The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP024275	Escherichia coli O6:H16 strain M9682-C1 chromosome, complete genome	4778550	612844	678450	4778550	lysis,protease,integrase,transposase,tRNA	Enterobacteria_phage(47.83%)	59	656113:656159	669922:669968
WP_047607918.1|612844_613324_-|tRNA	Cys-tRNA(Pro)/Cys-tRNA(Cys) deacylase YbaK	tRNA	NA	NA	NA	NA
WP_000365126.1|613527_614322_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000806442.1|614459_614801_+	HigA family addiction module antidote protein	NA	A0A222YWD7	Escherichia_phage	75.5	3.2e-41
WP_000083955.1|615116_617621_-	copper-exporting P-type ATPase CopA	NA	A0A218MNH6	uncultured_virus	38.4	2.9e-115
WP_000883034.1|617882_618815_+	glutaminase A	NA	NA	NA	NA	NA
WP_000982172.1|618817_620110_+	amino acid permease	NA	NA	NA	NA	NA
WP_001026747.1|620234_620642_+	Cu(I)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_000970323.1|620642_621101_-	NfeD family protein	NA	NA	NA	NA	NA
WP_000904501.1|621097_622015_-	SPFH/Band 7/PHB domain protein	NA	NA	NA	NA	NA
WP_001157540.1|622160_622838_+	iron ABC transporter ATP-binding protein FetA	NA	G3M9Y6	Bacillus_virus	34.3	1.4e-27
WP_001295323.1|622824_623604_+	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
WP_001300573.1|623666_624521_-	chaperedoxin	NA	NA	NA	NA	NA
WP_000148959.1|624581_625391_-	NADP(+)-dependent aldehyde reductase	NA	NA	NA	NA	NA
WP_001295836.1|625380_626004_-|protease	multifunctional acyl-CoA thioesterase I/protease I/lysophospholipase L1	protease	NA	NA	NA	NA
WP_001110573.1|625974_626661_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.6	2.9e-33
WP_000561872.1|626657_629072_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_047607921.1|629501_633782_+	RHS repeat protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	32.1	1.7e-22
WP_047607924.1|633821_634190_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001157938.1|636373_637468_-|tRNA	tRNA 2-selenouridine(34) synthase MnmH	tRNA	NA	NA	NA	NA
WP_000460145.1|637536_638463_-	HTH-type transcriptional activator AllS	NA	NA	NA	NA	NA
WP_000776388.1|638692_639175_+	ureidoglycolate lyase	NA	NA	NA	NA	NA
WP_000141275.1|639252_640068_+	HTH-type transcriptional repressor AllR	NA	NA	NA	NA	NA
WP_000495357.1|644061_645321_+	DUF1116 domain-containing protein	NA	NA	NA	NA	NA
WP_001306952.1|645331_646147_+	DUF2877 domain-containing protein	NA	NA	NA	NA	NA
WP_000855376.1|646143_647037_+	carbamate kinase	NA	NA	NA	NA	NA
WP_000815566.1|647231_648299_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_001351650.1|648295_648805_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	NA	NA	NA	NA
WP_000212253.1|648922_649645_-	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_000255997.1|649647_650142_-	peptidylprolyl isomerase B	NA	NA	NA	NA	NA
WP_000912345.1|650315_651701_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.9e-45
WP_001143558.1|651736_652258_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000190288.1|652365_652578_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_000729160.1|652579_653446_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
WP_001255226.1|654687_655203_+	fimbria assembly protein	NA	NA	NA	NA	NA
WP_000805422.1|655205_655838_-	fimbria biosynthesis transcriptional regulator FimZ	NA	NA	NA	NA	NA
656113:656159	attL	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
WP_000051902.1|656172_657336_-|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.6	3.0e-200
WP_000446905.1|657191_657563_-	helix-turn-helix domain-containing protein	NA	M1FJ59	Enterobacteria_phage	81.0	2.1e-46
WP_000488419.1|657534_657813_-	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	98.9	1.7e-48
WP_001099705.1|657882_658245_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	95.7	9.5e-60
WP_001393963.1|658241_658382_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	65.1	3.6e-07
WP_001204791.1|658467_658851_+	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	83.3	4.4e-55
WP_000737293.1|659040_660123_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	79.8	3.5e-166
WP_000839596.1|660711_660927_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_001135280.1|660926_661424_+	lysozyme	NA	M1FJA0	Enterobacteria_phage	97.6	1.1e-90
WP_001228695.1|661640_661823_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_000738423.1|661913_662207_-	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	91.8	2.0e-44
WP_001415975.1|662566_662761_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	96.9	4.3e-27
WP_000453611.1|663149_663695_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	2.3e-94
WP_001395371.1|664105_664798_+	hypothetical protein	NA	A0A0E3M194	Enterobacteria_phage	41.8	1.1e-40
WP_000654156.1|664794_665076_+	hypothetical protein	NA	A0A1X7QHA1	Escherichia_phage	50.0	4.1e-18
WP_000235988.1|665085_665790_+	hypothetical protein	NA	A0A1X7QGH6	Escherichia_phage	61.1	3.0e-57
WP_000355602.1|665800_666094_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001393528.1|666769_667510_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001201820.1|668544_669498_-|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_001177481.1|670011_670773_-	DNA-binding transcriptional regulator EnvY	NA	NA	NA	NA	NA
669922:669968	attR	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
WP_001224564.1|670955_671846_-	DUF4434 family protein	NA	NA	NA	NA	NA
WP_001355527.1|671846_674819_-	bacteriophage adsorption protein NfrA	NA	NA	NA	NA	NA
WP_000383906.1|674931_677043_-	phage adsorption protein NrfB	NA	NA	NA	NA	NA
WP_072327956.1|677313_678450_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP024275	Escherichia coli O6:H16 strain M9682-C1 chromosome, complete genome	4778550	904514	912358	4778550	lysis	Enterobacteria_phage(57.14%)	7	NA	NA
WP_000839596.1|904514_904730_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_001135263.1|904729_905227_+	lysozyme	NA	A0A1B5FP97	Escherichia_phage	97.0	9.3e-90
WP_001228696.1|905443_905629_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.2	2.8e-15
WP_001393987.1|907419_909252_+	ParB N-terminal domain-containing protein	NA	A5LH43	Enterobacteria_phage	97.8	1.0e-274
WP_001171282.1|909559_910522_-	hypothetical protein	NA	A0A0A7NV63	Enterobacteria_phage	91.1	4.0e-174
WP_001378636.1|910626_910821_+	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	95.3	2.3e-28
WP_000586337.1|911026_912358_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	37.1	3.2e-20
>prophage 3
NZ_CP024275	Escherichia coli O6:H16 strain M9682-C1 chromosome, complete genome	4778550	994510	1002309	4778550	integrase	Salmonella_phage(83.33%)	13	994423:994436	1010810:1010823
994423:994436	attL	AACAAAAAACCCAT	NA	NA	NA	NA
WP_000290937.1|994510_995563_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	57.3	3.6e-107
WP_001513672.1|995751_995943_-	hypothetical protein	NA	A0A0R6PIH8	Moraxella_phage	65.9	6.8e-09
WP_001047320.1|995958_996528_-	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	43.9	2.9e-39
WP_001247707.1|996653_996875_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000460891.1|996907_997417_+	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	98.2	1.3e-86
WP_000956182.1|997424_997625_+	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	98.5	7.1e-33
WP_001352070.1|997588_997930_+	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	96.5	4.3e-54
WP_001244216.1|997997_998231_+	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	96.1	9.2e-32
WP_000752613.1|998230_998458_+	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	100.0	2.7e-36
WP_000104157.1|998454_999312_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	98.2	4.1e-162
WP_032323488.1|999308_1001723_+	replication endonuclease	NA	E5G6L9	Salmonella_phage	97.1	0.0e+00
WP_001154431.1|1001876_1002065_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	96.8	1.6e-26
WP_001217575.1|1002075_1002309_+	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
1010810:1010823	attR	AACAAAAAACCCAT	NA	NA	NA	NA
>prophage 4
NZ_CP024275	Escherichia coli O6:H16 strain M9682-C1 chromosome, complete genome	4778550	1719282	1739149	4778550	integrase,transposase	Salmonella_phage(30.77%)	19	1710505:1710518	1733927:1733940
1710505:1710518	attL	ATTTCATCTTTTGT	NA	NA	NA	NA
WP_000527809.1|1719282_1720743_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	1.5e-42
WP_000347500.1|1720831_1722115_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_120795384.1|1722718_1722832_+	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000836768.1|1722900_1723134_+	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_000887491.1|1724704_1724917_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	97.1	1.7e-29
WP_001557860.1|1724961_1725069_+	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	100.0	3.8e-09
WP_085947771.1|1726032_1727195_-|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
WP_040036049.1|1727266_1729723_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	57.5	8.5e-59
WP_001296941.1|1729810_1730047_+	excisionase family protein	NA	S4TND0	Salmonella_phage	50.7	6.1e-15
WP_000876998.1|1730081_1731362_+|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	62.6	7.8e-157
WP_001389342.1|1731363_1731492_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001394316.1|1731549_1732569_-	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	25.9	7.4e-17
WP_001355548.1|1732580_1733795_-	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	4.1e-46
WP_000598292.1|1734000_1734327_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
1733927:1733940	attR	ACAAAAGATGAAAT	NA	NA	NA	NA
WP_000705211.1|1734461_1734803_+	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001138581.1|1734837_1735398_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_001321287.1|1735400_1736111_-	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001300836.1|1736218_1736524_+	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_000041677.1|1736722_1739149_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.1	3.8e-213
>prophage 5
NZ_CP024275	Escherichia coli O6:H16 strain M9682-C1 chromosome, complete genome	4778550	2301559	2311000	4778550		Enterobacteria_phage(85.71%)	10	NA	NA
WP_001333512.1|2301559_2302696_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.7	1.9e-162
WP_001355588.1|2302692_2304693_+	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	96.0	0.0e+00
WP_001295429.1|2304817_2305279_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_000950409.1|2305318_2305789_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	5.2e-82
WP_000598641.1|2305835_2306555_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295431.1|2306551_2308237_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_001240401.1|2308458_2309190_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001216963.1|2309249_2309357_+	protein YohO	NA	NA	NA	NA	NA
WP_000783115.1|2309337_2310069_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_000569357.1|2310073_2311000_-	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	1.7e-23
>prophage 6
NZ_CP024275	Escherichia coli O6:H16 strain M9682-C1 chromosome, complete genome	4778550	2525820	2592392	4778550	tail,portal,head,capsid,holin,integrase,tRNA,terminase	Enterobacteria_phage(85.0%)	74	2587153:2587166	2594707:2594720
WP_001283585.1|2525820_2526633_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_001289167.1|2526632_2527646_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001705257.1|2527711_2528869_-	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	28.8	6.0e-23
WP_000023402.1|2529027_2530032_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M4RTQ0	Salmonella_phage	55.7	4.5e-99
WP_001390705.1|2530128_2530449_-	helix-turn-helix transcriptional regulator	NA	Q1JS37	Enterobacteria_phage	43.2	1.4e-14
WP_001705258.1|2530562_2530850_+	regulatory phage cox family protein	NA	A0A0M4RCW1	Salmonella_phage	53.7	1.1e-23
WP_000200503.1|2530856_2531063_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000813363.1|2531315_2531657_+	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	92.2	2.3e-55
WP_004095521.1|2531667_2531955_+	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	75.8	3.0e-32
WP_000514277.1|2531966_2532209_+	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	100.0	2.3e-38
WP_001363442.1|2532205_2532319_+	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	97.3	2.8e-10
WP_001583389.1|2532408_2532672_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000985149.1|2532671_2532875_+	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	85.1	2.5e-25
WP_001705849.1|2532871_2533138_+	winged helix-turn-helix transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	75.0	4.9e-29
WP_001366666.1|2533134_2533434_+	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	97.0	5.5e-45
WP_001036813.1|2533445_2533649_+	hypothetical protein	NA	A0A0A7NQ74	Enterobacteria_phage	98.5	8.3e-29
WP_001705848.1|2533645_2534476_+	SPFH domain / Band 7 family protein	NA	A0A0A7NPW9	Enterobacteria_phage	98.2	9.0e-130
WP_114077967.1|2534529_2535150_+	hypothetical protein	NA	S5MQL6	Escherichia_phage	46.7	5.3e-10
WP_000599382.1|2535146_2535512_+	hypothetical protein	NA	A0A0A7NRY1	Enterobacteria_phage	97.5	1.7e-61
WP_001706443.1|2535518_2538266_+	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	96.6	0.0e+00
WP_000484450.1|2538311_2539121_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000763711.1|2539104_2539443_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000723541.1|2539459_2540839_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001706445.1|2541369_2542416_-|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	99.4	6.3e-205
WP_047607857.1|2542415_2544167_-	oxidoreductase	NA	A0A0A7NV54	Enterobacteria_phage	97.8	0.0e+00
WP_000180564.1|2544321_2545158_+|capsid	phage capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	80.2	7.2e-119
WP_047607859.1|2545181_2546234_+|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	92.0	3.1e-183
WP_032251099.1|2546279_2547080_+|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	88.3	1.4e-124
WP_000063103.1|2547182_2547677_+|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	99.4	1.2e-89
WP_000864897.1|2547676_2547877_+|tail	tail protein	tail	A0A0A7NV57	Enterobacteria_phage	98.5	6.0e-32
WP_000104350.1|2547879_2548203_+|holin	holin	holin	A0A0A7NRY9	Enterobacteria_phage	99.1	1.6e-50
WP_000072332.1|2548199_2548592_+	M15 family metallopeptidase	NA	A0A0A7NQ86	Enterobacteria_phage	99.2	1.3e-70
WP_000780570.1|2548588_2548996_+	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	98.5	3.4e-66
WP_032303454.1|2549133_2549601_+|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	99.4	1.0e-85
WP_032303455.1|2549593_2550229_+	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	98.1	7.6e-113
WP_000885638.1|2552041_2552659_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	80.9	1.0e-85
WP_001418511.1|2552622_2553168_-	serine acetyltransferase	NA	NA	NA	NA	NA
WP_032251504.1|2553356_2553845_-|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	98.8	3.0e-85
WP_032303460.1|2553857_2556665_-|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	97.1	0.0e+00
WP_000763327.1|2556651_2556780_-|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	97.6	3.0e-16
WP_000665308.1|2556815_2557181_-|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	97.5	3.8e-56
WP_000290450.1|2557235_2557748_-|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	100.0	3.2e-93
WP_000005415.1|2557747_2558932_-|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	98.5	1.5e-223
WP_047607868.1|2559089_2560199_+	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	94.3	1.1e-194
WP_000488107.1|2560241_2560502_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_000078916.1|2560692_2560833_+	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	97.8	1.5e-18
WP_001420124.1|2561010_2561343_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000615834.1|2562507_2563503_+	flagella biosynthesis regulator Flk	NA	NA	NA	NA	NA
WP_000127751.1|2563499_2564678_-	arabinose transporter	NA	NA	NA	NA	NA
WP_000817178.1|2564942_2566163_-	beta-ketoacyl-ACP synthase I	NA	NA	NA	NA	NA
WP_047607871.1|2566321_2568328_+|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
WP_000559764.1|2568448_2568727_-	YfcL family protein	NA	NA	NA	NA	NA
WP_001089222.1|2568760_2569309_-	elongation factor P hydroxylase	NA	NA	NA	NA	NA
WP_000447361.1|2569308_2570118_-	TSUP family transporter	NA	NA	NA	NA	NA
WP_001043825.1|2570117_2570942_-	penicillin-insensitive murein endopeptidase	NA	NA	NA	NA	NA
WP_001333535.1|2570945_2572031_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	47.8	9.1e-90
WP_001300582.1|2572065_2572998_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_000730806.1|2573163_2573715_+	endonuclease SmrB	NA	NA	NA	NA	NA
WP_000698745.1|2573785_2574607_-	YfcO family protein	NA	NA	NA	NA	NA
WP_001043398.1|2574608_2575148_-	fimbrial protein	NA	NA	NA	NA	NA
WP_001232541.1|2575144_2575633_-	fimbrial protein	NA	NA	NA	NA	NA
WP_001311011.1|2575629_2576142_-	fimbrial protein	NA	NA	NA	NA	NA
WP_001281606.1|2576141_2576894_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_001416631.1|2576913_2579559_-	fimbrial usher protein YfcU	NA	NA	NA	NA	NA
WP_000033316.1|2579640_2580204_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_001195819.1|2580884_2581370_-	phosphohistidine phosphatase SixA	NA	NA	NA	NA	NA
WP_000426176.1|2581572_2583717_-	fatty acid oxidation complex subunit alpha FadJ	NA	NA	NA	NA	NA
WP_000531952.1|2583716_2585027_-	acetyl-CoA C-acyltransferase FadI	NA	NA	NA	NA	NA
WP_001296261.1|2585207_2585492_-	YfcZ/YiiS family protein	NA	NA	NA	NA	NA
WP_001295701.1|2585863_2587204_+	long-chain fatty acid transporter FadL	NA	NA	NA	NA	NA
2587153:2587166	attL	GTCTGAAGGTAAAG	NA	NA	NA	NA
WP_000937788.1|2587569_2588628_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000776768.1|2588809_2589565_-	phospholipid-binding lipoprotein MlaA	NA	NA	NA	NA	NA
WP_000368140.1|2589858_2590791_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	99.0	2.5e-165
WP_001535474.1|2591105_2592392_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	37.3	1.1e-65
2594707:2594720	attR	CTTTACCTTCAGAC	NA	NA	NA	NA
>prophage 7
NZ_CP024275	Escherichia coli O6:H16 strain M9682-C1 chromosome, complete genome	4778550	2747822	2784269	4778550	holin,tail,integrase,transposase	Escherichia_phage(64.71%)	39	2749473:2749489	2781155:2781171
WP_001344399.1|2747822_2747996_+	DUF2633 family protein	NA	G9L6F2	Escherichia_phage	100.0	6.8e-24
WP_000669402.1|2748311_2748827_+	glycine zipper 2TM domain-containing protein	NA	G9L6F1	Escherichia_phage	100.0	1.0e-62
WP_000755173.1|2748842_2749382_+	DUF5384 family protein	NA	G9L6F0	Escherichia_phage	100.0	3.4e-45
2749473:2749489	attL	AATCATTCCCACTCAAT	NA	NA	NA	NA
WP_044316652.1|2749576_2750074_-	DUF2514 family protein	NA	A0A193GYU6	Enterobacter_phage	65.8	2.3e-48
WP_025651158.1|2750070_2750700_-	glycoside hydrolase family 19 protein	NA	G9L6E8	Escherichia_phage	97.1	2.0e-113
WP_001546697.1|2750689_2750998_-|holin	phage holin family protein	holin	G9L6E7	Escherichia_phage	95.1	1.2e-47
WP_044316653.1|2750984_2751389_-	membrane protein	NA	G9L6E6	Escherichia_phage	91.0	2.0e-58
WP_095033698.1|2751536_2752952_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001295213.1|2753008_2754031_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	98.8	2.5e-198
WP_001317493.1|2754027_2754810_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	5.9e-139
WP_001546908.1|2756291_2756549_+	hypothetical protein	NA	A0A0F6R8M4	Escherichia_coli_O157_typing_phage	97.6	3.7e-42
WP_044316654.1|2756571_2757300_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044316655.1|2757492_2757777_+	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_095033715.1|2757772_2758387_+	anti-repressor protein	NA	G9L6E2	Escherichia_phage	85.4	3.1e-95
WP_000671196.1|2758668_2759112_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000708858.1|2759205_2759367_+	hypothetical protein	NA	G9L6D9	Escherichia_phage	100.0	2.5e-20
WP_024203028.1|2759398_2759695_-	hypothetical protein	NA	A0A2R9YJP3	Escherichia_phage	99.0	5.6e-50
WP_044317170.1|2759891_2762366_-	phage protein	NA	A0A0F6TK45	Escherichia_coli_O157_typing_phage	96.5	0.0e+00
WP_044316658.1|2762371_2764174_-	hypothetical protein	NA	A0A0F6TJQ3	Escherichia_coli_O157_typing_phage	97.5	0.0e+00
WP_044316659.1|2764170_2766684_-	bacteriophage protein	NA	A0A0F6R8M6	Escherichia_coli_O157_typing_phage	98.7	0.0e+00
WP_044316662.1|2768779_2769766_-	phage protein	NA	G9L6C5	Escherichia_phage	98.8	1.4e-185
WP_044316663.1|2769780_2770476_-	peptidase	NA	G9L6C4	Escherichia_phage	98.3	1.9e-93
WP_000133160.1|2770478_2770775_-	hypothetical protein	NA	G9L6C3	Escherichia_phage	100.0	1.3e-46
WP_000852414.1|2770771_2772451_-|tail	tail protein	tail	G9L6C2	Escherichia_phage	99.3	8.0e-303
WP_047608207.1|2772465_2772663_-	hypothetical protein	NA	G9L6C1	Escherichia_phage	98.4	1.7e-07
WP_001406039.1|2772895_2773681_-	hypothetical protein	NA	A0A0F6TJ71	Escherichia_coli_O157_typing_phage	100.0	9.3e-153
WP_047608200.1|2773677_2774469_-	primosomal protein	NA	Q286X4	Escherichia_phage	91.6	1.7e-117
WP_001282457.1|2774835_2775066_-	hypothetical protein	NA	G9L6A7	Escherichia_phage	97.4	2.9e-38
WP_000836293.1|2775220_2775805_+	helix-turn-helix transcriptional regulator	NA	A0A0F6R8L7	Escherichia_coli_O157_typing_phage	99.5	2.7e-104
WP_044316665.1|2776113_2776413_+	hypothetical protein	NA	A0A0F6R7M4	Escherichia_coli_O157_typing_phage	98.0	1.7e-46
WP_044316666.1|2776409_2777231_+	exodeoxyribonuclease VIII	NA	A0A2R9YJH7	Escherichia_phage	98.9	5.2e-162
WP_044316667.1|2777227_2778169_+	recombinase RecT	NA	A0A0F6TJP0	Escherichia_coli_O157_typing_phage	99.4	1.1e-176
WP_000675390.1|2778218_2778467_+	AlpA family phage regulatory protein	NA	A0A0F6TJ45	Escherichia_coli_O157_typing_phage	100.0	3.6e-42
WP_001335975.1|2778624_2778876_+	PerC family transcriptional regulator	NA	G9L6A0	Escherichia_phage	100.0	3.1e-41
WP_000163467.1|2778868_2779519_+	adenine methylase	NA	A0A2R9YJG0	Escherichia_phage	98.6	5.6e-127
WP_001077941.1|2779515_2779710_+	DUF1382 family protein	NA	G9L698	Escherichia_phage	100.0	1.9e-27
WP_000954554.1|2779713_2780964_-|integrase	site-specific integrase	integrase	A0A0F6TJM5	Escherichia_coli_O157_typing_phage	98.8	8.8e-238
WP_000138270.1|2781156_2782734_-	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
2781155:2781171	attR	AATCATTCCCACTCAAT	NA	NA	NA	NA
WP_001299507.1|2782802_2784269_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	39.1	2.3e-88
>prophage 8
NZ_CP024275	Escherichia coli O6:H16 strain M9682-C1 chromosome, complete genome	4778550	2982068	2995249	4778550		Escherichia_phage(50.0%)	11	NA	NA
WP_001272895.1|2982068_2984630_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	4.6e-31
WP_001141322.1|2984735_2985392_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.3	6.2e-49
WP_001300386.1|2985442_2986210_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.3	7.4e-70
WP_000847985.1|2986405_2987314_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_000590403.1|2987310_2988573_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.4	1.7e-135
WP_001278994.1|2988569_2989208_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_001136934.1|2989212_2989989_+	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_000081550.1|2991533_2992526_-	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
WP_001272590.1|2992588_2993728_-	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
WP_000254708.1|2993867_2994494_-	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
WP_001295182.1|2994487_2995249_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	3.4e-59
>prophage 9
NZ_CP024275	Escherichia coli O6:H16 strain M9682-C1 chromosome, complete genome	4778550	3575001	3653890	4778550	plate,tail,head,integrase,transposase,tRNA	Burkholderia_virus(41.46%)	105	3628328:3628345	3658863:3658880
WP_001295213.1|3575001_3576024_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	98.8	2.5e-198
WP_001286216.1|3582667_3583222_+	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_001070563.1|3583197_3583455_-	DUF1488 domain-containing protein	NA	NA	NA	NA	NA
WP_000451243.1|3583451_3584270_-	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_001301412.1|3584274_3584847_-	L-threonylcarbamoyladenylate synthase type 1 TsaC	NA	NA	NA	NA	NA
WP_001129722.1|3584851_3585394_-	ssDNA-binding protein, function unknown	NA	NA	NA	NA	NA
WP_000460680.1|3585422_3585896_-	DUF494 domain-containing protein	NA	NA	NA	NA	NA
WP_047607718.1|3585867_3586992_-	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_000114984.1|3587121_3587631_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	41.9	3.9e-19
WP_000004473.1|3587645_3588593_+|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	35.7	1.4e-06
WP_000744778.1|3588638_3589928_+	16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB	NA	NA	NA	NA	NA
WP_000691379.1|3589949_3591326_+	Trk system potassium transporter TrkA	NA	NA	NA	NA	NA
WP_000022442.1|3591455_3591866_+	large-conductance mechanosensitive channel protein MscL	NA	NA	NA	NA	NA
WP_000092696.1|3591862_3592081_-	alternative ribosome-rescue factor A	NA	NA	NA	NA	NA
WP_000285607.1|3592136_3592562_-	Zn(2+)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_000266498.1|3592572_3592941_-	DUF1992 domain-containing protein	NA	NA	NA	NA	NA
WP_001216368.1|3593047_3593431_-	50S ribosomal protein L17	NA	NA	NA	NA	NA
WP_001162094.1|3593471_3594461_-	DNA-directed RNA polymerase subunit alpha	NA	NA	NA	NA	NA
WP_000135224.1|3594486_3595107_-	30S ribosomal protein S4	NA	NA	NA	NA	NA
WP_001029684.1|3595140_3595530_-	30S ribosomal protein S11	NA	NA	NA	NA	NA
WP_000090775.1|3595546_3595903_-	30S ribosomal protein S13	NA	NA	NA	NA	NA
WP_000868187.1|3596049_3596166_-	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_047607720.1|3596197_3597529_-	preprotein translocase subunit SecY	NA	NA	NA	NA	NA
WP_001238914.1|3597536_3597971_-	50S ribosomal protein L15	NA	NA	NA	NA	NA
WP_001140433.1|3597974_3598154_-	50S ribosomal protein L30	NA	NA	NA	NA	NA
WP_000940121.1|3598157_3598661_-	30S ribosomal protein S5	NA	NA	NA	NA	NA
WP_000358960.1|3598675_3599029_-	50S ribosomal protein L18	NA	NA	NA	NA	NA
WP_000091945.1|3599038_3599572_-	50S ribosomal protein L6	NA	NA	NA	NA	NA
WP_000062611.1|3599584_3599977_-	30S ribosomal protein S8	NA	NA	NA	NA	NA
WP_001118930.1|3600010_3600316_-	30S ribosomal protein S14	NA	NA	NA	NA	NA
WP_001096200.1|3600330_3600870_-	50S ribosomal protein L5	NA	NA	NA	NA	NA
WP_000729185.1|3600884_3601199_-	50S ribosomal protein L24	NA	NA	NA	NA	NA
WP_000613955.1|3601209_3601581_-	50S ribosomal protein L14	NA	NA	NA	NA	NA
WP_000130100.1|3601745_3602000_-	30S ribosomal protein S17	NA	NA	NA	NA	NA
WP_000644741.1|3601999_3602191_-	50S ribosomal protein L29	NA	NA	NA	NA	NA
WP_000941212.1|3602190_3602601_-	50S ribosomal protein L16	NA	NA	NA	NA	NA
WP_000529945.1|3602613_3603315_-	30S ribosomal protein S3	NA	NA	NA	NA	NA
WP_000447529.1|3603332_3603665_-	50S ribosomal protein L22	NA	NA	NA	NA	NA
WP_001138117.1|3603679_3603958_-	30S ribosomal protein S19	NA	NA	NA	NA	NA
WP_000301864.1|3603974_3604796_-	50S ribosomal protein L2	NA	NA	NA	NA	NA
WP_000617544.1|3604813_3605116_-	50S ribosomal protein L23	NA	NA	NA	NA	NA
WP_000424395.1|3605112_3605718_-	50S ribosomal protein L4	NA	NA	NA	NA	NA
WP_000579833.1|3605728_3606358_-	50S ribosomal protein L3	NA	NA	NA	NA	NA
WP_001181004.1|3606390_3606702_-	30S ribosomal protein S10	NA	NA	NA	NA	NA
WP_000461450.1|3606939_3607359_-	putative general secretion pathway protein GspB	NA	NA	NA	NA	NA
WP_001142708.1|3609009_3609825_+	type II secretion system protein GspC	NA	NA	NA	NA	NA
WP_001326512.1|3609808_3611761_+	type II secretion system secretin GspD	NA	R9TEZ5	Vibrio_phage	30.9	9.2e-32
WP_001219894.1|3611770_3613252_+	type II secretion system ATPase GspE	NA	NA	NA	NA	NA
WP_001109573.1|3613248_3614445_+	type II secretion system inner membrane protein GspF	NA	NA	NA	NA	NA
WP_001202874.1|3614454_3614892_+	type II secretion system major pseudopilin GspG	NA	NA	NA	NA	NA
WP_001076046.1|3614899_3615409_+	type II secretion system minor pseudopilin GspH	NA	NA	NA	NA	NA
WP_001041743.1|3615405_3615783_+	type II secretion system minor pseudopilin GspI	NA	NA	NA	NA	NA
WP_001058522.1|3616356_3617340_+	type II secretion system minor pseudopilin GspK	NA	NA	NA	NA	NA
WP_000904922.1|3617712_3618285_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	85.2	4.6e-85
WP_064757507.1|3618337_3618868_+|tail	tail fiber protein	tail	K7P7Q7	Enterobacteria_phage	48.3	4.1e-35
WP_000072166.1|3618867_3619482_+|tail	tail assembly protein	tail	Q9MCR5	Enterobacteria_phage	61.5	1.7e-61
WP_077777839.1|3619488_3621081_-|tail	phage tail protein	tail	A0A0K2FIZ6	Escherichia_phage	42.9	1.4e-38
WP_000138756.1|3621083_3621662_-|tail	phage tail protein I	tail	A4JWL7	Burkholderia_virus	66.8	1.7e-66
WP_016240628.1|3621654_3622758_-	hypothetical protein	NA	Q6QI99	Burkholderia_phage	55.0	2.4e-106
WP_000859111.1|3622748_3623096_-|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	62.4	5.9e-35
WP_001404342.1|3623150_3623747_-|plate	phage baseplate assembly protein V	plate	A4JWL4	Burkholderia_virus	45.7	3.2e-36
WP_001545521.1|3623743_3624898_-	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	47.3	1.2e-84
WP_032142594.1|3624885_3625101_-	membrane protein	NA	Q6QIA3	Burkholderia_phage	55.7	3.5e-17
WP_000458386.1|3625097_3625982_-|tail	phage tail protein	tail	A4JWL1	Burkholderia_virus	47.9	6.8e-51
WP_016240627.1|3625981_3628933_-|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	29.7	8.3e-85
3628328:3628345	attL	TGTTGCCGTTGCCGCGCG	NA	NA	NA	NA
WP_001202894.1|3629008_3629167_-|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_001513982.1|3629090_3629426_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_044325560.1|3629523_3629805_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000034292.1|3629807_3630329_-|tail	phage major tail tube protein	tail	A4JWK6	Burkholderia_virus	68.2	8.0e-68
WP_016240625.1|3630328_3631756_-	hypothetical protein	NA	A4JWK5	Burkholderia_virus	77.6	9.8e-217
WP_001789770.1|3631745_3632000_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001101804.1|3631996_3632461_-	hypothetical protein	NA	Q6QIB2	Burkholderia_phage	51.7	9.1e-39
WP_000271668.1|3632460_3632907_-	DUF1320 domain-containing protein	NA	A4JWK2	Burkholderia_virus	52.3	2.2e-34
WP_000537457.1|3632908_3633247_-	DUF2190 family protein	NA	NA	NA	NA	NA
WP_001286905.1|3633256_3634210_-	hypothetical protein	NA	A4JWK0	Burkholderia_virus	44.5	5.2e-65
WP_001273074.1|3634224_3635340_-	hypothetical protein	NA	A4JWJ9	Burkholderia_virus	51.6	9.4e-98
WP_000135513.1|3635554_3636013_-	phage virion morphogenesis protein	NA	Q6QIB8	Burkholderia_phage	44.8	1.5e-30
WP_000117560.1|3636015_3636837_-|head	phage head morphogenesis protein	head	A4JWJ6	Burkholderia_virus	61.2	1.2e-97
WP_016240624.1|3636817_3638314_-	DUF935 domain-containing protein	NA	A4JWJ5	Burkholderia_virus	59.0	1.4e-165
WP_000167507.1|3638313_3639909_-	hypothetical protein	NA	A4JWJ4	Burkholderia_virus	62.8	8.5e-185
WP_000124060.1|3639905_3640451_-	DUF3486 family protein	NA	A4JWJ3	Burkholderia_virus	67.6	9.3e-59
WP_000227700.1|3640450_3640762_-	hypothetical protein	NA	A0A0S4L0A3	Pseudomonas_phage	62.6	9.4e-32
WP_000175097.1|3640761_3641088_-	membrane protein	NA	Q6QIC4	Burkholderia_phage	49.5	9.6e-19
WP_016240623.1|3641084_3641735_-	hypothetical protein	NA	Q5ZQY9	Pseudomonas_phage	32.9	2.8e-09
WP_001104440.1|3641718_3642459_-	transglycosylase SLT domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	51.4	2.5e-62
WP_000793146.1|3642461_3642812_-	membrane protein	NA	A4JWP3	Burkholderia_virus	53.0	1.5e-22
WP_000149906.1|3642942_3643419_+	ABC transporter ATPase	NA	NA	NA	NA	NA
WP_001330012.1|3643456_3644044_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000031883.1|3644128_3645115_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001259268.1|3645111_3645573_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000200153.1|3645623_3645812_+	DNA-binding protein	NA	Q5ZQZ9	Pseudomonas_phage	71.0	6.1e-18
WP_000049025.1|3645864_3646173_+	helix-turn-helix domain-containing protein	NA	Q5ZR02	Pseudomonas_phage	55.9	5.5e-24
WP_000533821.1|3646183_3647098_+	DUF3102 domain-containing protein	NA	A4JWN3	Burkholderia_virus	52.5	6.8e-70
WP_001545516.1|3647101_3648871_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	Q6QIE0	Burkholderia_phage	68.3	2.4e-228
WP_000960679.1|3648881_3650048_+	AAA family ATPase	NA	A4JWN1	Burkholderia_virus	59.4	2.2e-121
WP_000843446.1|3650050_3650320_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001140136.1|3650347_3650878_+	host-nuclease inhibitor protein Gam	NA	L7P7T1	Pseudomonas_phage	66.7	1.2e-58
WP_001381531.1|3651166_3651439_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001299260.1|3651448_3651745_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000763553.1|3651759_3651975_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016240622.1|3651971_3652655_+	DUF2786 domain-containing protein	NA	A0A2P9JZH4	Alteromonadaceae_phage	35.6	2.4e-32
WP_016238301.1|3652651_3652882_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000123379.1|3652871_3653087_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031606346.1|3653076_3653529_+	regulatory protein GemA	NA	A4JWM5	Burkholderia_virus	45.9	2.8e-24
WP_001281694.1|3653500_3653890_+	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	54.2	5.8e-31
3658863:3658880	attR	TGTTGCCGTTGCCGCGCG	NA	NA	NA	NA
>prophage 10
NZ_CP024275	Escherichia coli O6:H16 strain M9682-C1 chromosome, complete genome	4778550	3999069	4007937	4778550	integrase	Morganella_phage(42.86%)	12	3994595:3994607	4003805:4003817
3994595:3994607	attL	GGCGGTGGCGCAT	NA	NA	NA	NA
WP_047608026.1|3999069_4000323_+|integrase	site-specific integrase	integrase	A0A1W6JPG6	Morganella_phage	79.3	2.2e-196
WP_032236939.1|4000341_4001292_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032236940.1|4001398_4001602_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_023063312.1|4001601_4002036_+	hypothetical protein	NA	A0A1W6JPH9	Morganella_phage	55.7	3.8e-31
WP_047608023.1|4002048_4002882_+	antA/AntB antirepressor family protein	NA	G9L6G1	Escherichia_phage	47.5	5.3e-21
WP_052158498.1|4002922_4003786_+	host cell division inhibitor Icd-like protein	NA	Q8SBF3	Shigella_phage	34.8	1.9e-13
WP_001565828.1|4003778_4003958_+	hypothetical protein	NA	NA	NA	NA	NA
4003805:4003817	attR	ATGCGCCACCGCC	NA	NA	NA	NA
WP_047608021.1|4003954_4004269_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047608019.1|4004265_4004529_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040075116.1|4004525_4005152_+	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	34.7	3.2e-23
WP_032236944.1|4005161_4005503_+	hypothetical protein	NA	A0A1W6JPD8	Morganella_phage	50.9	6.5e-26
WP_047608015.1|4005495_4007937_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	38.9	4.8e-139
>prophage 11
NZ_CP024275	Escherichia coli O6:H16 strain M9682-C1 chromosome, complete genome	4778550	4031231	4094662	4778550	integrase,transposase	Enterobacteria_phage(14.29%)	55	4030911:4030935	4073077:4073101
4030911:4030935	attL	TTCGACTCCTGTGATCTTCCGCCAA	NA	NA	NA	NA
WP_001683391.1|4031231_4032413_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	69.2	1.1e-160
WP_000952335.1|4033029_4034424_+|transposase	IS21 family transposase	transposase	U5N3F9	Enterobacteria_phage	97.7	9.9e-222
WP_047608433.1|4034848_4035667_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_085947916.1|4036547_4037640_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	2.9e-51
WP_001530297.1|4039162_4040257_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001201092.1|4040271_4042872_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000773452.1|4042940_4043453_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000698190.1|4043492_4044209_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085947916.1|4044368_4045462_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	2.9e-51
WP_000956749.1|4046408_4047224_+	helix-turn-helix domain-containing protein	NA	D0R0F8	Streptococcus_phage	31.6	3.8e-08
WP_000107478.1|4048805_4049819_-	aldose 1-epimerase family protein	NA	NA	NA	NA	NA
WP_001682518.1|4049830_4051147_-	L-fucose:H+ symporter permease	NA	NA	NA	NA	NA
WP_000350273.1|4051174_4052095_-	ribokinase	NA	NA	NA	NA	NA
WP_001298267.1|4052400_4053183_+	DeoR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001315617.1|4053184_4053283_-	acetolactate synthase	NA	NA	NA	NA	NA
WP_001189123.1|4054007_4055516_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	3.6e-44
WP_086405452.1|4055824_4056196_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000453335.1|4057424_4057637_-	hemolysin expression modulator Hha	NA	NA	NA	NA	NA
WP_001531226.1|4058521_4059313_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001706652.1|4059621_4059900_+	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_001355567.1|4059985_4060558_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001069707.1|4063174_4064047_+	GTPase family protein	NA	NA	NA	NA	NA
WP_000820580.1|4064418_4067265_+	autotransporter adhesin Ag43	NA	NA	NA	NA	NA
WP_001706654.1|4067590_4068412_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.5	6.1e-46
WP_000206659.1|4068503_4068989_+	antirestriction protein	NA	A9J566	Pseudomonas_phage	32.4	9.0e-13
WP_001186774.1|4069003_4069480_+	RadC family protein	NA	NA	NA	NA	NA
WP_000692307.1|4069542_4069764_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	8.5e-11
WP_000086754.1|4069782_4070427_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001285298.1|4070476_4070845_+	type IV toxin-antitoxin system YeeU family antitoxin	NA	NA	NA	NA	NA
WP_000854743.1|4070934_4071312_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000761693.1|4071308_4071797_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000839275.1|4071808_4072006_+	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_001315909.1|4073208_4073355_+	hypothetical protein	NA	NA	NA	NA	NA
4073077:4073101	attR	TTCGACTCCTGTGATCTTCCGCCAA	NA	NA	NA	NA
WP_001172882.1|4073737_4074922_+	sugar efflux transporter	NA	NA	NA	NA	NA
WP_000535961.1|4075032_4075956_+	DMT family transporter	NA	NA	NA	NA	NA
WP_000779419.1|4075959_4076778_-	lipoprotein NlpA	NA	NA	NA	NA	NA
WP_000805509.1|4076999_4077293_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001288549.1|4077333_4078524_-	purine ribonucleoside efflux pump NepI	NA	NA	NA	NA	NA
WP_001355577.1|4078734_4079187_-	DUF1198 domain-containing protein	NA	NA	NA	NA	NA
WP_002431302.1|4079239_4080574_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	36.9	9.6e-65
WP_001065718.1|4080748_4082515_+	adenine deaminase	NA	NA	NA	NA	NA
WP_000879194.1|4082560_4083952_-	hexose-6-phosphate:phosphate antiporter	NA	NA	NA	NA	NA
WP_000936566.1|4084089_4085409_-	MFS transporter family glucose-6-phosphate receptor UhpC	NA	NA	NA	NA	NA
WP_001295243.1|4085418_4086921_-	signal transduction histidine-protein kinase/phosphatase UhpB	NA	NA	NA	NA	NA
WP_000633668.1|4086920_4087511_-	transcriptional regulator UhpA	NA	NA	NA	NA	NA
WP_001181706.1|4087586_4087877_-	acetolactate synthase small subunit	NA	NA	NA	NA	NA
WP_000168475.1|4087880_4089569_-	acetolactate synthase large subunit	NA	E5EQ70	Micromonas_sp._RCC1109_virus	29.7	3.2e-57
WP_001300753.1|4089674_4089773_-	ilvB operon leader peptide IvbL	NA	NA	NA	NA	NA
WP_000060506.1|4090337_4090427_+	type I toxin-antitoxin system toxin TisB	NA	NA	NA	NA	NA
WP_000828746.1|4090706_4091891_+	multidrug efflux MFS transporter EmrD	NA	S4TR35	Salmonella_phage	23.5	8.9e-14
WP_000148061.1|4091898_4092396_-	radical SAM protein	NA	NA	NA	NA	NA
WP_001113432.1|4092392_4092755_-	DUF202 domain-containing protein	NA	NA	NA	NA	NA
WP_000703959.1|4092744_4093092_-	YidH family protein	NA	NA	NA	NA	NA
WP_001705161.1|4093261_4094470_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	92.3	1.3e-206
WP_001342382.1|4094539_4094662_+|transposase	transposase	transposase	A0A1S5RHE3	Helicobacter_phage	55.0	3.8e-05
>prophage 12
NZ_CP024275	Escherichia coli O6:H16 strain M9682-C1 chromosome, complete genome	4778550	4745756	4759614	4778550	integrase,transposase	Enterobacteria_phage(66.67%)	14	4754690:4754703	4759994:4760007
WP_001355687.1|4745756_4747259_-	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	44.8	6.1e-84
WP_001299662.1|4747388_4748408_-	NADPH-dependent aldehyde reductase Ahr	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	30.7	8.4e-45
WP_000090076.1|4749638_4750214_-	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	51.9	2.3e-39
WP_000984214.1|4750230_4750473_-	hypothetical protein	NA	Q7M294	Enterobacteria_phage	58.0	1.4e-19
WP_001295213.1|4750700_4751723_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	98.8	2.5e-198
WP_001317493.1|4751719_4752502_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	5.9e-139
WP_024171719.1|4753783_4754050_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	64.8	4.7e-24
WP_001355524.1|4754046_4754601_+	ash family protein	NA	Q7M2A7	Enterobacteria_phage	73.0	6.6e-36
WP_001133040.1|4754593_4754893_+	hypothetical protein	NA	Q7M2A0	Enterobacteria_phage	70.1	6.9e-32
4754690:4754703	attL	AATCGCGCCAGCGC	NA	NA	NA	NA
WP_000459282.1|4754885_4755335_+	hypothetical protein	NA	Q7M298	Enterobacteria_phage	67.3	1.3e-45
WP_024173160.1|4755439_4755667_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000844963.1|4755663_4755984_+	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_000783700.1|4755998_4758332_+	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	83.7	0.0e+00
WP_001355523.1|4758909_4759614_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	43.1	1.2e-42
4759994:4760007	attR	AATCGCGCCAGCGC	NA	NA	NA	NA
>prophage 1
NZ_CP024276	Escherichia coli O6:H16 strain M9682-C1 plasmid unnamed1	38177	1172	10718	38177	transposase	Stx2-converting_phage(37.5%)	13	NA	NA
WP_001339397.1|1172_1850_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000624622.1|1849_2197_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_047608463.1|2216_3788_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.3	4.2e-168
WP_001705702.1|3814_4621_-	DUF945 domain-containing protein	NA	A0A2C9CYF8	Yersinia_phage	38.1	1.9e-44
WP_001272251.1|4731_5028_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001550495.1|5090_5324_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000775238.1|5922_6084_-	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_001178556.1|6259_6778_-	hypothetical protein	NA	G9L6B3	Escherichia_phage	68.5	1.3e-57
WP_052158500.1|6777_8454_-	plasmid SOS inhibition protein A	NA	G8DH78	Emiliania_huxleyi_virus	31.8	3.4e-19
WP_000005971.1|8517_8751_-	DUF905 domain-containing protein	NA	NA	NA	NA	NA
WP_000290820.1|8807_9335_-	single-stranded DNA-binding protein	NA	I3PGW4	Xanthomonas_phage	74.4	4.6e-47
WP_024173136.1|9399_9636_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001297832.1|10154_10718_-	class I SAM-dependent methyltransferase	NA	A0A2I7RQ20	Vibrio_phage	36.9	3.0e-20
>prophage 1
NZ_CP024277	Escherichia coli O6:H16 strain M9682-C1 plasmid unnamed2, complete sequence	100184	0	62696	100184	transposase	Stx2-converting_phage(18.75%)	53	NA	NA
WP_000624622.1|476_824_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_047608463.1|843_2415_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.3	4.2e-168
WP_001393437.1|2418_3231_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000130971.1|4144_5002_-	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
WP_001365705.1|4994_5069_-	RepA leader peptide Tap	NA	NA	NA	NA	NA
WP_000083830.1|5305_5560_-	replication regulatory protein RepA	NA	NA	NA	NA	NA
WP_001393319.1|5799_6390_-	DUF2726 domain-containing protein	NA	NA	NA	NA	NA
WP_001393151.1|6541_7168_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001297500.1|7579_7789_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000840475.1|7919_8480_-	fertility inhibition protein FinO	NA	NA	NA	NA	NA
WP_000704511.1|8582_9443_-	alpha/beta hydrolase	NA	A2RQC8	Archaeal_BJ1_virus	23.0	2.3e-11
WP_000138370.1|11178_11571_-	F-type conjugal transfer protein TrbF	NA	NA	NA	NA	NA
WP_071594518.1|11524_11899_-	P-type conjugative transfer protein TrbJ	NA	NA	NA	NA	NA
WP_001230775.1|12310_13039_-	type-F conjugative transfer system secretin TraK	NA	NA	NA	NA	NA
WP_000399782.1|13025_13592_-	type IV conjugative transfer system protein TraE	NA	NA	NA	NA	NA
WP_000012113.1|13613_13925_-	type IV conjugative transfer system protein TraL	NA	NA	NA	NA	NA
WP_001098998.1|13929_14292_-	type IV conjugative transfer system pilin TraA	NA	NA	NA	NA	NA
WP_000089263.1|14324_14552_-	conjugal transfer relaxosome protein TraY	NA	NA	NA	NA	NA
WP_024171742.1|14688_15360_-	conjugal transfer transcriptional regulator TraJ	NA	NA	NA	NA	NA
WP_000124827.1|15553_15937_-	relaxosome protein TraM	NA	NA	NA	NA	NA
WP_013188482.1|16259_16862_+	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_001393327.1|17157_17979_-	DUF945 domain-containing protein	NA	A0A2C9CYF8	Yersinia_phage	38.2	1.7e-43
WP_000107522.1|18095_18383_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001272235.1|18538_18841_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001312861.1|19755_19914_-	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_047608279.1|20900_21335_-	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
WP_001508949.1|21389_22061_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001393231.1|22088_23357_-	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	32.1	5.2e-20
WP_001254933.1|23852_25004_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
WP_013188479.1|26227_26602_-	heat-labile enterotoxin LT subunit B	NA	D1GID8	Vibrio_virus	79.8	3.7e-51
WP_001378495.1|26598_27375_-	heat-labile enterotoxin LT subunit A	NA	A0A023W6A1	Vibrio_virus	80.2	6.5e-122
WP_000019162.1|27690_27963_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032178845.1|29716_30088_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001189123.1|30396_31905_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	3.6e-44
WP_013188501.1|34255_34474_-	heat-stable enterotoxin ST-I group b	NA	NA	NA	NA	NA
WP_000471255.1|35463_35793_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A088CBP5	Shigella_phage	43.0	2.6e-08
WP_000780221.1|35773_36055_+	helix-turn-helix transcriptional regulator	NA	A0A2I6TC97	Escherichia_phage	37.0	6.5e-08
WP_000710536.1|36377_37322_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001393279.1|37388_37739_-	plasmid stability family protein	NA	NA	NA	NA	NA
WP_000959870.1|37741_38704_-	plasmid segregation protein ParM	NA	A0A222YXF2	Escherichia_phage	53.9	4.1e-94
WP_000219392.1|39170_40187_+|transposase	IS110-like element ISShdy1 family transposase	transposase	NA	NA	NA	NA
WP_000343720.1|40302_41511_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	45.7	9.6e-48
WP_044307862.1|41507_41681_+|transposase	transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	65.9	2.3e-11
WP_001203081.1|42073_42568_-	DUF2919 family protein	NA	NA	NA	NA	NA
WP_001393184.1|42564_44478_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000894830.1|44549_44735_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069985299.1|44759_49310_-	filamentous hemagglutinin N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_001393122.1|49399_51211_-	two-partner secretion system transporter EtpB	NA	NA	NA	NA	NA
WP_000124092.1|52102_52468_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001416764.1|55340_56585_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013188496.1|58490_58847_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095033721.1|58987_60267_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	94.4	2.2e-167
WP_000593828.1|62069_62696_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.0	4.1e-18
>prophage 2
NZ_CP024277	Escherichia coli O6:H16 strain M9682-C1 plasmid unnamed2, complete sequence	100184	78169	78967	100184		Enterobacteria_phage(100.0%)	1	NA	NA
WP_000544814.1|78169_78967_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	98.5	4.7e-144
>prophage 3
NZ_CP024277	Escherichia coli O6:H16 strain M9682-C1 plasmid unnamed2, complete sequence	100184	84489	85296	100184	integrase	Macacine_betaherpesvirus(100.0%)	1	81877:81892	93368:93383
81877:81892	attL	TGTTATTGTCCGCCTC	NA	NA	NA	NA
WP_000016960.1|84489_85296_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	93.9	1.7e-53
WP_000016960.1|84489_85296_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	93.9	1.7e-53
93368:93383	attR	TGTTATTGTCCGCCTC	NA	NA	NA	NA
>prophage 4
NZ_CP024277	Escherichia coli O6:H16 strain M9682-C1 plasmid unnamed2, complete sequence	100184	93134	99626	100184	transposase	Stx2-converting_phage(50.0%)	7	NA	NA
WP_000998103.1|93134_94673_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	96.9	2.9e-291
WP_000612591.1|94722_95070_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|95066_95447_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_095033723.1|95738_96900_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
WP_122994480.1|97155_97347_-	ANR family transcriptional regulator	NA	NA	NA	NA	NA
WP_095033721.1|97487_98766_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	94.4	2.2e-167
WP_085950855.1|98932_99626_+|transposase	IS1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	97.4	7.5e-130
