The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP024521	Klebsiella pneumoniae strain INF158 chromosome, complete genome	5297118	666187	722454	5297118	protease,transposase,plate	Staphylococcus_phage(20.0%)	50	NA	NA
WP_032425077.1|666187_666934_+|protease	proteasome-type protease	protease	NA	NA	NA	NA
WP_048289971.1|667345_668359_+	fatty acid desaturase	NA	NA	NA	NA	NA
WP_004145488.1|669190_669313_-	nitrilotriacetate monooxygenase	NA	NA	NA	NA	NA
WP_023286625.1|669930_670872_+	transcriptional regulator TdcA	NA	NA	NA	NA	NA
WP_002910762.1|670965_671955_+	bifunctional threonine ammonia-lyase/L-serine ammonia-lyase TdcB	NA	NA	NA	NA	NA
WP_004145486.1|671980_673312_+	threonine/serine transporter TdcC	NA	NA	NA	NA	NA
WP_032425074.1|673339_674548_+	propionate kinase	NA	NA	NA	NA	NA
WP_032425474.1|674576_676871_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.7	7.4e-158
WP_060614334.1|677301_678417_+	branched-chain amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004175489.1|678526_679441_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_060614333.1|679450_680737_+	high-affinity branched-chain amino acid ABC transporter permease LivM	NA	NA	NA	NA	NA
WP_032425073.1|680733_681609_+	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	41.5	9.5e-05
WP_004175491.1|681605_682325_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.0	1.5e-11
WP_002910720.1|682330_683224_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004180410.1|683507_685151_+	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	50.4	5.7e-136
WP_002910717.1|685200_685677_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_020801827.1|685775_686702_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_032425072.1|687005_688301_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	36.8	7.4e-62
WP_004175495.1|688315_689122_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_020801945.1|689096_689996_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002910657.1|690105_690588_-	cold shock domain-containing protein	NA	NA	NA	NA	NA
WP_004197491.1|690778_691477_+	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	27.2	2.6e-05
WP_004899028.1|691502_692087_-	DUF2058 domain-containing protein	NA	NA	NA	NA	NA
WP_002910650.1|692156_692486_-	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_004899025.1|693054_694395_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_004184632.1|694391_695045_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_032425071.1|695048_696746_+	OmpA family protein	NA	NA	NA	NA	NA
WP_032425070.1|697204_699691_+	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_032425069.1|699714_701046_+	S-type Pyocin	NA	NA	NA	NA	NA
WP_032425473.1|701090_702014_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	92.8	2.3e-166
WP_032425068.1|702135_702645_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002910591.1|702641_703148_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060614320.1|703384_703894_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032425067.1|704187_705543_+	S-type Pyocin	NA	NA	NA	NA	NA
WP_004200304.1|705543_706053_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015958632.1|706049_706556_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002910549.1|706601_706832_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023317012.1|706855_708046_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015958629.1|708069_708375_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060614315.1|708396_709290_+	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A7H6	Microcystis_virus	30.5	1.1e-13
WP_016946122.1|709473_710367_+	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A075BSL8	Microcystis_phage	27.3	1.7e-12
WP_004184615.1|710542_711436_+	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A075BSL8	Microcystis_phage	27.1	2.2e-12
WP_004184614.1|712636_712978_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004227463.1|713166_713424_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002910497.1|713721_713988_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_032411808.1|715137_718548_+	type VI secretion protein VasK	NA	NA	NA	NA	NA
WP_099595213.1|718681_720445_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_060614316.1|720444_721491_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_021314026.1|721465_722008_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_004175538.1|722010_722454_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
>prophage 2
NZ_CP024521	Klebsiella pneumoniae strain INF158 chromosome, complete genome	5297118	1396340	1407227	5297118		Escherichia_phage(87.5%)	9	NA	NA
WP_004151613.1|1396340_1399448_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.6	0.0e+00
WP_004151612.1|1399502_1400768_+	MFS transporter	NA	NA	NA	NA	NA
WP_001620097.1|1400798_1401887_-	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	100.0	8.0e-211
WP_002904006.1|1401973_1402234_-	hypothetical protein	NA	A0A077SK33	Escherichia_phage	97.7	3.5e-40
WP_004176269.1|1402531_1403392_+	class A broad-spectrum beta-lactamase SHV-11	NA	A0A077SL40	Escherichia_phage	99.3	2.2e-155
WP_002210513.1|1403412_1404174_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_004151610.1|1404434_1405337_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.3	7.7e-159
WP_004151609.1|1405348_1406614_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	99.5	6.6e-233
WP_002210516.1|1406606_1407227_+	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
>prophage 3
NZ_CP024521	Klebsiella pneumoniae strain INF158 chromosome, complete genome	5297118	1635433	1727669	5297118	transposase,terminase,integrase	uncultured_Caudovirales_phage(26.56%)	109	1626062:1626079	1736109:1736126
1626062:1626079	attL	ATCTTTCACCGCGCCGCC	NA	NA	NA	NA
WP_004152576.1|1635433_1636300_-	hypothetical protein	NA	A0A2H4IYR0	uncultured_Caudovirales_phage	64.5	1.9e-34
WP_004152575.1|1636299_1637073_-	DUF2612 domain-containing protein	NA	A0A2H4J1A9	uncultured_Caudovirales_phage	54.4	2.8e-77
WP_004152574.1|1637069_1638266_-	hypothetical protein	NA	A0A0M4RD32	Salmonella_phage	72.9	3.9e-158
WP_004152573.1|1638265_1638619_-	hypothetical protein	NA	A0A2H4J629	uncultured_Caudovirales_phage	80.3	2.3e-50
WP_004152572.1|1638620_1639274_-	hypothetical protein	NA	A0A2H4J8H6	uncultured_Caudovirales_phage	63.5	1.0e-59
WP_004152571.1|1639327_1639894_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004199301.1|1639936_1640119_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152570.1|1640168_1640510_-	hypothetical protein	NA	A0A2H4J1A5	uncultured_Caudovirales_phage	46.6	1.8e-23
WP_004152569.1|1640509_1641532_-	hypothetical protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	54.2	9.2e-100
WP_004152568.1|1641534_1641837_-	hypothetical protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	55.2	2.0e-26
WP_004152567.1|1641837_1642437_-	hypothetical protein	NA	A0A2H4J1B3	uncultured_Caudovirales_phage	57.6	9.9e-54
WP_004152566.1|1642436_1644440_-	lytic transglycosylase domain-containing protein	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	63.6	1.2e-247
WP_004152565.1|1644429_1644582_-	hypothetical protein	NA	A0A2H4J1A2	uncultured_Caudovirales_phage	88.0	7.6e-19
WP_004152564.1|1644617_1645043_-	hypothetical protein	NA	A0A2H4J2V6	uncultured_Caudovirales_phage	63.4	2.6e-40
WP_004199809.1|1645046_1645487_-	DUF3277 family protein	NA	A0A0M5M1K6	Salmonella_phage	80.1	3.3e-62
WP_004152177.1|1645497_1646643_-	DUF3383 domain-containing protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	76.9	6.3e-166
WP_004152176.1|1646646_1647087_-	hypothetical protein	NA	A0A2H4J1A0	uncultured_Caudovirales_phage	51.7	1.6e-40
WP_001116156.1|1647181_1647568_-	hypothetical protein	NA	A0A2H4J1A4	uncultured_Caudovirales_phage	78.2	1.1e-48
WP_000834982.1|1647567_1648074_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000113538.1|1648070_1648490_-	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	60.7	3.3e-40
WP_000725700.1|1648458_1648740_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001132269.1|1648779_1649721_-	DUF2184 domain-containing protein	NA	A0A2H4J191	uncultured_Caudovirales_phage	77.1	1.7e-137
WP_000528476.1|1649732_1650227_-	hypothetical protein	NA	A0A2H4JHM9	uncultured_Caudovirales_phage	62.7	4.2e-50
WP_004199270.1|1650230_1651433_-	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	54.1	2.6e-106
WP_004152174.1|1651484_1652033_-	hypothetical protein	NA	A0A0M4REK0	Salmonella_phage	56.3	3.0e-49
WP_004152173.1|1652088_1653540_-	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	68.8	3.8e-192
WP_004152172.1|1653777_1655178_-|terminase	PBSX family phage terminase large subunit	terminase	A0A077KAW0	Edwardsiella_phage	69.0	9.4e-188
WP_004152171.1|1655128_1655881_-	hypothetical protein	NA	A0A077KBY7	Edwardsiella_phage	66.0	4.0e-12
WP_004152170.1|1655982_1656303_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004153952.1|1656537_1656927_-	lipase chaperone	NA	A0A192Y6H8	Salmonella_phage	49.2	9.4e-21
WP_004152169.1|1656923_1657454_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	77.1	2.7e-79
WP_004146526.1|1657456_1657705_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152167.1|1658110_1658893_-	antitermination protein	NA	F1C595	Cronobacter_phage	76.8	7.2e-113
WP_004198239.1|1658889_1659366_-	hypothetical protein	NA	A0A286N2Q1	Klebsiella_phage	100.0	1.8e-90
WP_004198233.1|1659362_1660325_-	zinc-binding domain of primase-helicase family protein	NA	A0A286N2Q0	Klebsiella_phage	99.4	4.8e-183
WP_004198228.1|1660326_1661985_-	DEAD/DEAH box helicase	NA	A0A286N2P9	Klebsiella_phage	96.0	0.0e+00
WP_004152162.1|1662561_1662783_-	helix-turn-helix transcriptional regulator	NA	A0A286S2C1	Klebsiella_phage	100.0	3.0e-32
WP_004152161.1|1662880_1663549_+	LexA family transcriptional regulator	NA	A0A286S2B2	Klebsiella_phage	99.5	2.4e-125
WP_004152160.1|1663719_1664034_+	hypothetical protein	NA	A0A286S1T9	Klebsiella_phage	100.0	1.0e-49
WP_004152159.1|1664026_1664215_+	hypothetical protein	NA	A0A286S1P8	Klebsiella_phage	100.0	4.6e-26
WP_004152158.1|1664384_1664750_+	hypothetical protein	NA	A0A286S1Q6	Klebsiella_phage	99.2	6.9e-58
WP_004152157.1|1664742_1664997_+	hypothetical protein	NA	A0A286SGR4	Klebsiella_phage	97.6	3.1e-41
WP_004177208.1|1664968_1665187_+	hypothetical protein	NA	A0A286S1P6	Klebsiella_phage	98.6	6.6e-32
WP_004152156.1|1665183_1665609_+	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	77.9	3.5e-53
WP_004152155.1|1665605_1665800_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152154.1|1665796_1666624_+	hypothetical protein	NA	Q8W654	Enterobacteria_phage	84.0	5.5e-111
WP_004152153.1|1666728_1667247_+	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	98.8	1.7e-94
WP_004154298.1|1667252_1667963_+	DNA-binding protein	NA	A0A286S260	Klebsiella_phage	88.3	2.1e-111
WP_004152151.1|1667952_1668177_+	hypothetical protein	NA	A0A286S2B3	Klebsiella_phage	89.2	3.1e-29
WP_004152150.1|1668173_1668386_+	hypothetical protein	NA	A0A286S2B6	Klebsiella_phage	98.6	3.4e-33
WP_004152149.1|1668382_1668862_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152148.1|1669040_1669283_+	hypothetical protein	NA	A0A0M4RTZ2	Salmonella_phage	73.8	2.2e-20
WP_004152147.1|1669263_1670445_-|integrase	site-specific integrase	integrase	A0A0M4QX09	Salmonella_phage	84.2	5.6e-202
WP_016197745.1|1670641_1671190_+	DJ-1/PfpI family protein	NA	NA	NA	NA	NA
WP_004152145.1|1671388_1672921_-	HD domain-containing protein	NA	A0A1B1ISR1	uncultured_Mediterranean_phage	30.0	1.1e-21
WP_004152144.1|1673137_1673899_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.5	2.4e-20
WP_004152143.1|1674007_1674922_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004176439.1|1675222_1675411_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152142.1|1675481_1675790_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_004152141.1|1675957_1676827_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	42.1	5.7e-50
WP_004218007.1|1676905_1678108_-	MFS transporter	NA	NA	NA	NA	NA
WP_004152139.1|1678180_1679317_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_004152138.1|1679489_1680374_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004152137.1|1680498_1681332_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152136.1|1681562_1681949_+	glyoxalase/bleomycin resistance/dioxygenase family protein	NA	NA	NA	NA	NA
WP_004152135.1|1682116_1683733_-	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004152134.1|1683918_1684626_+	murein tripeptide amidase MpaA	NA	NA	NA	NA	NA
WP_004152133.1|1684622_1685588_-	L-Ala-D/L-Glu epimerase	NA	NA	NA	NA	NA
WP_004152131.1|1685690_1686197_+	thiol peroxidase	NA	NA	NA	NA	NA
WP_085666574.1|1686267_1687290_-	AbrB family transcriptional regulator	NA	NA	NA	NA	NA
WP_002901979.1|1687421_1688963_-	transcriptional regulator TyrR	NA	NA	NA	NA	NA
WP_002901977.1|1689135_1690449_-	6-phospho-beta-glucosidase	NA	NA	NA	NA	NA
WP_071531198.1|1690580_1691462_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004152127.1|1691551_1692613_-	TIGR01620 family protein	NA	NA	NA	NA	NA
WP_002901917.1|1692609_1694007_-	YcjX family protein	NA	NA	NA	NA	NA
WP_002901915.1|1694109_1694328_-	phage shock protein PspD	NA	NA	NA	NA	NA
WP_002901913.1|1694356_1694716_-	envelope stress response membrane protein PspC	NA	NA	NA	NA	NA
WP_002901911.1|1694715_1694940_-	envelope stress response membrane protein PspB	NA	NA	NA	NA	NA
WP_002901908.1|1694995_1695664_-	phage shock protein PspA	NA	NA	NA	NA	NA
WP_002901905.1|1695831_1696806_+	phage shock protein operon transcriptional activator	NA	NA	NA	NA	NA
WP_002901901.1|1696796_1698188_-	MFS transporter	NA	NA	NA	NA	NA
WP_002901900.1|1698213_1699383_-	amidohydrolase	NA	NA	NA	NA	NA
WP_004152126.1|1699554_1701864_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_004171423.1|1701842_1702673_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_004152124.1|1702783_1703689_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_002901817.1|1704022_1705666_+	peptide ABC transporter substrate-binding protein SapA	NA	NA	NA	NA	NA
WP_002901816.1|1705662_1706628_+	peptide ABC transporter permease SapB	NA	NA	NA	NA	NA
WP_002901815.1|1706832_1707504_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	59.6	4.5e-79
WP_071531199.1|1707690_1708518_+	FRG domain-containing protein	NA	A0A1S6KZX9	Salmonella_phage	30.2	8.4e-19
WP_002901813.1|1708593_1709859_-	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	82.7	9.6e-208
WP_002901812.1|1709860_1710280_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	57.5	1.4e-35
WP_004152765.1|1710359_1711844_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_004152765.1|1712269_1713754_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_004152776.1|1714651_1715074_-	hypothetical protein	NA	K7P834	Enterobacteria_phage	45.3	3.6e-26
WP_001067855.1|1715666_1716371_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001389365.1|1716547_1717312_-|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_004152787.1|1717695_1717836_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000376623.1|1717818_1718319_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000259031.1|1718446_1719286_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	NA	NA	NA	NA
WP_000679427.1|1719279_1719627_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_001261740.1|1719790_1720582_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
WP_015057121.1|1720727_1721687_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	40.5	1.7e-47
WP_001067855.1|1721577_1722282_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_081541247.1|1722340_1722745_+	regulator	NA	M9NYX4	Enterobacteria_phage	78.9	2.6e-58
WP_004151899.1|1722741_1723404_+	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	84.6	2.7e-105
WP_004153574.1|1723611_1724799_-|integrase	site-specific integrase	integrase	K7PGY1	Enterobacteria_phage	52.4	1.1e-120
WP_004151901.1|1724975_1725866_+	peptide ABC transporter permease SapC	NA	NA	NA	NA	NA
WP_004140266.1|1725865_1726858_+	peptide ABC transporter ATP-binding protein SapD	NA	G9BWD6	Planktothrix_phage	27.2	3.0e-07
WP_004140269.1|1726859_1727669_+	peptide ABC transporter ATP-binding protein SapF	NA	A0A2H4PQG7	Staphylococcus_phage	28.9	2.1e-14
1736109:1736126	attR	ATCTTTCACCGCGCCGCC	NA	NA	NA	NA
>prophage 4
NZ_CP024521	Klebsiella pneumoniae strain INF158 chromosome, complete genome	5297118	2104903	2199515	5297118	transposase,plate,integrase,tail,head,terminase,lysis,protease,portal,capsid,tRNA	Salmonella_phage(57.63%)	94	2162090:2162108	2199590:2199608
WP_002898139.1|2104903_2106196_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	44.7	7.3e-94
WP_002898137.1|2106286_2107630_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.8	7.3e-81
WP_002898132.1|2107638_2108250_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_004150846.1|2108372_2112626_-	DNA translocase FtsK	NA	S5VNE3	Mycobacterium_phage	49.2	5.2e-88
WP_000228469.1|2112761_2113256_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_004141839.1|2113761_2114757_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.0	3.3e-62
WP_002898017.1|2114871_2116638_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	25.9	2.3e-21
WP_004150847.1|2116638_2118360_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	34.3	1.5e-14
WP_002898014.1|2118404_2119106_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|2119459_2119678_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_002896522.1|2119798_2122078_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
WP_002896520.1|2122108_2122426_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
WP_002896516.1|2122751_2122973_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
WP_004150848.1|2123049_2124990_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.5	1.9e-37
WP_002896440.1|2124986_2126102_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
WP_000608644.1|2126404_2127667_-|transposase	IS1380-like element ISEc9 family transposase	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
WP_002896437.1|2127909_2129568_-	ATP-dependent endonuclease	NA	NA	NA	NA	NA
WP_002896434.1|2129987_2130683_+	aquaporin Z	NA	NA	NA	NA	NA
WP_004147773.1|2130798_2131698_+	lysine exporter LysO family protein	NA	NA	NA	NA	NA
WP_002896412.1|2131841_2133494_+	hydroxylamine reductase	NA	NA	NA	NA	NA
WP_002896410.1|2133504_2134473_+	NADH oxidoreductase	NA	NA	NA	NA	NA
WP_002896408.1|2134684_2135119_-	DoxX family protein	NA	NA	NA	NA	NA
WP_002896406.1|2135270_2136989_+	ubiquinone-dependent pyruvate dehydrogenase	NA	NA	NA	NA	NA
WP_002896404.1|2137027_2138029_+	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_002896401.1|2138039_2139482_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_002896399.1|2139569_2140583_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_002896397.1|2140579_2141410_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	31.6	4.1e-05
WP_004150851.1|2141441_2142581_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_002896394.1|2143458_2143974_+	lipoprotein	NA	NA	NA	NA	NA
WP_002896392.1|2144200_2144929_+	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	37.1	1.2e-29
WP_002896390.1|2144949_2145681_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002896386.1|2145687_2146404_+	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
WP_004150852.1|2146403_2147072_+	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
WP_002896384.1|2147255_2147987_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002896382.1|2148029_2149502_-	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	31.8	7.9e-28
WP_002896380.1|2149498_2150215_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.9	2.1e-34
WP_002896378.1|2150293_2151421_-	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A2K5B251	Erysipelothrix_phage	25.6	1.3e-19
WP_002896376.1|2151462_2151951_-	DUF2593 family protein	NA	NA	NA	NA	NA
WP_002896372.1|2152008_2152854_-	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_002896371.1|2152850_2153804_-	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_002896370.1|2153814_2154948_-	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.9	2.2e-30
WP_002896368.1|2155111_2156224_-	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_002896365.1|2156572_2157052_-	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_002896363.1|2157140_2158043_-	30S ribosomal protein S6--L-glutamate ligase	NA	A0A1D7SR78	Cyanophage	35.3	2.0e-34
WP_002896354.1|2158864_2159152_-	YbjC family protein	NA	NA	NA	NA	NA
WP_002896352.1|2159354_2159618_+	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	73.1	1.6e-27
WP_002896351.1|2159624_2160008_-	membrane protein	NA	NA	NA	NA	NA
WP_004179131.1|2160274_2161960_+	aspartate:alanine antiporter	NA	NA	NA	NA	NA
2162090:2162108	attL	ATGGGTTTTTTGTTGCCTG	NA	NA	NA	NA
WP_000972391.1|2162179_2162398_-	transcriptional activator Ogr/delta	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
WP_002896225.1|2162489_2163590_-	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	87.4	4.9e-176
WP_002896224.1|2163586_2164072_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	75.6	7.2e-63
WP_002896222.1|2164068_2166696_-|tail	phage tail tape measure protein	tail	E5FFG5	Burkholderia_phage	42.0	5.6e-117
WP_002896220.1|2166688_2166808_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.2e-13
WP_002896204.1|2166822_2167122_-|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	79.0	3.7e-33
WP_002896201.1|2167174_2167690_-|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	85.4	1.3e-81
WP_002896193.1|2167699_2168872_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	93.3	1.9e-210
WP_002896191.1|2169010_2170087_-|tail	phage tail protein	tail	Q37842	Escherichia_phage	44.8	1.2e-25
WP_002896188.1|2170116_2170320_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002896186.1|2170316_2171048_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152882.1|2171051_2174003_-	hypothetical protein	NA	A0A2H4N7A3	Pectobacterium_phage	50.9	1.2e-06
WP_004150856.1|2174004_2174604_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	60.5	1.3e-58
WP_002896182.1|2174596_2175505_-|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	66.9	7.6e-106
WP_002896179.1|2175491_2175854_-|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	84.7	5.8e-49
WP_002896177.1|2175850_2176423_-|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	72.3	4.7e-77
WP_004150857.1|2176517_2177210_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002896175.1|2177206_2177653_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	71.2	2.2e-50
WP_002896172.1|2177645_2178077_-|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	82.5	9.9e-64
WP_002896168.1|2178172_2178601_-|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	77.9	9.6e-51
WP_002896163.1|2178597_2178981_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	42.0	2.1e-17
WP_002896161.1|2178985_2179495_-	lysozyme	NA	E5G6N1	Salmonella_phage	83.4	2.1e-81
WP_002896158.1|2179475_2179691_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	90.1	3.6e-30
WP_002896155.1|2179694_2179898_-|tail	tail protein X	tail	A0A1S6KZY4	Salmonella_phage	88.1	1.3e-29
WP_002896151.1|2179897_2180362_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.0	8.4e-77
WP_000059191.1|2180457_2181108_-|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	96.3	8.7e-112
WP_002895972.1|2181111_2182170_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.1	1.1e-180
WP_002895967.1|2182186_2183020_-|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	88.8	6.3e-123
WP_004150858.1|2183162_2184929_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.0	0.0e+00
WP_002895959.1|2184928_2185954_+|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	86.7	7.6e-171
WP_004199124.1|2186015_2187758_-	AIPR family protein	NA	NA	NA	NA	NA
WP_000700647.1|2188033_2188711_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001217575.1|2188825_2189059_-	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
WP_001154434.1|2189069_2189258_-	hypothetical protein	NA	E5G6M0	Salmonella_phage	98.4	5.5e-27
WP_004150862.1|2189411_2191826_-	replication endonuclease	NA	E5G6L9	Salmonella_phage	97.5	0.0e+00
WP_004150863.1|2191822_2192680_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	95.4	2.0e-156
WP_000752622.1|2192676_2192904_-	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	98.7	6.0e-36
WP_004150864.1|2192903_2193137_-	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	96.1	4.1e-32
WP_000963473.1|2193204_2193546_-	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	99.1	4.6e-56
WP_000956179.1|2193509_2193710_-	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	97.0	1.6e-32
WP_000460893.1|2193717_2194227_-	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	98.8	5.8e-87
WP_000188448.1|2194259_2194481_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152885.1|2194626_2195505_+	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	39.9	1.7e-30
WP_004150866.1|2195516_2196461_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152765.1|2196559_2198044_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_004151720.1|2198462_2199515_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	57.0	1.0e-106
2199590:2199608	attR	ATGGGTTTTTTGTTGCCTG	NA	NA	NA	NA
>prophage 5
NZ_CP024521	Klebsiella pneumoniae strain INF158 chromosome, complete genome	5297118	2851769	2863423	5297118	integrase	Enterobacteria_phage(70.0%)	13	2852219:2852233	2875276:2875290
WP_004144574.1|2851769_2852873_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.5	4.8e-62
2852219:2852233	attL	CAATCTCTCCGCGCT	NA	NA	NA	NA
WP_002889940.1|2852883_2854137_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	44.9	8.9e-89
WP_002889938.1|2854489_2855680_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	62.7	6.4e-145
WP_004152029.1|2855667_2856618_+	cobyrinic acid a,c-diamide synthase	NA	A0A1X9IGI7	Lactococcus_phage	27.1	1.2e-13
WP_004152979.1|2856617_2857043_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002889930.1|2857611_2858178_-	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	64.3	1.5e-59
WP_002889919.1|2858195_2858441_-	hypothetical protein	NA	Q7M294	Enterobacteria_phage	58.0	1.9e-19
WP_002889917.1|2858437_2859175_-	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	60.7	9.0e-73
WP_002889915.1|2859716_2859983_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	71.6	2.6e-30
WP_024940872.1|2859979_2860537_+	ash family protein	NA	Q7M2A7	Enterobacteria_phage	70.4	1.8e-33
WP_002889911.1|2860533_2860761_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002889897.1|2860757_2861078_+	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_002889890.1|2861089_2863423_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	82.2	0.0e+00
2875276:2875290	attR	CAATCTCTCCGCGCT	NA	NA	NA	NA
>prophage 6
NZ_CP024521	Klebsiella pneumoniae strain INF158 chromosome, complete genome	5297118	4421352	4493342	5297118	transposase,integrase,tail,head,terminase,protease,portal,capsid,tRNA	uncultured_Caudovirales_phage(55.0%)	72	4438960:4438977	4456261:4456278
WP_002919147.1|4421352_4422300_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	37.2	2.2e-07
WP_002919144.1|4422314_4422824_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	40.3	2.6e-18
WP_002919139.1|4422952_4424077_+	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_002919137.1|4424048_4424522_+	DUF494 domain-containing protein	NA	NA	NA	NA	NA
WP_004145330.1|4424547_4425090_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002919132.1|4425094_4425667_+	L-threonylcarbamoyladenylate synthase type 1 TsaC	NA	NA	NA	NA	NA
WP_002919126.1|4425670_4426489_+	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_002919125.1|4426485_4426743_+	DUF1488 domain-containing protein	NA	NA	NA	NA	NA
WP_002919123.1|4426718_4427273_-	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_002919103.1|4433068_4433290_-	membrane protein	NA	NA	NA	NA	NA
WP_002919102.1|4433583_4436694_-	multidrug efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_002919101.1|4436706_4437846_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_004150972.1|4438224_4438875_+	acrEF/envCD operon transcriptional regulator	NA	NA	NA	NA	NA
4438960:4438977	attL	GTATCAGTTCATGCCGTA	NA	NA	NA	NA
WP_004150971.1|4439150_4440377_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	62.2	1.8e-150
WP_004150970.1|4440469_4441411_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099595205.1|4441592_4441850_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_085955245.1|4441852_4443045_-|transposase	IS3-like element ISKpn18 family transposase	transposase	U5P429	Shigella_phage	43.5	3.5e-50
WP_004150969.1|4443193_4443973_+	hypothetical protein	NA	Q8HA02	Enterobacteria_phage	51.5	6.2e-40
WP_106918304.1|4444424_4444694_+	host cell division inhibitor Icd-like protein	NA	A0A2H4JGW3	uncultured_Caudovirales_phage	94.4	2.4e-44
WP_001549752.1|4444686_4444875_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150967.1|4444867_4445182_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150966.1|4445178_4445547_+	hypothetical protein	NA	A0A2H4JCX7	uncultured_Caudovirales_phage	81.1	3.7e-51
WP_001549749.1|4445543_4445909_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150965.1|4445908_4448044_+	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	62.4	3.4e-205
WP_004150964.1|4448386_4448722_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150963.1|4448770_4449283_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001549743.1|4449546_4450713_+|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	95.9	9.8e-207
WP_001547826.1|4450764_4451325_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	95.7	1.2e-98
WP_004150962.1|4451326_4452568_+|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	96.5	1.0e-230
WP_004150961.1|4452564_4452900_+|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	57.8	3.7e-26
WP_001547824.1|4452896_4453196_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4JD08	uncultured_Caudovirales_phage	80.8	3.4e-39
WP_004150959.1|4453195_4453639_+	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	91.8	2.8e-77
WP_000113647.1|4453914_4454271_+|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	99.2	5.5e-60
WP_004150955.1|4454254_4455916_+|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	98.0	0.0e+00
WP_004150954.1|4455918_4456110_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000462905.1|4456263_4456560_-	DNA-binding transcriptional regulator Fis	NA	NA	NA	NA	NA
4456261:4456278	attR	GTATCAGTTCATGCCGTA	NA	NA	NA	NA
WP_004144972.1|4456584_4457550_-|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_002918745.1|4457907_4458789_-	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
WP_002918742.1|4458800_4460252_-	sodium/pantothenate symporter	NA	NA	NA	NA	NA
WP_002918740.1|4460241_4460484_-	YhdT family protein	NA	NA	NA	NA	NA
WP_002918738.1|4460594_4461944_-	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_002918736.1|4461954_4462422_-	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
WP_002918732.1|4462444_4462897_-	type II 3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
WP_002918689.1|4463120_4463729_-	protein-methionine-sulfoxide reductase heme-binding subunit MsrQ	NA	NA	NA	NA	NA
WP_002918688.1|4463728_4464730_-	protein-methionine-sulfoxide reductase catalytic subunit MsrP	NA	NA	NA	NA	NA
WP_002918687.1|4464958_4465150_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085955245.1|4465484_4466676_+|transposase	IS3-like element ISKpn18 family transposase	transposase	U5P429	Shigella_phage	43.5	3.5e-50
WP_002918653.1|4468781_4469825_+	rod shape-determining protein	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
WP_004149974.1|4469895_4470888_+	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_002918648.1|4470887_4471376_+	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_002918646.1|4471383_4471965_+	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_002918644.1|4471967_4473437_+	ribonuclease G	NA	NA	NA	NA	NA
WP_004150952.1|4473474_4477272_+	AsmA2 domain-containing protein	NA	NA	NA	NA	NA
WP_002918642.1|4477360_4478806_+|protease	metalloprotease TldD	protease	NA	NA	NA	NA
WP_002918641.1|4478841_4479771_-	HTH-type transcriptional activator AaeR	NA	NA	NA	NA	NA
WP_002918640.1|4479902_4480106_+	AaeX family protein	NA	NA	NA	NA	NA
WP_002918639.1|4480113_4481046_+	p-hydroxybenzoic acid efflux pump subunit AaeA	NA	NA	NA	NA	NA
WP_002918632.1|4481051_4483019_+	p-hydroxybenzoic acid efflux pump subunit AaeB	NA	NA	NA	NA	NA
WP_002918629.1|4483098_4483374_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002918627.1|4483424_4483691_-	peroxide/acid stress response protein YhcN	NA	NA	NA	NA	NA
WP_002918626.1|4483789_4484053_-	peroxide/acid stress response protein YhcN	NA	NA	NA	NA	NA
WP_002918625.1|4484428_4484899_-	transcriptional regulator ArgR	NA	NA	NA	NA	NA
WP_002918570.1|4485313_4486252_+	malate dehydrogenase	NA	NA	NA	NA	NA
WP_002918568.1|4486388_4487447_-	outer membrane-stress sensor serine endopeptidase DegS	NA	NA	NA	NA	NA
WP_002918566.1|4487534_4488902_-|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	25.3	6.0e-22
WP_002918565.1|4489075_4489474_-	DUF1043 family protein	NA	NA	NA	NA	NA
WP_004144945.1|4489664_4490792_+	cell division protein ZapE	NA	NA	NA	NA	NA
WP_002918559.1|4491057_4491486_+	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_000829818.1|4491501_4491894_+	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_135801240.1|4491951_4492236_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002918467.1|4492205_4492844_+	stringent starvation protein A	NA	NA	NA	NA	NA
WP_002918465.1|4492847_4493342_+|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	54.8	1.5e-26
>prophage 1
NZ_CP024522	Klebsiella pneumoniae strain INF158 plasmid unnamed1, complete sequence	221606	24187	50033	221606	transposase	Escherichia_phage(38.46%)	33	NA	NA
WP_125551036.1|24187_24884_+|transposase	IS1 family transposase	transposase	A0A077SLN4	Escherichia_phage	98.7	4.7e-132
WP_000056203.1|25024_25243_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001909178.1|25612_25999_+	type IV secretion system protein	NA	NA	NA	NA	NA
WP_019706045.1|26072_26894_+	TrbG/VirB9 family P-type conjugative transfer protein	NA	NA	NA	NA	NA
WP_000101710.1|26893_28054_+	TrbI/VirB10 family protein	NA	NA	NA	NA	NA
WP_000128596.1|28095_29091_+	Flp pilus assembly complex ATPase component	NA	NA	NA	NA	NA
WP_000792636.1|29090_29624_+	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	33.9	5.8e-21
WP_002210549.1|30595_30937_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	7.3e-62
WP_001067855.1|30973_31678_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001044210.1|31683_31824_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001366550.1|32309_33047_+	recombinase family protein	NA	NA	NA	NA	NA
WP_000743213.1|33043_33268_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000338945.1|33366_33678_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001151304.1|33851_34637_+	ParA family protein	NA	A0A1X9IGI7	Lactococcus_phage	26.4	6.1e-11
WP_001207227.1|34640_35822_+	ParB/RepB/Spo0J family partition protein	NA	I3NLC2	Bifidobacterium_phage	28.7	2.4e-11
WP_000703827.1|35870_36143_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_099595285.1|36878_38378_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	26.7	1.5e-10
WP_099595287.1|38364_39105_+	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	36.9	2.7e-32
WP_000939033.1|39325_39469_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001125905.1|39787_40165_+	hypothetical protein	NA	A0A2H4P7P5	Pseudomonas_phage	49.6	2.2e-22
WP_000044824.1|40157_40439_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000344151.1|40413_41088_+	thymidylate kinase	NA	NA	NA	NA	NA
WP_005507681.1|41155_41587_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099595289.1|41571_41895_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085955245.1|41897_43090_-|transposase	IS3-like element ISKpn18 family transposase	transposase	U5P429	Shigella_phage	43.5	3.5e-50
WP_000647189.1|43218_43719_+	hypothetical protein	NA	I3UMJ0	Colwellia_phage	43.3	1.7e-19
WP_000936896.1|43722_45150_+	DNA cytosine methyltransferase	NA	NA	NA	NA	NA
WP_000268551.1|45149_45806_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000362482.1|46011_46230_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000464631.1|46323_46941_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000542259.1|47152_47452_+	hypothetical protein	NA	A0A0K1LLW2	Caulobacter_phage	55.4	2.1e-20
WP_000468105.1|47543_48032_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085955245.1|48841_50033_+|transposase	IS3-like element ISKpn18 family transposase	transposase	U5P429	Shigella_phage	43.5	3.5e-50
>prophage 2
NZ_CP024522	Klebsiella pneumoniae strain INF158 plasmid unnamed1, complete sequence	221606	111477	132108	221606	transposase,integrase	Salmonella_phage(33.33%)	18	114743:114756	131371:131384
WP_099595296.1|111477_112551_+|transposase	IS481-like element ISKpn28 family transposase	transposase	NA	NA	NA	NA
WP_001337692.1|112558_112960_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000988732.1|113073_113799_+	hypothetical protein	NA	NA	NA	NA	NA
114743:114756	attL	ATCACATCACCCTG	NA	NA	NA	NA
WP_000427620.1|117645_118650_-|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_099595303.1|118728_121701_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.0	0.0e+00
WP_001162012.1|121703_122261_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	81.3	5.8e-48
WP_002075255.1|122566_123580_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	6.1e-72
WP_015060105.1|123732_124473_+	subclass B1 metallo-beta-lactamase IMP-4	NA	NA	NA	NA	NA
WP_015063357.1|124704_125037_+	quaternary ammonium compound efflux SMR transporter QacG2	NA	NA	NA	NA	NA
WP_003159191.1|125163_125718_+	aminoglycoside N-acetyltransferase AAC(6')-Ib4	NA	NA	NA	NA	NA
WP_000186237.1|125812_126445_+	type B-3 chloramphenicol O-acetyltransferase CatB3	NA	A0A2R8FE91	Brazilian_cedratvirus	41.2	4.1e-26
WP_000679427.1|126601_126949_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259031.1|126942_127782_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_004883563.1|127909_128182_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040120329.1|128363_129368_-|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_000184001.1|129595_130801_+	chromate efflux transporter	NA	NA	NA	NA	NA
WP_000130000.1|130811_131117_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001389365.1|131343_132108_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
131371:131384	attR	CAGGGTGATGTGAT	NA	NA	NA	NA
>prophage 3
NZ_CP024522	Klebsiella pneumoniae strain INF158 plasmid unnamed1, complete sequence	221606	135446	189343	221606	transposase,integrase	Escherichia_phage(28.57%)	57	136215:136274	195227:195363
WP_001067855.1|135446_136151_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
136215:136274	attL	GTTTACTCATATATACTTTAGATTGATTTAAAACTTCATTTTTAATTTAAAAGGATCTAG	NA	NA	NA	NA
WP_000557454.1|136383_137244_+	aminoglycoside N-acetyltransferase AAC(3)-IId	NA	NA	NA	NA	NA
WP_000587837.1|137256_137799_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_000951934.1|138280_138472_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001330846.1|138477_138723_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000080861.1|138773_139910_+	DUF3883 domain-containing protein	NA	NA	NA	NA	NA
WP_000971921.1|140024_141395_+|transposase	IS1182-like element ISCfr1 family transposase	transposase	NA	NA	NA	NA
WP_099595305.1|143368_143764_+	hypothetical protein	NA	NA	NA	NA	NA
WP_125551038.1|143760_144198_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099595307.1|144194_144707_+	trimethoprim-resistant dihydrofolate reductase DfrA35	NA	A0A076GDN3	Bacillus_phage	41.2	4.4e-26
WP_000259031.1|145058_145898_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_004883563.1|146025_146298_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022652300.1|146479_147433_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_022652302.1|148053_148764_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.7	3.7e-31
WP_022652303.1|148765_149971_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_022652304.1|149967_151119_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_004393990.1|151115_151724_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_032430842.1|151911_152865_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_000493286.1|153283_153613_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A088CBP5	Shigella_phage	44.2	2.4e-09
WP_000780222.1|153593_153875_+	helix-turn-helix transcriptional regulator	NA	A0A2I6TC97	Escherichia_phage	38.0	1.3e-08
WP_016947617.1|154152_155133_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.8	6.8e-185
WP_087893729.1|155438_156712_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	81.7	2.8e-146
WP_001752509.1|156785_157286_-	non-heme ferritin-like protein	NA	NA	NA	NA	NA
WP_001067855.1|157612_158317_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000935452.1|158363_159668_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_000204520.1|159706_160414_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_000993386.1|160410_160647_-	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_001277456.1|160643_161006_-	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_000105636.1|161023_162718_-	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.6	8.8e-39
WP_001447540.1|162769_163192_-	organomercurial transporter MerC	NA	NA	NA	NA	NA
WP_000732292.1|163227_163503_-	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_001294663.1|163516_163867_-	mercuric transport protein MerT	NA	NA	NA	NA	NA
WP_000429836.1|163938_164373_+	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_047359309.1|164451_165456_+|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_099595309.1|166264_166516_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099595311.1|167196_167454_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043006371.1|168028_168313_+	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	NA	NA	NA	NA
WP_008652077.1|168337_168847_+	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_034053978.1|168932_169421_+	redoxin domain-containing protein	NA	NA	NA	NA	NA
WP_074423286.1|169425_170958_+	YdiU family protein	NA	A0A075BSJ0	Microcystis_phage	32.6	4.1e-51
WP_034054008.1|171525_171966_+	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_004099020.1|173425_173797_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000844627.1|175410_175653_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_000470728.1|175684_176362_-	tetracycline resistance transcriptional repressor TetR(A)	NA	NA	NA	NA	NA
WP_000804064.1|176440_177640_+	tetracycline efflux MFS transporter Tet(A)	NA	NA	NA	NA	NA
WP_000427620.1|178243_179248_-|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_000414383.1|179347_179782_-	mercury resistance transcriptional regulator MerR	NA	NA	NA	NA	NA
WP_001294666.1|179853_180204_+	mercuric transport protein MerT	NA	NA	NA	NA	NA
WP_000732290.1|180219_180495_+	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_000149288.1|180566_182252_+	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.9	1.1e-38
WP_000761850.1|182266_182905_+	organomercurial lyase MerB	NA	NA	NA	NA	NA
WP_000995361.1|183016_183382_+	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_001087810.1|183378_183615_+	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_001276635.1|183611_184601_+	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_053821786.1|184730_185291_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	87.9	1.3e-50
WP_053821785.1|185293_188260_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.2	0.0e+00
WP_000427620.1|188338_189343_+|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
195227:195363	attR	CTAGATCCTTTTAAATTAAAAATGAAGTTTTAAATCAATCTAAAGTATATATGAGTAAACTTGGTCTGACAGTTACCAATGCTTAATCAGTGAGGCACCTATCTCAGCGATCTGTCTATTTCGTTCATCCATAGTTG	NA	NA	NA	NA
>prophage 1
NZ_CP024523	Klebsiella pneumoniae strain INF158 plasmid unnamed2, complete sequence	147932	1727	64517	147932	transposase,integrase,protease	uncultured_Caudovirales_phage(27.78%)	59	NA	NA
WP_001515717.1|1727_2468_-|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	58.6	5.4e-25
WP_004152065.1|3611_4559_+	sensor domain-containing diguanylate cyclase	NA	G3MA91	Bacillus_virus	30.6	1.8e-12
WP_071527918.1|4585_4897_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_004152067.1|4961_5885_+|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	98.4	2.1e-175
WP_004197688.1|6557_6815_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020444838.1|7416_8871_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_004152070.1|9853_11131_-	DUF2254 domain-containing protein	NA	NA	NA	NA	NA
WP_004178088.1|11193_13191_-	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	25.9	9.7e-21
WP_085955172.1|14230_15438_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	63.2	1.7e-100
WP_004178091.1|16866_17298_-	silver-binding protein SilE	NA	NA	NA	NA	NA
WP_003032875.1|17548_19024_-	copper/silver sensor histidine kinase SilS	NA	W8CYF6	Bacillus_phage	30.1	1.0e-27
WP_001572351.1|19016_19697_-	copper/silver response regulator transcription factor SilR	NA	W8CYM9	Bacillus_phage	35.6	2.1e-31
WP_000475512.1|19886_21272_+	Cu(+)/Ag(+) efflux RND transporter outer membrane channel SilC	NA	NA	NA	NA	NA
WP_001246153.1|21300_21654_+	cation efflux system protein CusF	NA	NA	NA	NA	NA
WP_004152079.1|21767_23060_+	Cu(+)/Ag(+) efflux RND transporter periplasmic adaptor subunit SilB	NA	NA	NA	NA	NA
WP_004098958.1|23070_26217_+	Cu(+)/Ag(+) efflux RND transporter permease subunit SilA	NA	S5VTK5	Leptospira_phage	22.5	4.0e-61
WP_000758228.1|26303_26744_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004098955.1|26870_29318_+	Ag(+)-translocating P-type ATPase SilP	NA	A0A218MNH6	uncultured_virus	35.8	7.6e-84
WP_000843497.1|29358_29556_+	DUF2933 domain-containing protein	NA	NA	NA	NA	NA
WP_004118669.1|29589_30327_-	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A2H4JAF5	uncultured_Caudovirales_phage	32.5	1.2e-11
WP_001023257.1|30615_31065_-	copper resistance protein	NA	NA	NA	NA	NA
WP_000925242.1|31298_33116_+	multicopper oxidase PcoA	NA	NA	NA	NA	NA
WP_001242438.1|33115_34012_+	copper resistance outer membrane transporter PcoB	NA	NA	NA	NA	NA
WP_000025662.1|34051_34432_+	copper resistance system metallochaperone PcoC	NA	NA	NA	NA	NA
WP_004118344.1|34436_35366_+	copper resistance inner membrane protein PcoD	NA	NA	NA	NA	NA
WP_001188930.1|35420_36101_+	copper response regulator transcription factor PcoR	NA	W8CYM9	Bacillus_phage	34.4	8.7e-30
WP_004152084.1|36097_37498_+	copper resistance membrane spanning protein PcoS	NA	W8CYF6	Bacillus_phage	26.3	4.1e-18
WP_004152085.1|37714_38149_+	copper resistance system metallochaperone PcoE	NA	NA	NA	NA	NA
WP_004152086.1|38380_38560_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_031944101.1|40302_40812_+	major intrinsic protein MIP	NA	NA	NA	NA	NA
WP_004152091.1|40861_41359_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_004152092.1|41690_42017_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_085903505.1|42016_42727_+	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	77.0	2.9e-92
WP_004182005.1|42735_43281_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_004152095.1|43356_43719_+	arsenic metallochaperone ArsD family protein	NA	NA	NA	NA	NA
WP_004152096.1|45615_46152_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_004152097.1|46184_46610_-	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	72.9	2.3e-52
WP_004152098.1|46622_47912_-	arsenite efflux transporter membrane subunit ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	74.0	1.9e-171
WP_004152099.1|47959_49711_-	arsenite efflux transporter ATPase subunit ArsA	NA	NA	NA	NA	NA
WP_004152100.1|49728_50091_-	arsenite efflux transporter metallochaperone ArsD	NA	NA	NA	NA	NA
WP_004152101.1|50140_50491_-	As(III)-sensing metalloregulatory transcriptional repressor ArsR	NA	A0A2H4J145	uncultured_Caudovirales_phage	50.9	1.4e-23
WP_004152102.1|50848_51118_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152103.1|51105_51681_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152104.1|51711_52206_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_004152105.1|52249_52618_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152106.1|52651_52855_+	hemolysin expression modulator Hha	NA	NA	NA	NA	NA
WP_004152107.1|52903_53161_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152108.1|53236_53491_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003026799.1|53666_53933_+	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_003026803.1|53920_54403_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_020314316.1|54614_55961_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_004152113.1|57803_58766_-|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_009483782.1|58752_59502_-	diguanylate cyclase	NA	NA	NA	NA	NA
WP_004152115.1|59739_59937_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152116.1|59936_62732_-	heat shock survival AAA family ATPase ClpK	NA	K4FB40	Cronobacter_phage	41.0	5.2e-129
WP_004152117.1|62846_63416_-	small heat shock protein sHSP20	NA	NA	NA	NA	NA
WP_004152118.1|63450_63732_-	helix-turn-helix domain-containing protein	NA	A0A1B1IUF9	uncultured_Mediterranean_phage	38.2	5.2e-05
WP_004118208.1|63975_64239_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004118209.1|64253_64517_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 1
NZ_CP024524	Klebsiella pneumoniae strain INF158 plasmid unnamed3, complete sequence	89345	6364	67876	89345	transposase	Escherichia_phage(44.83%)	53	NA	NA
WP_000227969.1|6364_7441_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_001067855.1|8153_8858_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000509965.1|9394_10000_+	recombinase family protein	NA	A0A1S5Y2X8	uncultured_archaeal_virus	35.3	9.4e-20
WP_001067855.1|10601_11306_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_063840321.1|11449_12004_+	fluoroquinolone-acetylating aminoglycoside 6'-N-acetyltransferase AAC(6')-Ib-cr5	NA	NA	NA	NA	NA
WP_001334766.1|12134_12965_+	oxacillin-hydrolyzing class D beta-lactamase OXA-1	NA	NA	NA	NA	NA
WP_001067855.1|13596_14301_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000557452.1|14407_15268_+	aminoglycoside N-acetyltransferase AAC(3)-IIa	NA	NA	NA	NA	NA
WP_002063889.1|15280_15823_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_001067855.1|17016_17721_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001067855.1|18998_19703_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000368714.1|20790_21996_+	ParA family protein	NA	A0A077SL49	Escherichia_phage	69.6	2.4e-163
WP_012600007.1|21992_22970_+	ParB/RepB/Spo0J family partition protein	NA	Q38420	Escherichia_phage	54.4	2.6e-88
WP_004118291.1|23051_24323_-	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	63.3	4.9e-151
WP_000776034.1|24322_24754_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	53.3	1.6e-29
WP_004152765.1|25162_26647_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_001776120.1|27116_27548_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001776119.1|27580_28108_-	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	39.5	5.7e-21
WP_001166628.1|28367_28823_-	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_004200999.1|28894_29260_+	mercuric ion transporter MerT	NA	NA	NA	NA	NA
WP_000732275.1|29275_29551_+	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_000522996.1|29578_30004_+	organomercurial transporter MerC	NA	NA	NA	NA	NA
WP_000209296.1|30042_31728_+	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	29.1	1.8e-39
WP_001277466.1|31745_32111_+	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_001087807.1|32107_32344_+	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_050558936.1|32327_32411_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|32479_33184_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_014386481.1|34056_34701_-	quinolone resistance pentapeptide repeat protein QnrB1	NA	NA	NA	NA	NA
WP_087759376.1|39683_40804_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.2	6.0e-52
WP_020324562.1|40901_41606_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	9.9e-138
WP_071549088.1|41630_42143_+	restriction endonuclease	NA	NA	NA	NA	NA
WP_001749967.1|42147_42354_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001288432.1|42735_44169_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	50.6	7.0e-106
WP_004098817.1|44202_45417_-	type II site-specific deoxyribonuclease	NA	E5E3X4	Burkholderia_phage	42.5	1.2e-34
WP_001389365.1|45677_46442_-|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_001144737.1|46584_46851_-	plasmid mobilization relaxosome protein MobC	NA	NA	NA	NA	NA
WP_001067855.1|47385_48090_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_004201232.1|48886_49573_+	NYN domain-containing protein	NA	NA	NA	NA	NA
WP_004201234.1|49710_50448_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004201235.1|50967_52437_-	HNH endonuclease	NA	G0X580	Salmonella_phage	51.3	5.5e-21
WP_001067855.1|52682_53387_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001393253.1|55708_56041_+	cupin fold metalloprotein, WbuC family	NA	NA	NA	NA	NA
WP_000239590.1|56087_56963_-	class A extended-spectrum beta-lactamase CTX-M-15	NA	A0A1B0VBP7	Salmonella_phage	82.4	1.1e-125
WP_000608644.1|57218_58481_-|transposase	IS1380-like element ISEc9 family transposase	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
WP_001235713.1|59044_59602_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	100.0	7.0e-94
WP_000027057.1|59784_60645_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_001120891.1|60854_61394_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000480968.1|61365_62202_-	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_001082319.1|62201_63005_-	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	NA	NA	NA	NA
WP_001043260.1|63065_63881_-	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	5.9e-09
WP_000954592.1|64210_64387_+	DUF4102 domain-containing protein	NA	T1S9J3	Salmonella_phage	68.6	1.0e-06
WP_000427619.1|64568_65573_-|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_001067855.1|67171_67876_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
