The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP024545	Klebsiella pneumoniae strain INF059 chromosome, complete genome	5337491	1173874	1180870	5337491		Enterobacteria_phage(50.0%)	6	NA	NA
WP_157665542.1|1173874_1174084_-	hypothetical protein	NA	Q7M2A8	Enterobacteria_phage	87.3	1.3e-21
WP_023278769.1|1174280_1174625_-	hypothetical protein	NA	Q7M2A8	Enterobacteria_phage	73.7	5.3e-44
WP_004899969.1|1174716_1175181_+	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	63.2	3.7e-40
WP_023278770.1|1175504_1176566_+	hypothetical protein	NA	A0A2I7RNF6	Vibrio_phage	38.8	4.6e-54
WP_004899960.1|1176613_1178572_-	NACHT domain-containing protein	NA	X5JAK5	Clostridium_phage	33.5	1.6e-76
WP_002914164.1|1180387_1180870_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	2.3e-29
>prophage 2
NZ_CP024545	Klebsiella pneumoniae strain INF059 chromosome, complete genome	5337491	1404680	1448025	5337491	lysis,coat,head,tail,terminase	Cronobacter_phage(28.57%)	65	NA	NA
WP_002913370.1|1404680_1405139_-	nucleoside deaminase	NA	A0A0B5J096	Pandoravirus	32.3	1.2e-11
WP_002913369.1|1405271_1406180_+	transcriptional regulator CynR	NA	A0A2P0ZL89	Lactobacillus_phage	24.2	7.8e-10
WP_023158760.1|1406189_1407071_-	hypothetical protein	NA	A0A2H4JEC4	uncultured_Caudovirales_phage	56.8	1.5e-05
WP_002913367.1|1407438_1407921_-	WbuC family cupin fold metalloprotein	NA	NA	NA	NA	NA
WP_023301637.1|1408257_1408458_-	transcriptional regulator	NA	K7P7V0	Enterobacteria_phage	86.4	3.7e-29
WP_099728882.1|1408454_1408691_-	TraR/DksA family transcriptional regulator	NA	A0A0K2FI84	Escherichia_phage	51.9	9.4e-08
WP_099728883.1|1408687_1409377_-	morphogenetic protein	NA	H2BDG4	Pseudomonas_virus	50.0	1.4e-51
WP_099728884.1|1409587_1410244_-	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	88.0	2.7e-113
WP_099728885.1|1410240_1410669_-	regulator	NA	M9NYX4	Enterobacteria_phage	78.9	1.1e-62
WP_004151306.1|1410665_1411346_-	YqaJ viral recombinase family protein	NA	A0A0M3ULE0	Salmonella_phage	93.4	7.9e-124
WP_099728886.1|1411342_1412188_-	phage recombination protein Bet	NA	A0A1I9KF88	Aeromonas_phage	59.2	9.0e-69
WP_064185842.1|1412203_1412488_-	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	62.8	1.0e-29
WP_008807814.1|1412568_1412775_-	phage encoded cell division inhibitor protein	NA	A0A0M4S6W3	Salmonella_phage	94.1	1.4e-31
WP_099728887.1|1412767_1412956_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099728888.1|1413202_1413406_+	hypothetical protein	NA	A0A192Y6Q5	Salmonella_phage	71.6	2.7e-19
WP_071570777.1|1413602_1413938_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004178801.1|1414242_1414362_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024622727.1|1414384_1415074_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	70.6	1.0e-86
WP_004178811.1|1415178_1415412_+	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	70.4	3.0e-22
WP_087778955.1|1415451_1415772_+	hypothetical protein	NA	A0A0M4RU01	Salmonella_phage	67.9	1.1e-35
WP_099728889.1|1415858_1416656_+	DNA-binding protein	NA	A0A2H4J902	uncultured_Caudovirales_phage	71.1	5.7e-89
WP_099729049.1|1416715_1417681_+	replication protein	NA	K7PGZ0	Enterobacteria_phage	77.3	5.9e-64
WP_019704107.1|1417677_1418415_+	Replication protein 14	NA	A0A0K2FIT1	Enterobacteria_phage	55.6	3.1e-65
WP_099728890.1|1418411_1418714_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_099728891.1|1418710_1419121_+	hypothetical protein	NA	R9TME7	Aeromonas_phage	53.1	5.1e-25
WP_099728892.1|1419117_1419600_+	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	80.6	3.2e-71
WP_099728893.1|1420371_1420917_+	DUF550 domain-containing protein	NA	A0A0M4RTV1	Salmonella_phage	68.3	1.9e-59
WP_123297955.1|1421072_1421618_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099728894.1|1421699_1421957_+	DNA polymerase III subunit theta	NA	G8C7V1	Escherichia_phage	70.0	4.9e-26
WP_099728895.1|1422063_1422660_+	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	54.3	4.7e-56
WP_032413853.1|1422665_1422836_+	NinE family protein	NA	G8C7V4	Escherichia_phage	71.4	2.8e-14
WP_004151286.1|1422828_1423464_+	protein ninG	NA	M9NYX8	Enterobacteria_phage	77.9	2.7e-81
WP_023283343.1|1423460_1423601_+	YlcG family protein	NA	NA	NA	NA	NA
WP_063417047.1|1423600_1424290_+	antiterminator	NA	I6PDF8	Cronobacter_phage	53.6	1.2e-55
WP_004146526.1|1425034_1425283_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023341861.1|1425285_1425816_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	79.4	9.3e-80
WP_023342728.1|1425812_1426274_+|lysis	lysis protein	lysis	M9NYX9	Enterobacteria_phage	63.4	3.2e-44
WP_074184070.1|1426397_1426754_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032428158.1|1427278_1427614_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064146435.1|1427641_1428157_+|terminase	terminase small subunit	terminase	I6PDJ6	Cronobacter_phage	75.3	3.3e-66
WP_099728896.1|1428156_1429629_+|terminase	terminase	terminase	A0A1W6JNY3	Morganella_phage	82.3	2.9e-248
WP_099728897.1|1429641_1431105_+	DUF1073 domain-containing protein	NA	F1C5D7	Cronobacter_phage	56.1	2.6e-148
WP_099728898.1|1431037_1432033_+|head	phage head morphogenesis protein	head	F1C5D8	Cronobacter_phage	70.1	3.0e-116
WP_117270308.1|1432121_1432427_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099728899.1|1432477_1433863_+	DUF2213 domain-containing protein	NA	F1C5D9	Cronobacter_phage	64.2	1.2e-166
WP_012967726.1|1433866_1434298_+	hypothetical protein	NA	F1C5E0	Cronobacter_phage	60.8	6.2e-42
WP_099728900.1|1434309_1435407_+|coat	phage coat protein	coat	F1C5E1	Cronobacter_phage	73.0	3.6e-150
WP_099728901.1|1435416_1435701_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042937269.1|1435703_1436084_+	hypothetical protein	NA	F1C5E2	Cronobacter_phage	54.5	5.3e-29
WP_048336937.1|1436083_1436257_+	hypothetical protein	NA	I6R0P9	Salmonella_phage	54.4	4.1e-13
WP_016528891.1|1436256_1436619_+	hypothetical protein	NA	A0A0M3LSC9	Mannheimia_phage	49.2	2.5e-20
WP_099728902.1|1436621_1436990_+	hypothetical protein	NA	F1C5E3	Cronobacter_phage	82.0	1.1e-47
WP_099728903.1|1436986_1437370_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099728904.1|1437428_1438193_+	immunoglobulin domain-containing protein	NA	G0ZNE6	Cronobacter_phage	42.6	3.9e-39
WP_099728905.1|1438260_1438953_+	hypothetical protein	NA	G0ZNE7	Cronobacter_phage	54.2	2.7e-63
WP_087847127.1|1439003_1439387_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087847160.1|1439621_1439981_-	hypothetical protein	NA	A0A077K9U2	Edwardsiella_phage	41.7	4.1e-15
WP_099728906.1|1440232_1440574_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040181307.1|1440625_1440964_+	hypothetical protein	NA	H6WRV3	Salmonella_phage	57.3	1.0e-31
WP_099728907.1|1441019_1441490_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099728908.1|1441581_1444179_+|tail	tail protein (tape measure)	tail	F1C5E9	Cronobacter_phage	39.3	2.5e-93
WP_064144792.1|1444222_1444699_+	hypothetical protein	NA	A0A2P1MXB5	Escherichia_phage	48.4	6.7e-37
WP_099728909.1|1444698_1445169_+	hypothetical protein	NA	R9TPR6	Aeromonas_phage	39.7	2.8e-27
WP_080935608.1|1445165_1445561_+	hypothetical protein	NA	F1C5F2	Cronobacter_phage	56.3	1.2e-36
WP_099728910.1|1445547_1448025_+	MoaD/ThiS family protein	NA	F1C5A7	Cronobacter_phage	45.2	1.1e-196
>prophage 3
NZ_CP024545	Klebsiella pneumoniae strain INF059 chromosome, complete genome	5337491	1676738	1683643	5337491	tRNA	Planktothrix_phage(33.33%)	6	NA	NA
WP_023278799.1|1676738_1677602_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.5	5.7e-10
WP_004899467.1|1677612_1678386_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.7	3.9e-26
WP_099729051.1|1678626_1679520_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	28.3	9.4e-16
WP_004144192.1|1679765_1681127_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	94.8	1.8e-207
WP_004175198.1|1681445_1682168_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	8.3e-31
WP_019705218.1|1682164_1683643_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	28.3	8.5e-30
>prophage 4
NZ_CP024545	Klebsiella pneumoniae strain INF059 chromosome, complete genome	5337491	1727421	1742683	5337491		Hokovirus(18.18%)	12	NA	NA
WP_000043543.1|1727421_1728828_+	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.7	4.7e-38
WP_004180506.1|1729069_1730485_+	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	31.0	1.4e-53
WP_023288453.1|1730507_1731878_+	phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	26.0	6.4e-32
WP_023278824.1|1732034_1733099_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	55.0	7.5e-105
WP_023278825.1|1733125_1733995_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	66.7	1.7e-110
WP_004189149.1|1734026_1734917_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.2	3.7e-28
WP_023278826.1|1734931_1735486_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	57.6	1.5e-51
WP_023278827.1|1735666_1736833_+	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	54.7	5.3e-112
WP_004144151.1|1737256_1737379_-	small membrane protein	NA	NA	NA	NA	NA
WP_004184806.1|1737779_1738784_-	NAD-dependent epimerase	NA	E3T4Y8	Cafeteria_roenbergensis_virus	29.5	1.8e-31
WP_004180506.1|1739862_1741278_+	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	31.0	1.4e-53
WP_012967600.1|1741300_1742683_+	phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	25.8	4.2e-31
>prophage 5
NZ_CP024545	Klebsiella pneumoniae strain INF059 chromosome, complete genome	5337491	1844056	1897153	5337491	capsid,protease,integrase,head,tail,holin,portal,terminase,transposase	Salmonella_phage(19.05%)	59	1862572:1862631	1903649:1903712
WP_099728927.1|1844056_1845319_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	39.8	4.3e-75
WP_004151469.1|1845748_1847185_+	EmmdR/YeeO family multidrug/toxin efflux MATE transporter	NA	NA	NA	NA	NA
WP_004148975.1|1847550_1849005_-	AMP nucleosidase	NA	NA	NA	NA	NA
WP_004141189.1|1849134_1849380_-	signal transduction protein PmrD	NA	NA	NA	NA	NA
WP_023278836.1|1849652_1851275_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_020723560.1|1851185_1852118_-	nucleoside recognition family protein	NA	NA	NA	NA	NA
WP_023278837.1|1852238_1853216_-	oxidoreductase	NA	NA	NA	NA	NA
WP_004175384.1|1853212_1853917_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_009484423.1|1854508_1856143_+	Na+/H+ antiporter	NA	NA	NA	NA	NA
WP_099728928.1|1856642_1857560_+	nitrogen assimilation transcriptional regulator	NA	NA	NA	NA	NA
WP_004180456.1|1857666_1858617_+	HTH-type transcriptional regulator Cbl	NA	NA	NA	NA	NA
WP_009484426.1|1858695_1859637_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_099728929.1|1859786_1860071_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009484428.1|1860371_1861067_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002911599.1|1861652_1862450_-	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
1862572:1862631	attL	CGGTCTCGAAAACCGGAGTAGGGGCAACTCTACCGGGGGTTCAAATCCCCCTCTCTCCGC	NA	NA	NA	NA
WP_099728930.1|1862745_1863738_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	87.2	6.4e-175
WP_004184757.1|1863739_1863967_-	DUF4224 domain-containing protein	NA	Q8HAA9	Salmonella_phage	78.4	1.1e-29
WP_099728932.1|1864274_1865258_-	DUF550 domain-containing protein	NA	A0A0M4RTV1	Salmonella_phage	43.0	2.2e-50
WP_099728933.1|1865254_1865542_-	hypothetical protein	NA	A0A077KAZ4	Edwardsiella_phage	72.5	1.4e-29
WP_099728935.1|1865807_1866122_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099728936.1|1866122_1866788_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099728937.1|1867199_1867985_-	hypothetical protein	NA	C7BGF1	Burkholderia_phage	52.1	1.5e-62
WP_099728938.1|1867984_1868284_-	hypothetical protein	NA	K7PJS4	Enterobacterial_phage	47.8	1.7e-14
WP_099728939.1|1868371_1869289_-	recombination-associated protein RdgC	NA	A0A1W6JP69	Morganella_phage	36.9	1.8e-46
WP_000690183.1|1869833_1870529_-	helix-turn-helix transcriptional regulator	NA	Q8HAA0	Salmonella_phage	71.3	2.7e-87
WP_001191665.1|1870626_1870869_+	helix-turn-helix transcriptional regulator	NA	A0A1C9IHV8	Salmonella_phage	80.3	1.3e-25
WP_004213338.1|1870903_1871365_+	hypothetical protein	NA	K7PJS5	Enterobacterial_phage	88.2	1.7e-69
WP_001208720.1|1871602_1871782_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	73.1	4.6e-15
WP_024176409.1|1871771_1872725_+	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	75.5	3.7e-103
WP_099728940.1|1872721_1873531_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1C9II58	Salmonella_phage	68.9	6.5e-109
WP_087760093.1|1873540_1873918_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A1C9IIA0	Salmonella_phage	73.6	1.8e-48
WP_099728941.1|1873930_1874911_+	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	68.1	2.1e-133
WP_099728942.1|1874925_1875288_+	antitermination protein Q	NA	K7PGW2	Enterobacterial_phage	94.2	2.1e-59
WP_099728943.1|1875311_1875755_-	hypothetical protein	NA	A5LH78	Enterobacteria_phage	70.1	4.6e-48
WP_099729052.1|1875758_1876472_-	hypothetical protein	NA	A5LH79	Enterobacteria_phage	90.3	1.3e-121
WP_040186322.1|1877011_1877359_+|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	72.0	1.5e-38
WP_040186325.1|1877361_1877901_+	glycoside hydrolase family 108 protein	NA	A0A286N2Q6	Klebsiella_phage	98.9	1.1e-101
WP_048264668.1|1877897_1878239_+	hypothetical protein	NA	A0A286N2Q7	Klebsiella_phage	70.8	7.6e-35
WP_048325281.1|1878241_1878517_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072060439.1|1878897_1879248_+	HNH endonuclease	NA	K7PHK9	Enterobacteria_phage	77.6	8.6e-50
WP_001119413.1|1879406_1879904_+|terminase	phage terminase small subunit P27 family	terminase	K7PHI2	Enterobacteria_phage	71.3	7.4e-63
WP_004206689.1|1879907_1881659_+|terminase	terminase large subunit	terminase	A0A1P8DTK0	Proteus_phage	72.2	5.2e-252
WP_000923127.1|1881806_1883033_+|portal	phage portal protein	portal	Q8SBI0	Shigella_phage	85.3	2.5e-208
WP_000999827.1|1883025_1883625_+|head,protease	HK97 family phage prohead protease	head,protease	Q8SBH9	Shigella_phage	82.5	1.0e-90
WP_070585623.1|1883634_1884873_+|capsid	phage major capsid protein	capsid	Q8SBH8	Shigella_phage	67.7	7.1e-155
WP_019705272.1|1884951_1885269_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1W6JNZ5	Morganella_phage	52.9	7.4e-24
WP_019705271.1|1885277_1885616_+|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	68.8	6.6e-39
WP_019705270.1|1885612_1886062_+	HK97 gp10 family phage protein	NA	Q9MCS9	Enterobacteria_phage	82.6	6.7e-63
WP_087851069.1|1886058_1886406_+	DUF3168 domain-containing protein	NA	K7PKL6	Enterobacterial_phage	63.7	2.8e-32
WP_047671839.1|1886462_1887167_+	immunoglobulin domain-containing protein	NA	K7PHL2	Enterobacterial_phage	66.5	1.9e-80
WP_040204832.1|1887197_1887602_+|tail	phage tail protein	tail	Q9MCS5	Enterobacteria_phage	56.2	5.0e-33
WP_099728944.1|1887604_1887910_+	DUF4035 domain-containing protein	NA	Q9MCS5	Enterobacteria_phage	67.7	3.3e-29
WP_016530182.1|1887983_1888217_+	hypothetical protein	NA	K7PH16	Enterobacteria_phage	47.2	1.9e-08
WP_032442165.1|1888358_1889282_-|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	99.7	4.9e-177
WP_099729053.1|1889342_1892729_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	56.5	8.1e-294
WP_004884312.1|1892749_1893223_+	hypothetical protein	NA	A0A286S298	Klebsiella_phage	62.7	1.1e-55
WP_004864228.1|1893209_1893686_+	DUF1833 domain-containing protein	NA	A0A286S2B1	Klebsiella_phage	65.8	4.8e-51
WP_032408661.1|1893698_1894079_+	nitrite transporter	NA	A0A286S2A6	Klebsiella_phage	84.1	5.3e-61
WP_099728945.1|1894075_1897153_+	kinase	NA	A0A286S259	Klebsiella_phage	62.4	0.0e+00
1903649:1903712	attR	CGGTCTCGAAAACCGGAGTAGGGGCAACTCTACCGGGGGTTCAAATCCCCCTCTCTCCGCCACT	NA	NA	NA	NA
>prophage 6
NZ_CP024545	Klebsiella pneumoniae strain INF059 chromosome, complete genome	5337491	2783591	2794478	5337491		Escherichia_phage(87.5%)	9	NA	NA
WP_004190234.1|2783591_2786699_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.5	0.0e+00
WP_004176258.1|2786753_2788019_+	MFS transporter	NA	NA	NA	NA	NA
WP_001620097.1|2788049_2789138_-	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	100.0	8.0e-211
WP_004176262.1|2789224_2789485_-	hypothetical protein	NA	A0A077SK33	Escherichia_phage	98.8	5.4e-41
WP_004176269.1|2789782_2790643_+	class A broad-spectrum beta-lactamase SHV-11	NA	A0A077SL40	Escherichia_phage	99.3	2.2e-155
WP_002210513.1|2790663_2791425_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_002903955.1|2791685_2792588_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.7	2.6e-159
WP_023288424.1|2792599_2793865_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	99.3	5.1e-233
WP_002210516.1|2793857_2794478_+	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
>prophage 7
NZ_CP024545	Klebsiella pneumoniae strain INF059 chromosome, complete genome	5337491	3183348	3277975	5337491	capsid,lysis,tRNA,integrase,head,tail,portal,terminase,transposase	Klebsiella_phage(34.15%)	100	3175878:3175895	3286007:3286024
3175878:3175895	attL	ACGCCAAACCCCACCGTC	NA	NA	NA	NA
WP_002901088.1|3183348_3183849_+|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
WP_002901080.1|3183965_3184412_+	DUF441 domain-containing protein	NA	NA	NA	NA	NA
WP_002901073.1|3184395_3185187_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004190880.1|3185288_3186473_+	CynX/NimT family MFS transporter	NA	NA	NA	NA	NA
WP_004140471.1|3186504_3187197_-	CTP synthase	NA	NA	NA	NA	NA
WP_004190885.1|3187342_3187852_+	DUF523 domain-containing protein	NA	NA	NA	NA	NA
WP_023279122.1|3187838_3188195_+	DUF488 domain-containing protein	NA	NA	NA	NA	NA
WP_004190888.1|3188184_3188424_-	DUF333 domain-containing protein	NA	NA	NA	NA	NA
WP_004176549.1|3188724_3189738_+	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	29.0	1.9e-12
WP_004150782.1|3189795_3189897_+	YoaK family small membrane protein	NA	NA	NA	NA	NA
WP_004213093.1|3189896_3189971_+	protein YoaJ	NA	NA	NA	NA	NA
WP_004140488.1|3190088_3190214_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004190891.1|3190273_3190537_-	DUF2534 family protein	NA	NA	NA	NA	NA
WP_004150783.1|3190667_3191306_-	leucine efflux protein LeuE	NA	NA	NA	NA	NA
WP_004148038.1|3191395_3192310_-	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	50.4	1.1e-72
WP_004150784.1|3192971_3194015_-	type II asparaginase	NA	NA	NA	NA	NA
WP_004190896.1|3194317_3195526_+	HD domain-containing protein	NA	NA	NA	NA	NA
WP_004190899.1|3195598_3197383_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	36.1	5.8e-17
WP_004150788.1|3197389_3198280_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004140497.1|3198400_3199909_+	UbiD family decarboxylase	NA	NA	NA	NA	NA
WP_004150790.1|3200219_3200906_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_153831089.1|3201356_3201536_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004190902.1|3201514_3202147_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_004140506.1|3202713_3202911_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004183659.1|3203026_3204037_-	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_004140511.1|3204033_3205440_-	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_004179357.1|3205495_3206383_-	manganese catalase family protein	NA	NA	NA	NA	NA
WP_004190904.1|3206399_3206906_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_004148027.1|3206932_3207427_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_004150795.1|3207517_3207703_-	general stress protein	NA	NA	NA	NA	NA
WP_004190907.1|3207922_3208258_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004190910.1|3208325_3209519_+	glutathione-dependent formaldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_004140530.1|3209631_3209859_+	DUF1272 domain-containing protein	NA	NA	NA	NA	NA
WP_004150797.1|3210308_3210632_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_004190914.1|3210624_3211017_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004190918.1|3211013_3211727_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004892953.1|3211999_3212152_-	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.0	3.8e-18
WP_099728994.1|3212801_3213494_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_032430712.1|3213849_3214908_-	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	31.1	6.1e-14
WP_099728995.1|3215330_3216755_-|tail	tail fiber domain-containing protein	tail	A0A0P0IDN1	Klebsiella_phage	48.7	3.8e-96
WP_099728996.1|3216816_3229407_-	DUF1983 domain-containing protein	NA	Q6UAW1	Klebsiella_phage	41.5	0.0e+00
WP_099729057.1|3229464_3230040_-|tail	tail assembly protein	tail	K7PHE5	Enterobacteria_phage	57.0	1.1e-49
WP_012542161.1|3230053_3230761_-	peptidase P60	NA	A0A2H4J1J7	uncultured_Caudovirales_phage	45.4	1.3e-60
WP_032735256.1|3230763_3231513_-|tail	phage minor tail protein L	tail	K7PGX3	Enterobacteria_phage	56.8	5.7e-83
WP_016160681.1|3231605_3231965_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016160680.1|3231977_3232328_-|tail	phage tail protein	tail	Q6UAW6	Klebsiella_phage	41.8	2.6e-22
WP_099728997.1|3232327_3235324_-|tail	phage tail tape measure protein	tail	A0A2H4J7J3	uncultured_Caudovirales_phage	25.8	5.7e-33
WP_016160678.1|3235552_3235897_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016160677.1|3235911_3236391_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016160676.1|3236411_3236825_-	HK97 gp10 family phage protein	NA	Q6UAX1	Klebsiella_phage	59.3	2.0e-37
WP_016160675.1|3236829_3237210_-	hypothetical protein	NA	Q6UAX2	Klebsiella_phage	68.6	1.4e-40
WP_014228910.1|3237190_3237529_-|head,tail	head-tail adaptor protein	head,tail	Q6UAX3	Klebsiella_phage	91.1	5.6e-54
WP_016160674.1|3237525_3237843_-|head,tail	phage gp6-like head-tail connector protein	head,tail	Q6UAX4	Klebsiella_phage	88.8	2.0e-45
WP_016160673.1|3237823_3238084_-	hypothetical protein	NA	Q6UAX5	Klebsiella_phage	60.5	9.6e-22
WP_099728998.1|3238142_3239429_-|capsid	phage major capsid protein	capsid	Q6UAX6	Klebsiella_phage	89.0	2.6e-216
WP_016160672.1|3239506_3240427_-	S49 family peptidase	NA	Q6UAX7	Klebsiella_phage	87.9	9.6e-149
WP_012542166.1|3240463_3241723_-|portal	phage portal protein	portal	Q6UAX8	Klebsiella_phage	90.2	2.8e-223
WP_017898992.1|3241722_3241902_-	hypothetical protein	NA	Q6UAX9	Klebsiella_phage	57.6	3.1e-11
WP_099728999.1|3241895_3243617_-|terminase	terminase large subunit	terminase	Q7Y413	Yersinia_phage	57.0	3.6e-189
WP_012542168.1|3243616_3244051_-|terminase	phage terminase small subunit P27 family	terminase	A0A1J0GV10	Halomonas_phage	61.9	9.4e-30
WP_014907818.1|3244298_3244730_-	hypothetical protein	NA	Q6UAS0	Klebsiella_phage	61.6	1.8e-41
WP_023289183.1|3244726_3245050_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032428746.1|3245001_3245364_-	HNH endonuclease	NA	Q6UAS2	Klebsiella_phage	83.3	1.2e-57
WP_032749552.1|3245690_3245915_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065888617.1|3245953_3246391_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016160650.1|3247329_3247680_-	hypothetical protein	NA	R9TPM9	Aeromonas_phage	38.1	7.9e-11
WP_023317653.1|3247676_3248174_-	lysozyme	NA	A0A1V0E5Q7	Salmonella_phage	85.2	3.7e-78
WP_016160648.1|3248173_3248389_-|lysis	phage S lysis protein	lysis	A5LH82	Enterobacteria_phage	88.7	2.7e-30
WP_128316005.1|3249046_3249250_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060657012.1|3249493_3250096_-	hypothetical protein	NA	H9C175	Pectobacterium_phage	68.6	8.4e-77
WP_099729000.1|3250112_3251144_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	49.6	2.8e-96
WP_094315826.1|3251343_3251736_-	DNA-binding protein	NA	K7PHB4	Enterobacterial_phage	36.6	3.6e-12
WP_077253879.1|3251776_3252067_-	hypothetical protein	NA	H6WRY6	Salmonella_phage	56.9	6.1e-17
WP_023279529.1|3252078_3252312_-	DinI family protein	NA	K7PM44	Enterobacteria_phage	72.4	1.3e-25
WP_099729001.1|3252592_3254329_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099729002.1|3254561_3255455_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023279533.1|3256090_3256990_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023279534.1|3258125_3258566_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099729003.1|3258579_3259044_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	69.5	1.3e-61
WP_099729004.1|3259036_3260020_-	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	55.8	7.3e-46
WP_014907826.1|3260071_3260626_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046879032.1|3260628_3260844_-	Rha family transcriptional regulator	NA	A0A0M4QX15	Salmonella_phage	58.9	1.2e-17
WP_012542200.1|3260945_3261335_+	helix-turn-helix domain-containing protein	NA	A0A0M4R5D1	Salmonella_phage	60.2	6.7e-35
WP_099729005.1|3262177_3262372_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_014228879.1|3262414_3262759_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_099729006.1|3262900_3265039_+	exonuclease	NA	S4TNL0	Salmonella_phage	42.9	1.9e-99
WP_012542206.1|3265091_3265337_+	excisionase	NA	NA	NA	NA	NA
WP_099729007.1|3265317_3266445_+|integrase	tyrosine-type recombinase/integrase	integrase	O21925	Phage_21	58.1	4.8e-118
WP_004150800.1|3266562_3267813_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	1.1e-19
WP_004150801.1|3268053_3268704_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_004150802.1|3268720_3269179_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_004190921.1|3269235_3270342_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_004190923.1|3270396_3271038_+	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_004190926.1|3271041_3272412_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	45.1	4.7e-107
WP_023279125.1|3272466_3272829_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_004179353.1|3272912_3273719_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_004150807.1|3274001_3274673_+	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_004147969.1|3274672_3276139_+	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_004190935.1|3276224_3277346_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_004190938.1|3277483_3277975_-|transposase	transposase	transposase	NA	NA	NA	NA
3286007:3286024	attR	ACGCCAAACCCCACCGTC	NA	NA	NA	NA
>prophage 8
NZ_CP024545	Klebsiella pneumoniae strain INF059 chromosome, complete genome	5337491	3510058	3519520	5337491	protease,tRNA	Brazilian_cedratvirus(16.67%)	8	NA	NA
WP_004191145.1|3510058_3511780_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	34.3	1.2e-14
WP_002898014.1|3511824_3512526_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|3512879_3513098_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_002896522.1|3513216_3515496_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
WP_002896520.1|3515526_3515844_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
WP_002896516.1|3516169_3516391_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
WP_004191149.1|3516467_3518408_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.5	2.5e-37
WP_004191152.1|3518404_3519520_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
>prophage 1
NZ_CP024546	Klebsiella pneumoniae strain INF059 plasmid unnamed1, complete sequence	110374	43520	52314	110374		Escherichia_phage(42.86%)	9	NA	NA
WP_060579413.1|43520_44276_+	replication initiation protein RepE	NA	I3WF20	Macacine_betaherpesvirus	95.2	2.9e-135
WP_000368714.1|45041_46247_+	ParA family protein	NA	A0A077SL49	Escherichia_phage	69.6	2.4e-163
WP_087597452.1|46243_47221_+	ParB/RepB/Spo0J family partition protein	NA	Q38420	Escherichia_phage	53.5	1.4e-86
WP_099729065.1|47302_48574_-	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	63.3	3.2e-150
WP_048993623.1|48573_49005_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	53.3	2.1e-29
WP_001568038.1|49238_50210_+	hypothetical protein	NA	A0A222YXF2	Escherichia_phage	46.8	1.1e-73
WP_040213126.1|50212_50884_+	Mediator of plasmid stability	NA	NA	NA	NA	NA
WP_001568040.1|50945_51176_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001568041.1|51612_52314_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.2	1.6e-26
>prophage 1
NZ_CP024547	Klebsiella pneumoniae strain INF059 plasmid unnamed2, complete sequence	71587	4707	11421	71587	transposase	Stx2-converting_phage(50.0%)	8	NA	NA
WP_080892630.1|4707_5112_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	97.0	1.4e-67
WP_000612626.1|5108_5456_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_022644883.1|5504_7043_+|transposase	IS66-like element ISKpn24 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	94.7	4.6e-281
WP_020804876.1|7153_7765_+	DUF2913 family protein	NA	NA	NA	NA	NA
WP_020314639.1|7761_8715_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	57.1	9.5e-75
WP_022644719.1|8835_9102_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020314642.1|9121_9742_-	recombinase family protein	NA	A0A219Y912	Aeromonas_phage	31.0	1.0e-08
WP_020804882.1|10779_11421_+	ParA family protein	NA	A4JWV7	Burkholderia_virus	25.5	1.1e-05
>prophage 2
NZ_CP024547	Klebsiella pneumoniae strain INF059 plasmid unnamed2, complete sequence	71587	14629	23027	71587		Faecalibacterium_phage(16.67%)	12	NA	NA
WP_099729075.1|14629_15331_+	DNA methylase	NA	A0A2K9VH43	Faecalibacterium_phage	34.1	1.2e-21
WP_032743907.1|15330_15552_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099729076.1|15597_16008_+	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_020804421.1|16054_16819_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064181679.1|17250_17679_+	antirestriction protein	NA	A9J566	Pseudomonas_phage	31.9	2.8e-10
WP_099729085.1|17723_18230_+	antirestriction protein	NA	G9FHQ1	Rhodococcus_virus	31.9	5.3e-08
WP_020803881.1|18270_18462_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039698518.1|18662_18926_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	53.8	3.4e-14
WP_064174028.1|18950_19271_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039698514.1|20100_20658_+	single-stranded DNA-binding protein	NA	A0A0A0P1Q9	Enterobacteria_phage	75.2	5.2e-49
WP_020804458.1|20707_20956_+	DUF905 domain-containing protein	NA	NA	NA	NA	NA
WP_099729078.1|21026_23027_+	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	26.9	8.8e-22
