The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP024162	Vibrio cholerae strain E7946 chromosome 1, complete sequence	2992571	561053	568316	2992571		uncultured_Mediterranean_phage(33.33%)	6	NA	NA
WP_001883363.1|561053_561845_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	51.6	8.4e-69
WP_000002982.1|561837_562464_+	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	52.1	2.0e-36
WP_000177568.1|562463_563399_+	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	34.7	7.8e-05
WP_000116737.1|563472_564480_+	RNA polymerase sigma factor RpoS	NA	F4YCU2	Synechococcus_phage	34.2	6.0e-35
WP_001894770.1|564572_567161_-	DNA mismatch repair protein MutS	NA	A0A1V0SC35	Catovirus	23.0	2.2e-33
WP_001279365.1|567428_568316_-	cysteine synthase CysM	NA	A0A1X9I5K7	Streptococcus_phage	41.1	4.1e-56
>prophage 2
NZ_CP024162	Vibrio cholerae strain E7946 chromosome 1, complete sequence	2992571	799946	807139	2992571		Faustovirus(16.67%)	9	NA	NA
WP_000775253.1|799946_801161_+	IscS subfamily cysteine desulfurase	NA	A0A0H3TPH2	Faustovirus	30.5	1.1e-32
WP_000331703.1|801197_801581_+	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	78.2	5.4e-53
WP_000301571.1|801641_801965_+	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	50.5	3.0e-25
WP_001105747.1|802013_802529_+	co-chaperone HscB	NA	NA	NA	NA	NA
WP_001196560.1|802552_804403_+	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	41.1	5.3e-106
WP_001124187.1|804416_804755_+	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_000872176.1|804803_804998_+	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_000107237.1|805217_806507_+	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	34.3	1.7e-34
WP_001162850.1|806710_807139_+	nucleoside-diphosphate kinase	NA	D2E8E1	Anguillid_herpesvirus	38.4	1.0e-20
>prophage 3
NZ_CP024162	Vibrio cholerae strain E7946 chromosome 1, complete sequence	2992571	1545508	1578118	2992571		Vibrio_phage(42.11%)	25	NA	NA
WP_149591715.1|1545508_1547614_-	RTX toxin T1SS ABC transporter subunit RtxB	NA	W8CYL7	Bacillus_phage	27.1	4.9e-39
WP_000514481.1|1548028_1548388_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001881196.1|1548413_1548875_+	RTX toxin-activating lysine-acyltransferase RtxC	NA	NA	NA	NA	NA
WP_001881197.1|1548859_1562536_+	MARTX multifunctional-autoprocessing repeats-in-toxin holotoxin RtxA	NA	B3Y8K3	Vibrio_virus	100.0	8.4e-07
WP_000053920.1|1562903_1563128_-	RstC protein	NA	U5TMI6	Satellite_phage	100.0	1.1e-34
WP_010895442.1|1563221_1563596_-	hypothetical protein	NA	B9V3G5	Vibrio_virus	100.0	1.2e-68
WP_000743997.1|1563573_1564653_-	hypothetical protein	NA	U5TQR3	Satellite_phage	100.0	2.2e-213
WP_000693566.1|1564778_1565117_+	helix-turn-helix transcriptional regulator	NA	U5TNA1	Satellite_phage	100.0	7.3e-54
WP_000593522.1|1565718_1566093_-	cholera enterotoxin binding subunit CtxB	NA	Q77DH7	Vibrio_virus	100.0	7.8e-65
WP_001881225.1|1566089_1566866_-	cholera enterotoxin catalytic subunit CtxA	NA	A0A142I6Y0	Vibrio_phage	100.0	1.3e-151
WP_000021616.1|1566964_1568164_-	zonula occludens toxin ZOT	NA	A0A142I6Z1	Vibrio_phage	100.0	5.3e-240
WP_000979342.1|1568160_1568454_-	accessory cholera enterotoxin	NA	A0A0F6YNQ7	Vibrio_phage	100.0	3.7e-46
WP_001881237.1|1568450_1569734_-	hypothetical protein	NA	A0A142I701	Vibrio_phage	100.0	9.1e-222
WP_000493022.1|1569744_1569993_-	colonization factor	NA	A0A0N7F140	Vibrio_phage	100.0	8.8e-33
WP_001890610.1|1570128_1570512_-	hypothetical protein	NA	F1CC65	Vibrio_virus	100.0	4.8e-70
WP_000743997.1|1570489_1571569_-	hypothetical protein	NA	U5TQR3	Satellite_phage	100.0	2.2e-213
WP_000693566.1|1571694_1572033_+	helix-turn-helix transcriptional regulator	NA	U5TNA1	Satellite_phage	100.0	7.3e-54
WP_000170634.1|1572522_1573107_-	DNA-binding protein	NA	E3U9I9	Vibrio_phage	100.0	6.4e-114
WP_001161489.1|1573099_1573267_-	hypothetical protein	NA	E3U9J0	Vibrio_phage	100.0	2.3e-13
WP_001052672.1|1573344_1574037_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001881265.1|1574166_1574451_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001881266.1|1574455_1576024_-	replication protein	NA	A7BJY2	Enterobacteria_phage	32.3	2.7e-58
WP_001265358.1|1576185_1576752_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000170632.1|1577790_1577958_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001161489.1|1577950_1578118_-	hypothetical protein	NA	E3U9J0	Vibrio_phage	100.0	2.3e-13
>prophage 4
NZ_CP024162	Vibrio cholerae strain E7946 chromosome 1, complete sequence	2992571	2316769	2365602	2992571	capsid,head,tail,integrase,tRNA,terminase,portal	Vibrio_phage(89.13%)	58	2332702:2332725	2365812:2365835
WP_000186559.1|2316769_2317252_-|tRNA	Cys-tRNA(Pro) deacylase	tRNA	NA	NA	NA	NA
WP_000809002.1|2317385_2319047_-	bifunctional UDP-sugar hydrolase/5'-nucleotidase	NA	NA	NA	NA	NA
WP_000400335.1|2319588_2320440_-	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	40.7	2.6e-47
WP_000933144.1|2320459_2321272_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_000272895.1|2321287_2321671_-	SirB2 family protein	NA	NA	NA	NA	NA
WP_000117270.1|2321670_2322531_-	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_000647701.1|2322534_2323623_-	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	46.4	2.4e-05
WP_000054219.1|2323652_2324912_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_000993150.1|2325070_2325688_+	lipoprotein localization protein LolB	NA	NA	NA	NA	NA
WP_001881862.1|2325669_2326557_+	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
WP_001113134.1|2326587_2327532_+	ribose-phosphate pyrophosphokinase	NA	A0A2K9L2G2	Tupanvirus	38.0	1.7e-44
WP_000081944.1|2327700_2328291_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_000505884.1|2328301_2329393_+	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_000290380.1|2331252_2332386_-	flagellin	NA	NA	NA	NA	NA
2332702:2332725	attL	CAGAAAAAAGAAAAGCCCCTTTTC	NA	NA	NA	NA
WP_000779002.1|2333409_2335041_-	hypothetical protein	NA	U3PB83	Vibrio_phage	100.0	0.0e+00
WP_000457681.1|2335037_2335511_-	hypothetical protein	NA	U3PDI0	Vibrio_phage	100.0	6.6e-77
WP_000267787.1|2335498_2336392_-	hypothetical protein	NA	U3PIM3	Vibrio_phage	100.0	2.8e-161
WP_000369864.1|2336394_2336919_-	hypothetical protein	NA	A9ZT45	Vibrio_virus	100.0	4.8e-97
WP_000083759.1|2336918_2338781_-|tail	phage tail protein	tail	Q8HA58	Vibrio_phage	100.0	0.0e+00
WP_000005870.1|2338777_2339437_-	hypothetical protein	NA	U3PB79	Vibrio_phage	100.0	8.2e-126
WP_000044509.1|2339433_2340633_-	hypothetical protein	NA	U3PDH5	Vibrio_phage	100.0	1.0e-222
WP_001113003.1|2340629_2340962_-	DUF2590 family protein	NA	U3PIM1	Vibrio_phage	100.0	1.7e-55
WP_000343647.1|2340951_2342769_-|tail	phage tail tape measure protein	tail	U3PFL8	Vibrio_phage	100.0	0.0e+00
WP_000165786.1|2342965_2343247_-	hypothetical protein	NA	A9ZT39	Vibrio_virus	100.0	5.1e-45
WP_001881877.1|2343243_2343546_-	hypothetical protein	NA	U3PCH1	Vibrio_phage	100.0	1.5e-50
WP_000990572.1|2343454_2343796_-	hypothetical protein	NA	U3PB75	Vibrio_phage	100.0	1.1e-52
WP_000705022.1|2343770_2344358_-	lysozyme	NA	U3PDH1	Vibrio_phage	100.0	2.5e-110
WP_001077689.1|2344344_2344572_-	hypothetical protein	NA	U3PIL8	Vibrio_phage	100.0	2.1e-36
WP_000382491.1|2344568_2344778_-	TraR/DksA family transcriptional regulator	NA	U3PFL5	Vibrio_phage	100.0	2.0e-33
WP_000063627.1|2344792_2345251_-	DUF2597 family protein	NA	U3PCG7	Vibrio_phage	100.0	1.3e-82
WP_000312540.1|2345250_2346360_-	DUF2586 family protein	NA	U3PB71	Vibrio_phage	100.0	1.5e-209
WP_000461677.1|2346361_2347021_-	phage virion morphogenesis protein	NA	U3PDG7	Vibrio_phage	100.0	9.1e-117
WP_000122189.1|2347007_2347496_-	hypothetical protein	NA	U3PIL4	Vibrio_phage	100.0	1.6e-89
WP_000493401.1|2347492_2347954_-|head	head completion/stabilization protein	head	U3PFL1	Vibrio_phage	100.0	1.5e-78
WP_000059165.1|2348060_2348777_-|terminase	terminase endonuclease subunit	terminase	U3PCG2	Vibrio_phage	100.0	1.3e-132
WP_000078361.1|2348792_2349803_-|capsid	phage major capsid protein, P2 family	capsid	U3PB67	Vibrio_phage	100.0	7.0e-193
WP_001127095.1|2349839_2350739_-|capsid	GPO family capsid scaffolding protein	capsid	A0A160DHM4	Vibrio_phage	100.0	4.0e-123
WP_000331803.1|2350912_2352730_+|terminase	terminase ATPase subunit family protein	terminase	U3PIL1	Vibrio_phage	100.0	0.0e+00
WP_001999948.1|2352726_2353773_+|portal	phage portal protein	portal	U3PFK6	Vibrio_phage	100.0	5.7e-206
WP_000729650.1|2353756_2353972_+	hypothetical protein	NA	U3PCF7	Vibrio_phage	100.0	3.1e-34
WP_001263191.1|2354042_2354294_+	ogr/Delta-like zinc finger family protein	NA	U3PB63	Vibrio_phage	100.0	1.9e-43
WP_001292395.1|2354294_2354540_-	hypothetical protein	NA	U3PDF9	Vibrio_phage	100.0	1.5e-37
WP_001140408.1|2354777_2355116_+	helix-turn-helix transcriptional regulator	NA	U3PIK7	Vibrio_phage	100.0	2.8e-53
WP_000756239.1|2355189_2355726_-	DUF262 domain-containing protein	NA	U3PFK3	Vibrio_phage	100.0	4.1e-99
WP_001909657.1|2355735_2358321_-	replication endonuclease	NA	A0A166YHE2	Vibrio_phage	99.9	0.0e+00
WP_000613058.1|2358317_2358902_-	hypothetical protein	NA	U3PB60	Vibrio_phage	100.0	3.2e-105
WP_000629095.1|2358898_2359009_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000099608.1|2359005_2359623_-	DNA methyltransferase	NA	U3PDF3	Vibrio_phage	100.0	1.2e-118
WP_001198814.1|2359619_2359847_-	hypothetical protein	NA	U3PIK2	Vibrio_phage	100.0	3.2e-37
WP_000997540.1|2360096_2360507_-	hypothetical protein	NA	U3PCE8	Vibrio_phage	100.0	1.8e-75
WP_001031152.1|2360503_2361037_-	hypothetical protein	NA	U3PB56	Vibrio_phage	100.0	3.9e-86
WP_001272765.1|2361118_2361553_-	hypothetical protein	NA	U3PDF0	Vibrio_phage	100.0	2.8e-74
WP_000253093.1|2361565_2362105_-	hypothetical protein	NA	U3PIJ8	Vibrio_phage	100.0	5.5e-96
WP_000959026.1|2362215_2362428_-	hypothetical protein	NA	U3PFJ1	Vibrio_phage	100.0	6.4e-32
WP_001881894.1|2362573_2363221_+	phage repressor protein CI	NA	A0A166YHA0	Vibrio_phage	100.0	1.1e-119
WP_000132153.1|2363246_2364152_+	NAD-dependent DNA ligase	NA	U3PB51	Vibrio_phage	100.0	1.3e-161
WP_000985033.1|2364151_2364565_+	hypothetical protein	NA	U3PDE6	Vibrio_phage	100.0	8.9e-70
WP_000116333.1|2364564_2365602_+|integrase	site-specific integrase	integrase	U3PIJ4	Vibrio_phage	100.0	1.5e-198
2365812:2365835	attR	CAGAAAAAAGAAAAGCCCCTTTTC	NA	NA	NA	NA
>prophage 5
NZ_CP024162	Vibrio cholerae strain E7946 chromosome 1, complete sequence	2992571	2454174	2460791	2992571		Staphylococcus_phage(66.67%)	7	NA	NA
WP_000864130.1|2454174_2454645_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	48.7	6.8e-34
WP_001122865.1|2454909_2456019_-	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	39.8	6.7e-64
WP_000493874.1|2456059_2456713_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	38.2	1.2e-31
WP_001131994.1|2456717_2457821_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	33.1	1.3e-43
WP_000543544.1|2457846_2458296_-	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_001890340.1|2458395_2459649_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	49.5	5.0e-100
WP_000210573.1|2459657_2460791_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.4e-64
