assembly_id	genome_id	genome_def	crispr_array_locus_merge	crispr_array_location_merge	crispr_locus_id	crispr_pred_method	array_in_prot	prot_within_array_20000	prot_in_genome	crispr_type_by_cas_prot	consensus_repeat	repeat_length	self-targeting_spacer_number	self-targeting_target_number	spacer_location	protospacer_location	repeat_type	spacer_locus_num	spacer_num	correct_crispr_type	genome_cas_prots	unknown_protein_around_crispr	L10	L10_domain	L9	L9_domain	L8	L8_domain	L7	L7_domain	L6	L6_domain	L5	L5_domain	L4	L4_domain	L3	L3_domain	L2	L2_domain	L1	L1_domain	R1	R1_domain	R2	R2_domain	R3	R3_domain	R4	R4_domain	R5	R5_domain	R6	R6_domain	R7	R7_domain	R8	R8_domain	R9	R9_domain	R10	R10_domain
GCF_002749615.1_ASM274961v1	NZ_CP024201	Caulobacter mirabilis strain FWC 38 chromosome, complete genome	1	355383-355480	1	CRISPRCasFinder	no		WYL,csa3,DEDDh,DinG,cas3	Orphan	GCCTTCTTCGGCGCGGCCTTCTTGGC	26	0	0	NA	NA	NA	1	1	Orphan	WYL,csa3,DEDDh,DinG,cas3	NA|138aa|up_4|NZ_CP024201.1_352134_352548_-,NA|208aa|down_1|NZ_CP024201.1_357331_357955_+	NA|155aa|up_9|NZ_CP024201.1_347972_348437_-	PRK00103, PRK00103, rRNA large subunit methyltransferase; Provisional	NA|131aa|up_8|NZ_CP024201.1_348549_348942_-	TIGR00090, rsfS_iojap_ybeB, ribosome silencing factor RsfS/YbeB/iojap	NA|218aa|up_7|NZ_CP024201.1_349037_349691_-	PRK00071, nadD, nicotinate-nucleotide adenylyltransferase	NA|425aa|up_6|NZ_CP024201.1_349656_350931_-	PRK00197, proA, gamma-glutamyl phosphate reductase; Provisional	NA|377aa|up_5|NZ_CP024201.1_351001_352132_-	PRK05429, PRK05429, gamma-glutamyl kinase; Provisional	NA|138aa|up_4|NZ_CP024201.1_352134_352548_-	NA	NA|351aa|up_3|NZ_CP024201.1_352569_353622_-	PRK12299, obgE, GTPase CgtA; Reviewed	NA|212aa|up_2|NZ_CP024201.1_353734_354370_+	pfam13462, Thioredoxin_4, Thioredoxin	NA|178aa|up_1|NZ_CP024201.1_354377_354911_-	pfam13302, Acetyltransf_3, Acetyltransferase (GNAT) domain	NA|91aa|up_0|NZ_CP024201.1_355062_355335_-	PRK05435, rpmA, 50S ribosomal protein L27; Validated	NA|362aa|down_0|NZ_CP024201.1_356182_357268_+	pfam13847, Methyltransf_31, Methyltransferase domain	NA|208aa|down_1|NZ_CP024201.1_357331_357955_+	NA	NA|357aa|down_2|NZ_CP024201.1_357999_359070_+	COG0523, COG0523, Putative GTPases (G3E family) [General function prediction only]	NA|149aa|down_3|NZ_CP024201.1_359260_359707_-	COG0848, ExbD, Biopolymer transport protein [Intracellular trafficking and secretion]	NA|331aa|down_4|NZ_CP024201.1_359870_360863_+	cd00200, WD40, WD40 domain, found in a number of eukaryotic proteins that cover a wide variety of functions including adaptor/regulatory modules in signal transduction, pre-mRNA processing and cytoskeleton assembly; typically contains a GH dipeptide 11-24 residues from its N-terminus and the WD dipeptide at its C-terminus and is 40 residues long, hence the name WD40; between GH and WD lies a conserved core; serves as a stable propeller-like platform to which proteins can bind either stably or reversibly; forms a propeller-like structure with several blades where each blade is composed of a four-stranded anti-parallel b-sheet; instances with few detectable copies are hypothesized to form larger structures by dimerization; each WD40 sequence repeat forms the first three strands of one blade and the last strand in the next blade; the last C-terminal WD40 repeat completes the blade structure of the first WD40 repeat to create the closed ring propeller-structure; residues on the top and bottom surface of the propeller are proposed to coordinate interactions with other proteins and/or small ligands; 7 copies of the repeat are present in this alignment	NA|221aa|down_5|NZ_CP024201.1_360866_361529_-	cd02136, PnbA_NfnB-like, nitroreductase similar to Mycobacterium smegmatis NfnB	NA|604aa|down_6|NZ_CP024201.1_362590_364402_+	pfam01401, Peptidase_M2, Angiotensin-converting enzyme	NA|442aa|down_7|NZ_CP024201.1_364593_365919_+	COG4961, TadG, Flp pilus assembly protein TadG [Intracellular trafficking and secretion]	NA|616aa|down_8|NZ_CP024201.1_366014_367862_+	COG4961, TadG, Flp pilus assembly protein TadG [Intracellular trafficking and secretion]	NA|810aa|down_9|NZ_CP024201.1_367865_370295_-	TIGR02956, sensor_protein_TorS, TMAO reductase sytem sensor TorS
