|109119_110178_-	endonuclease	NA	NA	NA	NA	NA
WP_100271023.1|110924_112452_+|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	28.8	1.6e-10
WP_069597335.1|112760_113237_+	AAC(3)-I family aminoglycoside N-acetyltransferase	NA	NA	NA	NA	NA
WP_100271024.1|113299_114098_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_100271152.1|114399_116007_-	allantoin permease	NA	NA	NA	NA	NA
WP_100271025.1|116173_117418_+	acetamidase/formamidase family protein	NA	A0A1V0S8X7	Catovirus	59.2	1.6e-138
WP_100271026.1|117573_117894_+	formamidase	NA	NA	NA	NA	NA
WP_158522028.1|118260_118416_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158522029.1|118405_118819_+	PIN domain-containing protein	NA	NA	NA	NA	NA
WP_100271029.1|118835_119402_+	recombinase family protein	NA	E5FFF9	Burkholderia_phage	52.4	1.0e-44
WP_100271030.1|119549_120101_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100271031.1|121265_122060_-	hypothetical protein	NA	A0A218MND5	uncultured_virus	93.0	3.9e-21
WP_100271032.1|122493_123486_-|transposase	IS5-like element ISAba23 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	24.5	2.3e-07
>prophage 1
NZ_CP024445	Moraxella osloensis strain NP7 plasmid pNP7-2, complete sequence	134961	4450	52082	134961	transposase	uncultured_virus(35.29%)	44	NA	NA
WP_145958820.1|4450_5005_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_099808668.1|5580_5880_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_099808669.1|5883_6225_+	type II toxin-antitoxin system MqsA family antitoxin	NA	NA	NA	NA	NA
WP_100271158.1|7043_8168_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100271159.1|8233_9976_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036604826.1|9999_11187_+	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	48.9	2.5e-85
WP_100271160.1|11388_11916_+	recombinase family protein	NA	A0A286S1P7	Klebsiella_phage	45.9	9.7e-29
WP_062334988.1|12079_12403_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A141GEX6	Brucella_phage	52.2	8.6e-20
WP_062334989.1|12389_12677_+	putative addiction module antidote protein	NA	NA	NA	NA	NA
WP_100271161.1|13621_14452_+	cation transporter	NA	NA	NA	NA	NA
WP_100271162.1|14904_15246_+	type II toxin-antitoxin system MqsA family antitoxin	NA	NA	NA	NA	NA
WP_100271163.1|15272_16337_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_100271164.1|16638_16914_+|transposase	transposase	transposase	U5P4I9	Shigella_phage	36.1	1.0e-05
WP_100271165.1|16959_17676_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	42.4	4.0e-41
WP_100271167.1|18692_18884_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100271168.1|18945_20082_+	ThiF family adenylyltransferase	NA	NA	NA	NA	NA
WP_100271169.1|20074_21154_+	ThiF family adenylyltransferase	NA	NA	NA	NA	NA
WP_100271170.1|21143_23297_+	ATP-binding cassette domain-containing protein	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	27.4	7.7e-56
WP_100271171.1|23826_25563_-|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	90.8	4.3e-283
WP_100271172.1|25647_26019_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_100271173.1|26015_26426_-|transposase	transposase	transposase	A0A218MNG9	uncultured_virus	49.6	4.1e-27
WP_100270485.1|26545_28285_-|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	91.5	5.6e-291
WP_100270185.1|28369_28741_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_100270186.1|28737_29148_-|transposase	transposase	transposase	A0A218MNG9	uncultured_virus	47.4	6.0e-26
WP_100271174.1|29160_29565_-	hypothetical protein	NA	A0A218MNI5	uncultured_virus	45.3	1.2e-26
WP_100271175.1|29570_30425_-	hypothetical protein	NA	A0A218MND5	uncultured_virus	91.2	2.1e-20
WP_145958821.1|30495_30675_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145958822.1|31242_31800_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100271177.1|31842_40440_+	hypothetical protein	NA	A0A2H4JEI4	uncultured_Caudovirales_phage	38.0	3.5e-19
WP_158522035.1|40623_41982_+	TolC family protein	NA	NA	NA	NA	NA
WP_100271179.1|41978_44096_+	ATP-binding cassette domain-containing protein	NA	A0A1V0SE00	Indivirus	33.6	1.9e-22
WP_100271180.1|44092_45265_+	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_100271181.1|45266_45824_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100271182.1|46002_46182_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_100271183.1|46209_47085_+	PhzF family phenazine biosynthesis protein	NA	NA	NA	NA	NA
WP_100271184.1|47217_47817_-	hypothetical protein	NA	S4TP71	Salmonella_phage	31.4	4.7e-11
WP_100271185.1|47837_48083_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100271186.1|48553_49045_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_100271187.1|49041_49596_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_145958823.1|49510_49942_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100271189.1|49941_50547_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100271190.1|51447_51765_+	hypothetical protein	NA	B6ETC4	Enterobacteria_phage	46.1	3.9e-17
WP_100271191.1|51764_51980_+	hypothetical protein	NA	A0A0N7C1X7	Escherichia_phage	39.4	3.8e-08
WP_145958827.1|52001_52082_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP024445	Moraxella osloensis strain NP7 plasmid pNP7-2, complete sequence	134961	60309	110972	134961	integrase,transposase	Shigella_phage(23.08%)	51	70263:70322	109733:111004
WP_100271198.1|60309_62049_-|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	91.7	4.2e-286
WP_100271199.1|62128_62500_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_100271252.1|62496_62919_-|transposase	transposase	transposase	A0A218MNG9	uncultured_virus	47.8	4.6e-21
WP_100271200.1|63133_64198_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_100271201.1|64206_64770_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100271202.1|66403_66967_+	recombinase family protein	NA	E5FFF9	Burkholderia_phage	50.5	1.8e-41
WP_100271203.1|67168_68935_+	KAP family P-loop domain protein	NA	NA	NA	NA	NA
WP_100271204.1|68937_69696_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100271205.1|69692_70316_+	hypothetical protein	NA	NA	NA	NA	NA
70263:70322	attL	TATAATACTCCCAGAAAACTAGACCAAAAAATCGTAGCAAATAAGATAGAATAGCCCTTA	NA	NA	NA	NA
WP_100270171.1|70340_71502_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	30.2	2.5e-21
WP_145958824.1|71534_72251_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100271253.1|72250_72970_+	TatD family hydrolase	NA	NA	NA	NA	NA
WP_100271207.1|73204_74764_+	protein kinase	NA	M1HTX6	Paramecium_bursaria_Chlorella_virus	28.1	2.2e-12
WP_100271208.1|74974_75286_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_158522036.1|75480_75636_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100271209.1|75936_77130_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100271210.1|77119_79219_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076777093.1|79350_79983_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076777081.1|79985_80915_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099808770.1|80923_82816_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100271211.1|82808_83777_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076777086.1|83773_84841_+	methyltransferase	NA	NA	NA	NA	NA
WP_100271254.1|84995_85106_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_158522037.1|85457_86231_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	Q6J1X2	Lactobacillus_phage	32.2	1.6e-11
WP_100271213.1|87942_88305_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100271214.1|88317_89535_+	nucleoside 2-deoxyribosyltransferase	NA	A0A1G5S9Z4	Enterococcus_phage	33.6	1.4e-06
WP_100271215.1|89531_90134_+	7-cyano-7-deazaguanine synthase	NA	A0A2I7QX69	Vibrio_phage	27.6	1.6e-06
WP_100271216.1|90123_91602_+	deoxyguanosinetriphosphate triphosphohydrolase family protein	NA	NA	NA	NA	NA
WP_145958825.1|91674_91953_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100269541.1|92178_92697_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_100269542.1|92717_93098_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_100271219.1|93434_94996_-|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	24.5	3.2e-11
WP_100271220.1|95489_96062_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_158522038.1|96441_96612_+	hypothetical protein	NA	A0A0N7C1X7	Escherichia_phage	67.4	5.7e-07
WP_100271222.1|96804_97966_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	29.5	4.3e-21
WP_100271223.1|97976_98264_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100271224.1|98292_98448_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_100271225.1|98583_99159_-	DJ-1/PfpI family protein	NA	NA	NA	NA	NA
WP_100271226.1|99221_99530_-	DUF1272 domain-containing protein	NA	NA	NA	NA	NA
WP_100271227.1|99605_100103_-	peroxiredoxin	NA	NA	NA	NA	NA
WP_100271228.1|100236_100782_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_158522039.1|100827_100992_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100271229.1|101146_102427_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_100271230.1|102466_103597_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_100271231.1|103593_104715_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100271232.1|104711_105491_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_158522040.1|105469_106258_-	hypothetical protein	NA	A0A2K9L268	Tupanvirus	37.4	1.6e-06
WP_145958826.1|106415_106847_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100271234.1|106839_107904_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_158522041.1|107908_108955_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_100270171.1|109810_110972_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	30.2	2.5e-21
109733:111004	attR	TATAATACTCCCAGAAAACTAGACCAAAAAATCGTAGCAAATAAGATAGAATAGCCCTTAAGAAAAGAGGTCTATCTAATGACAAAAGTTCGTAAACGTCACAATGCTGAATTTAAAAGCAAAGTTGCCATTGAAGCCATCAAAGAGCAAAAGACGATCAATGAGCTGACCGCTGAATACGGTGTTCACGCAACCCAAATCAGCAACTGGAAAAAGCAAGCCTTGGCTGTCATACCCAGTGCCTTTAACACCAAACAGCATGACAACGAACAAGCCCAGCAAGCCACTATCGATGAACTGCATCGGCAACTGGGGCAAGTCATTAGTGAGAGAGACTGGCTTAAAAAAAAGTCCTCACAGCTACCTTGAATGCTCGTAAACAACTGCTAGAGCCTGACAATAAGGATTTCAGTACTCGTAAGCAATGTGAACTACTTGGTATTAACCGCTCAAGTCTGTATTATCAGCCAAAGCCCATCAGCGAGCTTGATATCACCTTGATGAACCTACTTGACGAGCAATATACCAAAACCCCATTTTACGGGGTAAAGCGTATGACTGCTCATTTAAGGCAATTGGGTCATCCAGTAGGACAAAAGCGAGTTAGGCGACTATTAAGACAAATGGGACTCGATGCCATCTACCAGCATCCTAACACAAGTAAACCTAATCCTGAGCATCAAGTTTACCCGTATTTGCTTAGAAATGTACCCATCACCCGATGTAATCAAGTATGGAGTACCGATATCACTTACATTCGCCTGTCTAAGGGCTTTGTGTATTTGATGGCGGTGATTGATTGGTATAGCCGTTATGTTTTAGGTTGGTCGCTATCTACCACGCTTGAGGCAGATTTCTGCATTGATACGGTGGGTAAACTATTGCACAATGGGTTACGCTGTGAGATTTTTAATACGGATCAAGGCTCGCAGTTCACCACGCCAAGATTTACCATGCCACTCATTGATTCGGGCATTGCTGTGAGCATGGATGGTCGTGGCAGGGCGTTGGACAATATCTTTGTGGAAAGGCTTTGGCGGTCAGTAAAATATGAGTGCGTGTATTTATGCCAGTTTGATACAGTCAGTCAAGCCAGAGCTGGTTTGAAACACTACTTCGAGTTTTACAATCATGAGCGGTTGCATCAGTCGCTTGATTACCATACCCCTGCACAGGTTTATTTAAACAATAGTTCGGATAATCCTGTGCTTTATCAACCCAATTCTATCTTAATTTTGTGAGAATTTGGTCTAGACATTGGGGAGTACCTTA	NA	NA	NA	NA
>prophage 3
NZ_CP024445	Moraxella osloensis strain NP7 plasmid pNP7-2, complete sequence	134961	126708	134441	134961		Staphylococcus_phage(33.33%)	8	NA	NA
WP_083106299.1|126708_126915_-	hypothetical protein	NA	A0A218MNB9	uncultured_virus	64.2	1.9e-17
WP_100271247.1|127166_127394_+	helix-turn-helix transcriptional regulator	NA	A0A1W6JQE6	Staphylococcus_phage	34.7	1.2e-07
WP_100271248.1|127412_128960_+	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	43.9	4.9e-105
WP_100271255.1|128959_129436_+	DUF3990 domain-containing protein	NA	A0A0H3UZB3	Geobacillus_virus	29.2	4.2e-07
WP_062335108.1|129432_129684_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100271249.1|129680_129884_+	DUF3791 domain-containing protein	NA	NA	NA	NA	NA
WP_100271256.1|129892_131029_+	restriction endonuclease subunit S	NA	F2Y1N5	Organic_Lake_phycodnavirus	26.7	2.7e-07
WP_100271250.1|131294_134441_+	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	22.3	4.6e-25
>prophage 1
NZ_CP024446	Moraxella osloensis strain NP7 plasmid pNP7-3, complete sequence	65541	21560	64328	65541	transposase,integrase	Mycobacterium_virus(10.0%)	31	25671:25686	54524:54539
WP_100271277.1|21560_22697_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q19ZT4	Mycobacterium_virus	30.5	2.0e-26
WP_100271278.1|22346_23936_-	ABC transporter ATP-binding protein	NA	A0A2R8FFL6	Cedratvirus	40.6	2.4e-06
WP_100271279.1|24505_25477_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100270171.1|25533_26695_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	30.2	2.5e-21
25671:25686	attL	GCAAGCCTTGGCTGTC	NA	NA	NA	NA
WP_100271280.1|26806_27109_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100271281.1|27516_28194_-	response regulator	NA	W8CYM9	Bacillus_phage	32.0	3.5e-31
WP_100271282.1|28205_30956_-	DUF4118 domain-containing protein	NA	A0A1B0VMK3	Pseudomonas_phage	23.4	2.8e-10
WP_100271283.1|30976_31600_-	potassium-transporting ATPase subunit KdpC	NA	NA	NA	NA	NA
WP_100271284.1|31616_33749_-	potassium-transporting ATPase subunit KdpB	NA	E4ZFI9	Streptococcus_phage	28.3	4.6e-37
WP_100271285.1|33780_35490_-	potassium-transporting ATPase subunit KdpA	NA	NA	NA	NA	NA
WP_072092986.1|35489_35570_-	K(+)-transporting ATPase subunit F	NA	NA	NA	NA	NA
WP_158521997.1|35860_36844_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_007117301.1|37052_38282_-	TerD family protein	NA	NA	NA	NA	NA
WP_100269542.1|40205_40586_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_100269541.1|40606_41125_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_145958832.1|44054_44543_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007116059.1|47573_48536_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_007116058.1|48619_49027_-	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_040403539.1|49098_49449_+	mercuric ion transporter MerT	NA	NA	NA	NA	NA
WP_040403538.1|49462_49738_+	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_158522047.1|49820_49979_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007116055.1|50000_51623_+	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	28.5	2.1e-37
WP_007116054.1|51634_52270_+	organomercurial lyase MerB	NA	NA	NA	NA	NA
WP_100271287.1|54102_54897_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
54524:54539	attR	GACAGCCAAGGCTTGC	NA	NA	NA	NA
WP_100271289.1|55059_55644_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100271290.1|55873_56434_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100271291.1|56575_57196_-	recombinase family protein	NA	A0A219YA40	Aeromonas_phage	29.5	1.4e-05
WP_100271292.1|57363_58185_-	trypsin-like peptidase domain-containing protein	NA	A0A2H4JE36	uncultured_Caudovirales_phage	34.8	1.9e-31
WP_100271293.1|60166_60571_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158522048.1|60862_62938_+	MobA/MobL family protein	NA	NA	NA	NA	NA
WP_100271295.1|63068_64328_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	95.3	5.2e-105
>prophage 1
NZ_CP024448	Moraxella osloensis strain NP7 plasmid pNP7-5, complete sequence	59633	1974	12715	59633	transposase	uncultured_virus(70.0%)	14	NA	NA
WP_100271345.1|1974_2958_+	DUF1016 domain-containing protein	NA	Q9JMP5	Wolbachia_phage	58.5	2.2e-103
WP_100271346.1|3009_3207_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100271347.1|3281_3935_+	DEAD/DEAH box helicase family protein	NA	NA	NA	NA	NA
WP_100271348.1|3989_4712_+	DUF3387 domain-containing protein	NA	NA	NA	NA	NA
WP_072092987.1|5238_6195_+	replication initiation protein	NA	A0A218MNI2	uncultured_virus	99.7	1.2e-173
WP_100271349.1|6253_6706_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A218MND2	uncultured_virus	99.3	2.9e-82
WP_100271350.1|6846_6960_+	hypothetical protein	NA	A0A218MNF2	uncultured_virus	100.0	9.6e-11
WP_100271351.1|7075_8287_+	Y-family DNA polymerase	NA	A0A218MNF2	uncultured_virus	96.0	8.3e-217
WP_100271352.1|8307_8988_+	DUF159 family protein	NA	A0A218MNF5	uncultured_virus	89.4	1.6e-113
WP_100271353.1|8994_9648_+	3'-5' exonuclease	NA	A0A218MNF0	uncultured_virus	88.9	6.7e-96
WP_100271354.1|9708_9930_-	helix-turn-helix transcriptional regulator	NA	A0A2K9V490	Faecalibacterium_phage	41.0	9.7e-07
WP_100271355.1|10096_10381_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100271356.1|10888_11590_-|transposase	IS1 family transposase	transposase	A0A218MNG1	uncultured_virus	79.2	3.9e-57
WP_100271357.1|11854_12715_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	35.6	2.4e-32
