The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP024289	Escherichia coli O178:H19 strain 2012C-4431 chromosome, complete genome	5074559	8931	16071	5074559		Escherichia_phage(83.33%)	6	NA	NA
WP_001278994.1|8931_9570_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_000590392.1|9566_10829_-	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	1.3e-135
WP_000847985.1|10825_11734_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_001297141.1|11929_12697_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	3.3e-70
WP_001141330.1|12747_13404_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.7	4.3e-50
WP_001272881.1|13509_16071_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.4	3.0e-30
>prophage 2
NZ_CP024289	Escherichia coli O178:H19 strain 2012C-4431 chromosome, complete genome	5074559	87540	95304	5074559	transposase,integrase	Escherichia_phage(66.67%)	6	78720:78733	95614:95627
78720:78733	attL	TACCGCCGCAGTCA	NA	NA	NA	NA
WP_085947771.1|87540_88702_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
WP_000577254.1|88854_90573_+	ATP-binding protein	NA	A0A1B5FPD5	Escherichia_phage	99.8	3.2e-307
WP_000214990.1|90574_92323_+	hypothetical protein	NA	A0A1B5FPH1	Escherichia_phage	99.8	0.0e+00
WP_000448925.1|92394_92811_-	hypothetical protein	NA	A0A1B5FPM5	Escherichia_phage	100.0	1.1e-72
WP_099528455.1|92849_94079_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	99.8	7.6e-234
WP_000162574.1|94821_95304_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
95614:95627	attR	TGACTGCGGCGGTA	NA	NA	NA	NA
>prophage 3
NZ_CP024289	Escherichia coli O178:H19 strain 2012C-4431 chromosome, complete genome	5074559	371213	415642	5074559	holin,integrase,coat,lysis,tail,terminase	Enterobacteria_phage(50.0%)	60	368745:368761	417652:417668
368745:368761	attL	GGTTGTCGATACCAATA	NA	NA	NA	NA
WP_000194515.1|371213_372647_-	glycoside hydrolase family 32 protein	NA	F8WPR5	Bacillus_phage	25.4	7.0e-29
WP_001274887.1|372862_373777_+	aminoimidazole riboside kinase	NA	NA	NA	NA	NA
WP_001197023.1|373848_375096_+	oligosaccharide MFS transporter	NA	NA	NA	NA	NA
WP_001163428.1|375625_375826_-	response regulator inhibitor TorI	NA	K7P7V0	Enterobacteria_phage	100.0	2.4e-33
WP_072617401.1|375950_376295_-	hypothetical protein	NA	K7PJY7	Enterobacterial_phage	98.2	4.5e-59
WP_000545732.1|376321_376489_-	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	98.2	4.9e-27
WP_069912920.1|376546_377347_-	hypothetical protein	NA	K7P7Q8	Enterobacteria_phage	98.5	3.7e-157
WP_000026225.1|377405_377687_-	hypothetical protein	NA	A0A0K2FIU9	Enterobacteria_phage	98.9	1.4e-50
WP_099528308.1|377889_378303_-	ead/Ea22-like family protein	NA	K7P6J7	Enterobacteria_phage	44.1	1.3e-33
WP_099528309.1|378299_378881_-	hypothetical protein	NA	E7C9P6	Salmonella_phage	65.7	3.9e-63
WP_001682200.1|378877_379042_-	DUF2737 family protein	NA	A0A2I6PID4	Escherichia_phage	98.1	1.6e-22
WP_001111304.1|379052_379349_-	DUF2856 family protein	NA	A5VWB0	Enterobacteria_phage	100.0	7.8e-52
WP_000951325.1|379372_379756_-	hypothetical protein	NA	A0A2I6PID1	Escherichia_phage	100.0	3.8e-67
WP_000031367.1|379755_380361_-	ERF family protein	NA	K7P6W7	Enterobacteria_phage	100.0	4.1e-108
WP_001243355.1|380617_380770_-	host cell division inhibitory peptide Kil	NA	A5VWA5	Enterobacteria_phage	100.0	4.7e-21
WP_000972063.1|380754_380889_-	hypothetical protein	NA	K7PHK2	Enterobacteria_phage	100.0	3.1e-16
WP_000597940.1|380972_381221_-	hypothetical protein	NA	K7P6N6	Enterobacteria_phage	100.0	1.6e-37
WP_099528310.1|381396_382020_-	hypothetical protein	NA	K7PKU5	Enterobacteria_phage	98.6	1.7e-109
WP_000340008.1|382031_382358_-	antitermination protein	NA	A4KWR0	Enterobacteria_phage	100.0	2.7e-53
WP_000026554.1|382834_383740_-	hypothetical protein	NA	A4KWU2	Enterobacteria_phage	100.0	6.3e-177
WP_001274755.1|383826_384540_-	LexA family transcriptional regulator	NA	A4KWS8	Enterobacteria_phage	100.0	2.1e-127
WP_000437875.1|384640_384841_+	hypothetical protein	NA	A4KWT7	Enterobacteria_phage	100.0	4.3e-30
WP_000251073.1|384959_385253_+	hypothetical protein	NA	K7P6Y2	Enterobacteria_phage	100.0	2.8e-46
WP_000166207.1|385285_385432_+	DUF2740 domain-containing protein	NA	Q687G5	Enterobacteria_phage	100.0	1.1e-19
WP_099528311.1|385424_386285_+	replication protein	NA	K7PL20	Enterobacteria_phage	99.3	2.5e-159
WP_001331794.1|386392_388273_+	bifunctional DNA primase/helicase	NA	K7PK08	Enterobacteria_phage	100.0	0.0e+00
WP_000807325.1|388349_388556_+	hypothetical protein	NA	K7P7Y0	Enterobacteria_phage	97.1	6.9e-31
WP_085455278.1|388573_388894_+	hypothetical protein	NA	A0A2I6PIG0	Escherichia_phage	74.5	1.3e-36
WP_016262211.1|388898_389153_+	hypothetical protein	NA	A0A2I6PIF4	Escherichia_phage	100.0	1.5e-40
WP_099528312.1|389133_389574_+	recombination protein NinB	NA	A0A2I6PIF6	Escherichia_phage	97.9	1.0e-79
WP_000113772.1|389710_389887_+	NinE family protein	NA	I6RSQ2	Salmonella_phage	100.0	4.6e-28
WP_001504515.1|389889_390291_+	hypothetical protein	NA	G9L690	Escherichia_phage	98.5	9.2e-72
WP_099528313.1|390250_390460_+	protein ninF	NA	G9L691	Escherichia_phage	95.6	4.5e-30
WP_040091916.1|390452_391064_+	recombination protein NinG	NA	A0A2D1GLP2	Escherichia_phage	99.5	1.0e-98
WP_099528314.1|391060_391267_+	protein ninH	NA	Q716C0	Shigella_phage	98.5	3.6e-32
WP_099528315.1|391244_391916_+	serine/threonine protein phosphatase	NA	Q716B9	Shigella_phage	97.8	6.6e-131
WP_099528316.1|391906_392425_+	DUF1133 family protein	NA	A5VW83	Enterobacteria_phage	97.1	9.4e-93
WP_000783734.1|392885_393209_+|holin	phage holin, lambda family	holin	G5DA93	Enterobacteria_phage	100.0	1.3e-52
WP_000229392.1|393192_393669_+	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	100.0	1.7e-88
WP_099528317.1|393665_394133_+|lysis	lysis protein	lysis	A0A291AWW3	Escherichia_phage	94.8	1.8e-74
WP_001139682.1|394120_394273_+	hypothetical protein	NA	Q716B2	Shigella_phage	100.0	2.1e-21
WP_001016386.1|394475_394994_+	Rha family transcriptional regulator	NA	A0A2D1GLJ3	Escherichia_phage	100.0	3.2e-93
WP_000807823.1|395288_395531_+	DUF2560 family protein	NA	A0A0M4R322	Salmonella_phage	98.8	8.3e-36
WP_023241099.1|395532_395712_+	hypothetical protein	NA	A0A088CPS9	Enterobacteria_phage	98.3	3.2e-24
WP_000729922.1|395735_396224_+	DNA-packaging protein gp3	NA	A0A0M3ULC0	Salmonella_phage	100.0	5.0e-88
WP_000417851.1|396201_397701_+|terminase	terminase	terminase	A0A2D1GLW6	Escherichia_phage	100.0	4.8e-307
WP_023486193.1|397701_399867_+	packaging glycoprotein	NA	A0A2D1GLJ6	Escherichia_phage	99.7	0.0e+00
WP_099528318.1|399880_400792_+	scaffolding protein	NA	A0A2D1GLN7	Escherichia_phage	99.7	3.7e-161
WP_059332935.1|400791_402087_+|coat	coat protein	coat	A0A2D1GLV2	Escherichia_phage	99.1	6.1e-242
WP_023486190.1|402404_402905_+	DNA stabilization, phage-associated	NA	G8EYJ2	Enterobacteria_phage	97.6	4.6e-89
WP_052906985.1|402905_404324_+	hypothetical protein	NA	Q9AYZ4	Salmonella_phage	99.2	6.0e-275
WP_052906986.1|404323_405172_+	hypothetical protein	NA	Q716G6	Shigella_phage	98.9	7.3e-103
WP_001701171.1|405171_405627_+	DUF2824 family protein	NA	G5DA79	Enterobacteria_phage	98.0	4.4e-86
WP_099528319.1|405629_406322_+	DNA transfer protein	NA	G5DA80	Enterobacteria_phage	99.1	7.8e-111
WP_001701217.1|406331_407720_+	DNA transfer protein gp20	NA	A0A220NR03	Salmonella_phage	64.9	2.6e-150
WP_099528320.1|407719_409717_+	DNA transfer protein	NA	Q716G2	Shigella_phage	98.6	0.0e+00
WP_099528321.1|409881_412020_+|tail	phage tail protein	tail	Q9AYY6	Salmonella_phage	65.8	4.8e-58
WP_099528322.1|412058_413066_-	acyltransferase family protein	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	27.5	2.4e-12
WP_099528323.1|413249_414398_-|integrase	prophage integrase IntS	integrase	K7P7E1	Enterobacteria_phage	99.0	2.2e-219
WP_000368131.1|414709_415642_-	transporter	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
417652:417668	attR	GGTTGTCGATACCAATA	NA	NA	NA	NA
>prophage 4
NZ_CP024289	Escherichia coli O178:H19 strain 2012C-4431 chromosome, complete genome	5074559	655652	663961	5074559		Enterobacteria_phage(83.33%)	9	NA	NA
WP_000569327.1|655652_656579_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	2.8e-23
WP_000783120.1|656583_657315_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216961.1|657295_657403_-	protein YohO	NA	NA	NA	NA	NA
WP_001240401.1|657462_658194_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001295431.1|658415_660101_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_096844500.1|660097_660817_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295430.1|660863_661334_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_001295429.1|661374_661836_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001326004.1|661960_663961_-	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	95.8	0.0e+00
>prophage 5
NZ_CP024289	Escherichia coli O178:H19 strain 2012C-4431 chromosome, complete genome	5074559	916141	977196	5074559	holin,capsid,tRNA,integrase,lysis,tail,head,portal,terminase	Escherichia_phage(44.83%)	70	908647:908665	945373:945391
908647:908665	attL	GCATTTTCGGCGGATAAGT	NA	NA	NA	NA
WP_001025326.1|916141_917875_-|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.7	8.8e-87
WP_001300190.1|918090_918657_+	VOC family protein	NA	NA	NA	NA	NA
WP_001185741.1|918670_919417_+	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_001214304.1|919804_920905_+	cytochrome c	NA	NA	NA	NA	NA
WP_000176841.1|920929_923359_+	molybdopterin guanine dinucleotide-containing S/N-oxide reductase	NA	NA	NA	NA	NA
WP_000564742.1|923523_924495_-|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_000019588.1|924491_925235_-	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	4.6e-24
WP_000252980.1|925275_925671_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096096185.1|925723_926488_-	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	99.2	6.0e-72
WP_028985372.1|926504_927791_-|integrase	site-specific integrase	integrase	Q20GI2	Phage_258-320	97.2	1.6e-247
WP_001193437.1|927824_928079_-	excisionase	NA	Q859D3	Escherichia_coli_phage	100.0	3.0e-44
WP_032295370.1|928097_928232_-	hypothetical protein	NA	A0A1B5FPC2	Escherichia_phage	88.6	8.7e-19
WP_001367902.1|928513_928885_-	hypothetical protein	NA	Q8W655	Enterobacteria_phage	95.9	4.2e-63
WP_000720013.1|928925_929753_-	hypothetical protein	NA	Q8W654	Enterobacteria_phage	99.6	1.6e-131
WP_028985373.1|930122_930695_-	hypothetical protein	NA	Q8W653	Enterobacteria_phage	67.6	9.7e-75
WP_000553977.1|930700_930883_-	hypothetical protein	NA	Q8W652	Enterobacteria_phage	52.7	2.9e-09
WP_000147364.1|931081_931282_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050457556.1|931278_931752_-	helix-turn-helix domain-containing protein	NA	A0A1B5FPB8	Escherichia_phage	75.4	6.0e-22
WP_028985374.1|932135_932840_-	helix-turn-helix transcriptional regulator	NA	G8C7U1	Escherichia_phage	53.2	2.4e-67
WP_028985375.1|932963_933209_+	helix-turn-helix domain-containing protein	NA	A0A0N7C1T6	Escherichia_phage	52.9	2.2e-12
WP_000867913.1|933279_933573_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096096184.1|933692_934400_+	DNA-binding protein	NA	Q8W645	Enterobacteria_phage	88.5	1.6e-114
WP_000794367.1|934452_935277_+	transporter	NA	Q8W644	Enterobacteria_phage	99.6	1.0e-157
WP_028985377.1|935273_936125_+	hypothetical protein	NA	Q8HA97	Salmonella_phage	68.7	4.8e-102
WP_000618002.1|936121_936346_+	hypothetical protein	NA	A0A1C9II64	Salmonella_phage	52.1	9.8e-15
WP_096096181.1|936342_937254_+	helix-turn-helix domain-containing protein	NA	Q8W642	Enterobacteria_phage	90.6	3.9e-142
WP_028985379.1|937273_938164_+	ATP-binding protein	NA	Q8W641	Enterobacteria_phage	62.9	1.3e-81
WP_028985380.1|938160_939561_+	replicative DNA helicase	NA	Q8W640	Enterobacteria_phage	91.3	1.2e-243
WP_001065352.1|939557_939815_+	hypothetical protein	NA	Q8W639	Enterobacteria_phage	71.1	1.2e-21
WP_050864163.1|939866_940856_+	DUF968 domain-containing protein	NA	S5MW46	Escherichia_phage	99.4	9.5e-195
WP_024213837.1|940874_941309_+	antitermination protein	NA	A0A0P0ZGJ3	Escherichia_phage	98.6	5.3e-81
WP_000691354.1|941815_942763_+	Shiga toxin Stx1 subunit A	NA	Q777W4	Enterobacteria_phage	100.0	3.2e-171
WP_000752026.1|942772_943042_+	Shiga toxin Stx1a subunit B	NA	Q7AYI7	Enterobacteria_phage	100.0	1.6e-43
WP_099528339.1|943545_945483_+	SASA family carbohydrate esterase	NA	S5MDQ7	Escherichia_phage	94.3	0.0e+00
945373:945391	attR	GCATTTTCGGCGGATAAGT	NA	NA	NA	NA
WP_000142786.1|945616_945796_+	DUF1378 family protein	NA	A0A088CBQ0	Shigella_phage	94.9	3.2e-24
WP_001290210.1|945836_946082_+	DUF826 domain-containing protein	NA	A0A2R2Z348	Escherichia_phage	100.0	3.6e-18
WP_000284506.1|946159_946375_+|holin	holin	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_096096232.1|946378_946963_+	hypothetical protein	NA	Q08JA0	Stx2-converting_phage	83.3	3.8e-50
WP_001063217.1|946942_947263_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096096231.1|947388_947922_+	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	96.6	3.6e-100
WP_001056888.1|948196_948769_+	hypothetical protein	NA	A0A088CD55	Shigella_phage	88.4	9.0e-97
WP_032295774.1|948768_948918_+	hypothetical protein	NA	A0A0P0ZG36	Escherichia_phage	77.6	2.0e-11
WP_032295775.1|948920_949358_+|lysis	lysis protein	lysis	A0A0P0ZFH2	Escherichia_phage	97.2	1.8e-68
WP_028985600.1|949560_950103_+	Rha family transcriptional regulator	NA	A0A088CBJ5	Shigella_phage	99.4	4.1e-99
WP_000867498.1|950771_951317_+|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	83.3	9.6e-80
WP_099528340.1|951291_953217_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	98.1	0.0e+00
WP_000198155.1|953213_953420_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJL2	Escherichia_phage	97.1	8.4e-29
WP_001365551.1|953416_955018_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.5	2.1e-308
WP_001702225.1|954998_956318_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.4	1.2e-232
WP_001299443.1|956327_956660_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	100.0	1.7e-55
WP_096096245.1|956714_957740_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.8	3.0e-191
WP_028985614.1|957781_958180_+	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	93.2	5.7e-58
WP_028985615.1|958191_958545_+|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	86.3	1.1e-52
WP_028985616.1|958560_959136_+|tail	tail protein	tail	A0A2R9YJK4	Escherichia_phage	57.8	1.9e-49
WP_000683074.1|959132_959528_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	80.9	2.2e-57
WP_099528341.1|959535_960285_+|tail	phage tail protein	tail	S5M7Q5	Escherichia_phage	94.0	4.8e-130
WP_001299690.1|960300_960732_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	67.4	2.4e-41
WP_071532372.1|960758_961172_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.8	2.3e-41
WP_099528342.1|961152_963732_+|tail	phage tail tape measure protein	tail	S5MBY3	Escherichia_phage	86.1	0.0e+00
WP_000847280.1|963728_964058_+|tail	phage tail protein	tail	S5MW28	Escherichia_phage	99.1	1.2e-58
WP_001365876.1|964057_964756_+|tail	phage minor tail protein L	tail	S5M7Q4	Escherichia_phage	98.3	1.4e-131
WP_099528343.1|964766_965510_+|tail	phage tail protein	tail	S5MQI8	Escherichia_phage	97.6	1.3e-148
WP_072121435.1|965455_966088_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	90.5	4.3e-100
WP_000078853.1|970805_970946_+	Hok/Gef family protein	NA	S5M7Q0	Escherichia_phage	95.7	2.9e-17
WP_062893928.1|971091_972804_+|tail	phage tail protein	tail	S5MDN9	Escherichia_phage	51.0	1.2e-67
WP_000438829.1|972813_973026_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001373129.1|973037_973712_+	DUF4376 domain-containing protein	NA	S5MBX6	Escherichia_phage	90.1	3.3e-114
WP_001217534.1|973981_974230_-	DinI-like family protein	NA	S5MQI1	Escherichia_phage	87.8	8.0e-34
WP_000891610.1|974547_975114_-	hydrolase	NA	NA	NA	NA	NA
WP_001258662.1|975423_977196_+|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
>prophage 6
NZ_CP024289	Escherichia coli O178:H19 strain 2012C-4431 chromosome, complete genome	5074559	1268496	1321900	5074559	holin,tail,portal,protease,terminase	Escherichia_phage(52.73%)	67	NA	NA
WP_000041534.1|1268496_1270923_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.1	7.7e-214
WP_001295396.1|1271121_1271427_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_001321287.1|1271534_1272245_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001138581.1|1272247_1272808_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_000705197.1|1272842_1273184_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_000598292.1|1273318_1273645_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_001295394.1|1273850_1275065_+	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_000836079.1|1275076_1276096_+	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	25.9	9.7e-17
WP_072094462.1|1276153_1276261_+	transporter	NA	NA	NA	NA	NA
WP_028985839.1|1276289_1277564_-	DUF3596 domain-containing protein	NA	B6DZ48	Enterobacteria_phage	61.5	6.2e-154
WP_001368608.1|1277599_1277836_-	excisionase family protein	NA	S4TND0	Salmonella_phage	50.7	6.1e-15
WP_096991160.1|1277921_1280393_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	54.9	1.4e-53
WP_096991161.1|1280488_1280677_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000450222.1|1280673_1280862_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_000389971.1|1281409_1281595_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077637644.1|1281675_1281933_-	hypothetical protein	NA	I6PDF6	Cronobacter_phage	84.2	1.4e-09
WP_000380310.1|1282088_1282241_-	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	53.2	5.1e-07
WP_024173670.1|1282505_1283222_-	helix-turn-helix domain-containing protein	NA	H9C160	Pectobacterium_phage	45.4	2.2e-55
WP_000471550.1|1283271_1283487_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000693935.1|1283483_1283921_+	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	53.0	1.5e-27
WP_052920214.1|1284007_1285018_+	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	89.1	1.5e-171
WP_001379651.1|1285049_1285472_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	90.0	5.7e-72
WP_052920211.1|1285505_1286231_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	70.1	1.8e-86
WP_001151139.1|1286246_1286654_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	59.4	2.2e-33
WP_029374881.1|1286650_1286950_+	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	94.9	4.8e-49
WP_001373171.1|1286978_1287134_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000991478.1|1287130_1287442_+	hypothetical protein	NA	A0A222YY67	Escherichia_phage	79.6	6.5e-49
WP_000829416.1|1287571_1287790_+	hypothetical protein	NA	H6WZG0	Escherichia_phage	70.3	1.2e-06
WP_000651125.1|1287779_1288175_+	hypothetical protein	NA	A0A193GYM6	Enterobacter_phage	60.5	1.6e-36
WP_024173669.1|1288408_1288621_+	Hok/Gef family protein	NA	A0A0P0ZAX5	Stx2-converting_phage	64.3	1.6e-14
WP_001341173.1|1288787_1289060_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	50.8	1.9e-12
WP_099528354.1|1289061_1290111_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	5.9e-110
WP_000904149.1|1290123_1290483_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	61.7	3.3e-36
WP_001367730.1|1290491_1291022_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	71.4	6.0e-71
WP_000917741.1|1291264_1291462_+	hypothetical protein	NA	A0A0P0ZDH6	Stx2-converting_phage	100.0	8.0e-29
WP_099528355.1|1291613_1292672_+	site-specific DNA-methyltransferase	NA	A0A0N7KZF8	Stx2-converting_phage	93.5	3.9e-194
WP_000649753.1|1293054_1294014_+	Shiga toxin Stx2c subunit A	NA	Q776Q3	Enterobacteria_phage	100.0	5.6e-176
WP_000738072.1|1294025_1294295_+	Shiga toxin Stx2a subunit B	NA	Q6DWN4	Enterobacteria_phage	100.0	1.2e-43
WP_099528356.1|1294806_1296753_+	DUF1737 domain-containing protein	NA	S5MDQ7	Escherichia_phage	98.6	0.0e+00
WP_000143458.1|1296890_1297070_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_001290230.1|1297110_1297356_+	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	100.0	8.8e-17
WP_000284510.1|1297433_1297649_+|holin	holin	holin	G9L6J5	Escherichia_phage	100.0	9.0e-34
WP_001457151.1|1297652_1298138_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001092868.1|1298649_1299183_+	lysozyme	NA	G9L6J6	Escherichia_phage	95.5	1.1e-99
WP_012816791.1|1299701_1299887_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000373411.1|1300361_1300838_+	DUF1441 family protein	NA	S5MQK0	Escherichia_phage	100.0	1.9e-84
WP_099528357.1|1300834_1302958_+|terminase	phage terminase large subunit family protein	terminase	S5MDQ1	Escherichia_phage	98.9	0.0e+00
WP_000102416.1|1302954_1303167_+	hypothetical protein	NA	S5MBY8	Escherichia_phage	97.1	8.6e-29
WP_000974567.1|1303166_1304669_+|portal	phage portal protein	portal	Q8VNN6	Enterobacteria_phage	99.8	1.2e-289
WP_122993599.1|1304658_1306638_+|protease	Clp protease ClpP	protease	S5M7Q8	Escherichia_phage	99.2	0.0e+00
WP_001097065.1|1306725_1307052_+	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	100.0	6.1e-50
WP_001281349.1|1307044_1307326_+	hypothetical protein	NA	Q8VNN4	Enterobacteria_phage	97.8	1.0e-45
WP_047082262.1|1307328_1307952_+|tail	tail protein	tail	Q8VNN3	Enterobacteria_phage	99.0	7.5e-105
WP_000682716.1|1307964_1308363_+|tail	tail protein	tail	Q9EYD7	Enterobacteria_phage	100.0	5.9e-71
WP_000235128.1|1308370_1309120_+|tail	phage tail protein	tail	S5M7Q5	Escherichia_phage	94.4	3.6e-130
WP_000479054.1|1309136_1309559_+|tail	phage minor tail protein G	tail	S5MQJ3	Escherichia_phage	100.0	5.1e-73
WP_000532075.1|1309585_1309894_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	99.0	3.0e-54
WP_052920606.1|1309937_1312568_+|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	92.6	0.0e+00
WP_000847280.1|1312564_1312894_+|tail	phage tail protein	tail	S5MW28	Escherichia_phage	99.1	1.2e-58
WP_001373202.1|1312893_1313592_+|tail	phage minor tail protein L	tail	S5M7Q4	Escherichia_phage	97.4	1.2e-130
WP_062867322.1|1313602_1314346_+|tail	phage tail protein	tail	S5MQI8	Escherichia_phage	97.2	5.0e-148
WP_072121435.1|1314291_1314924_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	90.5	4.3e-100
WP_099528358.1|1315163_1318850_+	DUF1983 domain-containing protein	NA	S5MW25	Escherichia_phage	87.9	0.0e+00
WP_000078853.1|1319048_1319189_+	Hok/Gef family protein	NA	S5M7Q0	Escherichia_phage	95.7	2.9e-17
WP_099528359.1|1319333_1320992_+|tail	phage tail protein	tail	S5MDN9	Escherichia_phage	53.4	5.9e-72
WP_000438830.1|1321001_1321214_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001367883.1|1321225_1321900_+	DUF4376 domain-containing protein	NA	S5MBX6	Escherichia_phage	89.2	1.3e-113
>prophage 7
NZ_CP024289	Escherichia coli O178:H19 strain 2012C-4431 chromosome, complete genome	5074559	1613415	1679505	5074559	holin,capsid,integrase,tail,head,protease,portal,terminase	Escherichia_phage(29.79%)	72	1627194:1627221	1679657:1679684
WP_000422045.1|1613415_1614465_-|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
WP_000559280.1|1614684_1615443_+	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	25.0	1.5e-06
WP_001278904.1|1615439_1616030_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_001291216.1|1616069_1616942_-	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001295575.1|1617042_1617663_-	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001285661.1|1617659_1618541_-	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001700591.1|1618678_1618723_+	trp operon leader peptide	NA	NA	NA	NA	NA
WP_099528370.1|1618814_1620377_+	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_000763511.1|1620376_1621972_+	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	3.8e-52
WP_099528458.1|1621975_1623334_+	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.7	1.5e-36
WP_000209520.1|1623345_1624539_+	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_000443056.1|1624538_1625345_+	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000807651.1|1625725_1625905_+	general stress protein	NA	NA	NA	NA	NA
WP_001056491.1|1625990_1626491_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001079509.1|1626536_1627043_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
1627194:1627221	attL	GTGGTATCGATATCCATGTACCACACTG	NA	NA	NA	NA
WP_001049908.1|1628657_1629329_-	DUF4376 domain-containing protein	NA	S5MBX6	Escherichia_phage	83.0	2.8e-105
WP_099528371.1|1629397_1630666_-|tail	phage tail protein	tail	S5MDN9	Escherichia_phage	97.3	1.6e-53
WP_060612545.1|1630815_1631439_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A1U8QHD6	Enterobacteria_phage	59.9	2.6e-65
WP_072121435.1|1636035_1636668_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	90.5	4.3e-100
WP_099528343.1|1636613_1637357_-|tail	phage tail protein	tail	S5MQI8	Escherichia_phage	97.6	1.3e-148
WP_001499019.1|1637367_1638066_-|tail	phage minor tail protein L	tail	S5M7Q4	Escherichia_phage	98.7	2.1e-132
WP_000343411.1|1638065_1638407_-|tail	phage tail protein	tail	A0A0P0ZDL9	Stx2-converting_phage	82.3	6.9e-52
WP_000212883.1|1638399_1641642_-|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	87.7	0.0e+00
WP_122993267.1|1641689_1641899_-	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	98.6	1.5e-33
WP_000710952.1|1641994_1642369_-|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	100.0	4.6e-65
WP_001275448.1|1642383_1643100_-|tail	major tail protein	tail	A0A0P0ZDV1	Stx2-converting_phage	99.2	2.3e-126
WP_000133383.1|1643166_1643511_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	99.1	4.2e-57
WP_000573358.1|1643507_1643954_-	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	99.3	2.0e-75
WP_001029274.1|1643950_1644301_-|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	99.1	6.0e-59
WP_060612395.1|1644310_1644637_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZBH1	Stx2-converting_phage	99.1	2.0e-53
WP_096096223.1|1644633_1647219_-|portal	phage portal protein	portal	B6DZA1	Enterobacteria_phage	97.0	0.0e+00
WP_001063099.1|1647164_1647386_-	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000172990.1|1647430_1649368_-|capsid	phage major capsid protein	capsid	Q6H9U8	Enterobacteria_phage	99.7	0.0e+00
WP_001376400.1|1649431_1651093_-|terminase	terminase large subunit	terminase	A0A0P0ZEI4	Stx2-converting_phage	99.8	0.0e+00
WP_000958387.1|1651089_1651653_-|terminase	terminase small subunit	terminase	A0A0N7KZJ8	Stx2-converting_phage	100.0	8.1e-90
WP_000829192.1|1651943_1652309_-	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	96.7	1.6e-62
WP_000095744.1|1652350_1652551_+	YlcI/YnfO family protein	NA	H6WZK6	Escherichia_phage	97.0	1.3e-29
WP_000828070.1|1652682_1653009_-	TonB family protein	NA	H6WZK5	Escherichia_phage	98.1	6.3e-55
WP_053294045.1|1653353_1653578_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071974579.1|1653642_1653849_-	hypothetical protein	NA	H6WRZ6	Salmonella_phage	63.2	4.6e-11
WP_072095843.1|1654217_1654400_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053294111.1|1654556_1655090_-	lysozyme	NA	G9L6J6	Escherichia_phage	97.7	1.9e-101
WP_096096241.1|1655094_1655310_-|holin	holin	holin	G9L6J5	Escherichia_phage	98.6	5.9e-33
WP_096096240.1|1655387_1655633_-	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	98.8	1.5e-16
WP_062855780.1|1655673_1655853_-	DUF1378 family protein	NA	A0A0P0ZCJ7	Stx2-converting_phage	93.2	1.2e-23
WP_099528372.1|1655987_1657952_-	SASA family carbohydrate esterase	NA	A0A0P0ZBH7	Stx2-converting_phage	79.4	1.2e-297
WP_096096235.1|1659816_1660542_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_099528373.1|1661237_1661666_-	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
WP_000917733.1|1663355_1663553_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	6.8e-28
WP_096695884.1|1663726_1664440_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096695882.1|1664693_1665359_-	antiterminator	NA	I6PDF8	Cronobacter_phage	51.6	1.3e-59
WP_000904135.1|1665351_1665714_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	61.9	9.0e-34
WP_001365882.1|1665726_1666776_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.0	8.5e-109
WP_032347855.1|1666777_1667047_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	50.8	3.6e-11
WP_052327139.1|1667100_1667328_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000042395.1|1667916_1668234_+	DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_000882662.1|1668336_1668549_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	95.7	2.5e-28
WP_000211993.1|1668763_1669315_-	ORF6N domain-containing protein	NA	A0A0N7C203	Escherichia_phage	53.3	5.5e-43
WP_000215512.1|1669666_1669852_-	hypothetical protein	NA	NA	NA	NA	NA
WP_097338867.1|1669911_1670673_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.3	3.4e-75
WP_099528375.1|1670702_1671443_-	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	82.7	2.3e-113
WP_033811891.1|1671449_1672439_-	phage O protein family	NA	U5P0A0	Shigella_phage	61.2	3.9e-55
WP_000705131.1|1672419_1672941_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000476991.1|1672924_1673152_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_001003380.1|1673229_1673637_+	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	45.4	5.5e-24
WP_000380317.1|1673826_1673979_+	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	53.2	5.1e-07
WP_001365839.1|1673990_1674359_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000450222.1|1675143_1675332_+	cell division inhibitor	NA	NA	NA	NA	NA
WP_000092839.1|1675328_1675517_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000034483.1|1675612_1678084_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.6	2.0e-55
WP_000113183.1|1678148_1678397_+	excisionase	NA	NA	NA	NA	NA
WP_000113693.1|1678374_1679505_+|integrase	tyrosine-type recombinase/integrase	integrase	O21940	Phage_21	51.4	4.0e-104
1679657:1679684	attR	GTGGTATCGATATCCATGTACCACACTG	NA	NA	NA	NA
>prophage 8
NZ_CP024289	Escherichia coli O178:H19 strain 2012C-4431 chromosome, complete genome	5074559	1782410	1849807	5074559	holin,tRNA,integrase,tail,portal,protease,terminase	Escherichia_phage(45.61%)	84	1809537:1809553	1858041:1858057
WP_001297484.1|1782410_1783517_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_001297479.1|1783552_1784194_+	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_000423729.1|1784197_1785568_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	4.2e-108
WP_001265481.1|1785735_1786407_+	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000735412.1|1786406_1787867_+	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_028985837.1|1788533_1788815_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050867864.1|1789072_1790962_-|protease	Clp protease ClpP	protease	Q8VNN5	Enterobacteria_phage	51.5	1.2e-182
WP_032307311.1|1791620_1792043_-	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_032307310.1|1792039_1792291_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047090986.1|1792492_1793902_-	AAA family ATPase	NA	A0A2H4JFA4	uncultured_Caudovirales_phage	59.8	1.1e-114
WP_000770163.1|1793898_1794198_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_001204973.1|1794203_1794437_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052904140.1|1794438_1794660_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052904139.1|1794652_1794892_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000609225.1|1794881_1795094_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157774579.1|1795086_1795644_-	host cell division inhibitor Icd-like protein	NA	Q8SBF3	Shigella_phage	40.0	6.0e-13
WP_001403025.1|1795842_1796148_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157774580.1|1796205_1796433_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000103621.1|1796653_1796833_+	hypothetical protein	NA	A0A2H4JB52	uncultured_Caudovirales_phage	58.6	1.5e-10
WP_000182306.1|1796890_1797094_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000953271.1|1797337_1797526_-	AlpA family transcriptional regulator	NA	A0A2H4JB58	uncultured_Caudovirales_phage	64.2	5.9e-13
WP_096970353.1|1797900_1799130_-|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	56.1	8.9e-134
WP_001295435.1|1799378_1800500_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_099528378.1|1800645_1801875_-	peptidase T	NA	NA	NA	NA	NA
WP_000531601.1|1802124_1803261_+	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	9.4e-29
WP_000799399.1|1803244_1804108_+	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_022581964.1|1804273_1804603_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_001373129.1|1804766_1805441_-	DUF4376 domain-containing protein	NA	S5MBX6	Escherichia_phage	90.1	3.3e-114
WP_000438830.1|1805452_1805665_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047082338.1|1805674_1807378_-|tail	phage tail protein	tail	S5MDN9	Escherichia_phage	52.0	1.1e-70
WP_000078855.1|1807522_1807663_-	Hok/Gef family protein	NA	S5M7Q0	Escherichia_phage	93.5	8.5e-17
WP_099528379.1|1807861_1811548_-	DUF1983 domain-containing protein	NA	S5MW25	Escherichia_phage	88.3	0.0e+00
1809537:1809553	attL	GTGATGGCGCTGGTCAC	NA	NA	NA	NA
WP_072121435.1|1811787_1812420_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	90.5	4.3e-100
WP_062867322.1|1812365_1813109_-|tail	phage tail protein	tail	S5MQI8	Escherichia_phage	97.2	5.0e-148
WP_001365876.1|1813119_1813818_-|tail	phage minor tail protein L	tail	S5M7Q4	Escherichia_phage	98.3	1.4e-131
WP_000847280.1|1813817_1814147_-|tail	phage tail protein	tail	S5MW28	Escherichia_phage	99.1	1.2e-58
WP_064506725.1|1814143_1816750_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	77.1	0.0e+00
WP_047081971.1|1816739_1817144_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	77.5	4.5e-42
WP_032330778.1|1817170_1817602_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	65.7	1.5e-40
WP_000235129.1|1817621_1818371_-|tail	phage tail protein	tail	S5M7Q5	Escherichia_phage	94.4	2.1e-130
WP_000682716.1|1818378_1818777_-|tail	tail protein	tail	Q9EYD7	Enterobacteria_phage	100.0	5.9e-71
WP_047082262.1|1818789_1819413_-|tail	tail protein	tail	Q8VNN3	Enterobacteria_phage	99.0	7.5e-105
WP_001281349.1|1819415_1819697_-	hypothetical protein	NA	Q8VNN4	Enterobacteria_phage	97.8	1.0e-45
WP_001097065.1|1819689_1820016_-	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	100.0	6.1e-50
WP_001114424.1|1820103_1822128_-|protease	Clp protease ClpP	protease	S5M7Q8	Escherichia_phage	99.8	0.0e+00
WP_062865652.1|1822072_1823575_-|portal	phage portal protein	portal	Q9EYD2	Enterobacteria_phage	99.6	9.1e-290
WP_157774581.1|1823574_1823787_-	hypothetical protein	NA	S5MBY8	Escherichia_phage	97.1	1.1e-28
WP_001077608.1|1823783_1825907_-|terminase	phage terminase large subunit family protein	terminase	S5MDQ1	Escherichia_phage	99.0	0.0e+00
WP_000373398.1|1825903_1826380_-	DUF1441 family protein	NA	Q8VNN8	Enterobacteria_phage	98.7	1.8e-82
WP_012816791.1|1826854_1827040_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_001092868.1|1827558_1828092_-	lysozyme	NA	G9L6J6	Escherichia_phage	95.5	1.1e-99
WP_001457151.1|1828603_1829089_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000284510.1|1829092_1829308_-|holin	holin	holin	G9L6J5	Escherichia_phage	100.0	9.0e-34
WP_001290230.1|1829385_1829631_-	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	100.0	8.8e-17
WP_000143458.1|1829671_1829851_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_062865884.1|1830001_1831948_-	DUF1737 domain-containing protein	NA	S5MDQ7	Escherichia_phage	97.8	0.0e+00
WP_000738080.1|1832460_1832730_-	Shiga toxin Stx2c subunit B	NA	Q5TJL5	Enterobacteria_phage	100.0	2.1e-43
WP_001365055.1|1832741_1833701_-	Shiga toxin Stx2d subunit A	NA	Q6DWN9	Enterobacteria_phage	100.0	1.6e-175
WP_099528381.1|1834083_1835142_-	site-specific DNA-methyltransferase	NA	A0A0N7KZF8	Stx2-converting_phage	93.2	1.9e-193
WP_000917741.1|1835293_1835491_-	hypothetical protein	NA	A0A0P0ZDH6	Stx2-converting_phage	100.0	8.0e-29
WP_001367730.1|1835733_1836264_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	71.4	6.0e-71
WP_000904149.1|1836272_1836632_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	61.7	3.3e-36
WP_099528382.1|1836644_1837694_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	2.6e-110
WP_001341173.1|1837695_1837968_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	50.8	1.9e-12
WP_047082286.1|1838134_1838347_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	62.9	7.9e-14
WP_001224668.1|1838890_1839073_-	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	95.0	2.6e-26
WP_072095369.1|1839220_1839526_-	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	93.1	5.8e-50
WP_000017341.1|1839522_1839840_-	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	75.0	1.4e-35
WP_047082289.1|1839836_1840553_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.1	8.7e-73
WP_001379651.1|1840586_1841009_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	90.0	5.7e-72
WP_028985607.1|1841040_1842072_-	phage replisome organiser	NA	A0A0U2RT81	Escherichia_phage	69.5	9.9e-86
WP_000693925.1|1842140_1842566_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000887454.1|1842549_1842822_-	hypothetical protein	NA	H6WRX5	Salmonella_phage	50.0	8.5e-13
WP_000986593.1|1842930_1843332_+	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	53.0	1.6e-12
WP_044705396.1|1843359_1843551_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032351442.1|1843550_1843838_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_047082292.1|1844112_1844265_+	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	51.1	4.3e-06
WP_122993601.1|1844420_1844678_+	hypothetical protein	NA	I6PDF6	Cronobacter_phage	84.2	1.4e-09
WP_000389971.1|1844758_1844944_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044808604.1|1845490_1845679_+	cell division inhibitor	NA	NA	NA	NA	NA
WP_000092782.1|1845675_1845864_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_062865829.1|1845959_1848389_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	55.5	3.6e-54
WP_000003742.1|1848450_1848720_+	excisionase	NA	NA	NA	NA	NA
WP_047082091.1|1848688_1849807_+|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z04	Phage_21	43.6	1.9e-82
1858041:1858057	attR	GTGACCAGCGCCATCAC	NA	NA	NA	NA
>prophage 9
NZ_CP024289	Escherichia coli O178:H19 strain 2012C-4431 chromosome, complete genome	5074559	2446074	2502158	5074559	capsid,integrase,lysis,transposase,head,tail,protease,portal,terminase	Enterobacteria_phage(62.07%)	69	2454555:2454601	2502172:2502218
WP_004021921.1|2446074_2447211_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_001402085.1|2447479_2449717_+	phage adsorption protein NrfB	NA	NA	NA	NA	NA
WP_000662373.1|2449703_2452676_+	phage receptor	NA	NA	NA	NA	NA
WP_001224567.1|2452676_2453567_+	DUF4434 family protein	NA	NA	NA	NA	NA
WP_001177469.1|2453749_2454511_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
2454555:2454601	attL	AATGGCGCGCCCTGCAGGATTCGAACCTGCGGCCCACGACTTAGAAG	NA	NA	NA	NA
WP_001201825.1|2455023_2455977_+|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_001226378.1|2456163_2457648_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000937502.1|2457831_2458137_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	76.5	2.8e-12
WP_000239874.1|2458193_2458862_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_120795384.1|2459227_2459341_+	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000836768.1|2459409_2459643_+	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_000086514.1|2459959_2460550_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	7.3e-25
WP_000885616.1|2460647_2461223_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.3	6.5e-103
WP_000279163.1|2461222_2464183_-	hypothetical protein	NA	A0A0K2FIZ6	Escherichia_phage	53.7	4.0e-55
WP_001233071.1|2464247_2464847_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	98.5	4.4e-110
WP_061091987.1|2464917_2468331_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	97.6	0.0e+00
WP_000090891.1|2468391_2469024_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.5	2.2e-96
WP_000194780.1|2468960_2469704_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.8	2.5e-147
WP_001152626.1|2469709_2470408_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	99.6	5.1e-134
WP_000847379.1|2470407_2470737_-|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	100.0	9.6e-59
WP_001774776.1|2470733_2473313_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	90.5	0.0e+00
WP_000459457.1|2473305_2473740_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000479193.1|2473721_2474144_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	85.7	2.2e-60
WP_001378767.1|2474159_2474900_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	97.2	6.8e-129
WP_000683142.1|2474907_2475303_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	99.2	2.9e-70
WP_000975110.1|2475299_2475878_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	97.4	5.0e-79
WP_000752994.1|2475889_2476243_-|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	100.0	9.0e-63
WP_000158880.1|2476254_2476650_-	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	93.9	2.2e-57
WP_000063221.1|2476691_2477717_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	97.9	8.1e-189
WP_001378764.1|2477772_2478105_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	97.3	4.2e-54
WP_032253652.1|2478114_2479434_-	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	98.9	1.6e-234
WP_001369921.1|2479414_2481016_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.9	1.9e-309
WP_000198149.1|2481012_2481219_-|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_001027283.1|2481215_2483141_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.5	0.0e+00
WP_063082806.1|2483115_2483661_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	4.0e-94
WP_001415975.1|2484049_2484244_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	96.9	4.3e-27
WP_000738423.1|2484603_2484897_+	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	91.8	2.0e-44
WP_001228695.1|2484987_2485170_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_001135277.1|2485386_2485884_-	lysozyme	NA	M1FJA0	Enterobacteria_phage	97.0	5.4e-90
WP_000839596.1|2485883_2486099_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_000737266.1|2486687_2487785_+	porin	NA	Q1MVN1	Enterobacteria_phage	76.5	2.2e-155
WP_001204791.1|2487974_2488358_-	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	83.3	4.4e-55
WP_000971068.1|2488443_2488584_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	67.4	5.5e-08
WP_001099700.1|2488580_2488943_-	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	7.3e-60
WP_001570806.1|2488939_2489230_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	94.8	4.3e-47
WP_000224914.1|2489222_2489393_-	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	69.8	2.4e-13
WP_001053009.1|2489392_2489848_-	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.9	9.2e-60
WP_072142085.1|2489844_2489946_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000825400.1|2490038_2490491_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000720581.1|2490487_2491048_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000145917.1|2491533_2491827_-	protein ren	NA	A0A0N6WES4	Escherichia_phage	95.7	1.1e-42
WP_001734999.1|2491823_2492525_-	replication P family protein	NA	A0A0K2FIT1	Enterobacteria_phage	97.4	1.2e-127
WP_016232481.1|2492521_2493451_-	replication protein	NA	M1FN81	Enterobacteria_phage	67.6	1.6e-111
WP_001182866.1|2493537_2494077_-	hypothetical protein	NA	K7PJT7	Enterobacteria_phage	67.0	6.8e-62
WP_000184665.1|2494107_2494335_-	helix-turn-helix domain-containing protein	NA	Q76H55	Enterobacteria_phage	69.0	3.8e-22
WP_001295669.1|2494445_2495138_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	86.1	1.5e-109
WP_000414677.1|2495219_2495693_+	hypothetical protein	NA	K7PLT9	Enterobacteria_phage	61.6	1.3e-53
WP_001288169.1|2495689_2496622_+	hypothetical protein	NA	K7PGT0	Enterobacteria_phage	54.4	2.8e-87
WP_000233576.1|2497106_2497313_+	phage encoded cell division inhibitor protein	NA	K7P6H3	Enterobacteria_phage	85.3	3.2e-28
WP_000995441.1|2497388_2497685_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	99.0	1.1e-48
WP_001430684.1|2497690_2498476_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	99.6	1.1e-148
WP_000186833.1|2498472_2499153_+	YqaJ viral recombinase family protein	NA	B6DZ61	Enterobacteria_phage	98.2	5.1e-131
WP_000682294.1|2499149_2499311_+	DUF1317 family protein	NA	A0A0N7CHV0	Escherichia_phage	96.0	7.7e-22
WP_000129285.1|2499303_2499861_+	phage N-6-adenine-methyltransferase	NA	E5AGF8	Erwinia_phage	62.3	2.0e-61
WP_001386642.1|2499871_2500153_+	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	98.9	5.5e-47
WP_000763385.1|2500251_2500470_+	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	100.0	7.5e-36
WP_000488407.1|2500517_2500796_+	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	97.8	4.9e-48
WP_000446905.1|2500767_2501139_+	helix-turn-helix domain-containing protein	NA	M1FJ59	Enterobacteria_phage	81.0	2.1e-46
WP_001299447.1|2500994_2502158_+|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.3	3.4e-199
2502172:2502218	attR	AATGGCGCGCCCTGCAGGATTCGAACCTGCGGCCCACGACTTAGAAG	NA	NA	NA	NA
>prophage 10
NZ_CP024289	Escherichia coli O178:H19 strain 2012C-4431 chromosome, complete genome	5074559	2845146	2864969	5074559	transposase,plate	uncultured_Caudovirales_phage(50.0%)	15	NA	NA
WP_157774583.1|2845146_2846247_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_033882877.1|2846246_2847383_-|transposase	ISAs1-like element ISEc1 family transposase	transposase	NA	NA	NA	NA
WP_000786991.1|2847782_2848040_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099528405.1|2848041_2852562_-	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	46.5	1.1e-22
WP_000103319.1|2852637_2854779_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.0	1.1e-25
WP_001142958.1|2854988_2855507_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000037397.1|2856203_2856704_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_000123970.1|2856738_2856963_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000056978.1|2857013_2858489_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_000611742.1|2858495_2858909_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000393844.1|2858912_2860763_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_001492738.1|2860726_2861809_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_001113725.1|2861833_2863114_+	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_001080149.1|2863110_2863635_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_000246437.1|2863637_2864969_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
>prophage 11
NZ_CP024289	Escherichia coli O178:H19 strain 2012C-4431 chromosome, complete genome	5074559	3504858	3552759	5074559	holin,tRNA,integrase,lysis,tail,portal,protease,terminase	Escherichia_phage(46.67%)	62	3495155:3495169	3550052:3550066
3495155:3495169	attL	TATTCGTCTGGCGAG	NA	NA	NA	NA
WP_000543828.1|3504858_3505896_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_000332264.1|3505984_3507082_+|integrase	site-specific integrase	integrase	S5MDN5	Escherichia_phage	100.0	4.3e-212
WP_001217557.1|3507143_3507392_+	DinI family protein	NA	S5MQI1	Escherichia_phage	100.0	8.3e-39
WP_001373129.1|3507661_3508336_-	DUF4376 domain-containing protein	NA	S5MBX6	Escherichia_phage	90.1	3.3e-114
WP_000438829.1|3508347_3508560_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099528419.1|3508569_3510228_-|tail	phage tail protein	tail	S5MDN9	Escherichia_phage	53.4	5.9e-72
WP_000078855.1|3510371_3510512_-	Hok/Gef family protein	NA	S5M7Q0	Escherichia_phage	93.5	8.5e-17
WP_047091035.1|3510710_3514397_-	DUF1983 domain-containing protein	NA	S5MW25	Escherichia_phage	88.0	0.0e+00
WP_136754566.1|3514637_3515270_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	89.0	3.7e-99
WP_047091036.1|3515215_3515959_-|tail	phage tail protein	tail	S5MQI8	Escherichia_phage	98.0	1.7e-148
WP_001365876.1|3515969_3516668_-|tail	phage minor tail protein L	tail	S5M7Q4	Escherichia_phage	98.3	1.4e-131
WP_000847298.1|3516667_3516997_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_047087056.1|3516993_3519639_-|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	95.2	0.0e+00
WP_000532074.1|3519682_3519991_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	100.0	7.8e-55
WP_000479054.1|3520017_3520440_-|tail	phage minor tail protein G	tail	S5MQJ3	Escherichia_phage	100.0	5.1e-73
WP_000174601.1|3520455_3521205_-|tail	phage tail protein	tail	S5M7Q5	Escherichia_phage	99.6	4.7e-138
WP_000682704.1|3521212_3521611_-	hypothetical protein	NA	S5MW30	Escherichia_phage	100.0	2.7e-71
WP_000974964.1|3521620_3522247_-	hypothetical protein	NA	S5MBY4	Escherichia_phage	100.0	7.8e-102
WP_001281344.1|3522249_3522531_-	hypothetical protein	NA	S5MDP9	Escherichia_phage	100.0	7.2e-47
WP_001097058.1|3522523_3522850_-	DUF2190 family protein	NA	S5MQJ5	Escherichia_phage	100.0	6.1e-50
WP_001114418.1|3522937_3524962_-|protease	Clp protease ClpP	protease	S5M7Q8	Escherichia_phage	100.0	0.0e+00
WP_000974564.1|3524906_3526409_-|portal	phage portal protein	portal	Q9EYD2	Enterobacteria_phage	100.0	4.8e-291
WP_000102415.1|3526408_3526621_-	hypothetical protein	NA	S5MBY8	Escherichia_phage	98.6	3.0e-29
WP_047087055.1|3526617_3528741_-|terminase	phage terminase large subunit family protein	terminase	Q9EYD1	Enterobacteria_phage	99.6	0.0e+00
WP_000348565.1|3528737_3529214_-	DUF1441 family protein	NA	Q9EYD0	Enterobacteria_phage	100.0	2.1e-83
WP_032307093.1|3529666_3530134_-|lysis	lysis protein	lysis	Q7AYI6	Enterobacteria_phage	86.5	4.8e-64
WP_032307092.1|3530130_3530664_-	lysozyme	NA	Q6H9V6	Enterobacteria_phage	93.8	6.9e-99
WP_000406285.1|3530788_3531076_+	hypothetical protein	NA	I6S632	Salmonella_phage	55.8	1.4e-21
WP_001371270.1|3531080_3531308_-	DUF1327 domain-containing protein	NA	Q5G8W5	Enterobacteria_phage	50.7	4.6e-12
WP_032307095.1|3531335_3531893_-	hypothetical protein	NA	Q08JA0	Stx2-converting_phage	81.7	8.9e-49
WP_000284506.1|3531896_3532112_-|holin	holin	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_001290230.1|3532189_3532435_-	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	100.0	8.8e-17
WP_000143458.1|3532475_3532655_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_047086944.1|3532804_3534751_-	DUF1737 domain-containing protein	NA	Q9EYC8	Enterobacteria_phage	96.5	0.0e+00
WP_000738072.1|3535263_3535533_-	Shiga toxin Stx2a subunit B	NA	Q6DWN4	Enterobacteria_phage	100.0	1.2e-43
WP_032360617.1|3535544_3536504_-	Shiga toxin Stx2 subunit A	NA	Q776Q3	Enterobacteria_phage	99.7	2.1e-175
WP_000483502.1|3536886_3537945_-	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	98.9	2.0e-206
WP_000917735.1|3538096_3538294_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	98.5	1.8e-28
WP_001204806.1|3538509_3538890_-	antitermination protein Q	NA	S5M7R9	Escherichia_phage	100.0	4.9e-67
WP_001202275.1|3538907_3539897_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	98.8	4.7e-194
WP_001061404.1|3539904_3540702_-	KilA-N domain-containing protein	NA	A0A0P0ZCS0	Stx2-converting_phage	100.0	5.2e-151
WP_000767113.1|3540721_3541111_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	100.0	7.1e-69
WP_000210167.1|3541107_3541434_-	LexA family transcriptional regulator	NA	S5FXP5	Shigella_phage	99.1	2.7e-53
WP_001355692.1|3541430_3542084_-	phage N-6-adenine-methyltransferase	NA	A0A0P0ZCC0	Stx2-converting_phage	100.0	1.1e-127
WP_032307264.1|3542178_3542997_-	helix-turn-helix domain-containing protein	NA	A0A0P0ZCQ6	Stx2-converting_phage	98.5	1.1e-119
WP_032307262.1|3542993_3543218_-	hypothetical protein	NA	A5LH70	Enterobacteria_phage	97.3	3.1e-37
WP_032307261.1|3543214_3544366_-	peptidase	NA	A0A0P0ZE80	Stx2-converting_phage	98.4	2.6e-212
WP_000515856.1|3544362_3544914_-	hypothetical protein	NA	A0A0P0ZE62	Stx2-converting_phage	100.0	3.4e-101
WP_001191670.1|3544906_3545167_-	helix-turn-helix transcriptional regulator	NA	A0A0P0ZCZ7	Stx2-converting_phage	100.0	1.6e-40
WP_001020631.1|3545264_3545957_+	helix-turn-helix transcriptional regulator	NA	S5FUZ3	Shigella_phage	95.7	1.4e-120
WP_000135680.1|3546735_3547098_+	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
WP_000081287.1|3547163_3547988_+	DUF2303 family protein	NA	U5P439	Shigella_phage	100.0	6.0e-150
WP_000008232.1|3548115_3548652_+	5'-deoxynucleotidase	NA	S5MW55	Escherichia_phage	100.0	7.4e-101
WP_001242733.1|3548642_3549005_+	phage protein	NA	S5MC15	Escherichia_phage	100.0	1.6e-67
WP_000111288.1|3549001_3549205_+	hypothetical protein	NA	K7PLX1	Enterobacteria_phage	100.0	4.7e-32
WP_000476212.1|3549197_3549437_+	hypothetical protein	NA	S5MQM0	Escherichia_phage	100.0	4.4e-37
WP_001289980.1|3549433_3549988_+	ead/Ea22-like family protein	NA	S5M7T0	Escherichia_phage	100.0	1.8e-102
WP_001014290.1|3549989_3550181_+	hypothetical protein	NA	K7PKJ7	Enterobacteria_phage	98.4	3.3e-27
3550052:3550066	attR	TATTCGTCTGGCGAG	NA	NA	NA	NA
WP_001094869.1|3550183_3550918_+	DUF551 domain-containing protein	NA	S5MC19	Escherichia_phage	100.0	2.2e-140
WP_001061345.1|3550917_3551490_+	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	100.0	2.4e-110
WP_001093917.1|3551526_3551808_+	hypothetical protein	NA	K7PGU0	Enterobacteria_phage	96.8	2.8e-43
WP_000956557.1|3552225_3552759_-	hypothetical protein	NA	K7PKJ4	Enterobacteria_phage	100.0	1.1e-99
>prophage 1
NZ_CP024291	Escherichia coli O178:H19 strain 2012C-4431 plasmid unnamed2, complete sequence	111697	0	13487	111697	integrase	Cronobacter_phage(25.0%)	20	9852:9864	15449:15461
WP_028985386.1|356_1718_-	DUF3560 domain-containing protein	NA	NA	NA	NA	NA
WP_099528461.1|1769_2000_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001027048.1|2964_3156_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000271710.1|3155_3575_-	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_137538285.1|3621_3924_-	antirestriction protein	NA	NA	NA	NA	NA
WP_113441034.1|4012_4255_-	DUF1472 domain-containing protein	NA	NA	NA	NA	NA
WP_099528463.1|4462_5590_-	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_001104895.1|5603_5825_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099528464.1|5825_6509_-	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	38.2	5.6e-29
WP_032236829.1|6585_6891_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001134299.1|6894_7821_-	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
WP_000618108.1|8072_8321_+	DinI-like family protein	NA	Q2A098	Sodalis_phage	46.7	4.1e-14
WP_028985391.1|8317_8755_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	48.4	4.9e-26
WP_001365565.1|8754_9747_+	translesion error-prone DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	59.5	8.0e-101
WP_001365560.1|9776_10025_+	DUF4113 domain-containing protein	NA	F1C5A5	Cronobacter_phage	59.0	1.5e-19
9852:9864	attL	CCCCGTAAAAACA	NA	NA	NA	NA
WP_000340836.1|10029_10422_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001103695.1|10426_11398_-	hypothetical protein	NA	A0A222YXF2	Escherichia_phage	42.9	1.3e-66
WP_028985392.1|11626_12271_+	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	43.5	2.5e-39
WP_000239527.1|12264_12540_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000016958.1|12677_13487_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	97.3	1.2e-54
15449:15461	attR	CCCCGTAAAAACA	NA	NA	NA	NA
>prophage 2
NZ_CP024291	Escherichia coli O178:H19 strain 2012C-4431 plasmid unnamed2, complete sequence	111697	18621	19599	111697		Salmonella_phage(100.0%)	1	NA	NA
WP_001369978.1|18621_19599_+	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	64.5	9.4e-102
>prophage 3
NZ_CP024291	Escherichia coli O178:H19 strain 2012C-4431 plasmid unnamed2, complete sequence	111697	22694	24815	111697		Bacillus_phage(100.0%)	1	NA	NA
WP_072094473.1|22694_24815_-	enterohemolysin T1SS ABC transporter permease/ATPase EhxB	NA	W8CYL7	Bacillus_phage	30.4	9.3e-46
>prophage 4
NZ_CP024291	Escherichia coli O178:H19 strain 2012C-4431 plasmid unnamed2, complete sequence	111697	44254	51031	111697	protease,transposase	Macacine_betaherpesvirus(33.33%)	7	NA	NA
WP_077746874.1|44254_44719_-|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	61.5	5.3e-47
WP_000203483.1|44834_45146_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000264906.1|45173_45365_-	hypothetical protein	NA	NA	NA	NA	NA
WP_028985519.1|45374_45740_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062896385.1|45873_46083_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047091594.1|46245_50148_-|protease	serine protease autotransporter EspP	protease	Q9LA58	Enterobacterial_phage	40.5	1.7e-239
WP_099528467.1|50644_51031_-	thermonuclease	NA	A0A0R6PHV6	Moraxella_phage	33.9	1.9e-10
>prophage 5
NZ_CP024291	Escherichia coli O178:H19 strain 2012C-4431 plasmid unnamed2, complete sequence	111697	54307	59008	111697		Yersinia_phage(50.0%)	2	NA	NA
WP_157774584.1|54307_55690_+	autoagglutinating adhesin Saa	NA	A0A2C9CZB7	Yersinia_phage	34.9	1.8e-05
WP_028985399.1|56920_59008_+	bifunctional siderophore receptor/adhesin Iha	NA	A0A0P0I887	Acinetobacter_phage	32.2	6.8e-09
>prophage 6
NZ_CP024291	Escherichia coli O178:H19 strain 2012C-4431 plasmid unnamed2, complete sequence	111697	66822	67569	111697		Xanthomonas_phage(100.0%)	1	NA	NA
WP_028985403.1|66822_67569_-	type-F conjugative transfer system pilin acetylase TraX	NA	A0A1D6ZIU7	Xanthomonas_phage	32.1	2.1e-05
>prophage 7
NZ_CP024291	Escherichia coli O178:H19 strain 2012C-4431 plasmid unnamed2, complete sequence	111697	95016	95238	111697		Erwinia_phage(100.0%)	1	NA	NA
WP_001278980.1|95016_95238_-	conjugal transfer protein TraR	NA	A0A218M4I6	Erwinia_phage	41.7	4.4e-07
>prophage 8
NZ_CP024291	Escherichia coli O178:H19 strain 2012C-4431 plasmid unnamed2, complete sequence	111697	103267	104089	111697		Yersinia_phage(100.0%)	1	NA	NA
WP_028985438.1|103267_104089_-	DUF945 domain-containing protein	NA	A0A2C9CYF8	Yersinia_phage	39.2	2.7e-46
>prophage 9
NZ_CP024291	Escherichia coli O178:H19 strain 2012C-4431 plasmid unnamed2, complete sequence	111697	107734	110570	111697		Emiliania_huxleyi_virus(50.0%)	3	NA	NA
WP_050864290.1|107734_109693_-	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	27.3	5.1e-22
WP_000005988.1|109757_109991_-	DUF905 domain-containing protein	NA	NA	NA	NA	NA
WP_000290783.1|110048_110570_-	single-stranded DNA-binding protein	NA	I3PGW4	Xanthomonas_phage	73.5	1.3e-46
