The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP024203	Bacillus velezensis strain NKG-1 chromosome, complete genome	4197217	671898	680254	4197217		Synechococcus_phage(57.14%)	8	NA	NA
WP_007408896.1|671898_673191_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	27.3	4.5e-19
WP_007408897.1|673266_673986_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3G7P8	Synechococcus_phage	44.7	5.7e-48
WP_003155758.1|673985_674240_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	M4QPE7	Synechococcus_phage	33.3	4.7e-05
WP_007408898.1|674236_674920_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_099566468.1|674903_677132_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	40.7	4.2e-158
WP_007609856.1|677107_678538_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	32.7	6.2e-54
WP_015239317.1|678629_679670_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	41.9	3.7e-64
WP_007408902.1|679666_680254_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	38.8	1.3e-26
>prophage 2
NZ_CP024203	Bacillus velezensis strain NKG-1 chromosome, complete genome	4197217	1142604	1175767	4197217	protease,tRNA,coat	Planktothrix_phage(16.67%)	37	NA	NA
WP_015417209.1|1142604_1143597_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_025284554.1|1144340_1145975_+	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_015239567.1|1146081_1147017_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_007409113.1|1147020_1147938_+	oligopeptide ABC transporter permease OppC	NA	NA	NA	NA	NA
WP_003155039.1|1147950_1149027_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.9	1.7e-16
WP_015239568.1|1149019_1149937_+	oligopeptide ABC transporter ATP-binding protein OppF	NA	M1HP82	Acanthocystis_turfacea_Chlorella_virus	24.6	1.5e-05
WP_015239569.1|1150043_1151231_+	putative glycoside hydrolase	NA	NA	NA	NA	NA
WP_007409110.1|1151347_1151926_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003155034.1|1152104_1152500_+	transcriptional regulator Spx	NA	NA	NA	NA	NA
WP_007409109.1|1152557_1153214_-	TerC family protein	NA	A0A0S4KZH7	Pseudomonas_phage	41.0	9.9e-31
WP_003155032.1|1153489_1154146_+	adaptor protein MecA	NA	NA	NA	NA	NA
WP_099566553.1|1154296_1155457_+	competence protein CoiA	NA	NA	NA	NA	NA
WP_007409107.1|1155684_1157514_+	oligoendopeptidase F	NA	NA	NA	NA	NA
WP_003155026.1|1157551_1157719_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099566554.1|1158004_1158907_-|protease	protease adaptor protein SpxH	protease	NA	NA	NA	NA
WP_003155023.1|1158903_1159302_-	thiol management oxidoreductase	NA	NA	NA	NA	NA
WP_099566555.1|1159530_1160202_-	lytic transglycosylase domain-containing protein	NA	A0A1P8CWQ1	Bacillus_phage	71.2	7.7e-39
WP_043021301.1|1160206_1160779_-	CYTH domain-containing protein	NA	NA	NA	NA	NA
WP_012117290.1|1160903_1161269_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007610625.1|1161296_1161932_+	GTP diphosphokinase	NA	NA	NA	NA	NA
WP_003155018.1|1161949_1162750_+	NAD kinase	NA	NA	NA	NA	NA
WP_099566556.1|1162764_1163658_+	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	30.6	1.8e-06
WP_099566557.1|1163691_1164441_-	bis(5'-nucleosyl)-tetraphosphatase PrpE	NA	A0A1V0SJW2	Klosneuvirus	26.4	5.8e-11
WP_099566558.1|1164668_1166513_+	monovalent cation:proton antiporter family protein	NA	NA	NA	NA	NA
WP_015417218.1|1166762_1167470_+	thiaminase II	NA	NA	NA	NA	NA
WP_015239576.1|1167447_1168065_+	thiazole tautomerase TenI	NA	NA	NA	NA	NA
WP_099566559.1|1168048_1169158_+	glycine oxidase ThiO	NA	NA	NA	NA	NA
WP_007409096.1|1169154_1169358_+	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_099566560.1|1169354_1170125_+	thiazole synthase	NA	NA	NA	NA	NA
WP_099566561.1|1170121_1171132_+	thiazole biosynthesis adenylyltransferase ThiF	NA	NA	NA	NA	NA
WP_052827264.1|1171154_1171967_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_012117300.1|1172097_1172874_+	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
WP_172424049.1|1172965_1173580_+|coat	spore coat protein	coat	NA	NA	NA	NA
WP_015239582.1|1173637_1174081_-|coat	Spore coat protein Z	coat	NA	NA	NA	NA
WP_003154995.1|1174226_1174709_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_015239583.1|1174859_1175360_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_082997847.1|1175452_1175767_-|coat	spore coat protein	coat	NA	NA	NA	NA
>prophage 3
NZ_CP024203	Bacillus velezensis strain NKG-1 chromosome, complete genome	4197217	1185379	1257756	4197217	protease,portal,capsid,terminase,tail,integrase,plate,holin	Bacillus_phage(40.68%)	96	1187835:1187881	1257908:1257954
WP_012117314.1|1185379_1186501_+	methionine biosynthesis PLP-dependent protein	NA	A0A0B5JD48	Pandoravirus	26.7	3.3e-18
WP_099566564.1|1186493_1187669_+	cystathionine beta-lyase	NA	NA	NA	NA	NA
1187835:1187881	attL	TACCTTGACAGGGTAGAGGTCGCTGGTTCGAGCCCAGTCGGAATCAT	NA	NA	NA	NA
WP_099566565.1|1188037_1189084_+|integrase	tyrosine-type recombinase/integrase	integrase	Q938N9	Temperate_phage	27.0	1.1e-07
WP_039251923.1|1189227_1189566_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_189318609.1|1189791_1189956_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099566566.1|1189945_1190269_+	hypothetical protein	NA	A0A0S2MUA3	Bacillus_phage	37.9	5.8e-08
WP_099566567.1|1190316_1190514_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099566568.1|1190629_1190971_+	hypothetical protein	NA	R4JGJ3	Bacillus_phage	39.2	5.3e-12
WP_099566569.1|1190967_1191336_+	hypothetical protein	NA	A0A2H4J134	uncultured_Caudovirales_phage	39.7	2.6e-20
WP_189318610.1|1191551_1192601_+	hypothetical protein	NA	R4JEY6	Bacillus_phage	42.0	2.3e-61
WP_099566570.1|1192769_1193549_+	DNA replication protein	NA	A0A0N7GFF0	Paenibacillus_phage	55.2	1.4e-76
WP_099566571.1|1193545_1194058_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099566572.1|1194054_1194279_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099566573.1|1194278_1194659_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099566574.1|1194655_1196050_+	DNA helicase	NA	A0A2H4IZL9	uncultured_Caudovirales_phage	47.8	4.4e-113
WP_099566575.1|1196184_1197180_+	toprim domain-containing protein	NA	A0A2H4J6E6	uncultured_Caudovirales_phage	46.2	6.0e-72
WP_099566576.1|1197196_1197436_-	helix-turn-helix transcriptional regulator	NA	O64102	Bacillus_phage	42.6	2.5e-08
WP_099566577.1|1197846_1199031_+	hypothetical protein	NA	A0A0U3TNF6	Bacillus_phage	34.7	6.5e-57
WP_099567267.1|1199210_1199840_+	hypothetical protein	NA	NA	NA	NA	NA
WP_170919545.1|1199982_1200144_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099566578.1|1200140_1200659_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099566579.1|1200896_1201688_+	hypothetical protein	NA	A0A2H4IZK6	uncultured_Caudovirales_phage	44.7	1.3e-45
WP_099566580.1|1201730_1202165_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099566581.1|1202165_1203464_+	hypothetical protein	NA	A0A2H4J459	uncultured_Caudovirales_phage	28.4	5.3e-20
WP_189318611.1|1203629_1203785_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099566582.1|1203819_1206066_+	DNA polymerase I	NA	A0A2H4J6W7	uncultured_Caudovirales_phage	48.2	9.8e-171
WP_099566583.1|1206065_1206977_+	RNA ligase family protein	NA	A0A0K2CNU9	Brevibacillus_phage	55.8	2.0e-85
WP_099566584.1|1206978_1207683_+	3'-5' exonuclease	NA	A0A0N9SJX9	Paenibacillus_phage	43.8	1.7e-33
WP_099566585.1|1207683_1208763_+	hypothetical protein	NA	A0A0N9SHN6	Paenibacillus_phage	44.4	5.0e-56
WP_099566587.1|1209043_1209577_+	crossover junction endodeoxyribonuclease RuvC	NA	A0A0N9ST03	Paenibacillus_phage	41.9	7.8e-10
WP_099566588.1|1209577_1209775_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099566589.1|1209774_1210137_+	hypothetical protein	NA	A0A0K2D038	Bacillus_phage	31.4	4.8e-11
WP_099566590.1|1210142_1210382_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082998376.1|1210378_1210564_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099566591.1|1210568_1210937_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	54.2	2.6e-28
WP_099566592.1|1210908_1213020_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	R4JDX9	Bacillus_phage	79.0	0.0e+00
WP_189318612.1|1213039_1213216_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099567268.1|1213234_1214200_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	F8WQ21	Bacillus_phage	78.3	1.5e-144
WP_189318613.1|1214353_1214500_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099566593.1|1214496_1215075_+	deoxyuridine 5'-triphosphate nucleotidohydrolase	NA	D2XR49	Bacillus_phage	52.7	3.8e-42
WP_099566594.1|1215049_1215439_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099566595.1|1215492_1216251_+	FAD-dependent thymidylate synthase	NA	A0A142F1S2	Bacillus_phage	66.5	7.5e-83
WP_099566596.1|1216220_1216844_+	hypothetical protein	NA	A0A142F1S8	Bacillus_phage	58.8	6.3e-27
WP_099566597.1|1216859_1217363_+	SprT-like domain-containing protein	NA	NA	NA	NA	NA
WP_099566598.1|1217346_1217532_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099566600.1|1218306_1218879_+	dephospho-CoA kinase	NA	M4HPU2	Bacillus_phage	37.2	7.0e-33
WP_099566601.1|1219052_1220003_+	DNA cytosine methyltransferase	NA	A0A1P8CX13	Bacillus_phage	76.3	2.7e-138
WP_099566602.1|1219975_1220365_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099566603.1|1220480_1221659_+	N-6 DNA methylase	NA	A0A0N9ST12	Paenibacillus_phage	65.3	1.0e-147
WP_099566604.1|1221692_1222076_+	DUF134 domain-containing protein	NA	A0A0N9RZI0	Paenibacillus_phage	45.8	6.0e-20
WP_099566605.1|1222075_1222597_+	hypothetical protein	NA	A0A2H4J2L4	uncultured_Caudovirales_phage	50.3	1.1e-32
WP_099566606.1|1222646_1223450_+	hypothetical protein	NA	A0A0N9S810	Paenibacillus_phage	54.6	1.4e-71
WP_189318614.1|1223554_1223716_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099566607.1|1223754_1224567_-	ATP-dependent DNA ligase	NA	O64130	Bacillus_phage	62.3	1.2e-97
WP_099566608.1|1224658_1225006_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013351549.1|1225032_1225212_-	hypothetical protein	NA	A0A1P8CWV7	Bacillus_phage	81.4	1.3e-22
WP_099566609.1|1225343_1225781_-	hypothetical protein	NA	A0A2H4J8A0	uncultured_Caudovirales_phage	67.4	1.4e-49
WP_099566610.1|1225886_1226090_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099566611.1|1226452_1228216_-	right-handed parallel beta-helix repeat-containing protein	NA	F8WPS8	Bacillus_phage	46.9	1.5e-145
WP_099566612.1|1228215_1229013_-	poly-gamma-glutamate hydrolase family protein	NA	O64134	Bacillus_phage	45.8	2.2e-53
WP_069013240.1|1229143_1229368_+	helix-turn-helix transcriptional regulator	NA	D0R7I7	Paenibacillus_phage	71.8	6.2e-09
WP_099566613.1|1229466_1230489_+	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	44.1	1.9e-12
WP_189318615.1|1231470_1231632_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099566614.1|1231996_1232278_+	hypothetical protein	NA	A0A1S5SBT9	Streptococcus_phage	48.8	2.7e-17
WP_145956847.1|1232687_1233173_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145956848.1|1233190_1233376_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099566616.1|1233370_1233919_-|integrase	site-specific integrase	integrase	A0A2H4J6I5	uncultured_Caudovirales_phage	51.1	4.1e-38
WP_099566617.1|1234001_1235756_+|terminase	phage terminase large subunit	terminase	A0A2H4J484	uncultured_Caudovirales_phage	71.4	9.8e-251
WP_046341194.1|1235772_1236204_+	hypothetical protein	NA	A0A2H4J6Z8	uncultured_Caudovirales_phage	50.4	6.5e-31
WP_099566618.1|1236206_1237838_+|portal	phage portal protein	portal	A0A2H4J180	uncultured_Caudovirales_phage	58.4	1.1e-168
WP_099566619.1|1237837_1238662_+|capsid	minor capsid protein	capsid	A0A0N9SJR1	Paenibacillus_phage	52.0	4.1e-74
WP_099566620.1|1238752_1239424_+|protease	Clp protease ClpB	protease	A0A2H4IZP8	uncultured_Caudovirales_phage	45.0	3.0e-14
WP_095352792.1|1239435_1240539_+	DUF5309 family protein	NA	A0A2I7S650	Vibrio_phage	27.6	7.5e-31
WP_095352793.1|1240590_1240827_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099566621.1|1240829_1241048_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095352795.1|1241062_1241449_+	hypothetical protein	NA	A0A0N9SGG4	Paenibacillus_phage	39.8	3.5e-20
WP_169303427.1|1241449_1241785_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099566622.1|1241781_1242189_+	hypothetical protein	NA	A0A0N9SJT1	Paenibacillus_phage	52.9	6.8e-30
WP_033575287.1|1242195_1242585_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029973260.1|1242609_1243164_+	hypothetical protein	NA	A0A0N9SHI3	Paenibacillus_phage	58.4	4.0e-49
WP_095352798.1|1243221_1243593_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099567270.1|1243688_1243925_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099566623.1|1243925_1246724_+|tail	phage tail tape measure protein	tail	A0A0N9SJR9	Paenibacillus_phage	38.3	3.3e-99
WP_099566624.1|1246730_1248155_+|tail	phage tail family protein	tail	A0A2H4JBY6	uncultured_Caudovirales_phage	44.0	1.4e-61
WP_099566625.1|1248166_1249567_+|tail	phage tail protein	tail	A6M966	Geobacillus_virus	31.2	1.9e-39
WP_099566626.1|1249581_1252146_+	peptidase G2	NA	D6R401	Bacillus_phage	74.9	0.0e+00
WP_189318618.1|1252161_1253742_+|plate	phage baseplate upper protein	plate	M4ZRP1	Bacillus_phage	51.4	3.1e-54
WP_014470931.1|1253756_1254026_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014470930.1|1254026_1254215_+	XkdX family protein	NA	NA	NA	NA	NA
WP_033575345.1|1254218_1254428_+	hypothetical protein	NA	A0A290GDY2	Caldibacillus_phage	45.1	2.6e-09
WP_099566627.1|1254507_1255446_+	N-acetylmuramoyl-L-alanine amidase	NA	Q9ZXD7	Bacillus_phage	64.6	1.3e-95
WP_099566628.1|1255467_1255725_+|holin	holin	holin	A0A0U4JE55	Bacillus_phage	57.6	7.3e-22
WP_099566629.1|1255851_1256217_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099566630.1|1256232_1256568_-	YolD-like family protein	NA	O64030	Bacillus_phage	35.4	2.6e-11
WP_013351586.1|1256627_1256834_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_099566631.1|1256970_1257756_+	helix-turn-helix domain-containing protein	NA	A0A288WFX2	Bacillus_phage	29.8	2.8e-16
1257908:1257954	attR	TACCTTGACAGGGTAGAGGTCGCTGGTTCGAGCCCAGTCGGAATCAT	NA	NA	NA	NA
>prophage 4
NZ_CP024203	Bacillus velezensis strain NKG-1 chromosome, complete genome	4197217	1310236	1342027	4197217	portal,capsid,terminase,tail,plate,holin	Bacillus_phage(32.26%)	42	NA	NA
WP_087920760.1|1310236_1311373_+	tetratricopeptide repeat protein	NA	A0A1P8CWN8	Bacillus_phage	47.9	1.3e-94
WP_003154881.1|1311362_1311497_+	PhrA family phosphatase inhibitor	NA	NA	NA	NA	NA
WP_099566660.1|1311639_1312593_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A218KC88	Bacillus_phage	69.3	1.1e-62
WP_007610770.1|1312630_1313008_-	PH domain-containing protein	NA	A5GYQ0	Lactococcus_phage	41.4	1.5e-15
WP_047935636.1|1313118_1313724_+	poly-gamma-glutamate hydrolase family protein	NA	A0A0Y0AJU6	Bacillus_phage	48.3	1.0e-42
WP_007610775.1|1313842_1314433_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A2H4JA43	uncultured_Caudovirales_phage	51.7	3.0e-39
WP_003154871.1|1314581_1314920_-	helix-turn-helix transcriptional regulator	NA	A0A2H4J6F9	uncultured_Caudovirales_phage	45.8	8.4e-18
WP_099566661.1|1315110_1315290_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099566662.1|1315279_1316107_+|portal	phage portal protein	portal	S6BFM4	Thermus_phage	49.0	2.2e-19
WP_014417520.1|1316006_1316807_+	ATP-binding protein	NA	A6XMI1	Bacillus_virus	45.3	3.0e-58
WP_003154863.1|1316806_1316974_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032871270.1|1317402_1317606_+	XtrA/YqaO family protein	NA	A0A2H4J4M6	uncultured_Caudovirales_phage	51.5	1.4e-12
WP_007407279.1|1317719_1318232_+	sigma-70 family RNA polymerase sigma factor	NA	A0A0K2CNQ1	Brevibacillus_phage	44.6	3.8e-22
WP_099566663.1|1318344_1319142_+|terminase	terminase small subunit	terminase	A0A0S2MVB6	Bacillus_phage	49.4	3.6e-59
WP_099566664.1|1319138_1320437_+|terminase	PBSX family phage terminase large subunit	terminase	M4ZRM5	Bacillus_phage	59.2	3.6e-149
WP_094031916.1|1320485_1321877_+|portal	phage portal protein	portal	A0A1B1P7C8	Bacillus_phage	55.8	3.0e-138
WP_007407275.1|1321896_1322742_+|portal	phage portal protein	portal	A0A1B1P7E4	Bacillus_phage	58.1	2.5e-55
WP_007407274.1|1322768_1323704_+|capsid	phage major capsid protein	capsid	A0A1B1P7E3	Bacillus_phage	62.8	3.3e-104
WP_099566665.1|1323720_1324104_+	DUF3199 family protein	NA	NA	NA	NA	NA
WP_007407272.1|1324100_1324457_+	DUF3599 family protein	NA	NA	NA	NA	NA
WP_025284607.1|1324453_1324957_+	HK97 gp10 family phage protein	NA	A0A249XXA4	Clostridium_phage	39.9	1.3e-35
WP_015417289.1|1324953_1325400_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007610809.1|1325396_1325606_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099566666.1|1325605_1327003_+|tail	phage tail sheath family protein	tail	A0A0A7RTT5	Clostridium_phage	40.6	4.8e-83
WP_003154837.1|1327004_1327448_+|tail	phage tail tube protein	tail	A0A0K2CNG3	Brevibacillus_phage	45.2	8.4e-26
WP_003154836.1|1327523_1327970_+|portal	phage portal protein	portal	A0A0A7RTY8	Clostridium_phage	35.8	1.0e-10
WP_015239684.1|1328011_1328164_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099566667.1|1328151_1333197_+	transglycosylase SLT domain-containing protein	NA	A0A1L2JY60	Aeribacillus_phage	47.0	8.7e-42
WP_052827320.1|1333189_1333849_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A090DBR9	Clostridium_phage	34.0	3.4e-23
WP_015239687.1|1333862_1334840_+	hypothetical protein	NA	A0A1L6BY20	Clostridium_phage	30.6	3.7e-34
WP_007610818.1|1334839_1335106_+	DUF2577 family protein	NA	S6C459	Thermus_phage	38.6	1.2e-06
WP_025284611.1|1335209_1335635_+	DUF2634 domain-containing protein	NA	A0A2H4J6K5	uncultured_Caudovirales_phage	38.6	1.1e-11
WP_060561805.1|1335627_1336674_+|plate	baseplate J/gp47 family protein	plate	S6AVU3	Thermus_phage	43.8	1.7e-69
WP_099566668.1|1336657_1337236_+	YmfQ family protein	NA	A0A2H4J717	uncultured_Caudovirales_phage	31.7	8.2e-13
WP_003154822.1|1337232_1337505_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052827325.1|1337507_1339139_+	hypothetical protein	NA	A0A1P8CWR7	Bacillus_phage	33.5	1.6e-53
WP_099566669.1|1339151_1339523_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007610833.1|1339527_1339725_+	XkdX family protein	NA	A0A2H4JAA1	uncultured_Caudovirales_phage	61.8	7.3e-14
WP_099566670.1|1339781_1340543_+|portal	phage portal protein	portal	NA	NA	NA	NA
WP_003154815.1|1340594_1340858_+	hemolysin XhlA family protein	NA	A0A2H4JD40	uncultured_Caudovirales_phage	63.1	8.8e-23
WP_003154813.1|1340871_1341135_+|holin	phage holin	holin	A0A2H4J6M0	uncultured_Caudovirales_phage	65.5	2.3e-23
WP_025284614.1|1341148_1342027_+	N-acetylmuramoyl-L-alanine amidase	NA	Q9ZXD7	Bacillus_phage	60.2	1.1e-80
>prophage 5
NZ_CP024203	Bacillus velezensis strain NKG-1 chromosome, complete genome	4197217	1983571	2143033	4197217	protease,head,portal,capsid,terminase,tail,integrase,plate,holin,tRNA	Bacillus_phage(64.29%)	103	2100063:2100079	2144751:2144767
WP_099566768.1|1983571_1984708_-|holin	choline esterase	holin	NA	NA	NA	NA
WP_099566769.1|1984952_1986452_-	cellulase family glycosylhydrolase	NA	NA	NA	NA	NA
WP_099566770.1|1986901_1987213_+	DUF4870 domain-containing protein	NA	A0A2H4J741	uncultured_Caudovirales_phage	41.7	2.0e-10
WP_099566771.1|1988665_1989373_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	38.0	1.2e-37
WP_042635241.1|1989516_1990788_-	glucuronoxylanase	NA	NA	NA	NA	NA
WP_099566772.1|1990849_1992388_-	carbohydrate-binding protein	NA	NA	NA	NA	NA
WP_099566773.1|1992712_2000569_-	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	22.6	8.3e-124
WP_099566774.1|2000657_2016746_-	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	27.0	7.2e-90
WP_099566775.1|2016790_2028739_-	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	28.2	4.3e-116
WP_085342048.1|2028758_2029961_-	bacillomycin D biosynthesis malonyl-CoA transacylase BamD	NA	NA	NA	NA	NA
WP_014418050.1|2030520_2031306_-	3-hydroxybutyrate dehydrogenase	NA	NA	NA	NA	NA
WP_014305098.1|2031318_2031981_-	CoA transferase subunit B	NA	NA	NA	NA	NA
WP_007410135.1|2031998_2032700_-	CoA transferase subunit A	NA	NA	NA	NA	NA
WP_020954028.1|2032724_2034161_-	GntP family permease	NA	NA	NA	NA	NA
WP_082998091.1|2034465_2035662_-	cytochrome P450	NA	NA	NA	NA	NA
WP_007410132.1|2035663_2036683_-	biotin synthase BioB	NA	NA	NA	NA	NA
WP_059367361.1|2036685_2037387_-	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_099566776.1|2037383_2038544_-	8-amino-7-oxononanoate synthase	NA	D2TEZ5	Emiliania_huxleyi_virus	26.8	1.0e-30
WP_099566777.1|2038533_2039880_-	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	23.2	3.8e-13
WP_099566778.1|2039876_2040647_-	6-carboxyhexanoate--CoA ligase	NA	NA	NA	NA	NA
WP_014418060.1|2040913_2041321_+	GtrA family protein	NA	NA	NA	NA	NA
WP_059367354.1|2041327_2042218_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	54.9	6.8e-83
WP_007410125.1|2042292_2042883_+	DedA family protein	NA	NA	NA	NA	NA
WP_099566779.1|2042937_2044467_-	acyl-CoA carboxylase subunit beta	NA	NA	NA	NA	NA
WP_085342056.1|2044484_2045264_-	enoyl-CoA hydratase	NA	NA	NA	NA	NA
WP_043021172.1|2045277_2046177_-	hydroxymethylglutaryl-CoA lyase	NA	NA	NA	NA	NA
WP_007410121.1|2046192_2046405_-	acetyl-CoA carboxylase biotin carboxyl carrier protein subunit	NA	NA	NA	NA	NA
WP_099566780.1|2046401_2047751_-	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_099566781.1|2047772_2049413_-	AMP-binding protein	NA	Q75ZG1	Hepacivirus	26.7	1.3e-47
WP_099566782.1|2049458_2050601_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_099566783.1|2050741_2052280_-	family 10 glycosylhydrolase	NA	NA	NA	NA	NA
WP_007410116.1|2052401_2052782_-	DUF1360 domain-containing protein	NA	NA	NA	NA	NA
WP_099566784.1|2052854_2056658_-	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	26.6	1.6e-85
WP_099566785.1|2056676_2067452_-	non-ribosomal peptide synthetase	NA	A0A2K9L3I8	Tupanvirus	26.5	1.6e-157
WP_099566786.1|2067477_2075127_-	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	24.4	3.9e-78
WP_099566787.1|2075142_2082840_-	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	26.6	1.4e-160
WP_099566788.1|2082865_2090524_-	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	23.9	7.6e-82
WP_025284824.1|2091003_2092479_-	D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase	NA	NA	NA	NA	NA
WP_015239977.1|2092497_2093466_-	aldose 1-epimerase	NA	NA	NA	NA	NA
WP_007407362.1|2093581_2094970_-	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_099566789.1|2095198_2095741_+	IseA DL-endopeptidase inhibitor family protein	NA	NA	NA	NA	NA
WP_099566790.1|2096083_2097736_+	hypothetical protein	NA	A0A1P8CWI7	Bacillus_phage	54.4	5.7e-67
WP_064107526.1|2097732_2098164_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099566791.1|2098322_2099072_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099566792.1|2099127_2100030_-	N-acetylmuramoyl-L-alanine amidase	NA	Q9ZXD7	Bacillus_phage	91.0	7.7e-159
2100063:2100079	attL	GAAAACAGCCGGATTAA	NA	NA	NA	NA
WP_099566793.1|2100075_2100498_-|holin	phage holin family protein	holin	D6R405	Bacillus_phage	88.7	2.5e-59
WP_043867136.1|2100548_2100737_-	XkdX family protein	NA	Q9ZXD9	Bacillus_phage	98.4	8.2e-31
WP_095352911.1|2100711_2101095_-	hypothetical protein	NA	Q9ZXE0	Bacillus_phage	94.1	4.7e-57
WP_099566794.1|2101091_2102324_-|plate	phage baseplate upper protein	plate	D6R402	Bacillus_phage	89.0	1.9e-155
WP_099566795.1|2102340_2104902_-	peptidase G2	NA	D6R401	Bacillus_phage	96.0	0.0e+00
WP_099566796.1|2104941_2106645_-|tail	phage tail protein	tail	D6R400	Bacillus_phage	99.1	1.8e-310
WP_099566797.1|2106656_2107496_-|tail	phage tail family protein	tail	D6R3Z9	Bacillus_phage	94.3	1.5e-153
WP_099566798.1|2107495_2111371_-|tail	phage tail tape measure protein	tail	D6R3Z8	Bacillus_phage	97.6	0.0e+00
WP_099566799.1|2111571_2111910_-	hypothetical protein	NA	Q9ZXE8	Bacillus_phage	89.3	7.5e-51
WP_099566800.1|2111962_2112571_-|tail	phage tail protein	tail	Q9ZXE9	Bacillus_phage	91.0	2.6e-102
WP_099566801.1|2112571_2112952_-	DUF3168 domain-containing protein	NA	Q9ZXF0	Bacillus_phage	93.5	4.2e-58
WP_061521161.1|2112948_2113332_-	HK97 gp10 family phage protein	NA	Q9ZXF1	Bacillus_phage	98.4	2.5e-66
WP_099566802.1|2113324_2113684_-|head	phage head closure protein	head	Q9ZXF2	Bacillus_phage	89.9	2.9e-53
WP_099566803.1|2113616_2113964_-|head,tail	phage gp6-like head-tail connector protein	head,tail	Q9ZXF3	Bacillus_phage	89.6	2.4e-52
WP_099566804.1|2113978_2114407_-	collagen-like protein	NA	D6R3Z0	Bacillus_phage	70.7	1.2e-37
WP_099566805.1|2114434_2114746_-	hypothetical protein	NA	Q9ZXF5	Bacillus_phage	96.2	4.6e-47
WP_015968216.1|2114757_2115951_-|capsid	phage major capsid protein	capsid	Q9ZXF6	Bacillus_phage	100.0	6.5e-222
WP_099566806.1|2115990_2116617_-|head,protease	HK97 family phage prohead protease	head,protease	Q9ZXF7	Bacillus_phage	99.5	5.8e-113
WP_099566807.1|2116606_2117857_-|portal	phage portal protein	portal	D6R3Y6	Bacillus_phage	98.6	2.0e-242
WP_032858702.1|2117862_2118093_-	hypothetical protein	NA	Q9ZXF9	Bacillus_phage	81.7	7.2e-21
WP_099566808.1|2118104_2119814_-|terminase	terminase large subunit	terminase	D6R3Y4	Bacillus_phage	97.2	0.0e+00
WP_015968210.1|2119813_2120320_-|terminase	phage terminase small subunit P27 family	terminase	Q9ZXG2	Bacillus_phage	100.0	8.8e-88
WP_099566809.1|2120406_2120733_-	transglycosylase	NA	Q9T203	Bacillus_phage	95.4	5.9e-53
WP_080130213.1|2120701_2121076_-	HNH endonuclease	NA	Q38456	Bacillus_phage	94.4	1.2e-68
WP_099566810.1|2121089_2121695_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099566811.1|2121850_2122555_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099566812.1|2122744_2123536_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024085426.1|2123755_2124298_-|integrase	tyrosine-type recombinase/integrase	integrase	D2XR58	Bacillus_phage	66.7	4.7e-63
WP_099566813.1|2124294_2124747_-	DUF1492 domain-containing protein	NA	S6AVV9	Thermus_phage	58.1	6.8e-39
WP_099566814.1|2124765_2124981_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099566815.1|2125101_2125377_-	hypothetical protein	NA	Q38076	Bacillus_phage	33.7	4.9e-08
WP_099566816.1|2125416_2125899_-	hypothetical protein	NA	A0A059VFZ8	Pseudomonas_phage	35.1	1.5e-15
WP_189318599.1|2125912_2126050_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099566817.1|2126046_2126385_-	hypothetical protein	NA	Q9ZXC0	Bacillus_phage	88.4	1.7e-50
WP_099566818.1|2126471_2127212_-	hypothetical protein	NA	A0A2H4J6H9	uncultured_Caudovirales_phage	68.4	3.6e-90
WP_099566819.1|2127307_2127565_-	hypothetical protein	NA	F8WQ54	Bacillus_phage	42.3	9.6e-06
WP_099566820.1|2127578_2127980_-	hypothetical protein	NA	X2JNJ3	Bacillus_phage	51.6	1.9e-32
WP_099566821.1|2127976_2128357_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099566822.1|2128497_2128701_-	XtrA/YqaO family protein	NA	A0A2H4J4M6	uncultured_Caudovirales_phage	53.8	1.3e-13
WP_179946976.1|2128780_2128936_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024085438.1|2128948_2129089_-	BH0509 family protein	NA	NA	NA	NA	NA
WP_099566823.1|2129196_2129745_-	hypothetical protein	NA	A0A0K2CYJ0	Paenibacillus_phage	36.5	2.0e-05
WP_024085440.1|2129741_2129900_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024085441.1|2129896_2130046_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043867634.1|2130060_2130894_-	ATP-binding protein	NA	Q2I8C8	Bacillus_phage	34.4	4.6e-33
WP_099566824.1|2130877_2131750_-	phage replisome organizer N-terminal domain-containing protein	NA	V5UQV4	Oenococcus_phage	44.4	3.2e-45
WP_064107496.1|2131736_2131961_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014305165.1|2131978_2132302_-	DUF771 domain-containing protein	NA	Q9MC19	Lactococcus_phage	40.7	4.6e-13
WP_032858779.1|2132365_2132572_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_014305167.1|2132737_2133136_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_099566825.1|2133567_2134668_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099566826.1|2134910_2136017_+|integrase	site-specific integrase	integrase	Q5YAA6	Bacillus_phage	57.8	1.1e-111
WP_003153850.1|2136290_2136836_-|integrase	site-specific integrase	integrase	A0A0S2GLG4	Bacillus_phage	48.6	2.1e-42
WP_043021794.1|2137150_2137381_-	excisionase family DNA-binding protein	NA	NA	NA	NA	NA
WP_007407357.1|2137624_2139400_+	gamma-glutamyltransferase	NA	NA	NA	NA	NA
WP_015239980.1|2139446_2140622_-	MFS transporter	NA	NA	NA	NA	NA
WP_003153841.1|2140764_2141067_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_099566827.1|2141113_2143033_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	39.7	9.3e-138
2144751:2144767	attR	GAAAACAGCCGGATTAA	NA	NA	NA	NA
>prophage 6
NZ_CP024203	Bacillus velezensis strain NKG-1 chromosome, complete genome	4197217	2409063	2415307	4197217		Staphylococcus_phage(66.67%)	9	NA	NA
WP_007409428.1|2409063_2409657_-	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	36.6	2.6e-14
WP_099566878.1|2409646_2410402_-	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	25.3	5.0e-10
WP_003153376.1|2410609_2410699_+	YjcZ family sporulation protein	NA	NA	NA	NA	NA
WP_003153375.1|2410786_2411308_+	DUF309 domain-containing protein	NA	NA	NA	NA	NA
WP_003153373.1|2411364_2411739_-	GNAT family N-acetyltransferase RibT	NA	NA	NA	NA	NA
WP_003153372.1|2411855_2412320_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	59.3	1.2e-43
WP_003153371.1|2412352_2413549_-	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	54.9	2.1e-116
WP_099566880.1|2413563_2414211_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	44.3	2.0e-39
WP_076425398.1|2414191_2415307_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	36.6	5.7e-55
>prophage 7
NZ_CP024203	Bacillus velezensis strain NKG-1 chromosome, complete genome	4197217	2707359	2773459	4197217	head,portal,capsid,tail,plate,holin,tRNA	Bacillus_phage(32.43%)	79	NA	NA
WP_099566917.1|2707359_2708472_-	tetratricopeptide repeat protein	NA	D6R410	Bacillus_phage	66.8	5.1e-136
WP_099566918.1|2708772_2708997_+	hypothetical protein	NA	O64023	Bacillus_phage	53.3	3.9e-11
WP_099566919.1|2708997_2709981_-	thermonuclease family protein	NA	A0A1P8CWK6	Bacillus_phage	70.2	7.8e-80
WP_099566920.1|2710153_2712007_+	HNH endonuclease	NA	A0A1P8CWI7	Bacillus_phage	45.8	5.5e-119
WP_099566921.1|2712018_2712465_+	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
WP_099567280.1|2712519_2712591_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099566922.1|2712737_2714621_+	DEAD/DEAH box helicase family protein	NA	A0A097BY72	Enterococcus_phage	23.4	1.9e-18
WP_099566923.1|2714624_2714954_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099566924.1|2714989_2715808_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A218KC88	Bacillus_phage	71.1	1.9e-63
WP_099566925.1|2715851_2716274_-|holin	holin family protein	holin	D6R405	Bacillus_phage	72.9	7.5e-48
WP_099566926.1|2716320_2717214_-|portal	phage portal protein	portal	NA	NA	NA	NA
WP_099566927.1|2717300_2717465_-	XkdX family protein	NA	A0A2H4JAA1	uncultured_Caudovirales_phage	58.5	5.1e-13
WP_099566928.1|2717461_2717800_-	XkdW family protein	NA	NA	NA	NA	NA
WP_099566929.1|2717811_2718909_-	hypothetical protein	NA	M4ZRP1	Bacillus_phage	58.2	6.3e-14
WP_099566930.1|2718912_2719185_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099566931.1|2719181_2719760_-	YmfQ family protein	NA	A0A2H4J717	uncultured_Caudovirales_phage	33.1	1.9e-14
WP_099567281.1|2719743_2720790_-|plate	baseplate J/gp47 family protein	plate	S6AVU3	Thermus_phage	44.0	7.5e-73
WP_004398572.1|2720782_2721208_-	DUF2634 domain-containing protein	NA	A0A0A8WJV8	Clostridium_phage	36.4	1.5e-11
WP_099566932.1|2721220_2721487_-	DUF2577 family protein	NA	NA	NA	NA	NA
WP_099566933.1|2721483_2722464_-|portal	phage portal protein	portal	H7BV96	unidentified_phage	32.6	3.2e-41
WP_021480096.1|2722476_2723136_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A090DBR9	Clostridium_phage	34.7	1.6e-25
WP_099566934.1|2723128_2727880_-	transglycosylase SLT domain-containing protein	NA	A0A1L2JY60	Aeribacillus_phage	47.2	3.0e-44
WP_088461984.1|2727925_2728075_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099566935.1|2728098_2728548_-|portal	phage portal protein	portal	A0A0A7RTY8	Clostridium_phage	38.2	2.0e-11
WP_142671712.1|2728715_2728799_+|holin	putative holin-like toxin	holin	NA	NA	NA	NA
WP_099566936.1|2729329_2729434_+|holin	putative holin-like toxin	holin	NA	NA	NA	NA
WP_019712741.1|2729811_2730255_-|tail	phage tail tube protein	tail	A0A0A7RVP1	Clostridium_phage	46.5	5.8e-27
WP_099566937.1|2730256_2731657_-|tail	phage tail sheath family protein	tail	A0A0A7RTT5	Clostridium_phage	40.5	7.2e-79
WP_032679171.1|2731657_2731849_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099566938.1|2731845_2732283_-|portal	phage portal protein	portal	NA	NA	NA	NA
WP_099566939.1|2732295_2732799_-	HK97 gp10 family phage protein	NA	A0A249XXA4	Clostridium_phage	46.9	3.7e-38
WP_099566940.1|2732795_2733158_-	YqbH/XkdH family protein	NA	A0A249XXE9	Clostridium_phage	38.3	3.1e-10
WP_099566941.1|2733154_2733550_-	DUF3199 family protein	NA	NA	NA	NA	NA
WP_041850069.1|2733553_2733865_-	YqbF domain-containing protein	NA	NA	NA	NA	NA
WP_099566942.1|2733875_2734811_-|capsid	phage major capsid protein	capsid	A0A1B1P7E3	Bacillus_phage	65.0	1.5e-104
WP_099566943.1|2734829_2735804_-|portal	phage portal protein	portal	A0A1B1P7E4	Bacillus_phage	56.6	1.8e-57
WP_099566944.1|2735839_2736499_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099566945.1|2736542_2737460_-|head	phage head morphogenesis protein	head	A0A1B1P7D7	Bacillus_phage	39.7	1.3e-52
WP_099566946.1|2737443_2738988_-|portal	phage portal protein	portal	A0A1B1P7C8	Bacillus_phage	51.9	2.8e-148
WP_099566947.1|2740278_2740998_-	hypothetical protein	NA	A0A2P1JTW4	Anoxybacillus_phage	50.8	2.4e-54
WP_099566948.1|2741151_2741631_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099566949.1|2741773_2742229_-	hypothetical protein	NA	A0A2H4J4R7	uncultured_Caudovirales_phage	71.5	5.9e-59
WP_099566950.1|2742328_2743558_-	DUF4935 domain-containing protein	NA	NA	NA	NA	NA
WP_099566951.1|2743759_2744485_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099566952.1|2744533_2744740_-	XtrA/YqaO family protein	NA	A0A2H4J4M6	uncultured_Caudovirales_phage	71.6	5.5e-20
WP_099566953.1|2744820_2745249_-	RusA family crossover junction endodeoxyribonuclease	NA	S6B1L9	Thermus_phage	65.0	4.8e-42
WP_099566954.1|2745343_2745493_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099566955.1|2745483_2746425_-	ATP-binding protein	NA	A6XMI1	Bacillus_virus	52.2	3.6e-58
WP_142671711.1|2746306_2746984_-	DnaD domain protein	NA	A0A2H4J6G9	uncultured_Caudovirales_phage	32.2	1.9e-05
WP_099566957.1|2747061_2747916_-	recombinase RecT	NA	A0A2H4JCY8	uncultured_Caudovirales_phage	78.3	1.8e-120
WP_099566958.1|2747918_2748878_-	YqaJ viral recombinase family protein	NA	A0A2H4JA52	uncultured_Caudovirales_phage	74.8	2.6e-136
WP_099566959.1|2748982_2749177_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142671710.1|2749136_2749310_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029727259.1|2749306_2749564_-	hypothetical protein	NA	A0A2H4J4M9	uncultured_Caudovirales_phage	42.2	4.9e-10
WP_099566960.1|2749560_2750130_-	helix-turn-helix transcriptional regulator	NA	A0A2H4J884	uncultured_Caudovirales_phage	60.4	7.7e-64
WP_088679343.1|2750203_2750344_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099566961.1|2750376_2750586_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_021480133.1|2750741_2751095_+	helix-turn-helix domain-containing protein	NA	A0A0A7RTK4	Clostridium_phage	48.6	8.0e-11
WP_019715123.1|2751336_2751693_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099566962.1|2751919_2752438_+	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_099566963.1|2753306_2754149_+	sialate O-acetylesterase	NA	NA	NA	NA	NA
WP_099566964.1|2754145_2754673_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_099566965.1|2755424_2756723_-	two-component system sensor histidine kinase YrkQ	NA	NA	NA	NA	NA
WP_099566966.1|2756709_2757405_-	two-component response regulator YrkP	NA	W8CYM9	Bacillus_phage	37.6	2.8e-31
WP_099566967.1|2757671_2758889_+	DUF418 domain-containing protein	NA	NA	NA	NA	NA
WP_099566968.1|2759362_2759920_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_032866675.1|2760394_2760931_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_031378922.1|2761094_2761313_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032866673.1|2762164_2762686_-	streptothricin N-acetyltransferase SatA	NA	A0A1B0RXL7	Streptococcus_phage	49.4	2.8e-44
WP_032866670.1|2762843_2763344_-	DinB family protein	NA	NA	NA	NA	NA
WP_080686311.1|2763561_2763894_-	DUF2651 family protein	NA	NA	NA	NA	NA
WP_025285030.1|2764064_2764868_-	HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_032866668.1|2764900_2765713_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_032866666.1|2765949_2766675_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_032866664.1|2766759_2767707_-	mannose-6-phosphate isomerase, class I	NA	NA	NA	NA	NA
WP_032866662.1|2767721_2769680_-	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_032866660.1|2769832_2771785_-	BglG family transcription antiterminator	NA	NA	NA	NA	NA
WP_032866657.1|2772014_2772932_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_012118054.1|2772976_2773459_-|tRNA	Cys-tRNA(Pro) deacylase	tRNA	NA	NA	NA	NA
>prophage 8
NZ_CP024203	Bacillus velezensis strain NKG-1 chromosome, complete genome	4197217	2797146	2838681	4197217	protease,head,portal,capsid,terminase,tail,integrase,plate,holin	Bacillus_phage(60.98%)	59	2794202:2794244	2836785:2836827
2794202:2794244	attL	TTTGTTCAAGGATCGTTTGAATCTTCGTGACCATCAGATCAAT	NA	NA	NA	NA
WP_099566972.1|2797146_2797839_+	hypothetical protein	NA	Q9AZW5	Lactococcus_phage	33.1	9.8e-13
WP_099566973.1|2797945_2798956_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1J0MS59	Bacillus_phage	97.6	2.7e-189
WP_044802500.1|2799004_2799427_-|holin	holin family protein	holin	D6R405	Bacillus_phage	97.7	9.7e-64
WP_044802499.1|2799478_2799667_-	XkdX family protein	NA	Q9ZXD9	Bacillus_phage	96.8	6.9e-30
WP_099566974.1|2799663_2800026_-	hypothetical protein	NA	Q9ZXE0	Bacillus_phage	91.7	6.4e-56
WP_099566975.1|2800022_2801255_-|plate	phage baseplate upper protein	plate	D6R402	Bacillus_phage	81.7	1.2e-141
WP_099566976.1|2801267_2803832_-	peptidase G2	NA	D6R401	Bacillus_phage	57.4	2.7e-289
WP_099566977.1|2803882_2805586_-|tail	phage tail protein	tail	D6R400	Bacillus_phage	56.5	3.3e-179
WP_099566978.1|2805600_2806440_-|tail	phage tail family protein	tail	D6R3Z9	Bacillus_phage	59.0	5.6e-95
WP_099566979.1|2806433_2810921_-|tail	phage tail tape measure protein	tail	A0A1Q1PVX7	Staphylococcus_phage	42.8	3.8e-65
WP_061890675.1|2811127_2811496_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014305137.1|2811554_2812169_-|tail	tail protein	tail	A0A2H4J8F3	uncultured_Caudovirales_phage	34.4	2.9e-24
WP_099566980.1|2812183_2812567_-	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_014305139.1|2812563_2812962_-	HK97 gp10 family phage protein	NA	NA	NA	NA	NA
WP_025852580.1|2812958_2813276_-|head	phage head closure protein	head	A0A2H4JCB1	uncultured_Caudovirales_phage	36.3	4.9e-12
WP_069007359.1|2813265_2813568_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0S2GLH6	Bacillus_phage	39.3	7.5e-10
WP_065522646.1|2813585_2814002_-	hypothetical protein	NA	D6R3Z0	Bacillus_phage	48.5	8.5e-12
WP_069007360.1|2814035_2815328_-|capsid	phage major capsid protein	capsid	A0A0A7RTL2	Clostridium_phage	47.1	5.4e-89
WP_015387941.1|2815365_2815992_-|head,protease	HK97 family phage prohead protease	head,protease	Q9ZXF7	Bacillus_phage	79.1	1.5e-84
WP_015387940.1|2815954_2817235_-|portal	phage portal protein	portal	D6R3Y6	Bacillus_phage	63.3	3.4e-152
WP_069007361.1|2817423_2819133_-|terminase	terminase large subunit	terminase	A0A0S2GLF0	Bacillus_phage	62.6	2.1e-205
WP_061890681.1|2819129_2819645_-|terminase	phage terminase small subunit P27 family	terminase	A6M947	Geobacillus_virus	44.6	5.7e-34
WP_076982849.1|2819875_2820238_-	HNH endonuclease	NA	A0A1U7Q1S7	Geobacillus_virus	54.2	2.1e-30
WP_069007363.1|2820227_2820596_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069007365.1|2820977_2821346_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069007366.1|2821335_2821581_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017417279.1|2822411_2822954_-|integrase	site-specific integrase	integrase	D2XR58	Bacillus_phage	59.4	1.8e-54
WP_069007367.1|2822950_2823403_-	DUF1492 domain-containing protein	NA	S6AVV9	Thermus_phage	56.6	1.1e-36
WP_175384529.1|2823421_2823598_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069007368.1|2823704_2824139_-	hypothetical protein	NA	A0A2H4J8A0	uncultured_Caudovirales_phage	69.3	7.7e-48
WP_069007369.1|2824350_2824539_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069007370.1|2824543_2824726_-	hypothetical protein	NA	A0A1P8CWX9	Bacillus_phage	49.3	7.7e-10
WP_069007372.1|2824895_2825114_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069007373.1|2825113_2825524_-	hypothetical protein	NA	A0A2I6UHP7	Bacillus_phage	73.6	5.7e-53
WP_069007374.1|2825520_2825793_-	hypothetical protein	NA	F8WQ59	Bacillus_phage	51.1	2.0e-17
WP_013351209.1|2825789_2826152_-	hypothetical protein	NA	H6WU17	Pseudomonas_phage	65.9	1.3e-05
WP_069007376.1|2826408_2826888_-	hypothetical protein	NA	A0A059VFZ8	Pseudomonas_phage	35.8	1.1e-15
WP_016938691.1|2826901_2827039_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069007377.1|2827035_2827374_-	hypothetical protein	NA	Q9ZXC0	Bacillus_phage	86.6	3.2e-49
WP_069007378.1|2827483_2827897_-	hypothetical protein	NA	O64129	Bacillus_phage	86.0	1.5e-64
WP_015388417.1|2827900_2828158_-	hypothetical protein	NA	F8WQ54	Bacillus_phage	40.0	6.6e-07
WP_069007379.1|2828170_2828572_-	hypothetical protein	NA	X2JNJ3	Bacillus_phage	53.2	9.9e-34
WP_069007380.1|2828568_2828793_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069007381.1|2828789_2829170_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069007382.1|2829309_2829513_-	XtrA/YqaO family protein	NA	A0A2H4J4M6	uncultured_Caudovirales_phage	55.2	2.0e-14
WP_175384531.1|2829592_2829748_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015387918.1|2829760_2829901_-	BH0509 family protein	NA	NA	NA	NA	NA
WP_061861552.1|2830009_2830558_-	hypothetical protein	NA	A0A0K2CYJ0	Paenibacillus_phage	36.5	2.0e-05
WP_024085440.1|2830554_2830713_-	hypothetical protein	NA	NA	NA	NA	NA
WP_175384532.1|2830709_2830859_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069007393.1|2830873_2831704_-	ATP-binding protein	NA	A0A0U3U1U1	Bacillus_phage	35.1	4.2e-34
WP_099566981.1|2831687_2832566_-	conserved phage C-terminal domain-containing protein	NA	A0A0U3TZZ4	Bacillus_phage	48.7	9.4e-61
WP_099566982.1|2832579_2832897_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041481796.1|2832937_2833129_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_015387909.1|2833298_2833688_+	helix-turn-helix transcriptional regulator	NA	A0A0U4B088	Bacillus_phage	30.6	2.2e-06
WP_099566983.1|2834059_2835241_-	helix-turn-helix transcriptional regulator	NA	A0A288WGA2	Bacillus_phage	25.6	1.3e-09
WP_053574415.1|2835548_2836709_+|integrase	site-specific integrase	integrase	S6C485	Thermus_phage	36.6	1.3e-65
WP_099566984.1|2836773_2837406_-	uridine kinase	NA	A0A1V0SAA3	Catovirus	39.2	3.2e-34
2836785:2836827	attR	TTTGTTCAAGGATCGTTTGAATCTTCGTGACCATCAGATCAAT	NA	NA	NA	NA
WP_003152759.1|2837412_2838681_-	U32 family peptidase	NA	Q6DW11	Phage_TP	32.1	7.3e-38
>prophage 9
NZ_CP024203	Bacillus velezensis strain NKG-1 chromosome, complete genome	4197217	3889964	3934462	4197217	holin,transposase,lysis,coat	Bacillus_phage(40.0%)	49	NA	NA
WP_099567177.1|3889964_3890969_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_189318605.1|3890970_3891711_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_099567179.1|3891703_3892825_-	N-acetylneuraminate synthase family protein	NA	NA	NA	NA	NA
WP_032868197.1|3892824_3893688_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_012118727.1|3893688_3894858_-	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	NA	NA	NA	NA
WP_099567180.1|3894880_3896305_-	CDP-glycerol glycerophosphotransferase family protein	NA	NA	NA	NA	NA
WP_015240806.1|3896309_3897080_-	glycosyltransferase family 2 protein	NA	A0A0F7L2F7	uncultured_marine_virus	25.4	5.8e-06
WP_007614539.1|3897360_3897906_+|coat	spore coat protein GerQ	coat	NA	NA	NA	NA
WP_099567181.1|3897952_3898324_-	DUF423 domain-containing protein	NA	NA	NA	NA	NA
WP_099567182.1|3898387_3899707_-	purine/pyrimidine permease	NA	NA	NA	NA	NA
WP_099567292.1|3899725_3900148_-	YwdI family protein	NA	NA	NA	NA	NA
WP_012118732.1|3900208_3900892_-	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	44.7	3.2e-48
WP_007407698.1|3900906_3901713_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_060562393.1|3901797_3902325_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060562392.1|3902369_3903005_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003150960.1|3902997_3903336_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_099567183.1|3903485_3904298_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_007407702.1|3904329_3904569_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099567184.1|3904668_3906108_-	sucrose-6-phosphate hydrolase	NA	F8WPR5	Bacillus_phage	25.3	5.4e-21
WP_020958006.1|3906104_3907487_-	PTS sucrose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_012118737.1|3907705_3908536_-	transcription antiterminator	NA	NA	NA	NA	NA
WP_025285458.1|3908559_3908874_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015240814.1|3909399_3911811_+	S8 family serine peptidase	NA	A0A217EQY2	Bacillus_phage	36.8	3.8e-19
WP_032868201.1|3911852_3912854_-	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_064108105.1|3913015_3913765_-	oxygen-insensitive NADPH nitroreductase	NA	NA	NA	NA	NA
WP_007407709.1|3913867_3915055_-	FtsW/RodA/SpoVE family cell cycle protein	NA	NA	NA	NA	NA
WP_015240818.1|3915256_3915715_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003150937.1|3916007_3916268_+	spore morphogenesis/germination protein YwcE	NA	NA	NA	NA	NA
WP_007407711.1|3916311_3916680_-	cytochrome aa3 quinol oxidase subunit IV	NA	NA	NA	NA	NA
WP_003150930.1|3916681_3917296_-	cytochrome aa3 quinol oxidase subunit III	NA	NA	NA	NA	NA
WP_012118743.1|3917310_3919260_-	cytochrome aa3 quinol oxidase subunit I	NA	NA	NA	NA	NA
WP_012118744.1|3919287_3920253_-	cytochrome aa3 quinol oxidase subunit II	NA	NA	NA	NA	NA
WP_003150926.1|3920755_3921001_+	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_099567185.1|3921017_3922559_-	UDP-glucose--hexose-1-phosphate uridylyltransferase	NA	NA	NA	NA	NA
WP_007407714.1|3922548_3923733_-	galactokinase	NA	NA	NA	NA	NA
WP_032869853.1|3923784_3924171_-	GtrA family protein	NA	NA	NA	NA	NA
WP_059367558.1|3924250_3924874_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003150917.1|3925209_3925371_+	anti-repressor SinI family protein	NA	NA	NA	NA	NA
WP_099567186.1|3925587_3926268_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_099567187.1|3926267_3926942_+	streptomycin biosynthesis protein StrF	NA	NA	NA	NA	NA
WP_099567188.1|3926962_3927565_-	DsbA family oxidoreductase	NA	NA	NA	NA	NA
WP_099567189.1|3927650_3928907_-	deferrochelatase/peroxidase EfeB	NA	NA	NA	NA	NA
WP_099567190.1|3929320_3929995_-	thiamine phosphate synthase	NA	NA	NA	NA	NA
WP_003150909.1|3929991_3930810_-	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
WP_099567191.1|3930812_3931721_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_007407725.1|3931827_3932214_+|holin	CidA/LrgA family holin-like protein	holin	NA	NA	NA	NA
WP_007407726.1|3932195_3932876_+|lysis	CidB/LrgB family autolysis modulator	lysis	NA	NA	NA	NA
WP_003150901.1|3933004_3933199_+	YwbE family protein	NA	NA	NA	NA	NA
WP_099566689.1|3933312_3934462_+|transposase	IS3 family transposase	transposase	A0A0N9SIX5	Staphylococcus_phage	60.7	2.3e-38
