The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP024548	Klebsiella pneumoniae strain KSB1_7J chromosome, complete genome	5354543	1227705	1234701	5354543		Enterobacteria_phage(50.0%)	6	NA	NA
WP_157665542.1|1227705_1227915_-	hypothetical protein	NA	Q7M2A8	Enterobacteria_phage	87.3	1.3e-21
WP_023278769.1|1228111_1228456_-	hypothetical protein	NA	Q7M2A8	Enterobacteria_phage	73.7	5.3e-44
WP_004899969.1|1228547_1229012_+	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	63.2	3.7e-40
WP_023278770.1|1229335_1230397_+	hypothetical protein	NA	A0A2I7RNF6	Vibrio_phage	38.8	4.6e-54
WP_004899960.1|1230444_1232403_-	NACHT domain-containing protein	NA	X5JAK5	Clostridium_phage	33.5	1.6e-76
WP_002914164.1|1234218_1234701_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	2.3e-29
>prophage 2
NZ_CP024548	Klebsiella pneumoniae strain KSB1_7J chromosome, complete genome	5354543	1683599	1690504	5354543	tRNA	Planktothrix_phage(33.33%)	6	NA	NA
WP_023278799.1|1683599_1684463_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.5	5.7e-10
WP_004899467.1|1684473_1685247_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.7	3.9e-26
WP_012541062.1|1685487_1686381_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.8	3.6e-15
WP_004144192.1|1686626_1687988_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	94.8	1.8e-207
WP_004175198.1|1688306_1689029_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	8.3e-31
WP_019705218.1|1689025_1690504_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	28.3	8.5e-30
>prophage 3
NZ_CP024548	Klebsiella pneumoniae strain KSB1_7J chromosome, complete genome	5354543	1734282	1749544	5354543		Hokovirus(18.18%)	12	NA	NA
WP_000043543.1|1734282_1735689_+	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.7	4.7e-38
WP_004180506.1|1735930_1737346_+	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	31.0	1.4e-53
WP_023288453.1|1737368_1738739_+	phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	26.0	6.4e-32
WP_023278824.1|1738895_1739960_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	55.0	7.5e-105
WP_023278825.1|1739986_1740856_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	66.7	1.7e-110
WP_004189149.1|1740887_1741778_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.2	3.7e-28
WP_023278826.1|1741792_1742347_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	57.6	1.5e-51
WP_023278827.1|1742527_1743694_+	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	54.7	5.3e-112
WP_004144151.1|1744117_1744240_-	small membrane protein	NA	NA	NA	NA	NA
WP_004184806.1|1744640_1745645_-	NAD-dependent epimerase	NA	E3T4Y8	Cafeteria_roenbergensis_virus	29.5	1.8e-31
WP_004180506.1|1746723_1748139_+	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	31.0	1.4e-53
WP_012967600.1|1748161_1749544_+	phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	25.8	4.2e-31
>prophage 4
NZ_CP024548	Klebsiella pneumoniae strain KSB1_7J chromosome, complete genome	5354543	1812874	1844323	5354543	holin,tail,integrase,head,protease,portal,capsid,terminase	Klebsiella_phage(32.5%)	45	1812701:1812760	1853245:1853308
1812701:1812760	attL	CGGTCTCGAAAACCGGAGTAGGGGCAACTCTACCGGGGGTTCAAATCCCCCTCTCTCCGC	NA	NA	NA	NA
WP_004184758.1|1812874_1813867_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	87.2	4.9e-175
WP_004184757.1|1813868_1814096_-	DUF4224 domain-containing protein	NA	Q8HAA9	Salmonella_phage	78.4	1.1e-29
WP_134896119.1|1814403_1814607_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099756016.1|1814593_1815073_-	DUF550 domain-containing protein	NA	S4TSR6	Salmonella_phage	72.2	1.4e-58
WP_099756017.1|1815425_1815947_-	hypothetical protein	NA	K7PJQ4	Enterobacteria_phage	71.7	2.0e-50
WP_025714330.1|1816058_1816367_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099755875.1|1816494_1817280_-	hypothetical protein	NA	C7BGF1	Burkholderia_phage	52.5	3.4e-62
WP_048269260.1|1817279_1817579_-	hypothetical protein	NA	K7PJS4	Enterobacterial_phage	45.7	1.5e-13
WP_099755876.1|1817666_1818584_-	recombination-associated protein RdgC	NA	A0A1W6JP69	Morganella_phage	36.2	4.9e-44
WP_157769551.1|1818871_1819042_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032408726.1|1819388_1820036_-	helix-turn-helix domain-containing protein	NA	H9C160	Pectobacterium_phage	63.0	9.3e-74
WP_016530206.1|1820140_1820338_+	hypothetical protein	NA	H9C161	Pectobacterium_phage	66.1	2.7e-16
WP_004213338.1|1820363_1820825_+	hypothetical protein	NA	K7PJS5	Enterobacterial_phage	88.2	1.7e-69
WP_004184738.1|1821062_1821242_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	75.0	1.6e-15
WP_099755877.1|1821231_1822200_+	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	66.0	1.6e-85
WP_099755878.1|1822196_1823006_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1C9II58	Salmonella_phage	68.9	2.2e-109
WP_099755879.1|1823015_1823393_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A1C9IIA0	Salmonella_phage	72.8	1.5e-47
WP_099755880.1|1823405_1824386_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	67.5	4.9e-135
WP_099755881.1|1824399_1824978_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	56.7	3.2e-49
WP_017145563.1|1825135_1825531_+	membrane protein	NA	K7PHB9	Enterobacterial_phage	98.5	2.6e-63
WP_019705280.1|1825517_1825799_+|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	80.6	3.9e-37
WP_099755882.1|1825798_1826428_+	glycoside hydrolase family 19 protein	NA	F1C591	Cronobacter_phage	74.9	5.5e-87
WP_099755883.1|1826430_1826706_+	hypothetical protein	NA	G8C7W1	Escherichia_phage	44.4	4.7e-11
WP_099755885.1|1827172_1827418_+	DUF2560 family protein	NA	A0A286N2R1	Klebsiella_phage	55.6	8.2e-15
WP_142763754.1|1827491_1827719_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075253004.1|1827772_1828123_+	HNH endonuclease	NA	A0A1B5FP94	Escherichia_phage	81.7	6.4e-53
WP_023316719.1|1828282_1828780_+|terminase	phage terminase small subunit P27 family	terminase	K7PHI2	Enterobacteria_phage	72.0	1.9e-63
WP_099755886.1|1828783_1830535_+|terminase	terminase large subunit	terminase	A0A1P8DTK0	Proteus_phage	72.4	1.8e-252
WP_023313057.1|1830682_1831909_+|portal	phage portal protein	portal	Q8SBI0	Shigella_phage	85.0	4.2e-208
WP_000999827.1|1831901_1832501_+|head,protease	HK97 family phage prohead protease	head,protease	Q8SBH9	Shigella_phage	82.5	1.0e-90
WP_023284978.1|1832510_1833749_+|capsid	phage major capsid protein	capsid	Q8SBH8	Shigella_phage	69.4	1.8e-158
WP_004206686.1|1833826_1834144_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1W6JNZ5	Morganella_phage	52.9	2.4e-22
WP_038434521.1|1834213_1834426_+	hypothetical protein	NA	A0A286S2A5	Klebsiella_phage	74.3	1.1e-15
WP_040196239.1|1834427_1834760_+|head	phage head closure protein	head	A0A286S2A2	Klebsiella_phage	97.3	4.5e-56
WP_099755887.1|1834752_1835292_+	HK97 gp10 family phage protein	NA	A0A286S249	Klebsiella_phage	98.3	8.8e-94
WP_099755888.1|1835288_1835654_+	DUF3168 domain-containing protein	NA	A0A286S1R1	Klebsiella_phage	90.9	1.5e-60
WP_000115125.1|1835710_1836202_+	hypothetical protein	NA	A0A286S1Q8	Klebsiella_phage	100.0	2.3e-88
WP_032440655.1|1836245_1836599_+|tail	phage tail assembly protein	tail	A0A286S1N4	Klebsiella_phage	98.3	1.4e-60
WP_004143895.1|1836631_1836895_+	hypothetical protein	NA	A0A286S1P2	Klebsiella_phage	98.8	5.9e-43
WP_064153924.1|1836960_1837428_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099755889.1|1837472_1839920_+|tail	phage tail tape measure protein	tail	A0A286S1S3	Klebsiella_phage	65.6	6.3e-272
WP_004899614.1|1839919_1840399_+	hypothetical protein	NA	A0A286S298	Klebsiella_phage	98.7	1.7e-93
WP_032433045.1|1840385_1840868_+	DUF1833 family protein	NA	A0A286S2B1	Klebsiella_phage	97.5	4.3e-84
WP_017880229.1|1840877_1841258_+	hypothetical protein	NA	A0A286S2A6	Klebsiella_phage	100.0	4.6e-73
WP_099755890.1|1841254_1844323_+	kinase	NA	A0A286S259	Klebsiella_phage	97.7	0.0e+00
1853245:1853308	attR	CGGTCTCGAAAACCGGAGTAGGGGCAACTCTACCGGGGGTTCAAATCCCCCTCTCTCCGCCACT	NA	NA	NA	NA
>prophage 5
NZ_CP024548	Klebsiella pneumoniae strain KSB1_7J chromosome, complete genome	5354543	1850113	1858246	5354543		Klebsiella_phage(25.0%)	9	NA	NA
WP_040146350.1|1850113_1851661_-	hypothetical protein	NA	A0A286S1P0	Klebsiella_phage	87.0	3.5e-50
WP_044071819.1|1851751_1852300_+	recombinase family protein	NA	A0A286S1P7	Klebsiella_phage	98.9	2.4e-94
WP_046387713.1|1852408_1852648_+	hypothetical protein	NA	K7P7N3	Enterobacteria_phage	53.2	3.3e-16
WP_072042796.1|1852647_1852974_+	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	53.9	2.5e-27
WP_002911596.1|1853578_1854724_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	58.7	1.1e-117
WP_004151461.1|1855262_1855544_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023278867.1|1855586_1856294_+	phosphohydrolase	NA	S4W232	Pandoravirus	27.7	2.8e-07
WP_004151460.1|1856337_1857771_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	53.0	4.0e-101
WP_032413845.1|1857751_1858246_+	very short patch repair endonuclease	NA	E5E3X5	Burkholderia_phage	51.4	2.6e-31
>prophage 6
NZ_CP024548	Klebsiella pneumoniae strain KSB1_7J chromosome, complete genome	5354543	2726365	2737252	5354543		Escherichia_phage(87.5%)	9	NA	NA
WP_004190234.1|2726365_2729473_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.5	0.0e+00
WP_004176258.1|2729527_2730793_+	MFS transporter	NA	NA	NA	NA	NA
WP_001620097.1|2730823_2731912_-	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	100.0	8.0e-211
WP_004176262.1|2731998_2732259_-	hypothetical protein	NA	A0A077SK33	Escherichia_phage	98.8	5.4e-41
WP_004176269.1|2732556_2733417_+	class A broad-spectrum beta-lactamase SHV-11	NA	A0A077SL40	Escherichia_phage	99.3	2.2e-155
WP_002210513.1|2733437_2734199_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_002903955.1|2734459_2735362_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.7	2.6e-159
WP_023288424.1|2735373_2736639_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	99.3	5.1e-233
WP_002210516.1|2736631_2737252_+	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
>prophage 7
NZ_CP024548	Klebsiella pneumoniae strain KSB1_7J chromosome, complete genome	5354543	3126120	3220871	5354543	transposase,lysis,tRNA,integrase,head,capsid,portal,tail,terminase	Klebsiella_phage(32.5%)	102	3118650:3118667	3228903:3228920
3118650:3118667	attL	ACGCCAAACCCCACCGTC	NA	NA	NA	NA
WP_002901088.1|3126120_3126621_+|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
WP_002901080.1|3126737_3127184_+	DUF441 domain-containing protein	NA	NA	NA	NA	NA
WP_002901073.1|3127167_3127959_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004190880.1|3128060_3129245_+	CynX/NimT family MFS transporter	NA	NA	NA	NA	NA
WP_004140471.1|3129276_3129969_-	CTP synthase	NA	NA	NA	NA	NA
WP_004190885.1|3130114_3130624_+	DUF523 domain-containing protein	NA	NA	NA	NA	NA
WP_023279122.1|3130610_3130967_+	DUF488 domain-containing protein	NA	NA	NA	NA	NA
WP_004190888.1|3130956_3131196_-	DUF333 domain-containing protein	NA	NA	NA	NA	NA
WP_004176549.1|3131496_3132510_+	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	29.0	1.9e-12
WP_004150782.1|3132567_3132669_+	YoaK family small membrane protein	NA	NA	NA	NA	NA
WP_004213093.1|3132668_3132743_+	protein YoaJ	NA	NA	NA	NA	NA
WP_004140488.1|3132860_3132986_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004190891.1|3133045_3133309_-	DUF2534 family protein	NA	NA	NA	NA	NA
WP_004150783.1|3133439_3134078_-	leucine efflux protein LeuE	NA	NA	NA	NA	NA
WP_004148038.1|3134167_3135082_-	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	50.4	1.1e-72
WP_004150784.1|3135743_3136787_-	type II asparaginase	NA	NA	NA	NA	NA
WP_004190896.1|3137089_3138298_+	HD domain-containing protein	NA	NA	NA	NA	NA
WP_004190899.1|3138370_3140155_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	36.1	5.8e-17
WP_004150788.1|3140161_3141052_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004140497.1|3141172_3142681_+	UbiD family decarboxylase	NA	NA	NA	NA	NA
WP_004150790.1|3142991_3143678_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_153831089.1|3144128_3144308_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004190902.1|3144286_3144919_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_004140506.1|3145485_3145683_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004183659.1|3145798_3146809_-	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_004140511.1|3146805_3148212_-	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_004179357.1|3148267_3149155_-	manganese catalase family protein	NA	NA	NA	NA	NA
WP_004190904.1|3149171_3149678_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_004148027.1|3149704_3150199_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_004150795.1|3150289_3150475_-	general stress protein	NA	NA	NA	NA	NA
WP_004190910.1|3151097_3152291_+	glutathione-dependent formaldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_004140530.1|3152403_3152631_+	DUF1272 domain-containing protein	NA	NA	NA	NA	NA
WP_004150797.1|3153080_3153404_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_004190914.1|3153396_3153789_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004190918.1|3153785_3154499_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004892953.1|3154771_3154924_-	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.0	3.8e-18
WP_080883086.1|3155574_3156267_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_099755925.1|3156622_3157681_-	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	31.1	2.7e-14
WP_099755926.1|3158103_3159528_-|tail	tail fiber domain-containing protein	tail	A0A0P0IDN1	Klebsiella_phage	48.7	1.2e-94
WP_099729057.1|3172237_3172813_-|tail	tail assembly protein	tail	K7PHE5	Enterobacteria_phage	57.0	1.1e-49
WP_099755927.1|3172826_3173534_-	peptidase P60	NA	A0A2H4J1J7	uncultured_Caudovirales_phage	46.3	4.9e-60
WP_012542162.1|3173536_3174286_-|tail	phage minor tail protein L	tail	K7PGX3	Enterobacteria_phage	57.2	2.6e-83
WP_064184437.1|3174378_3174738_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044650396.1|3174750_3175101_-|tail	phage tail protein	tail	Q6UAW6	Klebsiella_phage	41.8	4.5e-22
WP_099755928.1|3175100_3178097_-|tail	phage tail tape measure protein	tail	A0A2H4J7J3	uncultured_Caudovirales_phage	26.1	1.2e-33
WP_016160678.1|3178325_3178670_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049013950.1|3178684_3179164_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099756019.1|3179184_3179586_-	hypothetical protein	NA	Q6UAX1	Klebsiella_phage	62.7	1.9e-37
WP_048964996.1|3179602_3179983_-	hypothetical protein	NA	Q6UAX2	Klebsiella_phage	67.8	3.9e-40
WP_099755929.1|3179963_3180302_-|head,tail	head-tail adaptor protein	head,tail	Q6UAX3	Klebsiella_phage	90.2	2.8e-53
WP_099755930.1|3180298_3180616_-|head,tail	phage gp6-like head-tail connector protein	head,tail	Q6UAX4	Klebsiella_phage	87.8	1.3e-44
WP_048964994.1|3180596_3180884_-	hypothetical protein	NA	Q6UAX5	Klebsiella_phage	79.6	2.5e-18
WP_023339900.1|3180941_3182228_-|capsid	phage major capsid protein	capsid	Q6UAX6	Klebsiella_phage	86.0	1.4e-206
WP_099755931.1|3182305_3183226_-	S49 family peptidase	NA	Q6UAX7	Klebsiella_phage	87.6	1.6e-148
WP_047666384.1|3183262_3184522_-|portal	phage portal protein	portal	Q6UAX8	Klebsiella_phage	89.3	5.2e-222
WP_099755932.1|3184521_3184701_-	hypothetical protein	NA	Q6UAX9	Klebsiella_phage	56.1	1.5e-10
WP_014228904.1|3184694_3186416_-|terminase	terminase large subunit	terminase	Q7Y413	Yersinia_phage	57.2	7.2e-190
WP_012542168.1|3186415_3186850_-|terminase	phage terminase small subunit P27 family	terminase	A0A1J0GV10	Halomonas_phage	61.9	9.4e-30
WP_023289184.1|3187097_3187529_-	hypothetical protein	NA	Q6UAS0	Klebsiella_phage	62.0	1.1e-41
WP_023289183.1|3187525_3187849_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032428746.1|3187800_3188163_-	HNH endonuclease	NA	Q6UAS2	Klebsiella_phage	83.3	1.2e-57
WP_023289182.1|3188489_3188714_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049115059.1|3188752_3189190_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016160650.1|3190139_3190490_-	hypothetical protein	NA	R9TPM9	Aeromonas_phage	38.1	7.9e-11
WP_023317653.1|3190486_3190984_-	lysozyme	NA	A0A1V0E5Q7	Salmonella_phage	85.2	3.7e-78
WP_016160648.1|3190983_3191199_-|lysis	phage S lysis protein	lysis	A5LH82	Enterobacteria_phage	88.7	2.7e-30
WP_157769553.1|3191856_3192060_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046879042.1|3192303_3192906_-	hypothetical protein	NA	H9C175	Pectobacterium_phage	68.6	8.4e-77
WP_099755933.1|3192922_3193954_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	50.1	4.3e-97
WP_099755934.1|3194153_3194546_-	DNA-binding protein	NA	K7PHB4	Enterobacterial_phage	36.6	8.0e-12
WP_099755935.1|3194586_3194877_-	hypothetical protein	NA	H6WRY6	Salmonella_phage	58.3	1.6e-17
WP_099755936.1|3194888_3195122_-	DinI family protein	NA	K7PM44	Enterobacteria_phage	65.8	3.5e-23
WP_099755937.1|3195532_3196084_-	TIR domain-containing protein	NA	NA	NA	NA	NA
WP_017898977.1|3196380_3196968_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099755938.1|3196971_3198114_-	toll/interleukin-1 receptor domain-containing protein	NA	NA	NA	NA	NA
WP_099755939.1|3198165_3199002_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017898974.1|3199064_3200681_-	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_099755940.1|3200810_3201410_-	TIR domain-containing protein	NA	NA	NA	NA	NA
WP_017898972.1|3201814_3202255_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_017898971.1|3202268_3202733_-	Replication protein 14	NA	A0A0U2JGJ0	Escherichia_phage	71.5	3.1e-63
WP_099755941.1|3202725_3203709_-	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	54.6	1.7e-42
WP_014907826.1|3203760_3204315_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012542199.1|3204317_3204533_-	Rha family transcriptional regulator	NA	A0A0M4QX15	Salmonella_phage	57.5	2.0e-17
WP_012542200.1|3204634_3205024_+	helix-turn-helix domain-containing protein	NA	A0A0M4R5D1	Salmonella_phage	60.2	6.7e-35
WP_021462581.1|3205866_3206061_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_014228879.1|3206103_3206448_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_099755943.1|3206674_3206953_+	hypothetical protein	NA	C6ZR35	Salmonella_phage	64.9	2.1e-22
WP_012542206.1|3207005_3207251_+	excisionase	NA	NA	NA	NA	NA
WP_099755944.1|3207231_3208365_+|integrase	tyrosine-type recombinase/integrase	integrase	O21925	Phage_21	58.0	7.5e-119
WP_157769554.1|3208367_3209312_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004150800.1|3209458_3210709_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	1.1e-19
WP_004150801.1|3210949_3211600_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_004150802.1|3211616_3212075_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_004190921.1|3212131_3213238_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_004190923.1|3213292_3213934_+	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_004190926.1|3213937_3215308_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	45.1	4.7e-107
WP_023279125.1|3215362_3215725_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_004179353.1|3215808_3216615_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_004150807.1|3216897_3217569_+	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_004147969.1|3217568_3219035_+	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_004190935.1|3219120_3220242_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_099755946.1|3220379_3220871_-|transposase	transposase	transposase	NA	NA	NA	NA
3228903:3228920	attR	ACGCCAAACCCCACCGTC	NA	NA	NA	NA
>prophage 8
NZ_CP024548	Klebsiella pneumoniae strain KSB1_7J chromosome, complete genome	5354543	3498489	3507952	5354543	tRNA,protease	Brazilian_cedratvirus(16.67%)	8	NA	NA
WP_099755968.1|3498489_3500211_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	34.3	1.2e-14
WP_002898014.1|3500255_3500957_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|3501310_3501529_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_002896522.1|3501648_3503928_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
WP_002896520.1|3503958_3504276_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
WP_002896516.1|3504601_3504823_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
WP_004191149.1|3504899_3506840_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.5	2.5e-37
WP_004191152.1|3506836_3507952_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
