The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP024413	Lactiplantibacillus plantarum strain ATCC 8014 chromosome, complete genome	3202808	15166	53448	3202808	portal,terminase,tail,integrase,head,capsid,transposase	Staphylococcus_phage(28.57%)	32	9645:9659	55006:55020
9645:9659	attL	ATTTCCCGGGAAATA	NA	NA	NA	NA
WP_012778279.1|15166_16846_-|transposase	IS1182 family transposase	transposase	A0ZS58	Staphylococcus_virus	41.5	4.7e-93
WP_003641639.1|17162_18386_+	MFS transporter	NA	A0A2H4PQR6	Staphylococcus_phage	33.6	2.4e-54
WP_003643611.1|18407_19205_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	39.2	1.0e-45
WP_012778280.1|19223_20462_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	52.9	6.3e-111
WP_099686930.1|20922_22539_+	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_012778281.1|22869_24774_+	1,4-alpha-glucan branching protein GlgB	NA	NA	NA	NA	NA
WP_003641645.1|24763_25903_+	glucose-1-phosphate adenylyltransferase	NA	NA	NA	NA	NA
WP_003641646.1|25899_27072_+	glucose-1-phosphate adenylyltransferase subunit GlgD	NA	NA	NA	NA	NA
WP_012778282.1|27064_28504_+	glycogen synthase GlgA	NA	NA	NA	NA	NA
WP_003643612.1|28523_30920_+	glycogen/starch/alpha-glucan phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	42.9	1.6e-09
WP_012778283.1|30937_32755_+	glycoside hydrolase family 13 protein	NA	NA	NA	NA	NA
WP_003641650.1|33087_33855_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_003641651.1|34006_34678_-	beta-phosphoglucomutase	NA	NA	NA	NA	NA
WP_011100855.1|34695_37416_-	glycoside hydrolase family 65 protein	NA	NA	NA	NA	NA
WP_003641653.1|37803_38253_-	pyridoxamine 5'-phosphate oxidase family protein	NA	NA	NA	NA	NA
WP_003643615.1|38451_38652_+	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	74.6	2.8e-21
WP_012778285.1|38743_38974_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012778286.1|39442_40597_-|integrase	site-specific integrase	integrase	A0A172LN96	Lactococcus_phage	36.5	5.2e-59
WP_012778287.1|40675_41320_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_015640734.1|41468_41648_+	helix-turn-helix domain-containing protein	NA	E9LUT5	Lactobacillus_phage	87.9	4.3e-21
WP_012778290.1|41915_42146_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012778291.1|42159_42960_+	bifunctional DNA primase/polymerase	NA	NA	NA	NA	NA
WP_012778292.1|42959_44354_+	virulence protein	NA	Q4ZD27	Staphylococcus_phage	35.9	3.2e-71
WP_003645297.1|44497_44917_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012778293.1|44941_45124_+	sporulation protein Cse60	NA	NA	NA	NA	NA
WP_012778294.1|45133_45472_+|head	phage head closure protein	head	A0A2P0ZLF0	Lactobacillus_phage	36.6	1.4e-09
WP_012778295.1|45464_45854_+	HNH endonuclease	NA	A0A1J0MFT4	Staphylococcus_phage	43.5	3.3e-18
WP_012778296.1|46662_47661_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	37.6	2.4e-52
WP_012778297.1|47805_48279_+|terminase	phage terminase small subunit P27 family	terminase	NA	NA	NA	NA
WP_012778300.1|50134_51235_+|portal	phage portal protein	portal	A0A2H4J8V4	uncultured_Caudovirales_phage	34.6	3.0e-48
WP_012778301.1|51231_52773_+|capsid	phage major capsid protein	capsid	B8R651	Lactobacillus_phage	25.9	9.1e-43
WP_012778302.1|53181_53448_+|head,tail	phage gp6-like head-tail connector protein	head,tail	NA	NA	NA	NA
55006:55020	attR	ATTTCCCGGGAAATA	NA	NA	NA	NA
>prophage 2
NZ_CP024413	Lactiplantibacillus plantarum strain ATCC 8014 chromosome, complete genome	3202808	331551	380043	3202808	bacteriocin,protease	Bacillus_virus(33.33%)	43	NA	NA
WP_003643762.1|331551_332115_-|protease	matrixin family metalloprotease	protease	NA	NA	NA	NA
WP_011100974.1|332308_332977_+	ribose 5-phosphate isomerase A	NA	NA	NA	NA	NA
WP_003641930.1|333126_334632_+	multicopper oxidase domain-containing protein	NA	NA	NA	NA	NA
WP_003643763.1|334896_335265_+	DUF1304 domain-containing protein	NA	NA	NA	NA	NA
WP_015825106.1|335377_335887_-	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_011100975.1|335917_337114_-	DUF2075 domain-containing protein	NA	NA	NA	NA	NA
WP_003641934.1|337223_337694_+	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_003641935.1|337712_338168_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003641936.1|338271_338844_+	acetyl-CoA carboxylase biotin carboxyl carrier protein subunit	NA	NA	NA	NA	NA
WP_003646441.1|339009_339930_-	ribonucleoside hydrolase RihC	NA	NA	NA	NA	NA
WP_015825107.1|340066_340966_+	oxidoreductase	NA	NA	NA	NA	NA
WP_015825108.1|341405_343286_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003646442.1|343457_343904_-	ribonuclease H	NA	NA	NA	NA	NA
WP_003641940.1|344141_345668_+	ABC transporter permease/substrate-binding protein	NA	NA	NA	NA	NA
WP_015825109.1|345668_346640_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.7	1.7e-23
WP_015825110.1|346717_348049_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003643773.1|348514_350032_+	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_003643774.1|350046_351876_+	type 1 glycerol-3-phosphate oxidase	NA	NA	NA	NA	NA
WP_003641945.1|351890_352613_+	aquaporin family protein	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	31.9	3.2e-30
WP_015825112.1|353199_356883_+	MucBP domain-containing protein	NA	NA	NA	NA	NA
WP_063486260.1|356884_358759_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015825114.1|358764_359307_+	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_015825115.1|359321_359585_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003641960.1|359696_359972_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015379760.1|360354_360972_-	sugar O-acetyltransferase	NA	NA	NA	NA	NA
WP_003646460.1|360975_362130_-	MFS transporter	NA	NA	NA	NA	NA
WP_015825116.1|362133_362925_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_015379762.1|362995_363868_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_015825117.1|364027_364843_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_011100994.1|365368_366745_+	branched-chain amino acid transport system II carrier protein	NA	NA	NA	NA	NA
WP_015825118.1|366789_367974_+	cation:proton antiporter	NA	NA	NA	NA	NA
WP_015825119.1|368361_368565_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015825120.1|368936_369605_-	hypothetical protein	NA	NA	NA	NA	NA
WP_154766382.1|370162_370336_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015825121.1|370348_371689_+	GHKL domain-containing protein	NA	NA	NA	NA	NA
WP_015825122.1|371689_372433_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_015825123.1|372726_373500_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_015825124.1|373598_373757_-|bacteriocin	two-peptide bacteriocin plantaricin EF subunit PlnF	bacteriocin	NA	NA	NA	NA
WP_003641985.1|373781_373952_-|bacteriocin	two-peptide bacteriocin plantaricin EF subunit PlnE	bacteriocin	NA	NA	NA	NA
WP_015825125.1|374218_376369_+	peptide cleavage/export ABC transporter	NA	W8CYL7	Bacillus_phage	27.9	6.1e-45
WP_015825126.1|376384_377761_+	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_015825127.1|377850_378540_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_015825129.1|379362_380043_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
>prophage 3
NZ_CP024413	Lactiplantibacillus plantarum strain ATCC 8014 chromosome, complete genome	3202808	482651	539142	3202808	portal,terminase,tail,integrase,capsid,transposase,protease	Lactobacillus_phage(87.23%)	67	498539:498558	531404:531423
WP_015825156.1|482651_484322_+|transposase	IS1182 family transposase	transposase	A0ZS58	Staphylococcus_virus	41.5	4.7e-93
WP_003643855.1|489816_491289_+	peptide MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	34.3	2.1e-68
WP_003640888.1|491343_492186_+	metallophosphoesterase	NA	NA	NA	NA	NA
WP_015825157.1|492747_493206_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015825158.1|493385_493910_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_003640891.1|493940_494276_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_011101053.1|494310_495153_+	metallophosphoesterase	NA	NA	NA	NA	NA
WP_015825159.1|495311_496418_-	anion permease	NA	NA	NA	NA	NA
WP_015825160.1|496610_497432_-	nicotinamide mononucleotide transporter	NA	A0A2K9VCL6	Lactobacillus_phage	42.2	2.6e-52
WP_003640895.1|497792_498584_+	pyrroline-5-carboxylate reductase	NA	A0A1X9I6T5	Streptococcus_phage	36.1	3.5e-30
498539:498558	attL	GAAGGGAATTGATGCAACGA	NA	NA	NA	NA
WP_003644997.1|498662_499799_+	N-acetylglucosamine-6-phosphate deacetylase	NA	NA	NA	NA	NA
WP_003640897.1|499822_500524_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003643865.1|500693_501431_-	WecB/TagA/CpsF family glycosyltransferase	NA	NA	NA	NA	NA
WP_003640899.1|501587_503066_+	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	44.1	2.5e-106
WP_003640900.1|503065_503893_+	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	54.0	6.5e-72
WP_015825161.1|504348_507003_+	cation-translocating P-type ATPase	NA	M1I547	Acanthocystis_turfacea_Chlorella_virus	29.1	1.8e-70
WP_015825162.1|507057_507492_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015825163.1|507785_509957_+	RNA-binding transcriptional accessory protein	NA	NA	NA	NA	NA
WP_015825164.1|509956_510403_+	SprT family protein	NA	NA	NA	NA	NA
WP_015825165.1|510468_511755_+	homoserine dehydrogenase	NA	NA	NA	NA	NA
WP_003644991.1|511763_512639_+	homoserine kinase	NA	NA	NA	NA	NA
WP_003643870.1|512929_514087_-|integrase	site-specific integrase	integrase	A0A2P0ZL94	Lactobacillus_phage	97.7	1.0e-216
WP_003643871.1|514256_514925_-	GIY-YIG nuclease family protein	NA	A0A2P0ZL92	Lactobacillus_phage	99.1	2.0e-124
WP_003643872.1|515037_515469_-	universal stress protein	NA	A0A2P0ZL98	Lactobacillus_phage	98.6	1.2e-74
WP_003643873.1|515568_515826_-	hypothetical protein	NA	A0A2P0ZL96	Lactobacillus_phage	95.3	1.7e-39
WP_003643874.1|515949_516126_-	hypothetical protein	NA	A0A2P0ZL93	Lactobacillus_phage	100.0	2.4e-24
WP_003643875.1|516293_516962_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003643876.1|517053_517485_-	hypothetical protein	NA	A0A2P0ZLA0	Lactobacillus_phage	100.0	7.6e-80
WP_003643877.1|517494_517872_-	helix-turn-helix transcriptional regulator	NA	A0A2P0ZLA1	Lactobacillus_phage	69.4	5.3e-45
WP_003643878.1|518184_518394_+	hypothetical protein	NA	A0A2P0ZL97	Lactobacillus_phage	100.0	7.0e-31
WP_003643879.1|518397_518613_+	hypothetical protein	NA	A0A2P0ZLA4	Lactobacillus_phage	100.0	6.9e-26
WP_099112459.1|518606_518792_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003643880.1|518863_519136_+	hypothetical protein	NA	A0A2P0ZLA9	Lactobacillus_phage	98.9	3.6e-43
WP_003643881.1|519274_519724_+	hypothetical protein	NA	A0A2P0ZLA2	Lactobacillus_phage	96.0	6.9e-76
WP_015825166.1|519879_520065_+	hypothetical protein	NA	A0A2P0ZLA3	Lactobacillus_phage	91.8	2.4e-27
WP_021730257.1|520036_520207_+	hypothetical protein	NA	A0A2P0ZLA6	Lactobacillus_phage	98.2	5.5e-26
WP_016511377.1|520279_520531_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003643883.1|520527_520779_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003643884.1|520775_521255_+	siphovirus Gp157 family protein	NA	A0A2P0ZLB3	Lactobacillus_phage	95.6	1.3e-80
WP_003643885.1|521406_522666_+	DEAD/DEAH box helicase family protein	NA	A0A2P0ZLA5	Lactobacillus_phage	95.0	1.9e-227
WP_003643886.1|522662_523379_+	AAA family ATPase	NA	A0A2P0ZLB2	Lactobacillus_phage	99.1	3.5e-114
WP_003643887.1|523381_523981_+	hypothetical protein	NA	A0A2P0ZLB9	Lactobacillus_phage	98.9	1.6e-96
WP_003643888.1|523994_524549_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003643889.1|524622_525417_+	bifunctional DNA primase/polymerase	NA	A0A2P0ZLB0	Lactobacillus_phage	97.0	2.5e-145
WP_003643890.1|525413_526688_+	helicase	NA	A0A2P0ZLC4	Lactobacillus_phage	98.8	7.1e-243
WP_003643891.1|526945_527278_+	VRR-NUC domain-containing protein	NA	A0A2P0ZLB6	Lactobacillus_phage	96.4	8.2e-58
WP_003643892.1|527297_527522_+	hypothetical protein	NA	A0A2P0ZLC3	Lactobacillus_phage	87.8	1.1e-13
WP_162273788.1|527499_527934_+	hypothetical protein	NA	A0A2K9VD97	Lactobacillus_phage	57.4	4.7e-37
WP_003643894.1|527930_528392_+	DUF1642 domain-containing protein	NA	A0A2P0ZLB8	Lactobacillus_phage	47.5	1.9e-28
WP_003643895.1|528518_528830_+	hypothetical protein	NA	A0A2P0ZLD0	Lactobacillus_phage	97.1	2.6e-50
WP_099686931.1|528841_529273_+	hypothetical protein	NA	A0A2P0ZLC0	Lactobacillus_phage	96.3	6.0e-69
WP_003643897.1|529451_530159_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003643898.1|530227_530443_+	hypothetical protein	NA	A0A2P0ZLC2	Lactobacillus_phage	81.4	2.2e-27
WP_033615432.1|530426_530765_+	HNH endonuclease	NA	A0A2P0ZLC6	Lactobacillus_phage	93.8	5.2e-60
WP_003643899.1|530764_531019_+	hypothetical protein	NA	A0A2P0ZLD3	Lactobacillus_phage	82.5	5.9e-32
WP_003643900.1|531052_531304_+	hypothetical protein	NA	A0A2P0ZLD2	Lactobacillus_phage	89.2	7.3e-35
WP_015825169.1|531414_531702_+|terminase	P27 family phage terminase small subunit	terminase	A0A2P0ZLC8	Lactobacillus_phage	88.4	1.9e-39
531404:531423	attR	GAAGGGAATTGATGCAACGA	NA	NA	NA	NA
WP_015825170.1|531698_533381_+|terminase	terminase large subunit	terminase	A0A2P0ZLE5	Lactobacillus_phage	99.1	0.0e+00
WP_003643903.1|533399_534542_+|portal	phage portal protein	portal	A0A2P0ZLC9	Lactobacillus_phage	96.3	6.4e-211
WP_015825171.1|534528_535272_+|protease	Clp protease ClpP	protease	A0A2P0ZLE3	Lactobacillus_phage	97.6	1.4e-129
WP_003643905.1|535292_536471_+|capsid	phage major capsid protein	capsid	A0A2P0ZLD6	Lactobacillus_phage	98.7	1.6e-217
WP_003643906.1|536610_536916_+	hypothetical protein	NA	A0A2P0ZLD5	Lactobacillus_phage	91.1	1.6e-44
WP_003643907.1|536896_537286_+	hypothetical protein	NA	A0A2P0ZLD1	Lactobacillus_phage	89.1	3.4e-63
WP_003643908.1|537282_537690_+	hypothetical protein	NA	A0A2P0ZLD7	Lactobacillus_phage	97.8	3.3e-69
WP_003643909.1|537686_538109_+	hypothetical protein	NA	A0A2P0ZLE4	Lactobacillus_phage	98.6	7.4e-72
WP_003643910.1|538123_538735_+|tail	tail protein	tail	A0A2P0ZLF5	Lactobacillus_phage	97.0	1.1e-105
WP_003643911.1|538827_539142_+	hypothetical protein	NA	A0A2P0ZLF3	Lactobacillus_phage	90.4	4.2e-48
>prophage 4
NZ_CP024413	Lactiplantibacillus plantarum strain ATCC 8014 chromosome, complete genome	3202808	1005602	1098905	3202808	tRNA,portal,terminase,tail,integrase,head,capsid,transposase,protease	Lactobacillus_phage(61.82%)	98	1077023:1077037	1102192:1102206
WP_015825317.1|1005602_1005923_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC	tRNA	NA	NA	NA	NA
WP_015825318.1|1005922_1007386_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
WP_015825319.1|1007385_1008810_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB	tRNA	NA	NA	NA	NA
WP_003641344.1|1008914_1009937_+	diacylglycerol kinase	NA	A0A1V0SBJ0	Catovirus	26.5	2.6e-17
WP_015825320.1|1010270_1011644_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	50.0	3.2e-124
WP_003641346.1|1012097_1012676_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003646275.1|1012942_1015282_+	cation-translocating P-type ATPase	NA	M1HI01	Paramecium_bursaria_Chlorella_virus	24.8	7.1e-39
WP_003644132.1|1015531_1016848_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_003641349.1|1016840_1017725_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_003644133.1|1017849_1018728_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003641351.1|1018752_1019529_+	lysozyme	NA	A0A141HSE6	Bacillus_phage	31.1	2.6e-06
WP_003641352.1|1019684_1020050_-	DUF4828 domain-containing protein	NA	NA	NA	NA	NA
WP_003638174.1|1020393_1020594_+	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	71.4	3.1e-20
WP_003641353.1|1020780_1021788_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_003641354.1|1021800_1023135_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	30.9	2.9e-37
WP_015825321.1|1023376_1024558_-|integrase	site-specific integrase	integrase	B4XYR4	Lactobacillus_phage	37.6	1.5e-58
WP_003641356.1|1024725_1025040_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003641358.1|1025373_1025574_-	hypothetical protein	NA	E9LUS6	Lactobacillus_phage	100.0	4.9e-26
WP_041161662.1|1025585_1026401_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003641360.1|1026426_1026816_-	ImmA/IrrE family metallo-endopeptidase	NA	D6PSS8	Lactobacillus_phage	54.3	4.6e-36
WP_003641361.1|1026846_1027173_-	helix-turn-helix transcriptional regulator	NA	A0A1B0Y2R0	Lactobacillus_phage	44.1	6.9e-17
WP_003641362.1|1027429_1027645_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049821958.1|1027718_1028462_+	ORF6C domain-containing protein	NA	A0A1P8BM06	Lactococcus_phage	45.6	4.8e-50
WP_015825325.1|1028473_1028683_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015825327.1|1028695_1028911_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015825329.1|1029813_1030074_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015825330.1|1030216_1030396_+	helix-turn-helix domain-containing protein	NA	E9LUT5	Lactobacillus_phage	100.0	1.4e-24
WP_015825331.1|1030429_1030684_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015825332.1|1030686_1030887_+	hypothetical protein	NA	E9LUT7	Lactobacillus_phage	92.4	2.6e-27
WP_164878063.1|1030898_1031063_+	hypothetical protein	NA	E9LUT8	Lactobacillus_phage	65.4	1.4e-10
WP_021732029.1|1031065_1031212_+	hypothetical protein	NA	E9LUT9	Lactobacillus_phage	93.6	2.3e-17
WP_015825333.1|1031211_1032072_+	DUF1351 domain-containing protein	NA	A0A0P0IV40	Lactobacillus_phage	34.4	3.2e-37
WP_015825334.1|1032071_1032698_+	ERF family protein	NA	D7RWM8	Brochothrix_phage	37.4	6.1e-14
WP_015825335.1|1032694_1033156_+	single-stranded DNA-binding protein	NA	A0A2I2MUI5	uncultured_Caudovirales_phage	57.5	1.4e-39
WP_015825336.1|1033171_1033738_+	HNH endonuclease	NA	A0A249XVQ5	Enterococcus_phage	34.1	4.0e-20
WP_015825337.1|1033743_1034436_+	hypothetical protein	NA	E9LUU3	Lactobacillus_phage	91.3	2.2e-121
WP_015825338.1|1034485_1035292_+	hypothetical protein	NA	A0A0S2MYA8	Enterococcus_phage	37.2	6.0e-46
WP_015825339.1|1035291_1036077_+	ATP-binding protein	NA	E9LUN6	Lactobacillus_phage	98.9	1.2e-144
WP_013355641.1|1036212_1036521_+	hypothetical protein	NA	E9LUN7	Lactobacillus_phage	94.1	3.2e-48
WP_015825340.1|1036795_1037227_+	transcriptional regulator	NA	E9LUP5	Lactobacillus_phage	93.7	3.4e-72
WP_041161663.1|1037449_1037716_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015825342.1|1037737_1038397_+	HNH endonuclease	NA	B8R694	Lactobacillus_phage	38.4	2.5e-21
WP_049821959.1|1038588_1039023_+|terminase	phage terminase small subunit P27 family	terminase	B8R648	Lactobacillus_phage	37.7	8.3e-18
WP_015825344.1|1039009_1040926_+|terminase	terminase large subunit	terminase	A0A0M7RDK9	Lactobacillus_phage	41.4	8.2e-134
WP_165274444.1|1040939_1041104_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015825345.1|1041145_1042264_+|portal	phage portal protein	portal	Q9AZM4	Lactococcus_phage	39.5	3.6e-65
WP_015825346.1|1042235_1042841_+|head,protease	HK97 family phage prohead protease	head,protease	B8R651	Lactobacillus_phage	49.1	8.2e-40
WP_015825347.1|1042847_1044230_+|capsid	phage major capsid protein	capsid	A0A0M7RF71	Lactobacillus_phage	60.1	4.9e-96
WP_015825348.1|1044320_1044599_+	hypothetical protein	NA	A0A2P0ZLF2	Lactobacillus_phage	73.6	2.2e-32
WP_041161664.1|1044599_1044947_+|head	phage head closure protein	head	A0A2P0ZLF0	Lactobacillus_phage	92.2	1.4e-55
WP_015825350.1|1044949_1045357_+	HK97 gp10 family phage protein	NA	A0A2P0ZLE6	Lactobacillus_phage	90.9	1.1e-64
WP_015825351.1|1045356_1045737_+	DUF806 family protein	NA	A0A2P0ZLF4	Lactobacillus_phage	90.5	8.5e-59
WP_015825352.1|1045751_1046393_+|tail	phage tail protein	tail	A0A2P0ZLH1	Lactobacillus_phage	92.0	3.4e-108
WP_015825353.1|1046469_1046844_+|tail	phage tail assembly chaperone	tail	A0A2P0ZLH4	Lactobacillus_phage	93.5	2.0e-57
WP_015825354.1|1046888_1047074_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015825355.1|1047105_1052256_+	C40 family peptidase	NA	A0A2P0ZLG0	Lactobacillus_phage	53.8	0.0e+00
WP_015825356.1|1052332_1054105_+|tail	phage tail family protein	tail	A0A2P0ZLH2	Lactobacillus_phage	92.9	2.5e-310
WP_015825357.1|1054171_1056583_+|tail	phage tail protein	tail	A0A2P0ZLF8	Lactobacillus_phage	94.5	0.0e+00
WP_015825358.1|1056599_1059395_+|tail	tail fiber protein	tail	E9LUR4	Lactobacillus_phage	71.1	7.5e-221
WP_003641409.1|1059387_1059627_+	hypothetical protein	NA	A0A2K9VDF6	Lactobacillus_phage	97.4	1.9e-32
WP_166485333.1|1059630_1059792_+	hypothetical protein	NA	A0A2P0ZLG1	Lactobacillus_phage	98.1	2.1e-19
WP_015825359.1|1059775_1060891_+	collagen-like protein	NA	A0A2P0ZLF6	Lactobacillus_phage	85.7	9.1e-61
WP_041161665.1|1060887_1061145_+	hypothetical protein	NA	A0A0A1ENR9	Lactobacillus_phage	76.4	3.7e-18
WP_015825360.1|1061157_1062315_+	LysM peptidoglycan-binding domain-containing protein	NA	E9LUR8	Lactobacillus_phage	85.1	3.8e-187
WP_015825361.1|1062314_1062578_+	hemolysin XhlA family protein	NA	E9LUR9	Lactobacillus_phage	98.9	7.4e-38
WP_003643301.1|1063275_1063716_-	universal stress protein	NA	NA	NA	NA	NA
WP_015825363.1|1063849_1065157_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_045352539.1|1065149_1066016_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_076630458.1|1066167_1066368_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003643305.1|1066567_1067008_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003646269.1|1067440_1068004_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015825366.1|1068610_1069690_+	ATP-binding protein	NA	M4QMW8	Micromonas_pusilla_virus	32.1	4.2e-18
WP_015825367.1|1069698_1071753_+	S8 family peptidase	NA	NA	NA	NA	NA
WP_172436956.1|1072057_1073413_-	NADP-specific glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_015825369.1|1073669_1074845_+	serine hydrolase	NA	NA	NA	NA	NA
WP_015825370.1|1075034_1076153_+	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A0N9R0B2	Chrysochromulina_ericina_virus	31.3	7.1e-21
WP_015825371.1|1076539_1077469_+	YihY/virulence factor BrkB family protein	NA	NA	NA	NA	NA
1077023:1077037	attL	GTGATCTTGAATTTA	NA	NA	NA	NA
WP_003643315.1|1077658_1078375_+	aquaporin family protein	NA	A0A1J0F964	Only_Syngen_Nebraska_virus	32.7	5.6e-19
WP_015825372.1|1078626_1079820_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_077727009.1|1080568_1080778_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_015825374.1|1080774_1081323_+|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	40.3	3.1e-30
WP_099112445.1|1081391_1082438_-	N-acetylmuramoyl-L-alanine amidase	NA	NA	NA	NA	NA
WP_015825376.1|1082874_1083657_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_015825377.1|1083722_1084688_+	Stealth CR1 domain-containing protein	NA	NA	NA	NA	NA
WP_015825378.1|1084690_1085737_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_015825379.1|1085777_1086695_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_015825380.1|1086681_1087767_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_148113607.1|1087827_1088853_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015825382.1|1089211_1089874_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015825383.1|1089870_1090470_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_015825384.1|1090472_1091609_+	serine hydrolase	NA	NA	NA	NA	NA
WP_015825385.1|1091652_1093191_+	oligosaccharide flippase family protein	NA	NA	NA	NA	NA
WP_015825386.1|1093206_1094076_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	K7QKA7	Escherichia_phage	61.2	9.2e-101
WP_015825387.1|1094079_1094661_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	45.1	2.5e-38
WP_015825388.1|1094670_1095699_+	dTDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	42.1	3.8e-69
WP_015825389.1|1095768_1096611_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	37.2	1.4e-34
WP_049821960.1|1096692_1098219_-	oligosaccharide flippase family protein	NA	NA	NA	NA	NA
WP_015825391.1|1098308_1098905_-|integrase	tyrosine-type recombinase/integrase	integrase	D2XR58	Bacillus_phage	43.0	9.6e-33
1102192:1102206	attR	GTGATCTTGAATTTA	NA	NA	NA	NA
>prophage 5
NZ_CP024413	Lactiplantibacillus plantarum strain ATCC 8014 chromosome, complete genome	3202808	1281109	1290956	3202808		Lactobacillus_phage(87.5%)	9	NA	NA
WP_015825454.1|1281109_1282348_+	hypothetical protein	NA	A0A2P0ZL72	Lactobacillus_phage	99.2	6.3e-220
WP_015825455.1|1282438_1283410_-	peptidase S41	NA	A0A2P0ZL68	Lactobacillus_phage	99.4	1.8e-182
WP_003643099.1|1283595_1284543_-	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	100.0	2.7e-178
WP_003643097.1|1284886_1285501_+	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL77	Lactobacillus_phage	100.0	6.3e-112
WP_015825456.1|1285503_1287942_+	flavocytochrome c	NA	A0A2P0ZL82	Lactobacillus_phage	99.5	0.0e+00
WP_003643095.1|1288029_1288590_+	hypothetical protein	NA	A0A2P0ZL75	Lactobacillus_phage	100.0	2.7e-101
WP_011101401.1|1288660_1289101_-	nucleoside 2-deoxyribosyltransferase	NA	A0A2P0ZL88	Lactobacillus_phage	98.6	3.0e-76
WP_015380221.1|1289196_1289334_+	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_003645220.1|1289960_1290956_+	glycosyltransferase family 2 protein	NA	S5FKN0	Shigella_phage	38.8	3.1e-52
>prophage 6
NZ_CP024413	Lactiplantibacillus plantarum strain ATCC 8014 chromosome, complete genome	3202808	2329912	2338423	3202808		Synechococcus_phage(33.33%)	9	NA	NA
WP_003645867.1|2329912_2330491_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	33.9	1.3e-21
WP_015380733.1|2330483_2331509_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	41.0	1.2e-59
WP_003642591.1|2331505_2332960_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	34.0	2.5e-50
WP_015825820.1|2332944_2335164_-	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	40.1	3.8e-143
WP_011101895.1|2335156_2335837_-	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_003642588.1|2335836_2336091_-	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_003642587.1|2336092_2336824_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	M4SM18	Cyanophage	37.3	1.6e-37
WP_015380738.1|2336826_2337957_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_003645861.1|2337940_2338423_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	41.0	2.3e-16
>prophage 1
NZ_CP024415	Lactiplantibacillus plantarum strain ATCC 8014 plasmid pLP39, complete sequence	39069	12690	38903	39069	integrase,tail,capsid,protease,terminase,portal	Lactobacillus_phage(100.0%)	46	19801:19812	38991:39002
WP_003643911.1|12690_13005_-	hypothetical protein	NA	A0A2P0ZLF3	Lactobacillus_phage	90.4	4.2e-48
WP_003643910.1|13097_13709_-|tail	tail protein	tail	A0A2P0ZLF5	Lactobacillus_phage	97.0	1.1e-105
WP_003643909.1|13723_14146_-	hypothetical protein	NA	A0A2P0ZLE4	Lactobacillus_phage	98.6	7.4e-72
WP_003643908.1|14142_14550_-	hypothetical protein	NA	A0A2P0ZLD7	Lactobacillus_phage	97.8	3.3e-69
WP_003643907.1|14546_14936_-	hypothetical protein	NA	A0A2P0ZLD1	Lactobacillus_phage	89.1	3.4e-63
WP_003643906.1|14916_15222_-	hypothetical protein	NA	A0A2P0ZLD5	Lactobacillus_phage	91.1	1.6e-44
WP_003643905.1|15361_16540_-|capsid	phage major capsid protein	capsid	A0A2P0ZLD6	Lactobacillus_phage	98.7	1.6e-217
WP_015825171.1|16560_17304_-|protease	Clp protease ClpP	protease	A0A2P0ZLE3	Lactobacillus_phage	97.6	1.4e-129
WP_003643903.1|17290_18433_-|portal	phage portal protein	portal	A0A2P0ZLC9	Lactobacillus_phage	96.3	6.4e-211
WP_015825170.1|18451_20134_-|terminase	terminase large subunit	terminase	A0A2P0ZLE5	Lactobacillus_phage	99.1	0.0e+00
19801:19812	attL	ATAAAAGAAAAG	NA	NA	NA	NA
WP_015825169.1|20130_20418_-|terminase	P27 family phage terminase small subunit	terminase	A0A2P0ZLC8	Lactobacillus_phage	88.4	1.9e-39
WP_003643900.1|20528_20780_-	hypothetical protein	NA	A0A2P0ZLD2	Lactobacillus_phage	89.2	7.3e-35
WP_003643899.1|20813_21068_-	hypothetical protein	NA	A0A2P0ZLD3	Lactobacillus_phage	82.5	5.9e-32
WP_033615432.1|21067_21406_-	HNH endonuclease	NA	A0A2P0ZLC6	Lactobacillus_phage	93.8	5.2e-60
WP_003643898.1|21389_21605_-	hypothetical protein	NA	A0A2P0ZLC2	Lactobacillus_phage	81.4	2.2e-27
WP_003643897.1|21673_22381_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099686931.1|22559_22991_-	hypothetical protein	NA	A0A2P0ZLC0	Lactobacillus_phage	96.3	6.0e-69
WP_003643895.1|23002_23314_-	hypothetical protein	NA	A0A2P0ZLD0	Lactobacillus_phage	97.1	2.6e-50
WP_003643894.1|23440_23902_-	DUF1642 domain-containing protein	NA	A0A2P0ZLB8	Lactobacillus_phage	47.5	1.9e-28
WP_162273788.1|23898_24333_-	hypothetical protein	NA	A0A2K9VD97	Lactobacillus_phage	57.4	4.7e-37
WP_003643892.1|24310_24535_-	hypothetical protein	NA	A0A2P0ZLC3	Lactobacillus_phage	87.8	1.1e-13
WP_003643891.1|24554_24887_-	VRR-NUC domain-containing protein	NA	A0A2P0ZLB6	Lactobacillus_phage	96.4	8.2e-58
WP_003643890.1|25144_26419_-	helicase	NA	A0A2P0ZLC4	Lactobacillus_phage	98.8	7.1e-243
WP_003643889.1|26415_27210_-	bifunctional DNA primase/polymerase	NA	A0A2P0ZLB0	Lactobacillus_phage	97.0	2.5e-145
WP_003643888.1|27283_27838_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003643887.1|27851_28451_-	hypothetical protein	NA	A0A2P0ZLB9	Lactobacillus_phage	98.9	1.6e-96
WP_003643886.1|28453_29170_-	AAA family ATPase	NA	A0A2P0ZLB2	Lactobacillus_phage	99.1	3.5e-114
WP_003643885.1|29166_30426_-	DEAD/DEAH box helicase family protein	NA	A0A2P0ZLA5	Lactobacillus_phage	95.0	1.9e-227
WP_003643884.1|30577_31057_-	siphovirus Gp157 family protein	NA	A0A2P0ZLB3	Lactobacillus_phage	95.6	1.3e-80
WP_003643883.1|31053_31305_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016511377.1|31301_31553_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021730257.1|31625_31796_-	hypothetical protein	NA	A0A2P0ZLA6	Lactobacillus_phage	98.2	5.5e-26
WP_015825166.1|31767_31953_-	hypothetical protein	NA	A0A2P0ZLA3	Lactobacillus_phage	91.8	2.4e-27
WP_003643881.1|32108_32558_-	hypothetical protein	NA	A0A2P0ZLA2	Lactobacillus_phage	96.0	6.9e-76
WP_003643880.1|32696_32969_-	hypothetical protein	NA	A0A2P0ZLA9	Lactobacillus_phage	98.9	3.6e-43
WP_099112459.1|33040_33226_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003643879.1|33219_33435_-	hypothetical protein	NA	A0A2P0ZLA4	Lactobacillus_phage	100.0	6.9e-26
WP_003643878.1|33438_33648_-	hypothetical protein	NA	A0A2P0ZL97	Lactobacillus_phage	100.0	7.0e-31
WP_003643877.1|33960_34338_+	helix-turn-helix transcriptional regulator	NA	A0A2P0ZLA1	Lactobacillus_phage	69.4	5.3e-45
WP_003643876.1|34347_34779_+	hypothetical protein	NA	A0A2P0ZLA0	Lactobacillus_phage	100.0	7.6e-80
WP_003643875.1|34870_35539_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003643874.1|35706_35883_+	hypothetical protein	NA	A0A2P0ZL93	Lactobacillus_phage	100.0	2.4e-24
WP_003643873.1|36006_36264_+	hypothetical protein	NA	A0A2P0ZL96	Lactobacillus_phage	95.3	1.7e-39
WP_003643872.1|36363_36795_+	universal stress protein	NA	A0A2P0ZL98	Lactobacillus_phage	98.6	1.2e-74
WP_003643871.1|36907_37576_+	GIY-YIG nuclease family protein	NA	A0A2P0ZL92	Lactobacillus_phage	99.1	2.0e-124
WP_003643870.1|37745_38903_+|integrase	site-specific integrase	integrase	A0A2P0ZL94	Lactobacillus_phage	97.7	1.0e-216
38991:39002	attR	ATAAAAGAAAAG	NA	NA	NA	NA
