The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP024570	Klebsiella pneumoniae strain INF274 chromosome, complete genome	5293333	453139	525129	5293333	transposase,capsid,protease,tail,head,tRNA,portal,terminase,integrase	uncultured_Caudovirales_phage(55.0%)	72	470747:470764	488048:488065
WP_002919147.1|453139_454087_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	37.2	2.2e-07
WP_002919144.1|454101_454611_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	40.3	2.6e-18
WP_002919139.1|454739_455864_+	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_002919137.1|455835_456309_+	DUF494 domain-containing protein	NA	NA	NA	NA	NA
WP_004145330.1|456334_456877_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002919132.1|456881_457454_+	L-threonylcarbamoyladenylate synthase type 1 TsaC	NA	NA	NA	NA	NA
WP_002919126.1|457457_458276_+	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_002919125.1|458272_458530_+	DUF1488 domain-containing protein	NA	NA	NA	NA	NA
WP_002919123.1|458505_459060_-	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_002919103.1|464855_465077_-	membrane protein	NA	NA	NA	NA	NA
WP_002919102.1|465370_468481_-	multidrug efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_002919101.1|468493_469633_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_004150972.1|470011_470662_+	acrEF/envCD operon transcriptional regulator	NA	NA	NA	NA	NA
470747:470764	attL	GTATCAGTTCATGCCGTA	NA	NA	NA	NA
WP_004150971.1|470937_472164_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	62.2	1.8e-150
WP_004150970.1|472256_473198_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099595205.1|473379_473637_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_085955245.1|473639_474832_-|transposase	IS3-like element ISKpn18 family transposase	transposase	U5P429	Shigella_phage	43.5	3.5e-50
WP_004150969.1|474980_475760_+	hypothetical protein	NA	Q8HA02	Enterobacteria_phage	51.5	6.2e-40
WP_106918304.1|476211_476481_+	host cell division inhibitor Icd-like protein	NA	A0A2H4JGW3	uncultured_Caudovirales_phage	94.4	2.4e-44
WP_001549752.1|476473_476662_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150967.1|476654_476969_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150966.1|476965_477334_+	hypothetical protein	NA	A0A2H4JCX7	uncultured_Caudovirales_phage	81.1	3.7e-51
WP_001549749.1|477330_477696_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150965.1|477695_479831_+	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	62.4	3.4e-205
WP_004150964.1|480173_480509_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150963.1|480557_481070_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001549743.1|481333_482500_+|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	95.9	9.8e-207
WP_001547826.1|482551_483112_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	95.7	1.2e-98
WP_004150962.1|483113_484355_+|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	96.5	1.0e-230
WP_004150961.1|484351_484687_+|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	57.8	3.7e-26
WP_001547824.1|484683_484983_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4JD08	uncultured_Caudovirales_phage	80.8	3.4e-39
WP_004150959.1|484982_485426_+	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	91.8	2.8e-77
WP_000113647.1|485701_486058_+|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	99.2	5.5e-60
WP_004150955.1|486041_487703_+|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	98.0	0.0e+00
WP_004150954.1|487705_487897_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000462905.1|488050_488347_-	DNA-binding transcriptional regulator Fis	NA	NA	NA	NA	NA
488048:488065	attR	GTATCAGTTCATGCCGTA	NA	NA	NA	NA
WP_004144972.1|488371_489337_-|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_002918745.1|489694_490576_-	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
WP_002918742.1|490587_492039_-	sodium/pantothenate symporter	NA	NA	NA	NA	NA
WP_002918740.1|492028_492271_-	YhdT family protein	NA	NA	NA	NA	NA
WP_002918738.1|492381_493731_-	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_002918736.1|493741_494209_-	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
WP_002918732.1|494231_494684_-	type II 3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
WP_002918689.1|494907_495516_-	protein-methionine-sulfoxide reductase heme-binding subunit MsrQ	NA	NA	NA	NA	NA
WP_002918688.1|495515_496517_-	protein-methionine-sulfoxide reductase catalytic subunit MsrP	NA	NA	NA	NA	NA
WP_002918687.1|496745_496937_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085955245.1|497271_498463_+|transposase	IS3-like element ISKpn18 family transposase	transposase	U5P429	Shigella_phage	43.5	3.5e-50
WP_002918653.1|500568_501612_+	rod shape-determining protein	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
WP_004149974.1|501682_502675_+	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_002918648.1|502674_503163_+	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_002918646.1|503170_503752_+	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_002918644.1|503754_505224_+	ribonuclease G	NA	NA	NA	NA	NA
WP_004150952.1|505261_509059_+	AsmA2 domain-containing protein	NA	NA	NA	NA	NA
WP_002918642.1|509147_510593_+|protease	metalloprotease TldD	protease	NA	NA	NA	NA
WP_002918641.1|510628_511558_-	HTH-type transcriptional activator AaeR	NA	NA	NA	NA	NA
WP_002918640.1|511689_511893_+	AaeX family protein	NA	NA	NA	NA	NA
WP_002918639.1|511900_512833_+	p-hydroxybenzoic acid efflux pump subunit AaeA	NA	NA	NA	NA	NA
WP_002918632.1|512838_514806_+	p-hydroxybenzoic acid efflux pump subunit AaeB	NA	NA	NA	NA	NA
WP_002918629.1|514885_515161_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002918627.1|515211_515478_-	peroxide/acid stress response protein YhcN	NA	NA	NA	NA	NA
WP_002918626.1|515576_515840_-	peroxide/acid stress response protein YhcN	NA	NA	NA	NA	NA
WP_002918625.1|516215_516686_-	transcriptional regulator ArgR	NA	NA	NA	NA	NA
WP_002918570.1|517100_518039_+	malate dehydrogenase	NA	NA	NA	NA	NA
WP_002918568.1|518175_519234_-	outer membrane-stress sensor serine endopeptidase DegS	NA	NA	NA	NA	NA
WP_002918566.1|519321_520689_-|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	25.3	6.0e-22
WP_002918565.1|520862_521261_-	DUF1043 family protein	NA	NA	NA	NA	NA
WP_004144945.1|521451_522579_+	cell division protein ZapE	NA	NA	NA	NA	NA
WP_002918559.1|522844_523273_+	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_000829818.1|523288_523681_+	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_135801240.1|523738_524023_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002918467.1|523992_524631_+	stringent starvation protein A	NA	NA	NA	NA	NA
WP_002918465.1|524634_525129_+|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	54.8	1.5e-26
>prophage 2
NZ_CP024570	Klebsiella pneumoniae strain INF274 chromosome, complete genome	5293333	1642430	1685215	5293333	protease,integrase,transposase	Escherichia_phage(21.05%)	42	1669702:1669761	1675613:1676270
WP_002901758.1|1642430_1643477_+|protease	protease SohB	protease	NA	NA	NA	NA
WP_002901761.1|1643524_1643776_-	YciN family protein	NA	NA	NA	NA	NA
WP_002901763.1|1644182_1646780_+	type I DNA topoisomerase	NA	A0A2K9L5F8	Tupanvirus	35.6	2.9e-89
WP_002901772.1|1647125_1648100_+	HTH-type transcriptional regulator CysB	NA	NA	NA	NA	NA
WP_002901776.1|1648345_1648513_+	YmiA family putative membrane protein	NA	NA	NA	NA	NA
WP_002901777.1|1648901_1651574_+	aconitate hydratase AcnA	NA	NA	NA	NA	NA
WP_002901778.1|1651620_1652223_-	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	49.5	1.2e-43
WP_002901779.1|1652386_1653154_+	phosphatidylglycerophosphatase B	NA	NA	NA	NA	NA
WP_002901780.1|1653289_1653598_+	LapA family protein	NA	NA	NA	NA	NA
WP_002901781.1|1653604_1654774_+	lipopolysaccharide assembly protein LapB	NA	NA	NA	NA	NA
WP_004151907.1|1654965_1655703_+	orotidine-5'-phosphate decarboxylase	NA	NA	NA	NA	NA
WP_002901782.1|1655702_1656029_+	stress response translation initiation inhibitor YciH	NA	NA	NA	NA	NA
WP_004151906.1|1656160_1656382_-	osmotically-inducible lipoprotein OsmB	NA	NA	NA	NA	NA
WP_002901785.1|1656654_1657404_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_002901786.1|1657475_1657655_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002901787.1|1657813_1659748_-	exoribonuclease II	NA	A0A2H4UVB7	Bodo_saltans_virus	24.6	7.0e-08
WP_004151905.1|1659829_1660987_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_004140277.1|1661177_1661966_-	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
WP_004152967.1|1662164_1662707_-	HutD family protein	NA	NA	NA	NA	NA
WP_004176464.1|1662903_1664334_+	cytosine permease	NA	NA	NA	NA	NA
WP_004140269.1|1664378_1665188_-	peptide ABC transporter ATP-binding protein SapF	NA	A0A2H4PQG7	Staphylococcus_phage	28.9	2.1e-14
WP_004140266.1|1665189_1666182_-	peptide ABC transporter ATP-binding protein SapD	NA	G9BWD6	Planktothrix_phage	27.2	3.0e-07
WP_004151901.1|1666181_1667072_-	peptide ABC transporter permease SapC	NA	NA	NA	NA	NA
WP_004153574.1|1667248_1668436_+|integrase	site-specific integrase	integrase	K7PGY1	Enterobacteria_phage	52.4	1.1e-120
WP_004151899.1|1668643_1669306_-	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	84.6	2.7e-105
WP_081541247.1|1669302_1669707_-	regulator	NA	M9NYX4	Enterobacteria_phage	78.9	2.6e-58
1669702:1669761	attL	GGGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGCT	NA	NA	NA	NA
WP_001067855.1|1669765_1670470_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_015057121.1|1670360_1671320_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	40.5	1.7e-47
WP_001261740.1|1671465_1672257_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
WP_000679427.1|1672420_1672768_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259031.1|1672761_1673601_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	NA	NA	NA	NA
WP_000376623.1|1673728_1674229_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_004152787.1|1674211_1674352_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001389365.1|1674735_1675500_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_001067855.1|1675676_1676381_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
1675613:1676270	attR	GGGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGCTGCACATGAACCCATTCAAAGGCCGGCATTTTCAGCGTGACATCATTCTGTGGGCCGTACGCTGGTACTGCAAATACGGCATCAGTTACCGTGAGCTGCAGGAGATGCTGGCTGAACGCGGAGTGAATGTCGATCACTCCACGATTTACCGCTGGGTTCAGCGTTATGCGCCTGAAATGGAAAAACGGCTGCGCTGGTACTGGCGTAACCCTTCCGATCTTTGCCCGTGGCACATGGATGAAACCTACGTGAAGGTCAATGGCCGCTGGGCGTATCTGTACCGGGCCGTCGACAGCCGGGGCCGCACTGTCGATTTTTATCTCTCCTCCCGTCGTAACAGCAAAGCTGCATACCGGTTTCTGGGTAAAATCCTCAACAACGTGAAGAAGTGGCAGATCCCGCGATTCATCAACACGGATAAAGCGCCCGCCTATGGTCGCGCGCTTGCTCTGCTCAAACGCGAAGGCCGGTGCCCGTCTGACGTTGAACACCGACAGATTAAGTACCGGAACAACGTGATTGAATGCGATCATGGCAAACTGAAACGGATAATCGGCGCCACGCTGGGATTTAAATCCATGAAGACGGCTTACGCCACC	NA	NA	NA	NA
WP_004152776.1|1676973_1677396_+	hypothetical protein	NA	K7P834	Enterobacteria_phage	45.3	3.6e-26
WP_004152765.1|1678293_1679778_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_004152765.1|1680203_1681688_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_002901812.1|1681767_1682187_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	57.5	1.4e-35
WP_002901813.1|1682188_1683454_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	82.7	9.6e-208
WP_071531199.1|1683529_1684357_-	FRG domain-containing protein	NA	A0A1S6KZX9	Salmonella_phage	30.2	8.4e-19
WP_002901815.1|1684543_1685215_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	59.6	4.5e-79
>prophage 3
NZ_CP024570	Klebsiella pneumoniae strain INF274 chromosome, complete genome	5293333	1718148	1756614	5293333	terminase,integrase	uncultured_Caudovirales_phage(34.04%)	56	1716229:1716243	1725169:1725183
1716229:1716243	attL	AGTTGATCCTCTGGC	NA	NA	NA	NA
WP_004152144.1|1718148_1718910_+	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.5	2.4e-20
WP_004152145.1|1719126_1720659_+	HD domain-containing protein	NA	A0A1B1ISR1	uncultured_Mediterranean_phage	30.0	1.1e-21
WP_016197745.1|1720857_1721406_-	DJ-1/PfpI family protein	NA	NA	NA	NA	NA
WP_004152147.1|1721602_1722784_+|integrase	site-specific integrase	integrase	A0A0M4QX09	Salmonella_phage	84.2	5.6e-202
WP_004152148.1|1722764_1723007_-	hypothetical protein	NA	A0A0M4RTZ2	Salmonella_phage	73.8	2.2e-20
WP_004152149.1|1723185_1723665_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152150.1|1723661_1723874_-	hypothetical protein	NA	A0A286S2B6	Klebsiella_phage	98.6	3.4e-33
WP_004152151.1|1723870_1724095_-	hypothetical protein	NA	A0A286S2B3	Klebsiella_phage	89.2	3.1e-29
WP_004154298.1|1724084_1724795_-	DNA-binding protein	NA	A0A286S260	Klebsiella_phage	88.3	2.1e-111
WP_004152153.1|1724800_1725319_-	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	98.8	1.7e-94
1725169:1725183	attR	GCCAGAGGATCAACT	NA	NA	NA	NA
WP_004152154.1|1725423_1726251_-	hypothetical protein	NA	Q8W654	Enterobacteria_phage	84.0	5.5e-111
WP_004152155.1|1726247_1726442_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152156.1|1726438_1726864_-	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	77.9	3.5e-53
WP_004177208.1|1726860_1727079_-	hypothetical protein	NA	A0A286S1P6	Klebsiella_phage	98.6	6.6e-32
WP_004152157.1|1727050_1727305_-	hypothetical protein	NA	A0A286SGR4	Klebsiella_phage	97.6	3.1e-41
WP_004152158.1|1727297_1727663_-	hypothetical protein	NA	A0A286S1Q6	Klebsiella_phage	99.2	6.9e-58
WP_004152159.1|1727832_1728021_-	hypothetical protein	NA	A0A286S1P8	Klebsiella_phage	100.0	4.6e-26
WP_004152160.1|1728013_1728328_-	hypothetical protein	NA	A0A286S1T9	Klebsiella_phage	100.0	1.0e-49
WP_004152161.1|1728498_1729167_-	LexA family transcriptional regulator	NA	A0A286S2B2	Klebsiella_phage	99.5	2.4e-125
WP_004152162.1|1729264_1729486_+	helix-turn-helix transcriptional regulator	NA	A0A286S2C1	Klebsiella_phage	100.0	3.0e-32
WP_004198228.1|1730062_1731721_+	DEAD/DEAH box helicase	NA	A0A286N2P9	Klebsiella_phage	96.0	0.0e+00
WP_004198233.1|1731722_1732685_+	zinc-binding domain of primase-helicase family protein	NA	A0A286N2Q0	Klebsiella_phage	99.4	4.8e-183
WP_004198239.1|1732681_1733158_+	hypothetical protein	NA	A0A286N2Q1	Klebsiella_phage	100.0	1.8e-90
WP_004152167.1|1733154_1733937_+	antitermination protein	NA	F1C595	Cronobacter_phage	76.8	7.2e-113
WP_004146526.1|1734342_1734591_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152169.1|1734593_1735124_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	77.1	2.7e-79
WP_004153952.1|1735120_1735510_+	lipase chaperone	NA	A0A192Y6H8	Salmonella_phage	49.2	9.4e-21
WP_004152170.1|1735744_1736065_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152171.1|1736166_1736919_+	hypothetical protein	NA	A0A077KBY7	Edwardsiella_phage	66.0	4.0e-12
WP_004152172.1|1736869_1738270_+|terminase	PBSX family phage terminase large subunit	terminase	A0A077KAW0	Edwardsiella_phage	69.0	9.4e-188
WP_004152173.1|1738507_1739959_+	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	68.8	3.8e-192
WP_004152174.1|1740014_1740563_+	hypothetical protein	NA	A0A0M4REK0	Salmonella_phage	56.3	3.0e-49
WP_004199270.1|1740614_1741817_+	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	54.1	2.6e-106
WP_000528476.1|1741820_1742315_+	hypothetical protein	NA	A0A2H4JHM9	uncultured_Caudovirales_phage	62.7	4.2e-50
WP_001132269.1|1742326_1743268_+	DUF2184 domain-containing protein	NA	A0A2H4J191	uncultured_Caudovirales_phage	77.1	1.7e-137
WP_000725700.1|1743307_1743589_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000113538.1|1743557_1743977_+	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	60.7	3.3e-40
WP_000834982.1|1743973_1744480_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001116156.1|1744479_1744866_+	hypothetical protein	NA	A0A2H4J1A4	uncultured_Caudovirales_phage	78.2	1.1e-48
WP_004152176.1|1744960_1745401_+	hypothetical protein	NA	A0A2H4J1A0	uncultured_Caudovirales_phage	51.7	1.6e-40
WP_004152177.1|1745404_1746550_+	DUF3383 domain-containing protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	76.9	6.3e-166
WP_004199809.1|1746560_1747001_+	DUF3277 family protein	NA	A0A0M5M1K6	Salmonella_phage	80.1	3.3e-62
WP_004152564.1|1747004_1747430_+	hypothetical protein	NA	A0A2H4J2V6	uncultured_Caudovirales_phage	63.4	2.6e-40
WP_004152565.1|1747465_1747618_+	hypothetical protein	NA	A0A2H4J1A2	uncultured_Caudovirales_phage	88.0	7.6e-19
WP_004152566.1|1747607_1749611_+	lytic transglycosylase domain-containing protein	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	63.6	1.2e-247
WP_004152567.1|1749610_1750210_+	hypothetical protein	NA	A0A2H4J1B3	uncultured_Caudovirales_phage	57.6	9.9e-54
WP_004152568.1|1750210_1750513_+	hypothetical protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	55.2	2.0e-26
WP_004152569.1|1750515_1751538_+	hypothetical protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	54.2	9.2e-100
WP_004152570.1|1751537_1751879_+	hypothetical protein	NA	A0A2H4J1A5	uncultured_Caudovirales_phage	46.6	1.8e-23
WP_004199301.1|1751928_1752111_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152571.1|1752153_1752720_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152572.1|1752773_1753427_+	hypothetical protein	NA	A0A2H4J8H6	uncultured_Caudovirales_phage	63.5	1.0e-59
WP_004152573.1|1753428_1753782_+	hypothetical protein	NA	A0A2H4J629	uncultured_Caudovirales_phage	80.3	2.3e-50
WP_004152574.1|1753781_1754978_+	hypothetical protein	NA	A0A0M4RD32	Salmonella_phage	72.9	3.9e-158
WP_004152575.1|1754974_1755748_+	DUF2612 domain-containing protein	NA	A0A2H4J1A9	uncultured_Caudovirales_phage	54.4	2.8e-77
WP_004152576.1|1755747_1756614_+	hypothetical protein	NA	A0A2H4IYR0	uncultured_Caudovirales_phage	64.5	1.9e-34
>prophage 4
NZ_CP024570	Klebsiella pneumoniae strain INF274 chromosome, complete genome	5293333	1984820	1995707	5293333		Escherichia_phage(87.5%)	9	NA	NA
WP_002210516.1|1984820_1985441_-	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
WP_004151609.1|1985433_1986699_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	99.5	6.6e-233
WP_004151610.1|1986710_1987613_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.3	7.7e-159
WP_002210513.1|1987873_1988635_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_004176269.1|1988655_1989516_-	class A broad-spectrum beta-lactamase SHV-11	NA	A0A077SL40	Escherichia_phage	99.3	2.2e-155
WP_002904006.1|1989813_1990074_+	hypothetical protein	NA	A0A077SK33	Escherichia_phage	97.7	3.5e-40
WP_001620097.1|1990160_1991249_+	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	100.0	8.0e-211
WP_004151612.1|1991279_1992545_-	MFS transporter	NA	NA	NA	NA	NA
WP_004151613.1|1992599_1995707_-	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.6	0.0e+00
>prophage 5
NZ_CP024570	Klebsiella pneumoniae strain INF274 chromosome, complete genome	5293333	2665142	2726215	5293333	protease,transposase,tRNA,plate	Microcystis_phage(20.0%)	55	NA	NA
WP_004180389.1|2665142_2665727_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_002910443.1|2665844_2666936_+	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_032411802.1|2667017_2667347_-	DUF1869 domain-containing protein	NA	NA	NA	NA	NA
WP_002910453.1|2667431_2668346_-	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_023285288.1|2668477_2669929_-	type VI secretion system protein VasL	NA	NA	NA	NA	NA
WP_004175538.1|2669948_2670392_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_021314026.1|2670394_2670937_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_060614316.1|2670911_2671958_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_099595213.1|2671957_2673721_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_032411808.1|2673854_2677265_-	type VI secretion protein VasK	NA	NA	NA	NA	NA
WP_002910497.1|2678414_2678681_-	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_004227463.1|2678978_2679236_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004184614.1|2679424_2679766_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004184615.1|2680966_2681860_-	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A075BSL8	Microcystis_phage	27.1	2.2e-12
WP_016946122.1|2682035_2682929_-	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A075BSL8	Microcystis_phage	27.3	1.7e-12
WP_060614315.1|2683112_2684006_-	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A7H6	Microcystis_virus	30.5	1.1e-13
WP_015958629.1|2684027_2684333_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023317012.1|2684356_2685547_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002910549.1|2685570_2685801_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015958632.1|2685846_2686353_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004200304.1|2686349_2686859_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032425067.1|2686859_2688215_-	S-type Pyocin	NA	NA	NA	NA	NA
WP_060614320.1|2688508_2689018_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002910591.1|2689254_2689761_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032425068.1|2689757_2690267_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032425473.1|2690388_2691312_+|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	92.8	2.3e-166
WP_032425069.1|2691356_2692688_-	S-type Pyocin	NA	NA	NA	NA	NA
WP_032425070.1|2692711_2695198_-	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_032425071.1|2695656_2697354_-	OmpA family protein	NA	NA	NA	NA	NA
WP_004184632.1|2697357_2698011_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_004899025.1|2698007_2699348_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_002910650.1|2699916_2700246_+	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_004899028.1|2700315_2700900_+	DUF2058 domain-containing protein	NA	NA	NA	NA	NA
WP_004197491.1|2700925_2701624_-	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	27.2	2.6e-05
WP_002910657.1|2701814_2702297_+	cold shock domain-containing protein	NA	NA	NA	NA	NA
WP_020801945.1|2702406_2703306_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004175495.1|2703280_2704087_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_032425072.1|2704101_2705397_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	36.8	7.4e-62
WP_020801827.1|2705700_2706627_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002910717.1|2706725_2707202_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_004180410.1|2707251_2708895_-	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	50.4	5.7e-136
WP_002910720.1|2709178_2710072_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004175491.1|2710077_2710797_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.0	1.5e-11
WP_032425073.1|2710793_2711669_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	41.5	9.5e-05
WP_060614333.1|2711665_2712952_-	high-affinity branched-chain amino acid ABC transporter permease LivM	NA	NA	NA	NA	NA
WP_004175489.1|2712961_2713876_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_060614334.1|2713985_2715101_-	branched-chain amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_032425474.1|2715531_2717826_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.7	7.4e-158
WP_032425074.1|2717854_2719063_-	propionate kinase	NA	NA	NA	NA	NA
WP_004145486.1|2719090_2720422_-	threonine/serine transporter TdcC	NA	NA	NA	NA	NA
WP_002910762.1|2720447_2721437_-	bifunctional threonine ammonia-lyase/L-serine ammonia-lyase TdcB	NA	NA	NA	NA	NA
WP_023286625.1|2721530_2722472_-	transcriptional regulator TdcA	NA	NA	NA	NA	NA
WP_004145488.1|2723089_2723212_+	nitrilotriacetate monooxygenase	NA	NA	NA	NA	NA
WP_048289971.1|2724043_2725057_-	fatty acid desaturase	NA	NA	NA	NA	NA
WP_032425077.1|2725468_2726215_-|protease	proteasome-type protease	protease	NA	NA	NA	NA
>prophage 6
NZ_CP024570	Klebsiella pneumoniae strain INF274 chromosome, complete genome	5293333	3428932	3523544	5293333	transposase,capsid,protease,tail,head,tRNA,portal,terminase,lysis,plate,integrase	Salmonella_phage(57.63%)	94	3486119:3486137	3523619:3523637
WP_002898139.1|3428932_3430225_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	44.7	7.3e-94
WP_002898137.1|3430315_3431659_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.8	7.3e-81
WP_002898132.1|3431667_3432279_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_004150846.1|3432401_3436655_-	DNA translocase FtsK	NA	S5VNE3	Mycobacterium_phage	49.2	5.2e-88
WP_000228469.1|3436790_3437285_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_004141839.1|3437790_3438786_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.0	3.3e-62
WP_002898017.1|3438900_3440667_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	25.9	2.3e-21
WP_004150847.1|3440667_3442389_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	34.3	1.5e-14
WP_002898014.1|3442433_3443135_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|3443488_3443707_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_002896522.1|3443827_3446107_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
WP_002896520.1|3446137_3446455_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
WP_002896516.1|3446780_3447002_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
WP_004150848.1|3447078_3449019_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.5	1.9e-37
WP_002896440.1|3449015_3450131_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
WP_000608644.1|3450433_3451696_-|transposase	IS1380-like element ISEc9 family transposase	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
WP_002896437.1|3451938_3453597_-	ATP-dependent endonuclease	NA	NA	NA	NA	NA
WP_002896434.1|3454016_3454712_+	aquaporin Z	NA	NA	NA	NA	NA
WP_004147773.1|3454827_3455727_+	lysine exporter LysO family protein	NA	NA	NA	NA	NA
WP_002896412.1|3455870_3457523_+	hydroxylamine reductase	NA	NA	NA	NA	NA
WP_002896410.1|3457533_3458502_+	NADH oxidoreductase	NA	NA	NA	NA	NA
WP_002896408.1|3458713_3459148_-	DoxX family protein	NA	NA	NA	NA	NA
WP_002896406.1|3459299_3461018_+	ubiquinone-dependent pyruvate dehydrogenase	NA	NA	NA	NA	NA
WP_002896404.1|3461056_3462058_+	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_002896401.1|3462068_3463511_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_002896399.1|3463598_3464612_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_002896397.1|3464608_3465439_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	31.6	4.1e-05
WP_004150851.1|3465470_3466610_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_002896394.1|3467487_3468003_+	lipoprotein	NA	NA	NA	NA	NA
WP_002896392.1|3468229_3468958_+	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	37.1	1.2e-29
WP_002896390.1|3468978_3469710_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002896386.1|3469716_3470433_+	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
WP_004150852.1|3470432_3471101_+	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
WP_002896384.1|3471284_3472016_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002896382.1|3472058_3473531_-	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	31.8	7.9e-28
WP_002896380.1|3473527_3474244_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.9	2.1e-34
WP_002896378.1|3474322_3475450_-	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A2K5B251	Erysipelothrix_phage	25.6	1.3e-19
WP_002896376.1|3475491_3475980_-	DUF2593 family protein	NA	NA	NA	NA	NA
WP_002896372.1|3476037_3476883_-	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_002896371.1|3476879_3477833_-	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_002896370.1|3477843_3478977_-	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.9	2.2e-30
WP_002896368.1|3479140_3480253_-	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_002896365.1|3480601_3481081_-	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_002896363.1|3481169_3482072_-	30S ribosomal protein S6--L-glutamate ligase	NA	A0A1D7SR78	Cyanophage	35.3	2.0e-34
WP_002896354.1|3482893_3483181_-	YbjC family protein	NA	NA	NA	NA	NA
WP_002896352.1|3483383_3483647_+	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	73.1	1.6e-27
WP_002896351.1|3483653_3484037_-	membrane protein	NA	NA	NA	NA	NA
WP_004179131.1|3484303_3485989_+	aspartate:alanine antiporter	NA	NA	NA	NA	NA
3486119:3486137	attL	ATGGGTTTTTTGTTGCCTG	NA	NA	NA	NA
WP_000972391.1|3486208_3486427_-	transcriptional activator Ogr/delta	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
WP_002896225.1|3486518_3487619_-	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	87.4	4.9e-176
WP_002896224.1|3487615_3488101_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	75.6	7.2e-63
WP_002896222.1|3488097_3490725_-|tail	phage tail tape measure protein	tail	E5FFG5	Burkholderia_phage	42.0	5.6e-117
WP_002896220.1|3490717_3490837_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.2e-13
WP_002896204.1|3490851_3491151_-|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	79.0	3.7e-33
WP_002896201.1|3491203_3491719_-|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	85.4	1.3e-81
WP_002896193.1|3491728_3492901_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	93.3	1.9e-210
WP_002896191.1|3493039_3494116_-|tail	phage tail protein	tail	Q37842	Escherichia_phage	44.8	1.2e-25
WP_002896188.1|3494145_3494349_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002896186.1|3494345_3495077_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152882.1|3495080_3498032_-	hypothetical protein	NA	A0A2H4N7A3	Pectobacterium_phage	50.9	1.2e-06
WP_004150856.1|3498033_3498633_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	60.5	1.3e-58
WP_002896182.1|3498625_3499534_-|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	66.9	7.6e-106
WP_002896179.1|3499520_3499883_-|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	84.7	5.8e-49
WP_002896177.1|3499879_3500452_-|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	72.3	4.7e-77
WP_004150857.1|3500546_3501239_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002896175.1|3501235_3501682_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	71.2	2.2e-50
WP_002896172.1|3501674_3502106_-|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	82.5	9.9e-64
WP_002896168.1|3502201_3502630_-|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	77.9	9.6e-51
WP_002896163.1|3502626_3503010_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	42.0	2.1e-17
WP_002896161.1|3503014_3503524_-	lysozyme	NA	E5G6N1	Salmonella_phage	83.4	2.1e-81
WP_002896158.1|3503504_3503720_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	90.1	3.6e-30
WP_002896155.1|3503723_3503927_-|tail	tail protein X	tail	A0A1S6KZY4	Salmonella_phage	88.1	1.3e-29
WP_002896151.1|3503926_3504391_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.0	8.4e-77
WP_000059191.1|3504486_3505137_-|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	96.3	8.7e-112
WP_002895972.1|3505140_3506199_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.1	1.1e-180
WP_002895967.1|3506215_3507049_-|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	88.8	6.3e-123
WP_004150858.1|3507191_3508958_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.0	0.0e+00
WP_002895959.1|3508957_3509983_+|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	86.7	7.6e-171
WP_004199124.1|3510044_3511787_-	AIPR family protein	NA	NA	NA	NA	NA
WP_000700647.1|3512062_3512740_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001217575.1|3512854_3513088_-	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
WP_001154434.1|3513098_3513287_-	hypothetical protein	NA	E5G6M0	Salmonella_phage	98.4	5.5e-27
WP_004150862.1|3513440_3515855_-	replication endonuclease	NA	E5G6L9	Salmonella_phage	97.5	0.0e+00
WP_004150863.1|3515851_3516709_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	95.4	2.0e-156
WP_000752622.1|3516705_3516933_-	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	98.7	6.0e-36
WP_004150864.1|3516932_3517166_-	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	96.1	4.1e-32
WP_000963473.1|3517233_3517575_-	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	99.1	4.6e-56
WP_000956179.1|3517538_3517739_-	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	97.0	1.6e-32
WP_000460893.1|3517746_3518256_-	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	98.8	5.8e-87
WP_000188448.1|3518288_3518510_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152885.1|3518655_3519534_+	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	39.9	1.7e-30
WP_004150866.1|3519545_3520490_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152765.1|3520588_3522073_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_004151720.1|3522491_3523544_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	57.0	1.0e-106
3523619:3523637	attR	ATGGGTTTTTTGTTGCCTG	NA	NA	NA	NA
>prophage 7
NZ_CP024570	Klebsiella pneumoniae strain INF274 chromosome, complete genome	5293333	4175798	4187452	5293333	integrase	Enterobacteria_phage(70.0%)	13	4176248:4176262	4199305:4199319
WP_004144574.1|4175798_4176902_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.5	4.8e-62
4176248:4176262	attL	CAATCTCTCCGCGCT	NA	NA	NA	NA
WP_002889940.1|4176912_4178166_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	44.9	8.9e-89
WP_002889938.1|4178518_4179709_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	62.7	6.4e-145
WP_004152029.1|4179696_4180647_+	AAA family ATPase	NA	A0A1X9IGI7	Lactococcus_phage	27.1	1.2e-13
WP_004152979.1|4180646_4181072_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002889930.1|4181640_4182207_-	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	64.3	1.5e-59
WP_002889919.1|4182224_4182470_-	hypothetical protein	NA	Q7M294	Enterobacteria_phage	58.0	1.9e-19
WP_002889917.1|4182466_4183204_-	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	60.7	9.0e-73
WP_002889915.1|4183745_4184012_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	71.6	2.6e-30
WP_024940872.1|4184008_4184566_+	ash family protein	NA	Q7M2A7	Enterobacteria_phage	70.4	1.8e-33
WP_002889911.1|4184562_4184790_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002889897.1|4184786_4185107_+	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_002889890.1|4185118_4187452_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	82.2	0.0e+00
4199305:4199319	attR	CAATCTCTCCGCGCT	NA	NA	NA	NA
>prophage 1
NZ_CP024571	Klebsiella pneumoniae strain INF274 plasmid unnamed1, complete sequence	187611	24187	66066	187611	transposase	Escherichia_phage(35.71%)	49	NA	NA
WP_125551036.1|24187_24884_+|transposase	IS1 family transposase	transposase	A0A077SLN4	Escherichia_phage	98.7	4.7e-132
WP_000056203.1|25024_25243_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001909178.1|25612_25999_+	type IV secretion system protein	NA	NA	NA	NA	NA
WP_019706045.1|26072_26894_+	TrbG/VirB9 family P-type conjugative transfer protein	NA	NA	NA	NA	NA
WP_000101710.1|26893_28054_+	TrbI/VirB10 family protein	NA	NA	NA	NA	NA
WP_000128596.1|28095_29091_+	Flp pilus assembly complex ATPase component	NA	NA	NA	NA	NA
WP_000792636.1|29090_29624_+	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	33.9	5.8e-21
WP_002210549.1|30595_30937_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	7.3e-62
WP_001067855.1|30973_31678_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001044210.1|31683_31824_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001366550.1|32309_33047_+	recombinase family protein	NA	NA	NA	NA	NA
WP_000743213.1|33043_33268_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000338945.1|33366_33678_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001151304.1|33851_34637_+	ParA family protein	NA	A0A1X9IGI7	Lactococcus_phage	26.4	6.1e-11
WP_001207227.1|34640_35822_+	ParB/RepB/Spo0J family partition protein	NA	I3NLC2	Bifidobacterium_phage	28.7	2.4e-11
WP_000703827.1|35870_36143_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_099595285.1|36878_38378_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	26.7	1.5e-10
WP_099595287.1|38364_39105_+	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	36.9	2.7e-32
WP_000939033.1|39325_39469_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001125905.1|39787_40165_+	hypothetical protein	NA	A0A2H4P7P5	Pseudomonas_phage	49.6	2.2e-22
WP_000044824.1|40157_40439_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000344151.1|40413_41088_+	thymidylate kinase	NA	NA	NA	NA	NA
WP_005507681.1|41155_41587_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000348669.1|41571_41904_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000647189.1|41912_42413_+	hypothetical protein	NA	I3UMJ0	Colwellia_phage	43.3	1.7e-19
WP_000936896.1|42416_43844_+	DNA cytosine methyltransferase	NA	NA	NA	NA	NA
WP_000268551.1|43843_44500_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000362482.1|44705_44924_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000464631.1|45017_45635_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000542259.1|45846_46146_+	hypothetical protein	NA	A0A0K1LLW2	Caulobacter_phage	55.4	2.1e-20
WP_000468105.1|46237_46726_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000366822.1|46740_48933_-	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	29.2	1.7e-42
WP_001191892.1|48932_49166_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001249396.1|49147_49765_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085955245.1|52549_53742_-|transposase	IS3-like element ISKpn18 family transposase	transposase	U5P429	Shigella_phage	43.5	3.5e-50
WP_000178856.1|54213_56079_+	conjugative transfer system coupling protein TraD	NA	NA	NA	NA	NA
WP_000332866.1|56089_56674_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000743450.1|56630_57260_+	DUF4400 domain-containing protein	NA	NA	NA	NA	NA
WP_000122506.1|57269_57716_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000869261.1|57725_58103_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001231463.1|58102_58765_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000509509.1|59088_59466_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000805625.1|59610_59892_+	type IV conjugative transfer system protein TraL	NA	NA	NA	NA	NA
WP_001049716.1|59888_60515_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000794249.1|60498_61416_+	conjugal transfer protein TraK	NA	NA	NA	NA	NA
WP_000595749.1|61412_62729_+	conjugal transfer protein TraB	NA	NA	NA	NA	NA
WP_000793435.1|62725_63304_+	type IV conjugative transfer system lipoprotein TraV	NA	NA	NA	NA	NA
WP_000479535.1|63307_63700_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087759376.1|64946_66066_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.2	6.0e-52
>prophage 2
NZ_CP024571	Klebsiella pneumoniae strain INF274 plasmid unnamed1, complete sequence	187611	110090	183446	187611	transposase,integrase	Escherichia_phage(14.29%)	75	121682:121703	163699:163720
WP_099725713.1|110090_111137_+|transposase	IS481-like element ISKpn28 family transposase	transposase	NA	NA	NA	NA
WP_001083725.1|111393_111891_+	trimethoprim-resistant dihydrofolate reductase DfrA12	NA	A0A0A0PL85	Bacillus_phage	40.9	7.5e-23
WP_001336345.1|112002_112293_+	DUF1010 domain-containing protein	NA	NA	NA	NA	NA
WP_001206356.1|112298_113090_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
WP_000679427.1|113253_113601_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259031.1|113594_114434_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_004883563.1|114561_114834_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032430842.1|115015_115969_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_022652302.1|116589_117300_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.7	3.7e-31
WP_022652303.1|117301_118507_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_022652304.1|118503_119655_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_004393990.1|119651_120260_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_032430842.1|120447_121401_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
121682:121703	attL	CTCAGTGGAACGAAAACTCACG	NA	NA	NA	NA
WP_000493286.1|121819_122149_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A088CBP5	Shigella_phage	44.2	2.4e-09
WP_000780222.1|122129_122411_+	helix-turn-helix transcriptional regulator	NA	A0A2I6TC97	Escherichia_phage	38.0	1.3e-08
WP_016947617.1|122688_123669_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.8	6.8e-185
WP_087893729.1|123974_125248_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	81.7	2.8e-146
WP_001752509.1|125321_125822_-	non-heme ferritin-like protein	NA	NA	NA	NA	NA
WP_001067855.1|126148_126853_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000935452.1|126899_128204_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_000204520.1|128242_128950_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_000993386.1|128946_129183_-	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_001277456.1|129179_129542_-	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_000105636.1|129559_131254_-	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.6	8.8e-39
WP_001447540.1|131305_131728_-	organomercurial transporter MerC	NA	NA	NA	NA	NA
WP_000732292.1|131763_132039_-	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_001294663.1|132052_132403_-	mercuric transport protein MerT	NA	NA	NA	NA	NA
WP_000429836.1|132474_132909_+	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_047359309.1|132987_133992_+|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_099595309.1|134800_135052_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099595311.1|135732_135990_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043006371.1|136564_136849_+	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	NA	NA	NA	NA
WP_008652077.1|136873_137383_+	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_034053978.1|137468_137957_+	redoxin domain-containing protein	NA	NA	NA	NA	NA
WP_074423286.1|137961_139494_+	YdiU family protein	NA	A0A075BSJ0	Microcystis_phage	32.6	4.1e-51
WP_034054008.1|140061_140502_+	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_004099020.1|141961_142333_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000844627.1|143946_144189_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_000470728.1|144220_144898_-	tetracycline resistance transcriptional repressor TetR(A)	NA	NA	NA	NA	NA
WP_000804064.1|144976_146176_+	tetracycline efflux MFS transporter Tet(A)	NA	NA	NA	NA	NA
WP_000427620.1|146779_147784_-|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_000414383.1|147883_148318_-	mercury resistance transcriptional regulator MerR	NA	NA	NA	NA	NA
WP_001294666.1|148389_148740_+	mercuric transport protein MerT	NA	NA	NA	NA	NA
WP_000732290.1|148755_149031_+	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_000149288.1|149102_150788_+	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.9	1.1e-38
WP_000761850.1|150802_151441_+	organomercurial lyase MerB	NA	NA	NA	NA	NA
WP_000995361.1|151552_151918_+	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_001087810.1|151914_152151_+	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_001276635.1|152147_153137_+	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_053821786.1|153266_153827_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	87.9	1.3e-50
WP_053821785.1|153829_156796_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.2	0.0e+00
WP_000427620.1|156874_157879_+|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_000787563.1|158983_159256_+	MafI family immunity protein	NA	NA	NA	NA	NA
WP_125551039.1|159260_159503_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000243483.1|159514_159850_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000791469.1|160016_160469_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000278322.1|160484_161087_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000243801.1|161309_161630_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000949433.1|161928_162465_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000543934.1|162467_163478_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0K0N6I5	Gordonia_phage	31.9	3.1e-07
WP_000027057.1|163834_164695_-	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
163699:163720	attR	CTCAGTGGAACGAAAACTCACG	NA	NA	NA	NA
WP_001235713.1|164877_165435_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	100.0	7.0e-94
WP_001143760.1|165598_168604_+|transposase	Tn3-like element Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	100.0	0.0e+00
WP_052952388.1|168725_169307_+	3'-5' exonuclease	NA	A0A1S6L012	Salmonella_phage	35.2	2.3e-23
WP_000139717.1|169303_169795_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001097010.1|170121_170997_+	DNA replication terminus site-binding protein	NA	NA	NA	NA	NA
WP_000101568.1|171158_172199_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_000811656.1|172485_173997_+	ATP-dependent helicase	NA	A0A2D1GN12	Pseudoalteromonas_phage	30.7	3.6e-44
WP_001326396.1|174107_175148_+	conjugal transfer protein TraF	NA	NA	NA	NA	NA
WP_000256129.1|175149_176583_+	conjugal transfer protein TraH	NA	NA	NA	NA	NA
WP_000534551.1|176595_180210_+	conjugal transfer protein TraG	NA	NA	NA	NA	NA
WP_000683483.1|180247_180610_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000356489.1|181325_181598_+	nucleotide excision repair protein	NA	A0A2H4J3B6	uncultured_Caudovirales_phage	41.0	1.3e-08
WP_000790610.1|181597_182131_+	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_087759376.1|182326_183446_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.2	6.0e-52
>prophage 1
NZ_CP024572	Klebsiella pneumoniae strain INF274 plasmid unnamed2, complete sequence	147932	1727	64517	147932	transposase,integrase,protease	uncultured_Caudovirales_phage(27.78%)	59	NA	NA
WP_001515717.1|1727_2468_-|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	58.6	5.4e-25
WP_004152065.1|3611_4559_+	sensor domain-containing diguanylate cyclase	NA	G3MA91	Bacillus_virus	30.6	1.8e-12
WP_071527918.1|4585_4897_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_004152067.1|4961_5885_+|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	98.4	2.1e-175
WP_004197688.1|6557_6815_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020444838.1|7416_8871_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_004152070.1|9853_11131_-	DUF2254 domain-containing protein	NA	NA	NA	NA	NA
WP_004178088.1|11193_13191_-	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	25.9	9.7e-21
WP_085955172.1|14230_15438_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	63.2	1.7e-100
WP_004178091.1|16866_17298_-	silver-binding protein SilE	NA	NA	NA	NA	NA
WP_003032875.1|17548_19024_-	copper/silver sensor histidine kinase SilS	NA	W8CYF6	Bacillus_phage	30.1	1.0e-27
WP_001572351.1|19016_19697_-	copper/silver response regulator transcription factor SilR	NA	W8CYM9	Bacillus_phage	35.6	2.1e-31
WP_000475512.1|19886_21272_+	Cu(+)/Ag(+) efflux RND transporter outer membrane channel SilC	NA	NA	NA	NA	NA
WP_001246153.1|21300_21654_+	cation efflux system protein CusF	NA	NA	NA	NA	NA
WP_004152079.1|21767_23060_+	Cu(+)/Ag(+) efflux RND transporter periplasmic adaptor subunit SilB	NA	NA	NA	NA	NA
WP_004098958.1|23070_26217_+	Cu(+)/Ag(+) efflux RND transporter permease subunit SilA	NA	S5VTK5	Leptospira_phage	22.5	4.0e-61
WP_000758228.1|26303_26744_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004098955.1|26870_29318_+	Ag(+)-translocating P-type ATPase SilP	NA	A0A218MNH6	uncultured_virus	35.8	7.6e-84
WP_000843497.1|29358_29556_+	DUF2933 domain-containing protein	NA	NA	NA	NA	NA
WP_004118669.1|29589_30327_-	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A2H4JAF5	uncultured_Caudovirales_phage	32.5	1.2e-11
WP_001023257.1|30615_31065_-	copper resistance protein	NA	NA	NA	NA	NA
WP_000925242.1|31298_33116_+	multicopper oxidase PcoA	NA	NA	NA	NA	NA
WP_001242438.1|33115_34012_+	copper resistance outer membrane transporter PcoB	NA	NA	NA	NA	NA
WP_000025662.1|34051_34432_+	copper resistance system metallochaperone PcoC	NA	NA	NA	NA	NA
WP_004118344.1|34436_35366_+	copper resistance inner membrane protein PcoD	NA	NA	NA	NA	NA
WP_001188930.1|35420_36101_+	copper response regulator transcription factor PcoR	NA	W8CYM9	Bacillus_phage	34.4	8.7e-30
WP_004152084.1|36097_37498_+	copper resistance membrane spanning protein PcoS	NA	W8CYF6	Bacillus_phage	26.3	4.1e-18
WP_004152085.1|37714_38149_+	copper resistance system metallochaperone PcoE	NA	NA	NA	NA	NA
WP_004152086.1|38380_38560_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_031944101.1|40302_40812_+	major intrinsic protein MIP	NA	NA	NA	NA	NA
WP_004152091.1|40861_41359_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_004152092.1|41690_42017_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_085903505.1|42016_42727_+	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	77.0	2.9e-92
WP_004182005.1|42735_43281_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_004152095.1|43356_43719_+	arsenic metallochaperone ArsD family protein	NA	NA	NA	NA	NA
WP_004152096.1|45615_46152_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_004152097.1|46184_46610_-	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	72.9	2.3e-52
WP_004152098.1|46622_47912_-	arsenite efflux transporter membrane subunit ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	74.0	1.9e-171
WP_004152099.1|47959_49711_-	arsenite efflux transporter ATPase subunit ArsA	NA	NA	NA	NA	NA
WP_004152100.1|49728_50091_-	arsenite efflux transporter metallochaperone ArsD	NA	NA	NA	NA	NA
WP_004152101.1|50140_50491_-	As(III)-sensing metalloregulatory transcriptional repressor ArsR	NA	A0A2H4J145	uncultured_Caudovirales_phage	50.9	1.4e-23
WP_004152102.1|50848_51118_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152103.1|51105_51681_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152104.1|51711_52206_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_004152105.1|52249_52618_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152106.1|52651_52855_+	hemolysin expression modulator Hha	NA	NA	NA	NA	NA
WP_004152107.1|52903_53161_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152108.1|53236_53491_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003026799.1|53666_53933_+	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_003026803.1|53920_54403_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_020314316.1|54614_55961_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_004152113.1|57803_58766_-|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_009483782.1|58752_59502_-	diguanylate cyclase	NA	NA	NA	NA	NA
WP_004152115.1|59739_59937_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152116.1|59936_62732_-	heat shock survival AAA family ATPase ClpK	NA	K4FB40	Cronobacter_phage	41.0	5.2e-129
WP_004152117.1|62846_63416_-	small heat shock protein sHSP20	NA	NA	NA	NA	NA
WP_004152118.1|63450_63732_-	helix-turn-helix domain-containing protein	NA	A0A1B1IUF9	uncultured_Mediterranean_phage	38.2	5.2e-05
WP_004118208.1|63975_64239_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004118209.1|64253_64517_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 1
NZ_CP024573	Klebsiella pneumoniae strain INF274 plasmid unnamed3, complete sequence	90173	6364	68704	90173	transposase	Escherichia_phage(46.67%)	54	NA	NA
WP_000227969.1|6364_7441_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_001067855.1|8153_8858_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000509965.1|9394_10000_+	recombinase family protein	NA	A0A1S5Y2X8	uncultured_archaeal_virus	35.3	9.4e-20
WP_001067855.1|10601_11306_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_063840321.1|11449_12004_+	fluoroquinolone-acetylating aminoglycoside 6'-N-acetyltransferase AAC(6')-Ib-cr5	NA	NA	NA	NA	NA
WP_001334766.1|12134_12965_+	oxacillin-hydrolyzing class D beta-lactamase OXA-1	NA	NA	NA	NA	NA
WP_001067855.1|13596_14301_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000557452.1|14407_15268_+	aminoglycoside N-acetyltransferase AAC(3)-IIa	NA	NA	NA	NA	NA
WP_002063889.1|15280_15823_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_001067855.1|17016_17721_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001067855.1|18998_19703_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000368714.1|20790_21996_+	ParA family protein	NA	A0A077SL49	Escherichia_phage	69.6	2.4e-163
WP_012600007.1|21992_22970_+	ParB/RepB/Spo0J family partition protein	NA	Q38420	Escherichia_phage	54.4	2.6e-88
WP_004118291.1|23051_24323_-	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	63.3	4.9e-151
WP_000776034.1|24322_24754_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	53.3	1.6e-29
WP_004152765.1|25162_26647_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_001776120.1|27116_27548_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001776119.1|27580_28108_-	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	39.5	5.7e-21
WP_001166628.1|28367_28823_-	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_004200999.1|28894_29260_+	mercuric ion transporter MerT	NA	NA	NA	NA	NA
WP_000732275.1|29275_29551_+	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_000522996.1|29578_30004_+	organomercurial transporter MerC	NA	NA	NA	NA	NA
WP_000209296.1|30042_31728_+	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	29.1	1.8e-39
WP_001277466.1|31745_32111_+	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_001087807.1|32107_32344_+	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_050558936.1|32327_32411_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|32479_33184_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_004201232.1|33425_34112_-	NYN domain-containing protein	NA	NA	NA	NA	NA
WP_001067855.1|34908_35613_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001144737.1|36147_36414_+	plasmid mobilization relaxosome protein MobC	NA	NA	NA	NA	NA
WP_001389365.1|36556_37321_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_004098817.1|37581_38796_+	type II site-specific deoxyribonuclease	NA	E5E3X4	Burkholderia_phage	42.5	1.2e-34
WP_001288432.1|38829_40263_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	50.6	7.0e-106
WP_001749967.1|40644_40851_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071549088.1|40855_41368_-	restriction endonuclease	NA	NA	NA	NA	NA
WP_020324562.1|41392_42097_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	9.9e-138
WP_087759376.1|42194_43314_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.2	6.0e-52
WP_014386481.1|48297_48942_+	quinolone resistance pentapeptide repeat protein QnrB1	NA	NA	NA	NA	NA
WP_001067855.1|49814_50519_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_099730319.1|50577_51276_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004201235.1|51795_53265_-	HNH endonuclease	NA	G0X580	Salmonella_phage	51.3	5.5e-21
WP_001067855.1|53510_54215_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001393253.1|56536_56869_+	cupin fold metalloprotein, WbuC family	NA	NA	NA	NA	NA
WP_000239590.1|56915_57791_-	class A extended-spectrum beta-lactamase CTX-M-15	NA	A0A1B0VBP7	Salmonella_phage	82.4	1.1e-125
WP_000608644.1|58046_59309_-|transposase	IS1380-like element ISEc9 family transposase	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
WP_001235713.1|59872_60430_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	100.0	7.0e-94
WP_000027057.1|60612_61473_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_001120891.1|61682_62222_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000480968.1|62193_63030_-	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_001082319.1|63029_63833_-	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	NA	NA	NA	NA
WP_001043260.1|63893_64709_-	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	5.9e-09
WP_000954592.1|65038_65215_+	DUF4102 domain-containing protein	NA	T1S9J3	Salmonella_phage	68.6	1.0e-06
WP_000427619.1|65396_66401_-|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_001067855.1|67999_68704_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
