The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	0	5761	4934701		Klosneuvirus(100.0%)	2	NA	NA
WP_000096698.1|3815_4949_+	LPS O-antigen length regulator	NA	NA	NA	NA	NA
WP_000140647.1|4945_5761_-	iron-enterobactin ABC transporter ATP-binding protein	NA	A0A1V0SJ29	Klosneuvirus	22.0	7.3e-07
>prophage 2
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	20081	21904	4934701		uncultured_marine_virus(50.0%)	2	NA	NA
WP_000502952.1|20081_20711_-	ParB-like nuclease domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	52.8	2.9e-56
WP_000029824.1|20683_21904_-	phosphoadenosine phosphosulfate reductase	NA	A0A220GKF8	Streptococcus_phage	32.8	2.7e-58
>prophage 3
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	25088	27203	4934701		Bacillus_virus(50.0%)	2	NA	NA
WP_000887629.1|25088_26654_+	alkyl hydroperoxide reductase subunit F	NA	G3MA85	Bacillus_virus	34.3	2.2e-44
WP_000278505.1|26774_27203_-	universal stress protein UspG	NA	A0A1W6JNV4	Morganella_phage	39.2	1.1e-19
>prophage 4
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	42626	43272	4934701		Morganella_phage(50.0%)	2	NA	NA
WP_000034825.1|42626_42836_+	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	2.7e-22
WP_000939738.1|42888_43272_-	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	53.6	6.8e-24
>prophage 5
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	48087	50527	4934701		Stx2-converting_phage(50.0%)	2	NA	NA
WP_001092082.1|48087_49299_-	D-alanyl-D-alanine carboxypeptidase DacA	NA	B6DZZ7	Stx2-converting_phage	47.4	1.2e-101
WP_032200858.1|49438_50527_-	endolytic peptidoglycan transglycosylase RlpA	NA	F5B3X9	Synechococcus_phage	53.2	3.6e-09
>prophage 6
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	57537	60120	4934701	tRNA	Staphylococcus_phage(100.0%)	1	NA	NA
WP_001612599.1|57537_60120_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	42.2	6.8e-184
>prophage 7
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	63168	63894	4934701		Planktothrix_phage(100.0%)	1	NA	NA
WP_000631384.1|63168_63894_-	glutamate/aspartate ABC transporter ATP binding protein GltL	NA	G9BWD6	Planktothrix_phage	38.6	7.6e-32
>prophage 8
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	69777	70857	4934701		Pseudomonas_phage(100.0%)	1	NA	NA
WP_000490838.1|69777_70857_-	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	46.6	4.3e-47
>prophage 9
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	74952	76617	4934701		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_000337063.1|74952_76617_-	asparagine synthase B	NA	A9YVS6	Ostreococcus_tauri_virus	39.3	6.1e-85
>prophage 10
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	81383	85254	4934701	tRNA	Vibrio_phage(50.0%)	2	NA	NA
WP_001717856.1|81383_83330_+	PTS N-acetyl glucosamine transporter subunit IIABC	NA	A0A2I7SAJ6	Vibrio_phage	47.3	1.6e-07
WP_001287164.1|83589_85254_+|tRNA	glutamine--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	98.9	0.0e+00
>prophage 11
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	89536	105598	4934701		Mycobacterium_phage(20.0%)	11	NA	NA
WP_001612611.1|89536_90301_-	esterase	NA	A0A1J0GNR5	Mycobacterium_phage	32.4	5.8e-06
WP_000848387.1|90485_91031_+	replication initiation negative regulator SeqA	NA	NA	NA	NA	NA
WP_001297249.1|91056_92697_+	alpha-D-glucose phosphate-specific phosphoglucomutase	NA	NA	NA	NA	NA
WP_000186102.1|92871_93549_-	two-component system response regulator KdpE	NA	W8CYM9	Bacillus_phage	31.1	8.9e-27
WP_001717860.1|93545_96230_-	two-component system sensor histidine kinase KdbD	NA	A0A1V0SGX0	Hokovirus	27.1	5.0e-12
WP_001717861.1|96222_96795_-	K(+)-transporting ATPase subunit C	NA	NA	NA	NA	NA
WP_001717862.1|96803_98852_-	potassium-transporting ATPase subunit KdpB	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	22.8	5.5e-27
WP_032200861.1|98874_100548_-	potassium-transporting ATPase subunit KdpA	NA	NA	NA	NA	NA
WP_001272653.1|100547_100637_-	K(+)-transporting ATPase subunit F	NA	NA	NA	NA	NA
WP_000424924.1|100949_101156_+	YbfA family protein	NA	NA	NA	NA	NA
WP_099490906.1|101398_105598_+	RHS repeat protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	32.6	7.3e-26
>prophage 12
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	109356	112406	4934701		Hokovirus(50.0%)	2	NA	NA
WP_001717891.1|109356_110775_+	deoxyribodipyrimidine photo-lyase	NA	A0A1V0SGL1	Hokovirus	32.2	8.9e-61
WP_001032694.1|110924_112406_-	dipeptide permease DtpD	NA	A0A0P0IY73	Acinetobacter_phage	28.2	2.5e-45
>prophage 13
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	115784	116576	4934701		Kaumoebavirus(100.0%)	1	NA	NA
WP_001717892.1|115784_116576_+	endonuclease VIII	NA	A0A1V0CNR6	Kaumoebavirus	31.5	2.2e-08
>prophage 14
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	140614	142012	4934701		Bordetella_phage(100.0%)	1	NA	NA
WP_024171454.1|140614_142012_-	RtcB family protein	NA	A0A291L9X2	Bordetella_phage	31.8	1.8e-34
>prophage 15
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	167798	171318	4934701		Vibrio_phage(33.33%)	4	NA	NA
WP_000345410.1|167798_168518_+	nicotinamide riboside transporter PnuC	NA	A0A126HGA3	Vibrio_phage	32.7	9.2e-22
WP_001612652.1|168514_169456_-	CDF family zinc transporter ZitB	NA	A0A1V0SED0	Indivirus	27.6	4.9e-23
WP_000784348.1|169569_169950_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001109196.1|170265_171318_+	3-deoxy-7-phosphoheptulonate synthase AroG	NA	A0A2I6UFP9	Klebsiella_phage	49.4	3.4e-81
>prophage 16
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	175679	182254	4934701		Tupanvirus(33.33%)	7	NA	NA
WP_001265443.1|175679_176696_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	46.0	1.0e-79
WP_001612654.1|176957_178430_-	molybdate ABC transporter ATP-binding protein ModF	NA	A0A1M7XV31	Cedratvirus	27.9	2.7e-12
WP_001147439.1|178497_179286_-	molybdenum-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_000891515.1|179414_179564_+	multidrug efflux pump-associated protein, AcrZ family	NA	NA	NA	NA	NA
WP_001612655.1|179730_180504_+	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000604034.1|180503_181193_+	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_000891692.1|181195_182254_+	molybdenum ABC transporter ATP-binding protein ModC	NA	G9BWD6	Planktothrix_phage	35.9	1.5e-20
>prophage 17
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	191964	218283	4934701	tail,lysis,integrase	Enterobacteria_phage(45.71%)	42	191877:191891	216354:216368
191877:191891	attL	GCTTTTTTATACTAA	NA	NA	NA	NA
WP_000533642.1|191964_193035_-|integrase	tyrosine-type recombinase/integrase	integrase	Q9MCR4	Enterobacteria_phage	100.0	5.1e-202
WP_001303849.1|193012_193231_-	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_000545745.1|193270_193438_-	hypothetical protein	NA	A5VWB7	Enterobacteria_phage	98.2	2.9e-27
WP_001348592.1|193680_194283_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000763367.1|194493_194715_-	TraR/DksA family transcriptional regulator	NA	A0A0K2FI84	Escherichia_phage	100.0	2.9e-35
WP_001386642.1|194813_195095_-	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	98.9	5.5e-47
WP_024171457.1|195105_195297_-	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	98.4	2.8e-26
WP_000682318.1|195269_195452_-	DUF1317 domain-containing protein	NA	A0A0N7CHV0	Escherichia_phage	98.3	1.3e-28
WP_000186792.1|195448_196129_-	YqaJ viral recombinase family protein	NA	A0A0P0ZCQ7	Stx2-converting_phage	99.6	4.6e-132
WP_074528805.1|196155_196911_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	2.0e-144
WP_000995441.1|196916_197213_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	99.0	1.1e-48
WP_000233576.1|197289_197496_-	phage encoded cell division inhibitor protein	NA	K7P6H3	Enterobacteria_phage	85.3	3.2e-28
WP_064716911.1|198091_198781_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	74.6	1.1e-91
WP_001067458.1|198885_199116_+	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	68.0	1.5e-21
WP_001182903.1|199185_199725_+	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	66.1	1.2e-61
WP_001471439.1|199811_200741_+	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	62.8	4.9e-108
WP_001717909.1|200737_201439_+	replication P family protein	NA	M1FJ72	Enterobacteria_phage	96.6	4.3e-125
WP_000145901.1|201435_201738_+	protein ren	NA	M1FPD5	Enterobacteria_phage	97.8	6.1e-44
WP_001070442.1|201805_202138_+	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_001348591.1|202186_202336_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001717910.1|202393_203920_+	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	27.5	1.3e-30
WP_000338662.1|204031_204355_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001348590.1|204529_205312_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072097297.1|205406_205508_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001053027.1|205504_205960_+	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	67.5	2.2e-61
WP_000224914.1|205959_206130_+	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	69.8	2.4e-13
WP_000774504.1|206122_206413_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	92.7	2.8e-46
WP_001099713.1|206409_206772_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	95.7	4.3e-60
WP_000971071.1|206768_206909_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	2.5e-08
WP_001204791.1|206994_207378_+	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	83.3	4.4e-55
WP_000737275.1|207566_208649_-	porin OmpD	NA	Q1MVN1	Enterobacteria_phage	76.3	8.9e-154
WP_000839596.1|209236_209452_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_001717912.1|209451_209949_+	lysozyme	NA	A0A1B5FP97	Escherichia_phage	97.0	6.0e-89
WP_001228702.1|210165_210372_+	hypothetical protein	NA	H6WRZ6	Salmonella_phage	98.5	5.3e-31
WP_001139678.1|210400_210553_+	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	96.0	3.1e-20
WP_000079508.1|210904_211315_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	76.3	1.3e-52
WP_000105084.1|211371_211605_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	94.4	7.3e-21
WP_001717915.1|213346_213724_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	91.3	1.8e-40
WP_001717916.1|213723_214308_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.3	3.9e-103
WP_001717917.1|214381_215713_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	37.1	1.4e-20
WP_000767391.1|216458_216935_-	kinase inhibitor	NA	NA	NA	NA	NA
216354:216368	attR	GCTTTTTTATACTAA	NA	NA	NA	NA
WP_001612659.1|216993_218283_-	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	29.0	1.0e-18
>prophage 18
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	224763	225672	4934701		Streptococcus_phage(100.0%)	1	NA	NA
WP_001400532.1|224763_225672_-	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	31.1	1.4e-27
>prophage 19
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	236643	241635	4934701		Anomala_cuprea_entomopoxvirus(50.0%)	4	NA	NA
WP_000996092.1|236643_238380_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	29.8	2.3e-18
WP_000743444.1|238372_239368_-	secretion protein HlyD	NA	NA	NA	NA	NA
WP_001296991.1|239370_240042_-	DNA-binding transcriptional regulator CecR	NA	NA	NA	NA	NA
WP_001717923.1|240270_241635_+	ATP-dependent RNA helicase RhlE	NA	A0A1V0SBR7	Catovirus	31.8	1.5e-52
>prophage 20
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	246025	255012	4934701		Bacillus_phage(25.0%)	8	NA	NA
WP_001612679.1|246025_248176_+	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	26.0	1.8e-41
WP_001612685.1|248203_249166_+	DNA-binding protein YbiB	NA	NA	NA	NA	NA
WP_001612686.1|249306_250392_+	malate/lactate/ureidoglycolate dehydrogenase	NA	NA	NA	NA	NA
WP_000849301.1|250620_250881_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_000146357.1|251145_251412_-	C4-type zinc finger protein YbiI	NA	E5G6L7	Salmonella_phage	45.6	3.1e-07
WP_000990176.1|251485_252163_-	PKHD-type hydroxylase YbiX	NA	Q5GQB0	Synechococcus_phage	30.1	1.2e-18
WP_000430039.1|252204_254487_-	catecholate siderophore receptor Fiu	NA	NA	NA	NA	NA
WP_000710619.1|254751_255012_-	DUF1471 domain-containing protein	NA	A0A1B2ICL8	Erwinia_phage	51.0	1.6e-05
>prophage 21
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	258552	263777	4934701		Planktothrix_phage(33.33%)	7	NA	NA
WP_000569080.1|258552_259275_-	glutamine ABC transporter ATP-binding protein GlnQ	NA	G9BWD6	Planktothrix_phage	41.8	2.5e-35
WP_001159065.1|259271_259931_-	glutamine ABC transporter permease GlnP	NA	NA	NA	NA	NA
WP_001717928.1|260069_260816_-	glutamine ABC transporter substrate-binding protein GlnH	NA	NA	NA	NA	NA
WP_000100800.1|261219_261723_-	DNA starvation/stationary phase protection protein Dps	NA	A0A222YYG6	Streptomyces_phage	29.0	4.9e-06
WP_001295297.1|262021_262909_-	threonine/homoserine exporter RhtA	NA	NA	NA	NA	NA
WP_120795379.1|263143_263209_+	protein YliM	NA	NA	NA	NA	NA
WP_001295296.1|263261_263777_+	outer membrane protein OmpX	NA	H6WZM8	Escherichia_phage	33.8	1.1e-16
>prophage 22
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	268774	277110	4934701		Tupanvirus(33.33%)	6	NA	NA
WP_000961458.1|268774_270367_+	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.7	6.9e-62
WP_001612693.1|270607_271867_-	DUF1479 domain-containing protein	NA	NA	NA	NA	NA
WP_001612694.1|272018_272834_-	sugar-phosphatase YbiV	NA	NA	NA	NA	NA
WP_000209318.1|272979_275412_-	glycyl radical protein	NA	A0A076YHZ7	Citrobacter_phage	43.5	6.1e-09
WP_001612696.1|275417_276317_-	glycyl-radical enzyme activating protein	NA	NA	NA	NA	NA
WP_001612697.1|276447_277110_+	fructose-6-phosphate aldolase	NA	A0A0E3HJ81	Synechococcus_phage	33.6	5.7e-26
>prophage 23
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	280428	282300	4934701		Planktothrix_phage(100.0%)	1	NA	NA
WP_001400536.1|280428_282300_+	glutathione ABC transporter ATP-binding protein GsiA	NA	G9BWD6	Planktothrix_phage	29.7	4.0e-16
>prophage 24
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	293635	294838	4934701		Stx2-converting_phage(100.0%)	1	NA	NA
WP_000195961.1|293635_294838_+	serine-type D-Ala-D-Ala carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	48.0	8.2e-100
>prophage 25
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	303404	312554	4934701		Vibrio_phage(25.0%)	11	NA	NA
WP_001195231.1|303404_303662_-	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	63.1	7.8e-24
WP_001612709.1|303821_304109_+	DUF1418 family protein	NA	NA	NA	NA	NA
WP_001612710.1|304092_304815_+	nitroreductase NfsA	NA	NA	NA	NA	NA
WP_000684321.1|304875_305778_+	30S ribosomal protein S6--L-glutamate ligase	NA	I3ULC9	Synechococcus_phage	34.4	2.6e-37
WP_000203025.1|305865_306342_+	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_001612712.1|306692_307805_+	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_000996010.1|307899_309033_+	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.0	1.4e-29
WP_032200979.1|309042_309996_+	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_001061658.1|309992_310838_+	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_001612714.1|310897_311386_+	YbjO family protein	NA	NA	NA	NA	NA
WP_001612715.1|311426_312554_+	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	28.0	1.8e-27
>prophage 26
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	315890	316619	4934701		Planktothrix_phage(100.0%)	1	NA	NA
WP_000027205.1|315890_316619_-	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.7	6.0e-29
>prophage 27
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	320308	321139	4934701		Roseobacter_phage(100.0%)	1	NA	NA
WP_001255167.1|320308_321139_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	30.0	5.7e-07
>prophage 28
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	324726	326445	4934701		Yellowstone_lake_phycodnavirus(100.0%)	1	NA	NA
WP_001717941.1|324726_326445_-	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.1	3.1e-31
>prophage 29
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	335731	359516	4934701	tRNA,protease	uncultured_Mediterranean_phage(16.67%)	16	NA	NA
WP_001612725.1|335731_337678_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.1	2.5e-37
WP_000410785.1|337750_337975_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
WP_000520781.1|338297_338618_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_000934041.1|338648_340925_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
WP_001040187.1|341608_341827_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_001612726.1|342111_342816_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001612727.1|342857_344579_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	25.2	2.9e-21
WP_001043606.1|344579_346346_-	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.3	5.4e-23
WP_001612728.1|346468_347434_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	1.1e-62
WP_000228473.1|347978_348473_+	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_001717944.1|348607_352702_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
WP_001295343.1|352856_353468_+	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_000067767.1|353478_354822_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.8	2.1e-80
WP_000886683.1|354912_356205_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
WP_001612731.1|356443_358888_+	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.7	1.5e-220
WP_000213098.1|358898_359516_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	60.6	5.0e-77
>prophage 30
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	365826	369041	4934701		Tetraselmis_virus(100.0%)	2	NA	NA
WP_000111043.1|365826_366567_-	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.5	8.0e-21
WP_001292812.1|366758_369041_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.4	1.3e-162
>prophage 31
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	373139	374228	4934701		Streptococcus_phage(100.0%)	1	NA	NA
WP_001612734.1|373139_374228_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	46.8	3.5e-81
>prophage 32
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	379314	383855	4934701		Bacillus_phage(100.0%)	3	NA	NA
WP_000167336.1|379314_379599_+	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	3.2e-10
WP_001612737.1|379805_382070_+	ComEC family protein	NA	NA	NA	NA	NA
WP_000551273.1|382106_383855_+	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	29.8	4.3e-57
>prophage 33
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	398560	409678	4934701	tRNA	Rhodobacter_phage(20.0%)	8	NA	NA
WP_001295932.1|398560_399109_+	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	7.0e-06
WP_001109487.1|399135_399783_+	hydroxyacylglutathione hydrolase GloC	NA	NA	NA	NA	NA
WP_001612744.1|400004_401195_-	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_024171461.1|401379_402453_-	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	55.1	1.0e-101
WP_000117881.1|403054_404455_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	36.1	5.3e-82
WP_001612745.1|404623_405826_-	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000193803.1|406091_408704_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.6	4.1e-19
WP_001090514.1|408910_409678_-	aliphatic sulfonates ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.6	1.7e-29
>prophage 34
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	425601	427509	4934701		Tupanvirus(100.0%)	1	NA	NA
WP_001717963.1|425601_427509_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.9e-54
>prophage 35
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	440121	442176	4934701		Bacillus_phage(100.0%)	1	NA	NA
WP_001612761.1|440121_442176_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.8	4.5e-21
>prophage 36
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	446409	447069	4934701	protease	uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000375136.1|446409_447069_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	4.0e-48
>prophage 37
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	466356	478612	4934701		Morganella_phage(20.0%)	13	NA	NA
WP_000066490.1|466356_466569_+	cold shock protein CspG	NA	A0A1W6JNX5	Morganella_phage	71.4	7.8e-22
WP_071524879.1|466579_466768_+	cold-shock protein	NA	NA	NA	NA	NA
WP_032201002.1|466742_466973_+	protein YmcE	NA	NA	NA	NA	NA
WP_001019197.1|466962_467136_+	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_001717981.1|467184_468258_-	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_072148431.1|468329_471074_-	TMAO reductase system sensor histidine kinase/response regulator TorS	NA	A0A1V0SGX0	Hokovirus	31.9	1.2e-37
WP_001717983.1|471156_472185_+	TMAO reductase system periplasmic protein TorT	NA	NA	NA	NA	NA
WP_001120120.1|472157_472850_-	two-component system response regulator TorR	NA	W8CYM9	Bacillus_phage	28.0	4.5e-18
WP_001717984.1|472979_474152_+	pentaheme c-type cytochrome TorC	NA	NA	NA	NA	NA
WP_001717985.1|474151_476698_+	trimethylamine-N-oxide reductase TorA	NA	A0A077SK27	Escherichia_phage	30.7	7.7e-71
WP_032201004.1|476694_477294_+	molecular chaperone TorD	NA	NA	NA	NA	NA
WP_000024560.1|477386_477692_-	chaperone modulator CbpM	NA	NA	NA	NA	NA
WP_001717987.1|477691_478612_-	curved DNA-binding protein	NA	A0A1V0SIM1	Klosneuvirus	43.0	4.2e-11
>prophage 38
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	482910	485185	4934701		Enterobacteria_phage(100.0%)	3	NA	NA
WP_001273658.1|482910_483084_+	general stress protein	NA	Q9KX95	Enterobacteria_phage	96.3	4.9e-06
WP_032201005.1|483341_484670_-	pyrimidine utilization transport protein G	NA	Q9KX94	Enterobacteria_phage	99.5	1.5e-235
WP_001028095.1|484690_485185_-	pyrimidine utilization flavin reductase protein F	NA	Q9KX93	Enterobacteria_phage	97.9	5.0e-51
>prophage 39
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	501954	503019	4934701		Cronobacter_phage(100.0%)	1	NA	NA
WP_000258770.1|501954_503019_+	phosphate starvation-inducible protein PhoH	NA	R4II13	Cronobacter_phage	76.7	8.1e-91
>prophage 40
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	507664	508498	4934701		Pelagibacter_phage(100.0%)	1	NA	NA
WP_001189321.1|507664_508498_-	curli production assembly/transport protein CsgG	NA	M1ICK2	Pelagibacter_phage	40.1	5.1e-40
>prophage 41
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	512632	513166	4934701		Red_sea_bream_iridovirus(100.0%)	1	NA	NA
WP_000857405.1|512632_513166_+	O-acetyl-ADP-ribose deacetylase	NA	Q71G61	Red_sea_bream_iridovirus	40.2	5.9e-26
>prophage 42
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	522473	523394	4934701		Morganella_phage(100.0%)	1	NA	NA
WP_001612800.1|522473_523394_-	LpxL/LpxP family Kdo(2)-lipid IV(A) lauroyl/palmitoleoyl acyltransferasee	NA	A0A1W6JP29	Morganella_phage	41.1	2.5e-56
>prophage 43
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	528056	528302	4934701		Salmonella_phage(100.0%)	1	NA	NA
WP_001217754.1|528056_528302_-	DNA damage-inducible protein I	NA	H6WRY5	Salmonella_phage	48.7	7.7e-13
>prophage 44
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	544183	545125	4934701		Brevibacillus_phage(100.0%)	1	NA	NA
WP_001612811.1|544183_545125_+	flagellar assembly peptidoglycan hydrolase FlgJ	NA	S5M633	Brevibacillus_phage	31.3	3.6e-10
>prophage 45
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	557482	558664	4934701		Trichoplusia_ni_ascovirus(50.0%)	2	NA	NA
WP_001008535.1|557482_558217_+	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	34.1	1.3e-15
WP_000103754.1|558427_558664_+	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	45.2	1.5e-10
>prophage 46
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	561936	563579	4934701		Pseudomonas_phage(50.0%)	2	NA	NA
WP_001257000.1|561936_562578_+	dTMP kinase	NA	Q2Z0N0	Pseudomonas_phage	36.9	4.5e-28
WP_001612817.1|562574_563579_+	DNA polymerase III subunit delta'	NA	A0A1U9WR94	Streptococcus_virus	30.9	2.9e-05
>prophage 47
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	575902	576160	4934701		Erwinia_phage(100.0%)	1	NA	NA
WP_000800153.1|575902_576160_+	multiple stress resistance protein BhsA	NA	A0A1B2IFR9	Erwinia_phage	37.1	9.6e-06
>prophage 48
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	583449	587172	4934701		Planktothrix_phage(50.0%)	4	NA	NA
WP_001033694.1|583449_584151_+	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	40.3	1.1e-35
WP_024171465.1|584150_585395_+	lipoprotein-releasing ABC transporter permease subunit LolE	NA	NA	NA	NA	NA
WP_000291292.1|585423_586335_+	N-acetylglucosamine kinase	NA	NA	NA	NA	NA
WP_000952736.1|586350_587172_+	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	35.6	5.6e-23
>prophage 49
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	590613	648314	4934701	tRNA,terminase,integrase,tail,portal,protease,holin	Enterobacteria_phage(50.0%)	69	585712:585726	592188:592202
585712:585726	attL	GATCGCGATGTACGC	NA	NA	NA	NA
WP_000074983.1|590613_591732_-|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z04	Phage_21	44.2	7.7e-84
WP_000003742.1|591700_591970_-	excisionase	NA	NA	NA	NA	NA
WP_074500330.1|592031_594503_-	exonuclease	NA	K7PLW7	Enterobacteria_phage	60.3	8.5e-59
592188:592202	attR	GCGTACATCGCGATC	NA	NA	NA	NA
WP_001083283.1|594595_594787_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449196.1|594783_594972_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_000202162.1|595530_595752_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394538.1|595741_596116_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001171936.1|596138_596357_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379589.1|596516_596672_-	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	51.1	8.8e-07
WP_023486593.1|596864_597272_-	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	45.4	5.5e-24
WP_000476994.1|597349_597577_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_001718103.1|597560_598082_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000054487.1|598062_599028_+	hypothetical protein	NA	U5P0A0	Shigella_phage	60.8	2.6e-56
WP_001718104.1|599068_599491_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	91.0	1.4e-62
WP_032200795.1|599743_600643_+	SMEK domain-containing protein	NA	NA	NA	NA	NA
WP_001718106.1|600957_601611_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_024171483.1|601623_602319_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000967408.1|603004_603217_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	94.3	1.1e-26
WP_000980987.1|603433_603685_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032200798.1|603751_604030_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	46.9	3.7e-11
WP_001718109.1|604031_605090_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	48.6	1.1e-90
WP_001718110.1|605090_605456_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	66.7	1.6e-38
WP_001718111.1|605452_606142_+	phage antitermination Q family protein	NA	I6PDF8	Cronobacter_phage	50.6	2.1e-60
WP_000839567.1|606954_607170_+|holin	holin	holin	M1FN85	Enterobacteria_phage	97.2	6.9e-34
WP_001718112.1|607174_607519_+	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	95.2	2.2e-37
WP_000370545.1|607484_607757_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001718113.1|607862_608396_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	94.3	5.8e-98
WP_157186075.1|608959_609097_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001228685.1|609318_609504_+	hypothetical protein	NA	A0A0P0ZE50	Stx2-converting_phage	80.3	6.4e-20
WP_001595003.1|609587_609950_+	hypothetical protein	NA	A5LH85	Enterobacteria_phage	98.3	3.4e-65
WP_000373425.1|610403_610898_+	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	100.0	9.9e-84
WP_032200799.1|610897_613000_+|terminase	phage terminase large subunit family protein	terminase	A0A291AWY5	Escherichia_phage	97.1	0.0e+00
WP_001718117.1|612996_613209_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	91.4	1.1e-28
WP_032200800.1|613208_614714_+|portal	phage portal protein	portal	S5MW34	Escherichia_phage	89.0	1.4e-258
WP_077841550.1|614658_616719_+|protease	Clp protease ClpP	protease	A0A291AWT6	Escherichia_phage	93.1	0.0e+00
WP_001097050.1|616805_617129_+	DUF2190 family protein	NA	A0A291AWX2	Escherichia_phage	100.0	8.5e-52
WP_001283153.1|617121_617397_+	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
WP_000677097.1|617408_617987_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	99.5	5.5e-102
WP_001079419.1|617983_618385_+|tail	tail protein	tail	A5LH34	Enterobacteria_phage	99.2	1.9e-72
WP_001718121.1|618395_619139_+	cell motility protein	NA	A5LH35	Enterobacteria_phage	98.8	4.3e-131
WP_001429942.1|619199_619586_+|tail	phage minor tail protein G	tail	K7PLV8	Enterobacteria_phage	99.2	2.8e-65
WP_001161009.1|619594_619924_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_001718122.1|619895_622961_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	98.7	0.0e+00
WP_000447256.1|622960_623290_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	99.1	3.9e-60
WP_001718123.1|623299_623998_+|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	99.1	4.3e-133
WP_001718124.1|624002_624746_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	98.4	7.0e-150
WP_001531692.1|624643_625291_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	97.7	7.8e-113
WP_001718126.1|625351_628747_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	90.1	0.0e+00
WP_001228270.1|628814_629414_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	88.9	7.7e-99
WP_001718127.1|629468_631298_+|tail	phage tail fiber protein	tail	A0A2D1UII2	Escherichia_phage	77.0	3.2e-47
WP_071586406.1|631592_631691_+|tail	phage tail protein	tail	K7PMH7	Enterobacteria_phage	78.1	1.2e-06
WP_000239880.1|631745_632414_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001394135.1|632470_632737_+|tail	caudovirales tail fiber assembly family protein	tail	K7PMH7	Enterobacteria_phage	81.7	9.2e-20
WP_000799406.1|632968_633832_-	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000531594.1|633815_634952_-	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
WP_000359447.1|635201_636431_+	peptidase T	NA	NA	NA	NA	NA
WP_001718130.1|636576_637698_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_000735413.1|637773_639234_-	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_001265481.1|639233_639905_-	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_032200804.1|640074_641445_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	7.2e-108
WP_001297479.1|641448_642090_-	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_001353282.1|642125_643232_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_000476093.1|643285_643747_-	phosphatase NudJ	NA	NA	NA	NA	NA
WP_024171487.1|643756_644410_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000444488.1|644581_645832_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	96.3	3.2e-22
WP_032149907.1|645934_646258_-	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	63.6	7.5e-40
WP_032082692.1|646794_646905_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000373095.1|646957_647362_-	DUF1398 domain-containing protein	NA	NA	NA	NA	NA
WP_000332303.1|647582_648314_-	MerR family transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	50.5	2.7e-53
>prophage 50
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	654181	656503	4934701		Escherichia_phage(100.0%)	1	NA	NA
WP_001718135.1|654181_656503_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	43.8	3.2e-92
>prophage 51
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	665036	666724	4934701		Morganella_phage(50.0%)	2	NA	NA
WP_000897378.1|665036_665456_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	62.1	6.9e-38
WP_000457622.1|665455_666724_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	83.4	1.0e-209
>prophage 52
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	684842	685601	4934701		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_000173324.1|684842_685601_-	ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	29.7	1.5e-14
>prophage 53
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	701499	704251	4934701		uncultured_Caudovirales_phage(50.0%)	2	NA	NA
WP_001033352.1|701499_703179_-	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	23.6	1.3e-23
WP_001298109.1|703303_704251_-	ribose-phosphate pyrophosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.8	3.9e-44
>prophage 54
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	707387	714191	4934701		Pseudomonas_phage(33.33%)	9	NA	NA
WP_000804726.1|707387_708470_+	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	41.6	1.5e-07
WP_000456467.1|708469_709303_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_001612854.1|709299_709692_+	SirB family protein	NA	NA	NA	NA	NA
WP_001257044.1|709695_710505_+	tetratricopeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_000811065.1|710540_711395_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	39.0	8.3e-46
WP_000170954.1|711542_711650_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000170963.1|712078_712186_-	small toxic polypeptide LdrB	NA	NA	NA	NA	NA
WP_001301956.1|712590_713691_-	sodium-potassium/proton antiporter ChaA	NA	NA	NA	NA	NA
WP_001146444.1|713960_714191_+	putative cation transport regulator ChaB	NA	A5IZT6	Spodoptera_litura_granulovirus	40.0	8.5e-06
>prophage 55
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	725323	735333	4934701		Escherichia_phage(25.0%)	10	NA	NA
WP_001612858.1|725323_726862_+	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	40.8	4.8e-20
WP_000571681.1|726858_727569_+	nitrate reductase molybdenum cofactor assembly chaperone	NA	NA	NA	NA	NA
WP_001160110.1|727568_728246_+	respiratory nitrate reductase subunit gamma	NA	NA	NA	NA	NA
WP_000555853.1|728970_729813_-	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	47.6	3.7e-14
WP_001612859.1|729862_730321_-	YchJ family protein	NA	NA	NA	NA	NA
WP_001226476.1|730433_731339_+	patatin-like phospholipase RssA	NA	NA	NA	NA	NA
WP_000193447.1|731430_732444_+	two-component system response regulator RssB	NA	NA	NA	NA	NA
WP_000718995.1|732645_733554_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	46.8	1.4e-59
WP_001287378.1|733697_734111_-	DNA-binding transcriptional regulator H-NS	NA	NA	NA	NA	NA
WP_000068079.1|734715_735333_+	thymidine kinase	NA	A0A0A0YP64	Citrobacter_phage	53.6	1.3e-53
>prophage 56
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	743742	745757	4934701		Planktothrix_phage(50.0%)	2	NA	NA
WP_001612864.1|743742_744756_+	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppD	NA	G9BWD6	Planktothrix_phage	31.7	2.0e-14
WP_000994905.1|744752_745757_+	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppF	NA	G3M9Y6	Bacillus_virus	30.7	2.3e-15
>prophage 57
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	757411	760369	4934701		Acinetobacter_phage(100.0%)	2	NA	NA
WP_001718161.1|757411_758770_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	41.2	3.9e-37
WP_000763511.1|758773_760369_-	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	3.8e-52
>prophage 58
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	767337	772629	4934701	protease	Chrysochromulina_ericina_virus(33.33%)	4	NA	NA
WP_000559268.1|767337_768096_-	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.9	6.7e-07
WP_000422045.1|768315_769365_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
WP_001031530.1|769400_769652_-	YciN family protein	NA	NA	NA	NA	NA
WP_001295576.1|770031_772629_+	type I DNA topoisomerase	NA	A0A2K9L1Q2	Tupanvirus	34.5	7.0e-88
>prophage 59
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	777552	778143	4934701		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001176295.1|777552_778143_-	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	48.9	7.7e-43
>prophage 60
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	785959	791525	4934701		Lactococcus_phage(50.0%)	5	NA	NA
WP_001612906.1|785959_787894_-	exoribonuclease II	NA	Q0GXV6	Lactococcus_phage	27.2	5.3e-32
WP_001718172.1|787961_789089_-	CMD domain-containing protein	NA	NA	NA	NA	NA
WP_000506490.1|789232_790021_-	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
WP_001612907.1|790285_790651_-	DUF559 domain-containing protein	NA	NA	NA	NA	NA
WP_000573412.1|790718_791525_-	peptide ABC transporter ATP-binding protein SapF	NA	G3M9Y6	Bacillus_virus	28.6	7.2e-15
>prophage 61
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	804440	805706	4934701		Klosneuvirus(100.0%)	1	NA	NA
WP_001612910.1|804440_805706_+	4-aminobutyrate transaminase	NA	A0A1V0SKB7	Klosneuvirus	26.8	7.0e-25
>prophage 62
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	809883	813517	4934701	transposase	Bluetongue_virus(50.0%)	3	NA	NA
WP_099490915.1|809883_811092_+|transposase	IS4-like element ISVsa5 family transposase	transposase	Q9E8P4	Bluetongue_virus	99.5	7.5e-234
WP_000428546.1|811605_812199_+	tetracyline resistance-associated transcriptional repressor TetC	NA	NA	NA	NA	NA
WP_001089068.1|812311_813517_-	tetracycline efflux MFS transporter Tet(B)	NA	A0A2H4UVM2	Bodo_saltans_virus	24.4	3.0e-09
>prophage 63
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	817607	818816	4934701	transposase	uncultured_marine_virus(100.0%)	1	NA	NA
WP_001352368.1|817607_818816_-|transposase	IS4-like element ISVsa5 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	100.0	1.8e-235
>prophage 64
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	828862	829945	4934701		Planktothrix_phage(100.0%)	1	NA	NA
WP_001612920.1|828862_829945_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.7	9.6e-23
>prophage 65
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	848108	848624	4934701		Streptococcus_phage(100.0%)	1	NA	NA
WP_000945005.1|848108_848624_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	42.8	2.4e-24
>prophage 66
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	854951	908719	4934701	tRNA,terminase,integrase,tail,holin	Escherichia_phage(74.58%)	67	852339:852354	873810:873825
852339:852354	attL	AGTAAAATAATCAACA	NA	NA	NA	NA
WP_000628065.1|854951_856184_-	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
WP_000387388.1|856438_857422_+	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_000123745.1|857899_859273_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_001157377.1|859401_860337_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	100.0	2.8e-148
WP_024171493.1|860388_861624_-|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	98.3	6.7e-238
WP_000079604.1|861625_861841_-	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_001302840.1|861940_862129_-	DUF1187 family protein	NA	A0A0U2QL97	Escherichia_phage	98.4	5.5e-27
WP_072130784.1|862121_862316_-	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	92.2	9.3e-30
WP_000166322.1|862372_863206_-	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	66.8	7.2e-95
WP_001718192.1|863198_865874_-	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	81.7	0.0e+00
WP_001594001.1|865972_866248_-	phage protein	NA	A0A0U2QW85	Escherichia_phage	96.7	2.3e-42
WP_001594002.1|866322_866499_-	phage protein	NA	A0A0U2SHB5	Escherichia_phage	87.9	1.5e-23
WP_000560220.1|866492_866714_-	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	100.0	6.2e-38
WP_001594003.1|867134_867287_-	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	55.3	3.5e-08
WP_000233319.1|867719_868139_-	helix-turn-helix domain-containing protein	NA	A0A2I6PIE7	Escherichia_phage	46.5	5.5e-19
WP_001072340.1|868218_868473_+	hypothetical protein	NA	A0A2I6PIE5	Escherichia_phage	63.0	5.7e-19
WP_001594005.1|868469_868892_+	phage protein	NA	A0A0U2RXZ9	Escherichia_phage	94.3	7.7e-69
WP_001718193.1|868904_869201_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024171494.1|869201_869453_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001684845.1|869742_870651_+	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	90.1	2.2e-97
WP_001718195.1|870682_871105_+	hypothetical protein	NA	A0A0U2JGJ0	Escherichia_phage	94.3	5.1e-73
WP_001353252.1|871134_871530_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	53.6	3.5e-31
WP_001353251.1|871526_871823_+	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	94.7	2.0e-47
WP_001017772.1|871819_872104_+	DUF4752 family protein	NA	A0A088CD82	Shigella_phage	80.9	2.9e-35
WP_000935426.1|872203_872416_+	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	88.6	3.7e-32
WP_001033793.1|872454_873009_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001718196.1|873005_873938_-	hypothetical protein	NA	NA	NA	NA	NA
873810:873825	attR	AGTAAAATAATCAACA	NA	NA	NA	NA
WP_000018421.1|874307_874520_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	92.9	8.1e-27
WP_001594015.1|874986_875586_+	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	92.5	7.7e-107
WP_001594016.1|875585_875876_+	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	85.4	3.1e-45
WP_001594017.1|875872_876415_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	76.8	8.9e-78
WP_000833653.1|877920_878073_+	DUF3927 domain-containing protein	NA	NA	NA	NA	NA
WP_001297664.1|878159_878552_+|holin	holin	holin	Q9MBZ5	Enterobacteria_phage	78.5	3.4e-47
WP_000950577.1|878541_878817_+|holin	phage holin family protein	holin	Q9MBZ4	Enterobacteria_phage	96.7	7.2e-44
WP_001718205.1|878819_879197_+	M15 family metallopeptidase	NA	Q9MBZ3	Enterobacteria_phage	97.6	3.9e-64
WP_001353217.1|879211_879394_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001291088.1|879798_880590_+	ParB N-terminal domain-containing protein	NA	R4TG31	Halovirus	40.2	1.7e-48
WP_001204026.1|880582_881515_+	hypothetical protein	NA	A0A1B1INP7	uncultured_Mediterranean_phage	54.5	5.4e-83
WP_000126790.1|881492_881702_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000089436.1|881705_882797_+	hypothetical protein	NA	A0A0U2RXW9	Escherichia_phage	90.8	4.3e-148
WP_000021156.1|882786_884115_+|terminase	terminase	terminase	A0A0U2JTW9	Escherichia_phage	98.6	3.2e-262
WP_001718207.1|884133_885570_+	DUF1073 domain-containing protein	NA	A0A0U2S5X9	Escherichia_phage	95.8	5.7e-265
WP_001507252.1|885628_886348_+	hypothetical protein	NA	A0A0U2I1R8	Escherichia_phage	97.9	2.3e-134
WP_001718208.1|886328_887651_+	DUF2213 domain-containing protein	NA	A0A0U2QW61	Escherichia_phage	96.1	5.0e-191
WP_001353212.1|887643_888261_+	hypothetical protein	NA	A0A0U2S600	Escherichia_phage	99.0	8.5e-117
WP_001272372.1|888275_889304_+	hypothetical protein	NA	A0A0U2QQI2	Escherichia_phage	99.1	1.6e-189
WP_000780863.1|889361_889832_+	hypothetical protein	NA	A0A0U2SAX6	Escherichia_phage	99.4	5.5e-84
WP_000175375.1|889831_890272_+	hypothetical protein	NA	A0A0U2S646	Escherichia_phage	98.6	2.7e-77
WP_001718209.1|890268_890709_+	hypothetical protein	NA	A0A0U2RTA8	Escherichia_phage	94.5	1.9e-78
WP_001139505.1|890695_891640_+	hypothetical protein	NA	A0A0U2SH76	Escherichia_phage	99.7	1.3e-172
WP_001718210.1|891639_892977_+	hypothetical protein	NA	A0A0U2KD19	Escherichia_phage	96.2	2.6e-243
WP_000613368.1|893000_893432_+	hypothetical protein	NA	A0A0U2S616	Escherichia_phage	100.0	3.3e-75
WP_000703984.1|893428_894046_+	hypothetical protein	NA	A0A0U2S634	Escherichia_phage	75.5	2.1e-83
WP_000918397.1|894110_896186_+	hypothetical protein	NA	A0A0U2QV45	Escherichia_phage	42.8	2.1e-127
WP_000056327.1|896189_896858_+	hypothetical protein	NA	A0A0U2JGI7	Escherichia_phage	97.3	4.0e-120
WP_000209262.1|896854_897121_+	hypothetical protein	NA	A0A0U2JGJ3	Escherichia_phage	100.0	9.8e-46
WP_001271165.1|897120_898128_+	hypothetical protein	NA	A0A0U2QL72	Escherichia_phage	91.3	4.7e-181
WP_000063619.1|898127_898841_+	hypothetical protein	NA	A0A0U2JTX5	Escherichia_phage	95.4	2.8e-124
WP_001261327.1|899091_899439_+	hypothetical protein	NA	A0A0U2I1S2	Escherichia_phage	97.4	2.2e-61
WP_000426903.1|899588_900749_+	hypothetical protein	NA	A0A1S5SAB0	Streptococcus_phage	30.0	4.9e-33
WP_072148422.1|900789_902016_+	hypothetical protein	NA	A0A0U2RJZ0	Escherichia_phage	98.5	4.4e-226
WP_001199727.1|901999_902626_+	hypothetical protein	NA	A0A0U2RK03	Escherichia_phage	99.0	1.7e-120
WP_001718212.1|902622_904008_+	hypothetical protein	NA	A0A0U2SAV1	Escherichia_phage	90.2	1.9e-241
WP_001718213.1|904010_904556_+|tail	caudovirales tail fiber assembly family protein	tail	Q8W612	Enterobacteria_phage	78.6	2.4e-78
WP_032200929.1|904579_906406_+|tail	tail fiber protein	tail	Q8W611	Enterobacteria_phage	98.2	1.9e-55
WP_001295593.1|907010_907445_-	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.4e-28
WP_000837924.1|907585_908719_-	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	58.8	8.3e-118
>prophage 67
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	913678	914668	4934701		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_000762229.1|913678_914668_-	D-lactate dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	44.0	2.5e-70
>prophage 68
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	943655	947558	4934701		Klosneuvirus(100.0%)	1	NA	NA
WP_001718243.1|943655_947558_+	ATP-dependent RNA helicase HrpA	NA	A0A1V0SIV3	Klosneuvirus	29.5	2.2e-53
>prophage 69
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	951497	952446	4934701		Escherichia_phage(50.0%)	2	NA	NA
WP_001340313.1|951497_952028_+	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	44.9	3.1e-19
WP_000731833.1|952272_952446_+	periplasmic protein	NA	A0A0R6PKG1	Moraxella_phage	67.4	4.4e-07
>prophage 70
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	964253	974427	4934701	transposase	Escherichia_phage(20.0%)	10	NA	NA
WP_024194360.1|964253_965462_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	92.0	1.1e-205
WP_072148478.1|965501_966716_-	BenE family transporter YdcO	NA	NA	NA	NA	NA
WP_000429147.1|966768_967305_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001718255.1|967377_969339_+	23S rRNA 5-hydroxycytidine C2501 synthase	NA	Q6DW11	Phage_TP	28.9	5.4e-24
WP_000494244.1|969430_969661_-	YncJ family protein	NA	NA	NA	NA	NA
WP_001612987.1|969882_970059_+	type II toxin-antitoxin system mRNA interferase toxin HicA	NA	A0A0M3LQ86	Mannheimia_phage	56.1	8.0e-12
WP_001270286.1|970104_970521_+	type II toxin-antitoxin system antitoxin HicB	NA	F1C593	Cronobacter_phage	57.8	6.3e-31
WP_001718258.1|970599_972006_+	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_001612991.1|972250_973396_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000220411.1|973413_974427_+	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	37.9	2.1e-27
>prophage 71
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	981559	983662	4934701		Salmonella_phage(100.0%)	1	NA	NA
WP_001612994.1|981559_983662_-	TonB-dependent receptor	NA	A0A1B0VCF0	Salmonella_phage	65.6	1.1e-134
>prophage 72
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	991409	995037	4934701	transposase	Acidithiobacillus_phage(66.67%)	3	NA	NA
WP_001282653.1|991409_992165_-	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	43.8	6.2e-45
WP_000447015.1|992181_993717_-|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	40.7	8.6e-102
WP_157774359.1|993900_995037_+	hypothetical protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	32.3	1.8e-19
>prophage 73
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	1004632	1005280	4934701		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_024171500.1|1004632_1005280_+	RHS repeat-associated core domain-containing protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	48.9	4.1e-13
>prophage 74
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	1011520	1013065	4934701		Escherichia_phage(100.0%)	1	NA	NA
WP_001718285.1|1011520_1013065_-	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	39.2	6.4e-20
>prophage 75
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	1021353	1022454	4934701		Enterobacteria_phage(100.0%)	1	NA	NA
WP_001613040.1|1021353_1022454_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	65.1	1.6e-137
>prophage 76
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	1028466	1029907	4934701		Escherichia_phage(50.0%)	2	NA	NA
WP_001613048.1|1028466_1028751_-	HigA family addiction module antidote protein	NA	A0A2L1IV52	Escherichia_phage	51.1	1.5e-20
WP_000642406.1|1028896_1029907_-	alcohol dehydrogenase AdhP	NA	A0A2K9L339	Tupanvirus	25.3	9.6e-25
>prophage 77
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	1033180	1035086	4934701		Planktothrix_phage(100.0%)	2	NA	NA
WP_001613053.1|1033180_1034107_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.6	7.0e-14
WP_001613054.1|1034099_1035086_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.1	1.7e-18
>prophage 78
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	1039402	1043209	4934701		Klosneuvirus(50.0%)	2	NA	NA
WP_072148463.1|1039402_1041802_-	oxygen-sensing cyclic-di-GMP phosphodiesterase	NA	A0A1V0SL97	Klosneuvirus	22.0	1.6e-09
WP_000426272.1|1041826_1043209_-	diguanylate cyclase DosC	NA	G3MA91	Bacillus_virus	31.5	2.0e-17
>prophage 79
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	1048483	1055419	4934701		Powai_lake_megavirus(50.0%)	3	NA	NA
WP_072148476.1|1048483_1051279_-	insulinase family protein	NA	A0A167R9K4	Powai_lake_megavirus	24.2	1.2e-19
WP_001613062.1|1051323_1053696_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_000628551.1|1053733_1055419_-	ABC transporter ATP-binding protein/permease	NA	W8CYL7	Bacillus_phage	23.3	2.2e-10
>prophage 80
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	1072028	1073429	4934701		Escherichia_phage(100.0%)	1	NA	NA
WP_032149973.1|1072028_1073429_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	49.8	1.6e-107
>prophage 81
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	1080852	1082388	4934701		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001613077.1|1080852_1082388_+	autoinducer 2 ABC transporter ATP-binding protein LsrA	NA	A0A2H4PQG7	Staphylococcus_phage	24.0	1.9e-16
>prophage 82
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	1090259	1091678	4934701		Bacillus_phage(100.0%)	1	NA	NA
WP_001551135.1|1090259_1091678_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	36.1	1.4e-18
>prophage 83
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	1099423	1101553	4934701		Streptococcus_phage(50.0%)	3	NA	NA
WP_000091199.1|1099423_1099807_+	MDR efflux pump AcrAB transcriptional activator MarA	NA	D0R0F8	Streptococcus_phage	32.3	4.7e-09
WP_000803526.1|1099838_1100057_+	multiple antibiotic resistance protein MarB	NA	NA	NA	NA	NA
WP_001718317.1|1100113_1101553_-	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	25.7	6.3e-30
>prophage 84
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	1110539	1111430	4934701		Bacillus_phage(100.0%)	1	NA	NA
WP_001613095.1|1110539_1111430_-	diguanylate cyclase DgcZ	NA	A0A127AWB9	Bacillus_phage	37.0	3.1e-19
>prophage 85
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	1116795	1118495	4934701		Salmonella_phage(50.0%)	2	NA	NA
WP_000214712.1|1116795_1116999_+	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
WP_001613099.1|1117034_1118495_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	4.3e-42
>prophage 86
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	1121602	1130239	4934701	tail,lysis	Enterobacteria_phage(50.0%)	14	NA	NA
WP_001593356.1|1121602_1122184_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.3	2.5e-102
WP_000738423.1|1123052_1123346_+	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	91.8	2.0e-44
WP_001228695.1|1123436_1123619_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_001135280.1|1123835_1124333_-	lysozyme	NA	M1FJA0	Enterobacteria_phage	97.6	1.1e-90
WP_000839561.1|1124332_1124548_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	95.8	5.9e-33
WP_001348108.1|1124799_1125174_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000506937.1|1125345_1125774_-	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
WP_000562553.1|1126140_1126272_-	DUF3927 domain-containing protein	NA	H6WZJ7	Escherichia_phage	100.0	3.7e-06
WP_000762868.1|1127172_1127994_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	58.6	2.1e-78
WP_000904112.1|1127990_1128365_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	8.4e-35
WP_001265040.1|1128377_1129427_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	1.1e-108
WP_011478175.1|1129428_1129707_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	46.9	1.3e-11
WP_024171509.1|1129874_1130087_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	96.9	5.2e-26
WP_122083109.1|1130131_1130239_+	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	100.0	3.8e-09
>prophage 87
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	1137341	1158485	4934701	integrase	Escherichia_phage(33.33%)	26	1143779:1143792	1156144:1156157
WP_001151151.1|1137341_1137764_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	88.5	4.8e-63
WP_001262352.1|1137804_1138875_-	hypothetical protein	NA	A0A088CD36	Shigella_phage	64.6	4.7e-62
WP_000693836.1|1138946_1139372_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000391949.1|1139355_1139637_-	hypothetical protein	NA	K7PHA1	Enterobacteria_phage	72.6	8.5e-24
WP_000362155.1|1139737_1140157_+	hypothetical protein	NA	K7PK07	Enterobacteria_phage	65.1	8.8e-25
WP_000379589.1|1140422_1140578_+	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	51.1	8.8e-07
WP_001171928.1|1140737_1140953_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001331024.1|1140939_1141092_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001331023.1|1141492_1141681_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001083273.1|1141677_1141869_+	YebW family protein	NA	NA	NA	NA	NA
WP_000048286.1|1141962_1144434_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.7	1.5e-58
1143779:1143792	attL	GCGGCAATCAGCAT	NA	NA	NA	NA
WP_001296941.1|1144521_1144758_+	excisionase family protein	NA	S4TND0	Salmonella_phage	50.7	6.1e-15
WP_000876976.1|1144792_1146073_+|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	62.6	1.0e-156
WP_001389342.1|1146074_1146203_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001613128.1|1146260_1147280_-	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	25.9	2.2e-16
WP_001613129.1|1147291_1148506_-	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.8e-46
WP_001613130.1|1148711_1149038_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	1.7e-23
WP_000705197.1|1149172_1149514_+	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001138584.1|1149548_1150109_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_001321287.1|1150111_1150822_-	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001295396.1|1150929_1151235_+	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_001613131.1|1151433_1153860_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.2	1.3e-213
WP_072148439.1|1153920_1156344_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	2.2e-208
1156144:1156157	attR	ATGCTGATTGCCGC	NA	NA	NA	NA
WP_000213028.1|1156354_1156972_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_001613133.1|1156973_1157828_+	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000148698.1|1157870_1158485_+	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	1.1e-28
>prophage 88
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	1176245	1177547	4934701		Bacillus_phage(100.0%)	1	NA	NA
WP_000732487.1|1176245_1177547_+	two-component system sensor histidine kinase RstB	NA	W8CYF6	Bacillus_phage	23.9	7.2e-17
>prophage 89
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	1187442	1189254	4934701		Vaccinia_virus(100.0%)	1	NA	NA
WP_023308011.1|1187442_1189254_-	beta-glucuronidase	NA	B9U1V4	Vaccinia_virus	99.5	0.0e+00
>prophage 90
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	1209137	1210412	4934701	tRNA	Cronobacter_phage(100.0%)	1	NA	NA
WP_001295400.1|1209137_1210412_-|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	41.4	8.8e-84
>prophage 91
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	1217321	1218820	4934701		Salmonella_phage(50.0%)	2	NA	NA
WP_001296937.1|1217321_1217843_-	superoxide dismutase [Cu-Zn] SodC2	NA	Q9MC02	Salmonella_phage	55.7	7.8e-47
WP_000250656.1|1217923_1218820_-	aldo/keto reductase family oxidoreductase	NA	A0A1V0SDE7	Indivirus	30.8	4.7e-07
>prophage 92
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	1227623	1236427	4934701		Streptomyces_phage(20.0%)	9	NA	NA
WP_001718349.1|1227623_1228451_+	C40 family peptidase	NA	A0A2H5BM69	Streptomyces_phage	42.7	1.7e-19
WP_000007283.1|1228578_1229160_+	superoxide dismutase [Fe]	NA	Q56AR7	Bacillus_thuringiensis_phage	46.0	2.6e-43
WP_000701040.1|1229305_1230475_-	MFS transporter	NA	NA	NA	NA	NA
WP_000102278.1|1230640_1230730_-	stress response protein YnhF	NA	NA	NA	NA	NA
WP_000190982.1|1231028_1232054_+	HTH-type transcriptional repressor PurR	NA	C6ZCU4	Enterobacteria_phage	31.6	3.7e-32
WP_000269493.1|1232050_1232983_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001718351.1|1233095_1234307_+	Bcr/CflA family multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_000098896.1|1234597_1235746_+	cyclopropane fatty acyl phospholipid synthase	NA	A0A2K9L4K8	Tupanvirus	45.4	9.3e-85
WP_000493947.1|1235785_1236427_-	riboflavin synthase	NA	A0A2I2L4R9	Orpheovirus	35.2	7.4e-23
>prophage 93
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	1241931	1244198	4934701		Edwardsiella_phage(50.0%)	3	NA	NA
WP_001718353.1|1241931_1242744_-	hypothetical protein	NA	A0A077K9W7	Edwardsiella_phage	35.9	1.7e-08
WP_001613177.1|1242747_1243533_-	thiosulfate reductase cytochrome B subunit	NA	NA	NA	NA	NA
WP_001349911.1|1243529_1244198_-	4Fe-4S dicluster domain-containing protein	NA	A0A077SL61	Escherichia_phage	37.2	1.0e-22
>prophage 94
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	1252487	1257571	4934701		environmental_halophage(33.33%)	5	NA	NA
WP_001613181.1|1252487_1253708_-	cysteine desulfurase SufS	NA	Q2XUY6	environmental_halophage	40.9	3.2e-91
WP_001613182.1|1253704_1254976_-	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_000948855.1|1254950_1255697_-	Fe-S cluster assembly ATPase SufC	NA	A0A1V0SE00	Indivirus	24.0	5.1e-07
WP_000089364.1|1255706_1257194_-	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_000367160.1|1257202_1257571_-	Fe-S cluster assembly scaffold SufA	NA	A0A2H4N7N5	Lake_Baikal_phage	39.4	4.3e-15
>prophage 95
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	1276165	1295758	4934701	tRNA	Tupanvirus(22.22%)	19	NA	NA
WP_072148437.1|1276165_1277866_+	medium-chain fatty-acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	25.8	2.1e-32
WP_001613191.1|1277922_1280301_-	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	36.7	7.2e-172
WP_000368046.1|1280633_1281467_+	posphoenolpyruvate synthetase regulatory kinase/phosphorylase PpsR	NA	NA	NA	NA	NA
WP_001082229.1|1281623_1282670_+	3-deoxy-7-phosphoheptulonate synthase AroH	NA	S4W5F1	Pandoravirus	47.7	3.2e-84
WP_001270809.1|1282801_1282993_+	hemin uptake protein HemP	NA	NA	NA	NA	NA
WP_001613192.1|1282996_1284433_-	YdiU family protein	NA	NA	NA	NA	NA
WP_001613194.1|1284495_1285209_-	anti-FlhDC factor	NA	NA	NA	NA	NA
WP_001209780.1|1285455_1285920_-	lipoprotein	NA	S5MM68	Bacillus_phage	37.7	9.5e-12
WP_001613196.1|1285997_1286747_-	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	28.7	3.2e-09
WP_001154167.1|1286746_1287298_-	glutathione peroxidase	NA	NA	NA	NA	NA
WP_000956527.1|1287360_1288341_-	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
WP_001229265.1|1288441_1288741_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
WP_032201046.1|1288745_1291133_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_000018588.1|1291147_1292131_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	1.1e-33
WP_001386830.1|1292413_1292458_-|tRNA	phenylalanyl--tRNA ligase operon leader peptide	tRNA	NA	NA	NA	NA
WP_000124850.1|1292580_1292937_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_001124225.1|1292989_1293187_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_001700733.1|1293283_1293826_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.9	6.3e-15
WP_001144202.1|1293829_1295758_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.3	9.4e-130
>prophage 96
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	1307056	1309318	4934701		Tupanvirus(100.0%)	1	NA	NA
WP_032201048.1|1307056_1309318_+	catalase HPII	NA	A0A2K9L572	Tupanvirus	48.5	1.0e-143
>prophage 97
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	1315445	1316273	4934701		Bacillus_virus(100.0%)	1	NA	NA
WP_000175050.1|1315445_1316273_+	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	54.9	1.2e-73
>prophage 98
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	1323749	1324970	4934701		Klosneuvirus(100.0%)	1	NA	NA
WP_032201053.1|1323749_1324970_-	succinylornithine/acetylornithine transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.3	2.5e-27
>prophage 99
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	1331734	1332388	4934701		Bacillus_phage(100.0%)	1	NA	NA
WP_001718379.1|1331734_1332388_+	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	30.4	1.9e-10
>prophage 100
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	1337987	1339949	4934701		Streptococcus_phage(100.0%)	1	NA	NA
WP_032201055.1|1337987_1339949_-	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	29.2	3.2e-40
>prophage 101
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	1344862	1348948	4934701		Tupanvirus(50.0%)	4	NA	NA
WP_001135075.1|1344862_1345504_+	bifunctional nicotinamidase/pyrazinamidase	NA	A0A2K9L2K0	Tupanvirus	34.9	2.9e-19
WP_001718388.1|1345596_1346955_-	MFS transporter	NA	NA	NA	NA	NA
WP_000719088.1|1347072_1347831_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_000723724.1|1347967_1348948_-	NADH-dependent methylglyoxal reductase	NA	A0A2H4PQR8	Staphylococcus_phage	22.0	7.9e-08
>prophage 102
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	1357761	1358616	4934701		Indivirus(100.0%)	1	NA	NA
WP_001186347.1|1357761_1358616_-	methylglyoxal reductase YeaE	NA	A0A1V0SDE7	Indivirus	24.6	1.1e-10
>prophage 103
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	1361934	1366511	4934701		Bacillus_phage(100.0%)	3	NA	NA
WP_000219686.1|1361934_1363218_+	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	36.3	7.6e-11
WP_000616417.1|1363364_1364840_+	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_000766132.1|1365020_1366511_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	30.6	6.4e-09
>prophage 104
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	1381265	1389371	4934701	tRNA	Staphylococcus_phage(33.33%)	8	NA	NA
WP_000758422.1|1381265_1382951_-	long-chain-fatty-acid--CoA ligase FadD	NA	A0A2H4PQM9	Staphylococcus_phage	26.0	1.5e-35
WP_000290576.1|1383155_1383737_-	Slp family lipoprotein YeaY	NA	NA	NA	NA	NA
WP_001220997.1|1383776_1384472_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_000128847.1|1384529_1386440_-	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	31.9	4.5e-92
WP_001295493.1|1386571_1386916_+	RidA family protein	NA	NA	NA	NA	NA
WP_001307845.1|1387277_1387637_+	DUF1889 family protein	NA	NA	NA	NA	NA
WP_000457334.1|1387756_1387936_-	YoaH family protein	NA	NA	NA	NA	NA
WP_001613238.1|1388009_1389371_+	aminodeoxychorismate synthase component 1	NA	S4VT78	Pandoravirus	33.4	3.4e-41
>prophage 105
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	1393233	1394790	4934701		Moraxella_phage(100.0%)	1	NA	NA
WP_000394983.1|1393233_1394790_-	CNNM family cation transport protein YoaE	NA	A0A0R6PEZ3	Moraxella_phage	45.4	1.7e-41
>prophage 106
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	1400431	1400641	4934701		Morganella_phage(100.0%)	1	NA	NA
WP_001062678.1|1400431_1400641_-	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	1.6e-22
>prophage 107
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	1405972	1408021	4934701		Moraxella_phage(100.0%)	1	NA	NA
WP_001055778.1|1405972_1408021_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.5	1.2e-85
>prophage 108
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	1415517	1419987	4934701		Escherichia_phage(33.33%)	7	NA	NA
WP_001718411.1|1415517_1416174_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	50.2	1.8e-56
WP_000976472.1|1416569_1416911_-	YebY family protein	NA	NA	NA	NA	NA
WP_001718412.1|1416923_1417796_-	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000168747.1|1417799_1418174_-	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000916763.1|1418312_1418543_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	1.3e-14
WP_001718413.1|1418644_1419301_+	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_000944256.1|1419324_1419987_+	exodeoxyribonuclease X	NA	Q6UAU3	Klebsiella_phage	41.6	2.0e-07
>prophage 109
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	1428043	1429519	4934701		Cyanophage(100.0%)	1	NA	NA
WP_001718415.1|1428043_1429519_-	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	37.3	1.7e-78
>prophage 110
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	1433518	1440780	4934701		Bacillus_virus(50.0%)	9	NA	NA
WP_001613254.1|1433518_1434841_-	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	40.9	1.2e-14
WP_001342995.1|1434856_1435789_-	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_001718418.1|1435867_1436620_+	zinc ABC transporter ATP-binding protein ZnuC	NA	G3M9Y6	Bacillus_virus	28.3	1.3e-18
WP_001613256.1|1436619_1437405_+	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_000568519.1|1437749_1438760_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.5	5.6e-09
WP_000580323.1|1438768_1439380_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_072094247.1|1439518_1439584_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001718419.1|1439654_1440257_+	YebB family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_001295503.1|1440258_1440780_-	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.0e-10
>prophage 111
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	1444798	1446849	4934701		Escherichia_coli_phage(50.0%)	3	NA	NA
WP_000639274.1|1444798_1445617_+	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	99.2	6.5e-72
WP_000252980.1|1445669_1446065_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000019588.1|1446105_1446849_+	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	4.6e-24
>prophage 112
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	1453465	1455199	4934701	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_001613267.1|1453465_1455199_+|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.5	4.4e-86
>prophage 113
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	1460453	1466097	4934701		uncultured_Caudovirales_phage(50.0%)	5	NA	NA
WP_000763867.1|1460453_1460843_-	chemotaxis protein CheY	NA	A0A2K9L4R0	Tupanvirus	32.0	1.3e-06
WP_000036378.1|1460857_1461907_-	chemotaxis response regulator protein-glutamate methylesterase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	1.0e-05
WP_000204335.1|1461909_1462770_-	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_001613272.1|1462788_1464390_-	methyl-accepting chemotaxis protein IV	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.7	2.9e-15
WP_001297437.1|1464435_1466097_-	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.3	1.7e-10
>prophage 114
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	1476184	1477699	4934701		Cedratvirus(100.0%)	1	NA	NA
WP_001537115.1|1476184_1477699_-	L-arabinose ABC transporter ATP-binding protein AraG	NA	A0A285PWH2	Cedratvirus	29.7	1.3e-12
>prophage 115
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	1489692	1490445	4934701		Bacillus_virus(100.0%)	1	NA	NA
WP_001272992.1|1489692_1490445_-	L-cystine ABC transporter ATP-binding protein YecC	NA	G3M9Y6	Bacillus_virus	34.9	3.8e-26
>prophage 116
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	1502633	1503302	4934701		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_001718434.1|1502633_1503302_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	61.7	6.6e-83
>prophage 117
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	1518481	1530967	4934701		Bacillus_phage(33.33%)	12	NA	NA
WP_001613324.1|1518481_1520176_-	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	35.6	1.3e-18
WP_000009307.1|1520346_1520529_-	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_000922682.1|1520607_1521525_-	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_001718442.1|1521697_1522618_+	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_000786004.1|1522606_1523077_-	very short patch repair endonuclease	NA	E5E3X5	Burkholderia_phage	47.6	1.5e-33
WP_001157247.1|1523057_1524476_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	55.6	1.4e-101
WP_000365562.1|1524542_1525238_-	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	28.0	2.8e-07
WP_001313057.1|1525277_1525643_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001718446.1|1526208_1527387_+	porin	NA	Q1MVN1	Enterobacteria_phage	55.4	2.9e-105
WP_000218214.1|1527979_1528831_+	protein deglycase HchA	NA	NA	NA	NA	NA
WP_001718447.1|1528937_1530296_-	heavy metal sensor histidine kinase	NA	NA	NA	NA	NA
WP_001339045.1|1530295_1530967_-	response regulator transcription factor HprR	NA	W8CYM9	Bacillus_phage	35.2	5.4e-32
>prophage 118
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	1534511	1535042	4934701		Escherichia_phage(100.0%)	1	NA	NA
WP_001079074.1|1534511_1535042_+	cytochrome b	NA	A0A0U2QLA7	Escherichia_phage	100.0	1.9e-56
>prophage 119
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	1561622	1562789	4934701		Stx2-converting_phage(100.0%)	1	NA	NA
WP_001296209.1|1561622_1562789_-	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	99.5	5.9e-228
>prophage 120
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	1569982	1570882	4934701		Cellulophaga_phage(100.0%)	1	NA	NA
WP_000131782.1|1569982_1570882_+	ATP phosphoribosyltransferase	NA	A0A0F7Q4B0	Cellulophaga_phage	94.7	1.8e-11
>prophage 121
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	1578236	1581058	4934701		Paramecium_bursaria_Chlorella_virus(50.0%)	2	NA	NA
WP_000704798.1|1578236_1579403_-	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	54.2	3.3e-114
WP_001718466.1|1579651_1581058_-	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.3	1.8e-37
>prophage 122
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	1586675	1589599	4934701		Bacillus_phage(50.0%)	2	NA	NA
WP_001718482.1|1586675_1588049_-	phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	27.4	3.8e-32
WP_001718483.1|1588162_1589599_-	mannose-1-phosphate guanyltransferase	NA	A0A1V0SH58	Hokovirus	30.7	1.1e-55
>prophage 123
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	1595338	1599022	4934701		Bacillus_phage(33.33%)	3	NA	NA
WP_000183060.1|1595338_1596232_-	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	1.0e-46
WP_001718491.1|1596474_1597470_-	SDR family oxidoreductase	NA	A0A1V0QG29	Shearwaterpox_virus	26.3	1.9e-09
WP_001718492.1|1597627_1599022_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	31.8	3.7e-19
>prophage 124
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	1604830	1611712	4934701		Bacillus_phage(25.0%)	6	NA	NA
WP_001313977.1|1604830_1606201_-	phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	27.7	2.2e-32
WP_000079285.1|1606481_1607918_-	mannose-1-phosphate guanyltransferase	NA	A0A1V0SH58	Hokovirus	29.2	1.3e-46
WP_001718496.1|1607920_1609144_-	colanic acid biosynthesis fucosyltransferase WcaI	NA	NA	NA	NA	NA
WP_000479836.1|1609140_1609620_-	GDP-mannose mannosyl hydrolase	NA	NA	NA	NA	NA
WP_000043606.1|1609622_1610588_-	GDP-L-fucose synthase	NA	D1LW79	Prochlorococcus_phage	50.8	1.7e-87
WP_000048190.1|1610590_1611712_-	GDP-mannose 4,6-dehydratase	NA	M4QRT5	Synechococcus_phage	64.9	1.5e-132
>prophage 125
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	1615955	1626524	4934701		uncultured_marine_virus(20.0%)	8	NA	NA
WP_000654503.1|1615955_1616795_-	colanic acid biosynthesis glycosyltransferase WcaA	NA	A0A0F7L2F7	uncultured_marine_virus	34.8	9.7e-07
WP_032201074.1|1616887_1619050_-	tyrosine-protein kinase Wzc	NA	A0A1X9I5D6	Streptococcus_phage	30.3	2.4e-17
WP_001718499.1|1619052_1619496_-	low molecular weight protein-tyrosine-phosphatase Wzb	NA	NA	NA	NA	NA
WP_000978094.1|1619501_1620641_-	polysaccharide export protein	NA	NA	NA	NA	NA
WP_000454701.1|1621299_1622883_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	42.6	7.2e-35
WP_032201077.1|1623334_1625188_-	outer membrane assembly protein AsmA	NA	NA	NA	NA	NA
WP_001234767.1|1625209_1625791_-	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	42.1	1.3e-31
WP_001295424.1|1625882_1626524_-	uridine kinase	NA	A0A1V0SAA3	Catovirus	36.9	3.2e-34
>prophage 126
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	1643505	1647137	4934701	tail	Escherichia_phage(100.0%)	3	NA	NA
WP_071685744.1|1643505_1644270_-|tail	tail fiber domain-containing protein	tail	A0A0M7Q827	Escherichia_phage	50.8	5.0e-58
WP_141011545.1|1644634_1645414_-	hypothetical protein	NA	A0A1B2APF7	Escherichia_phage	38.7	1.8e-31
WP_073849404.1|1645391_1647137_-	hypothetical protein	NA	K7P802	Escherichia_phage	42.1	4.8e-16
>prophage 127
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	1656911	1657130	4934701		Escherichia_phage(100.0%)	1	NA	NA
WP_073849413.1|1656911_1657130_-	hypothetical protein	NA	A0A2I2L6P6	Escherichia_phage	52.6	6.6e-16
>prophage 128
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	1679792	1686655	4934701	tRNA	Bacillus_phage(50.0%)	8	NA	NA
WP_000675144.1|1679792_1681196_+	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.4	1.2e-33
WP_000137877.1|1681192_1681915_+	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.6	3.7e-31
WP_001718511.1|1682105_1682438_+	YegP family protein	NA	NA	NA	NA	NA
WP_000124651.1|1682681_1682933_+	type II toxin-antitoxin system ParD family antitoxin	NA	NA	NA	NA	NA
WP_001220181.1|1682934_1683231_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001718513.1|1683333_1684695_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	99.5	4.2e-217
WP_000716757.1|1685024_1685342_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000807361.1|1685755_1686655_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	1.3e-12
>prophage 129
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	1695877	1699434	4934701		Serratia_phage(50.0%)	4	NA	NA
WP_032201094.1|1695877_1696882_+	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	29.7	1.3e-13
WP_001613398.1|1696878_1697844_+	kinase	NA	NA	NA	NA	NA
WP_000434038.1|1697817_1698564_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001400611.1|1698615_1699434_-	glycoside hydrolase family 25 protein	NA	D0R7H8	Paenibacillus_phage	38.5	1.7e-24
>prophage 130
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	1710082	1712116	4934701	tRNA	Indivirus(100.0%)	1	NA	NA
WP_001613409.1|1710082_1712116_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.8e-54
>prophage 131
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	1724628	1734073	4934701		Enterobacteria_phage(85.71%)	10	NA	NA
WP_001292770.1|1724628_1725765_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.7	8.5e-163
WP_001613415.1|1725761_1727765_+	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	96.7	0.0e+00
WP_001295429.1|1727889_1728351_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001295430.1|1728391_1728862_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_000598641.1|1728908_1729628_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295431.1|1729624_1731310_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_001240399.1|1731531_1732263_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.0	2.8e-111
WP_001216963.1|1732322_1732430_+	protein YohO	NA	NA	NA	NA	NA
WP_000783120.1|1732410_1733142_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001718529.1|1733146_1734073_-	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	31.2	9.7e-24
>prophage 132
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	1754493	1756014	4934701		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_000255032.1|1754493_1756014_-	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	33.0	2.6e-10
>prophage 133
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	1759708	1763482	4934701		Cellulophaga_phage(50.0%)	3	NA	NA
WP_001139613.1|1759708_1760377_-	GTP cyclohydrolase I FolE	NA	M1Q6X8	Cellulophaga_phage	56.3	9.0e-56
WP_000425434.1|1760634_1761471_+	S-formylglutathione hydrolase YeiG	NA	NA	NA	NA	NA
WP_000489252.1|1761502_1763482_-	catecholate siderophore receptor CirA	NA	A0A0P0I887	Acinetobacter_phage	36.6	1.9e-13
>prophage 134
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	1767550	1768408	4934701		Catovirus(100.0%)	1	NA	NA
WP_000873899.1|1767550_1768408_+	deoxyribonuclease IV	NA	A0A1V0SBL9	Catovirus	34.0	1.4e-24
>prophage 135
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	1782902	1787203	4934701		Ostreococcus_tauri_virus(50.0%)	4	NA	NA
WP_001613458.1|1782902_1784369_+	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	30.2	1.0e-43
WP_001613459.1|1784486_1785473_+	GTP-binding protein	NA	NA	NA	NA	NA
WP_001613460.1|1785511_1786225_+	Kdo(2)-lipid A phosphotransferase	NA	NA	NA	NA	NA
WP_032201106.1|1786636_1787203_+	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	A0A1V0DZX6	Clostridioides_phage	39.8	1.2e-13
>prophage 136
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	1792957	1800605	4934701		Vibrio_phage(50.0%)	7	NA	NA
WP_001613465.1|1792957_1794547_+	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	34.0	1.1e-19
WP_000202798.1|1794550_1794895_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000213385.1|1795227_1796418_-	multidrug efflux MFS transporter Bcr	NA	S4TR35	Salmonella_phage	23.7	2.9e-20
WP_001234850.1|1796445_1797141_-	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
WP_000578040.1|1797289_1799050_+	DEAD/DEAH box helicase	NA	M4Q3N1	Vibrio_phage	42.0	1.9e-100
WP_000494183.1|1799174_1799459_+	50S ribosomal protein L25	NA	NA	NA	NA	NA
WP_000050789.1|1799597_1800605_-	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	48.3	1.5e-83
>prophage 137
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	1812478	1813096	4934701		Bacillus_virus(100.0%)	1	NA	NA
WP_001613471.1|1812478_1813096_-	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	G3M9Y6	Bacillus_virus	25.5	2.5e-12
>prophage 138
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	1822089	1827876	4934701		Bacillus_phage(25.0%)	5	NA	NA
WP_001613473.1|1822089_1823733_-	microcin J25 efflux ABC transporter YojI	NA	W8CYL7	Bacillus_phage	24.0	1.2e-13
WP_000884972.1|1823808_1824459_-	DNA oxidative demethylase AlkB	NA	A0A2K9L3R7	Tupanvirus	31.7	1.4e-05
WP_001718541.1|1824458_1825523_-	bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	48.5	1.6e-17
WP_001613476.1|1825596_1826652_-	FAD:protein FMN transferase ApbE	NA	NA	NA	NA	NA
WP_000865563.1|1826763_1827876_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	59.4	7.6e-116
>prophage 139
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	1832135	1834985	4934701		Hokovirus(100.0%)	1	NA	NA
WP_001613477.1|1832135_1834985_-	two-component system sensor histidine kinase RcsC	NA	A0A1V0SGX0	Hokovirus	27.2	1.1e-41
>prophage 140
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	1844685	1847313	4934701		Bacillus_virus(100.0%)	1	NA	NA
WP_032201114.1|1844685_1847313_-	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	G3M9Z5	Bacillus_virus	31.4	1.4e-88
>prophage 141
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	1852757	1856660	4934701		Pseudomonas_phage(66.67%)	3	NA	NA
WP_001075170.1|1852757_1855043_+	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2D1GNB1	Pseudoalteromonas_phage	63.6	1.9e-283
WP_000332036.1|1855275_1856406_+	ribonucleotide-diphosphate reductase subunit beta	NA	G9IAA3	Pseudomonas_phage	78.9	2.5e-175
WP_001613486.1|1856405_1856660_+	ferredoxin-like diferric-tyrosyl radical cofactor maintenance protein YfaE	NA	G9IAA2	Pseudomonas_phage	61.9	1.5e-24
>prophage 142
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	1859722	1860802	4934701		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001613489.1|1859722_1860802_-	glycerophosphodiester phosphodiesterase	NA	A0A220BYK6	Staphylococcus_phage	46.0	5.1e-08
>prophage 143
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	1866694	1871082	4934701	transposase	Sodalis_phage(50.0%)	4	NA	NA
WP_001718555.1|1866694_1867669_+|transposase	ISNCY family transposase	transposase	Q2A0A7	Sodalis_phage	55.2	7.2e-70
WP_001613493.1|1867709_1868513_-	2-keto-3-deoxy-L-rhamnonate aldolase	NA	NA	NA	NA	NA
WP_001613495.1|1868530_1869820_-	MFS transporter	NA	NA	NA	NA	NA
WP_001613496.1|1869876_1871082_-	L-rhamnonate dehydratase	NA	Q6A202	Oenococcus_phage	28.5	3.2e-27
>prophage 144
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	1874685	1879689	4934701		Tupanvirus(50.0%)	4	NA	NA
WP_001306469.1|1874685_1875288_-	histidine phosphatase family protein	NA	A0A2L1IV13	Escherichia_phage	42.9	4.4e-09
WP_001718556.1|1875595_1876735_+	UDP-4-amino-4-deoxy-L-arabinose aminotransferase	NA	A0A2K9L470	Tupanvirus	29.8	1.5e-29
WP_000461658.1|1876738_1877707_+	undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase	NA	F1C5B0	Cronobacter_phage	31.5	1.2e-35
WP_032201117.1|1877706_1879689_+	bifunctional UDP-4-amino-4-deoxy-L-arabinose formyltransferase/UDP-glucuronic acid oxidase ArnA	NA	A0A2K9KZK0	Tupanvirus	25.8	4.1e-19
>prophage 145
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	1914112	1917340	4934701		Salmonella_phage(50.0%)	3	NA	NA
WP_000813854.1|1914112_1914712_+	5'-deoxynucleotidase	NA	A0A2L0V156	Salmonella_phage	38.6	7.0e-07
WP_001012892.1|1914770_1916603_-	SLC13 family permease	NA	NA	NA	NA	NA
WP_001613513.1|1916689_1917340_-	hexitol phosphatase HpxA	NA	M1IMD4	Acanthocystis_turfacea_Chlorella_virus	27.5	2.8e-09
>prophage 146
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	1927899	1929760	4934701	transposase	Sodalis_phage(50.0%)	2	NA	NA
WP_001613519.1|1927899_1928790_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	52.3	5.8e-66
WP_001293612.1|1928986_1929760_-	histidine ABC transporter ATP-binding protein HisP	NA	M1I0T9	Acanthocystis_turfacea_Chlorella_virus	28.2	2.1e-08
>prophage 147
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	1933971	1935489	4934701		Mollivirus(100.0%)	1	NA	NA
WP_001613521.1|1933971_1935489_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	44.0	2.0e-87
>prophage 148
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	1942021	1943158	4934701		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_001613522.1|1942021_1943158_-	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.4	4.5e-23
>prophage 149
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	1951713	1952799	4934701		Pandoravirus(100.0%)	1	NA	NA
WP_001297933.1|1951713_1952799_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	47.8	7.0e-90
>prophage 150
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	1970867	1978117	4934701	transposase	Enterobacteria_phage(25.0%)	6	NA	NA
WP_000368131.1|1970867_1971800_+	transporter	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
WP_000064874.1|1972463_1972889_-|transposase	IS200/IS605-like element ISEc46 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	50.4	1.1e-25
WP_001613545.1|1972945_1974115_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SLN2	Escherichia_phage	99.5	9.2e-205
WP_001613546.1|1974234_1975482_-	MFS transporter	NA	NA	NA	NA	NA
WP_001274878.1|1975553_1976468_-	aminoimidazole riboside kinase	NA	NA	NA	NA	NA
WP_001613547.1|1976683_1978117_+	glycoside hydrolase family 32 protein	NA	F8WPR5	Bacillus_phage	25.2	4.1e-29
>prophage 151
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	1984770	1992347	4934701		Bacillus_phage(50.0%)	4	NA	NA
WP_001613552.1|1984770_1988364_+	acid-sensing system histidine kinase EvgS	NA	W8CYM9	Bacillus_phage	40.0	6.2e-10
WP_001433504.1|1988419_1989565_-	CoA:oxalate CoA-transferase	NA	NA	NA	NA	NA
WP_000955028.1|1989638_1990583_-	transporter YfdV	NA	NA	NA	NA	NA
WP_001283479.1|1990652_1992347_-	oxalyl-CoA decarboxylase	NA	E5ERI2	Ostreococcus_lucimarinus_virus	23.8	1.0e-23
>prophage 152
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	1996037	1996958	4934701		Morganella_phage(100.0%)	1	NA	NA
WP_000484404.1|1996037_1996958_+	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	54.8	4.9e-76
>prophage 153
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	2000776	2001511	4934701		Clostridioides_phage(100.0%)	1	NA	NA
WP_001295458.1|2000776_2001511_+	response regulator transcription factor	NA	A0A2R2ZGH8	Clostridioides_phage	25.4	3.6e-13
>prophage 154
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	2028397	2043780	4934701		Streptococcus_phage(33.33%)	15	NA	NA
WP_001718634.1|2028397_2030413_-	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	43.4	1.7e-150
WP_001299866.1|2030483_2031482_-	cell division protein ZipA	NA	NA	NA	NA	NA
WP_000254839.1|2031711_2032473_+	sulfate transporter CysZ	NA	NA	NA	NA	NA
WP_000034402.1|2032657_2033629_+	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	51.0	2.8e-74
WP_000487600.1|2034012_2034270_+	phosphocarrier protein Hpr	NA	NA	NA	NA	NA
WP_000623136.1|2034314_2036042_+	phosphoenolpyruvate-protein phosphotransferase PtsI	NA	A0A1V0SGR7	Hokovirus	31.1	9.6e-17
WP_000522247.1|2036082_2036592_+	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_000096660.1|2036633_2037485_-	pyridoxine/pyridoxal/pyridoxamine kinase	NA	NA	NA	NA	NA
WP_000719943.1|2037589_2037958_+	YfeK family protein	NA	NA	NA	NA	NA
WP_001295461.1|2037960_2038872_-	cysteine synthase B	NA	A0A1X9I5F1	Streptococcus_phage	41.9	7.7e-58
WP_000021039.1|2039006_2040104_-	sulfate/thiosulfate ABC transporter ATP-binding protein CysA	NA	G3M9Y6	Bacillus_virus	34.1	4.2e-26
WP_000852686.1|2040093_2040969_-	sulfate/thiosulfate ABC transporter permease CysW	NA	NA	NA	NA	NA
WP_000458406.1|2040968_2041802_-	sulfate/thiosulfate ABC transporter permease CysT	NA	NA	NA	NA	NA
WP_000290231.1|2041801_2042818_-	sulfate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000517431.1|2042988_2043780_-	SDR family oxidoreductase UcpA	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.0	8.9e-18
>prophage 155
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	2047258	2052342	4934701		Mycobacterium_phage(33.33%)	6	NA	NA
WP_001315775.1|2047258_2048563_+	penicillin binding protein PBP4B	NA	A0A0B5A438	Mycobacterium_phage	26.2	1.6e-08
WP_000084590.1|2048620_2049520_-	porphyrinogen peroxidase	NA	S4VVJ7	Pandoravirus	32.6	4.5e-26
WP_000838945.1|2049615_2050191_-	RpoE-regulated lipoprotein	NA	NA	NA	NA	NA
WP_001613566.1|2050397_2050847_-	DUF2919 domain-containing protein	NA	NA	NA	NA	NA
WP_000406000.1|2050833_2051259_-	acetyltransferase YpeA	NA	NA	NA	NA	NA
WP_000102891.1|2051472_2052342_+	N-acetylmuramoyl-L-alanine amidase AmiA	NA	E5DV68	Deep-sea_thermophilic_phage	27.4	4.2e-13
>prophage 156
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	2071096	2072047	4934701		Cyanophage(100.0%)	1	NA	NA
WP_001003709.1|2071096_2072047_+	transaldolase A	NA	A0A127KNC6	Cyanophage	31.3	5.7e-11
>prophage 157
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	2089350	2090064	4934701		Synechococcus_phage(100.0%)	1	NA	NA
WP_001295467.1|2089350_2090064_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3FGF0	Synechococcus_phage	36.1	6.9e-38
>prophage 158
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	2111365	2115367	4934701		Enterobacteria_phage(33.33%)	4	NA	NA
WP_000198328.1|2111365_2112655_-	uracil permease	NA	Q9KX94	Enterobacteria_phage	37.4	5.1e-63
WP_001295473.1|2112740_2113367_-	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001295474.1|2113691_2114729_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SE90	Cyanophage	43.3	1.1e-71
WP_001028618.1|2114728_2115367_+	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	42.9	4.0e-29
>prophage 159
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	2121802	2123360	4934701		Escherichia_phage(100.0%)	3	NA	NA
WP_001344399.1|2121802_2121976_+	DUF2633 family protein	NA	G9L6F2	Escherichia_phage	100.0	6.8e-24
WP_000669412.1|2122289_2122805_+	glycine zipper 2TM domain-containing protein	NA	G9L6F1	Escherichia_phage	99.4	2.9e-62
WP_001718659.1|2122820_2123360_+	hypothetical protein	NA	G9L6F0	Escherichia_phage	97.8	2.2e-44
>prophage 160
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	2128972	2131971	4934701		Klosneuvirus(50.0%)	2	NA	NA
WP_001299507.1|2128972_2130439_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	39.1	2.3e-88
WP_001718663.1|2130600_2131971_+	exodeoxyribonuclease VII large subunit	NA	A0A2H4UVM9	Bodo_saltans_virus	35.3	6.8e-42
>prophage 161
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	2140800	2141232	4934701		Powai_lake_megavirus(100.0%)	1	NA	NA
WP_000963837.1|2140800_2141232_-	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	37.9	3.7e-18
>prophage 162
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	2151443	2157781	4934701		Mycoplasma_phage(20.0%)	8	NA	NA
WP_001718669.1|2151443_2152727_-	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	37.8	2.2e-34
WP_000523616.1|2152785_2152986_-	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_099560746.1|2152997_2153333_-	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_001196613.1|2153334_2155185_-	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	41.6	5.5e-103
WP_000384413.1|2155201_2155717_-	co-chaperone HscB	NA	NA	NA	NA	NA
WP_000028953.1|2155812_2156136_-	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	48.6	5.4e-22
WP_000331707.1|2156152_2156539_-	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	78.9	1.4e-53
WP_001295373.1|2156566_2157781_-	cysteine desulfurase	NA	A0A1X7C038	Faustovirus	31.8	8.8e-33
>prophage 163
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	2173007	2174519	4934701		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_032201231.1|2173007_2174519_-	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	28.4	7.1e-08
>prophage 164
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	2180411	2191719	4934701		Bacillus_phage(50.0%)	7	NA	NA
WP_000919159.1|2180411_2181665_-	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	52.7	7.8e-101
WP_000883122.1|2181992_2183183_+	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_000717694.1|2183227_2183566_-	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
WP_001295369.1|2183626_2184961_-	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	37.3	3.9e-10
WP_001215860.1|2184950_2185664_-	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
WP_001301750.1|2185828_2187256_-	two component system sensor histidine kinase QseE/GlrK	NA	W8CYF6	Bacillus_phage	25.6	1.8e-16
WP_001718683.1|2187831_2191719_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	59.2	5.9e-131
>prophage 165
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	2195838	2196099	4934701		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_001196285.1|2195838_2196099_+	4Fe-4S dicluster ferredoxin YfhL	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	52.3	8.4e-18
>prophage 166
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	2199559	2203302	4934701		Tetraselmis_virus(50.0%)	3	NA	NA
WP_001068343.1|2199559_2200240_-	ribonuclease III	NA	A0A2P0VNZ5	Tetraselmis_virus	39.6	5.6e-21
WP_000002542.1|2200512_2201487_-	signal peptidase I	NA	NA	NA	NA	NA
WP_000790168.1|2201502_2203302_-	elongation factor 4	NA	A0A2K9L6L3	Tupanvirus	41.9	4.2e-23
>prophage 167
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	2209073	2215157	4934701	tRNA	Cafeteria_roenbergensis_virus(25.0%)	7	NA	NA
WP_099560747.1|2209073_2210357_+	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.8	2.8e-45
WP_001383425.1|2210441_2211323_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001613622.1|2211425_2212013_+	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_000627807.1|2212068_2212452_-	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	72.0	1.4e-32
WP_001262720.1|2212756_2213446_+	uracil-DNA glycosylase	NA	A0A077BCN4	Equid_alphaherpesvirus	52.1	3.5e-55
WP_000997403.1|2213493_2214531_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001098726.1|2214737_2215157_+	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
>prophage 168
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	2220450	2221749	4934701		Burkholderia_virus(100.0%)	1	NA	NA
WP_000841103.1|2220450_2221749_-	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	32.2	1.3e-45
>prophage 169
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	2227524	2230098	4934701		Enterobacteria_phage(100.0%)	1	NA	NA
WP_001235102.1|2227524_2230098_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	2.6e-127
>prophage 170
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	2236010	2237081	4934701		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
WP_001168032.1|2236010_2237081_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	6.9e-90
>prophage 171
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	2250715	2253629	4934701	integrase	Escherichia_phage(66.67%)	3	2247549:2247564	2253553:2253568
2247549:2247564	attL	CTGTATATAAAACCAG	NA	NA	NA	NA
WP_000162574.1|2250715_2251198_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
WP_001718710.1|2251939_2253169_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	98.3	1.0e-230
WP_024171535.1|2253212_2253629_+	hypothetical protein	NA	A0A1B5FPM5	Escherichia_phage	95.7	7.6e-69
2253553:2253568	attR	CTGGTTTTATATACAG	NA	NA	NA	NA
>prophage 172
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	2257234	2258623	4934701		Leptospira_phage(100.0%)	1	NA	NA
WP_001718714.1|2257234_2258623_-	His-Xaa-Ser system radical SAM maturase HxsB	NA	S5VT21	Leptospira_phage	28.7	2.8e-51
>prophage 173
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	2271316	2271523	4934701		Vibrio_phage(100.0%)	1	NA	NA
WP_001071599.1|2271316_2271523_-	AlpA family transcriptional regulator	NA	A0A1V0E8E5	Vibrio_phage	43.3	1.8e-07
>prophage 174
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	2277825	2278044	4934701		Salmonella_phage(100.0%)	1	NA	NA
WP_071589635.1|2277825_2278044_-	recombinase family protein	NA	A0A1S6L009	Salmonella_phage	72.0	4.1e-10
>prophage 175
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	2287496	2291548	4934701		Klosneuvirus(50.0%)	4	NA	NA
WP_001613645.1|2287496_2288777_+	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	29.9	1.6e-32
WP_001301367.1|2289014_2290415_+	GABA permease	NA	NA	NA	NA	NA
WP_000156811.1|2290435_2291098_+	DNA-binding transcriptional regulator CsiR	NA	NA	NA	NA	NA
WP_000522424.1|2291098_2291548_-	potassium binding protein Kbp	NA	A0A090DBR9	Clostridium_phage	39.5	2.0e-06
>prophage 176
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	2295483	2300779	4934701		Oenococcus_phage(20.0%)	5	NA	NA
WP_001223227.1|2295483_2295729_+	glutaredoxin-like protein NrdH	NA	Q5K5J3	Oenococcus_phage	35.3	1.8e-06
WP_000080944.1|2295725_2296136_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	44.4	2.7e-18
WP_001718731.1|2296108_2298253_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	48.4	2.4e-195
WP_000777969.1|2298262_2299222_+	ribonucleoside-diphosphate reductase 2 subunit beta	NA	R4TBI6	Mycobacterium_phage	71.8	3.5e-133
WP_000985494.1|2299576_2300779_+	proline/glycine betaine ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	39.4	4.9e-28
>prophage 177
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	2315520	2321080	4934701	tRNA	Vibrio_phage(25.0%)	5	NA	NA
WP_000906486.1|2315520_2315706_-	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	4.9e-12
WP_000047196.1|2315940_2318571_-|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L1X7	Tupanvirus	38.6	5.5e-80
WP_000140506.1|2318698_2319199_-	recombination regulator RecX	NA	NA	NA	NA	NA
WP_000963143.1|2319441_2320503_-	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	63.4	1.2e-113
WP_000132231.1|2320582_2321080_-	nicotinamide-nucleotide amidase	NA	B5TK85	Pseudomonas_phage	49.7	4.4e-31
>prophage 178
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	2326547	2327513	4934701		Tetraselmis_virus(100.0%)	1	NA	NA
WP_001718738.1|2326547_2327513_+	arabinose-5-phosphate isomerase GutQ	NA	A0A2P0VNK5	Tetraselmis_virus	34.3	1.0e-36
>prophage 179
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	2355267	2362407	4934701		Escherichia_phage(83.33%)	6	NA	NA
WP_001272907.1|2355267_2357829_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	2.3e-30
WP_001141330.1|2357934_2358591_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.7	4.3e-50
WP_001297141.1|2358641_2359409_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	3.3e-70
WP_000847985.1|2359604_2360513_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_001613685.1|2360509_2361772_+	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	1.7e-135
WP_001278994.1|2361768_2362407_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
>prophage 180
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	2367621	2371337	4934701		uncultured_Mediterranean_phage(50.0%)	4	NA	NA
WP_000081550.1|2367621_2368614_-	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
WP_001272592.1|2368676_2369816_-	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
WP_001718755.1|2369955_2370582_-	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	4.4e-36
WP_001295182.1|2370575_2371337_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	3.4e-59
>prophage 181
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	2374449	2376482	4934701		Tupanvirus(50.0%)	2	NA	NA
WP_001718759.1|2374449_2375055_-	adenylyl-sulfate kinase	NA	A0A2K9L4R9	Tupanvirus	38.1	5.5e-28
WP_001090338.1|2375054_2376482_-	sulfate adenylyltransferase subunit CysN	NA	A0A1V0SGC3	Hokovirus	31.8	1.6e-30
>prophage 182
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	2395009	2395795	4934701		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
WP_001618810.1|2395009_2395795_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.5	5.0e-21
>prophage 183
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	2400633	2405553	4934701		Dinoroseobacter_phage(33.33%)	4	NA	NA
WP_001718782.1|2400633_2401305_-	7-carboxy-7-deazaguanine synthase QueE	NA	A0A1V0DYC7	Dinoroseobacter_phage	27.4	1.1e-08
WP_001718785.1|2401597_2402470_+	YgcG family protein	NA	NA	NA	NA	NA
WP_000036723.1|2402529_2403828_-	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	58.8	2.0e-131
WP_000210878.1|2403915_2405553_-	CTP synthase (glutamine hydrolyzing)	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	50.4	1.8e-153
>prophage 184
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	2408949	2413064	4934701		Erysipelothrix_phage(50.0%)	2	NA	NA
WP_001718787.1|2408949_2410251_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	27.7	2.0e-38
WP_000186450.1|2410307_2413064_+	two-component sensor histidine kinase BarA	NA	A0A1V0SGX0	Hokovirus	30.6	6.4e-55
>prophage 185
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	2420599	2421448	4934701		Vibrio_phage(100.0%)	1	NA	NA
WP_000100422.1|2420599_2421448_+	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A2I7SAX1	Vibrio_phage	37.1	4.7e-41
>prophage 186
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	2426306	2427062	4934701		Bacillus_phage(100.0%)	1	NA	NA
WP_000268232.1|2426306_2427062_+	flap endonuclease Xni	NA	F8WQ40	Bacillus_phage	33.5	5.0e-10
>prophage 187
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	2438587	2454134	4934701	tRNA	environmental_halophage(16.67%)	9	NA	NA
WP_001299106.1|2438587_2439793_+	cysteine desulfurase CsdA	NA	Q2XUY6	environmental_halophage	37.0	1.7e-73
WP_000184261.1|2439792_2440236_+	cysteine desulfurase sulfur acceptor subunit CsdE	NA	NA	NA	NA	NA
WP_001613718.1|2440286_2441093_-|tRNA	tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA	tRNA	S4VW33	Pandoravirus	33.3	1.0e-16
WP_000678646.1|2441331_2442429_-	murein transglycosylase A	NA	NA	NA	NA	NA
WP_001613719.1|2443006_2444260_-	N-acetylmuramoyl-L-alanine amidase	NA	Q5YA51	Bacillus_phage	28.6	2.2e-15
WP_000237969.1|2444491_2445823_+	amino-acid N-acetyltransferase	NA	NA	NA	NA	NA
WP_001718798.1|2445884_2447711_-	exodeoxyribonuclease V subunit alpha	NA	A0A1P8DII4	Virus_Rctr197k	26.7	7.8e-25
WP_032200763.1|2447710_2451253_-	exodeoxyribonuclease V subunit beta	NA	G3MA40	Bacillus_virus	21.6	1.5e-08
WP_001613722.1|2451245_2454134_-	pitrilysin	NA	A0A1V0SJA4	Klosneuvirus	25.8	1.4e-68
>prophage 188
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	2459610	2466383	4934701		Geobacillus_virus(33.33%)	6	NA	NA
WP_000816232.1|2459610_2460405_-	thymidylate synthase	NA	A6M9A2	Geobacillus_virus	70.8	7.6e-118
WP_000204658.1|2460411_2461287_-	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_000957912.1|2461437_2463684_-	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	26.2	2.7e-11
WP_000564489.1|2463696_2464227_-	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_000082188.1|2464911_2465601_+	DNA mismatch repair endonuclease MutH	NA	NA	NA	NA	NA
WP_000895624.1|2465669_2466383_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	47.3	2.6e-45
>prophage 189
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	2476014	2478509	4934701		Aichi_virus(50.0%)	2	NA	NA
WP_000256438.1|2476014_2477433_-	sugar porter family MFS transporter	NA	O13311	Aichi_virus	26.9	1.8e-24
WP_000603529.1|2477747_2478509_-	2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.3	2.9e-18
>prophage 190
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	2510320	2511076	4934701		Clostridium_phage(100.0%)	1	NA	NA
WP_001272558.1|2510320_2511076_-	peptidoglycan DD-metalloendopeptidase family protein	NA	I2E8W3	Clostridium_phage	36.8	1.1e-12
>prophage 191
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	2535536	2550928	4934701	tRNA	environmental_Halophage(14.29%)	14	NA	NA
WP_001280192.1|2535536_2536937_+	xanthine/proton symporter XanQ	NA	H9YQ34	environmental_Halophage	46.1	1.7e-19
WP_001613756.1|2536954_2538271_+	guanine deaminase	NA	NA	NA	NA	NA
WP_000012163.1|2538306_2539674_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	73.1	2.1e-160
WP_001718830.1|2539709_2540198_-	4Fe-4S dicluster domain-containing protein	NA	NA	NA	NA	NA
WP_024171560.1|2540197_2542117_-	formate-dependent uric acid utilization protein YgfT	NA	NA	NA	NA	NA
WP_001718832.1|2542552_2544001_+	purine permease	NA	Q9KX94	Enterobacteria_phage	26.8	1.2e-25
WP_001010156.1|2544002_2544128_+	hypothetical protein	NA	NA	NA	NA	NA
WP_120795390.1|2544124_2544196_-	protein YqfH	NA	NA	NA	NA	NA
WP_001192818.1|2544250_2544799_+	isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_001613759.1|2544841_2546359_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.7	5.9e-87
WP_001701073.1|2546368_2547467_-	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	39.0	1.8e-05
WP_000813202.1|2547557_2549291_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	28.7	1.4e-60
WP_000715214.1|2549296_2550007_-	bifunctional protein-disulfide isomerase/oxidoreductase DsbC	NA	NA	NA	NA	NA
WP_000806638.1|2550031_2550928_-	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	28.6	6.7e-30
>prophage 192
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	2554733	2559206	4934701		Pandoravirus(50.0%)	2	NA	NA
WP_032200731.1|2554733_2556167_+	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	26.1	1.5e-31
WP_000195016.1|2556332_2559206_-	aminomethyl-transferring glycine dehydrogenase	NA	E3SN07	Prochlorococcus_phage	52.1	3.7e-263
>prophage 193
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	2567342	2568575	4934701		Catovirus(100.0%)	1	NA	NA
WP_001718839.1|2567342_2568575_-	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	48.4	4.3e-104
>prophage 194
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	2586628	2587306	4934701		Bacillus_virus(100.0%)	1	NA	NA
WP_001613781.1|2586628_2587306_+	sulfate/molybdate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	25.6	6.4e-09
>prophage 195
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	2600995	2602150	4934701		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001718854.1|2600995_2602150_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	63.2	3.1e-128
>prophage 196
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	2658936	2660109	4934701		Emiliania_huxleyi_virus(100.0%)	1	NA	NA
WP_001613831.1|2658936_2660109_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	D2TEZ5	Emiliania_huxleyi_virus	31.0	5.5e-40
>prophage 197
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	2682321	2683206	4934701		Diadromus_pulchellus_ascovirus(100.0%)	1	NA	NA
WP_032200702.1|2682321_2683206_+	NADP(+)-dependent aldehyde reductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	47.1	1.7e-65
>prophage 198
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	2689282	2700104	4934701		Staphylococcus_phage(25.0%)	9	NA	NA
WP_001613848.1|2689282_2690110_+	2,5-didehydrogluconate reductase DkgA	NA	A0A2H4PQR8	Staphylococcus_phage	45.2	4.2e-63
WP_001613849.1|2690309_2691236_+	YbjP/YqhG family protein	NA	NA	NA	NA	NA
WP_001613850.1|2691284_2691542_+	lipoprotein YqhH	NA	NA	NA	NA	NA
WP_000095187.1|2691584_2693804_-	YgiQ family radical SAM protein	NA	M1QSD9	Pseudomonas_phage	70.4	7.8e-104
WP_000059395.1|2693914_2695327_-	cell division protein FtsP	NA	NA	NA	NA	NA
WP_000965712.1|2695401_2696139_-	1-acylglycerol-3-phosphate O-acyltransferase	NA	NA	NA	NA	NA
WP_001281881.1|2696372_2698631_-	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	35.1	1.4e-84
WP_001718874.1|2699176_2699659_-	gyrI-like small molecule-binding domain protein	NA	NA	NA	NA	NA
WP_000712658.1|2699711_2700104_-	OB fold stress tolerance protein YgiW	NA	A0A1I9LJU6	Stx_converting_phage	49.1	9.4e-21
>prophage 199
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	2706860	2722191	4934701		uncultured_Caudovirales_phage(14.29%)	15	NA	NA
WP_001613857.1|2706860_2707844_-	iron ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.6	5.0e-10
WP_001613858.1|2707840_2708650_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	29.9	2.1e-14
WP_001613859.1|2709023_2711165_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_001613860.1|2711228_2713121_-	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	34.9	5.8e-92
WP_000105733.1|2713149_2713731_-	esterase YqiA	NA	NA	NA	NA	NA
WP_001718877.1|2713730_2714558_-	3',5'-cyclic-AMP phosphodiesterase	NA	NA	NA	NA	NA
WP_000833393.1|2714582_2715005_-	DUF1249 family protein	NA	NA	NA	NA	NA
WP_000917117.1|2715005_2715635_-	ADP-ribose diphosphatase	NA	A0A1S6L1P8	Vibrio_phage	32.5	9.2e-18
WP_000735278.1|2715839_2717321_+	outer membrane channel protein TolC	NA	NA	NA	NA	NA
WP_001718878.1|2717468_2718140_+	DUF1190 family protein	NA	A0A173GEW8	Erwinia_phage	44.3	4.8e-33
WP_000442860.1|2718145_2719306_+	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.1	3.5e-87
WP_001613863.1|2719343_2720159_-	4,5-DOPA dioxygenase extradiol	NA	NA	NA	NA	NA
WP_001613864.1|2720274_2721048_+	zinc transporter ZupT	NA	NA	NA	NA	NA
WP_000469266.1|2721105_2721276_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001076997.1|2721537_2722191_-	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	44.3	4.9e-46
>prophage 200
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	2726480	2727914	4934701		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_001613866.1|2726480_2727914_-	bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE	NA	A0A1B1IUK5	uncultured_Mediterranean_phage	29.4	3.0e-40
>prophage 201
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	2733051	2734290	4934701	tRNA	Sinorhizobium_phage(100.0%)	1	NA	NA
WP_001613869.1|2733051_2734290_+|tRNA	fused tRNA nucleotidyltransferase/2',3'-cyclic phosphodiesterase/2' nucleotidase/phosphatase Cca	tRNA	A0A0F6YPT7	Sinorhizobium_phage	51.9	2.6e-93
>prophage 202
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	2740691	2756886	4934701	tRNA	Moraxella_phage(16.67%)	12	NA	NA
WP_001264352.1|2740691_2741705_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.2	6.3e-109
WP_001144069.1|2741942_2742158_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_000918827.1|2742268_2744014_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.4	1.1e-76
WP_000437371.1|2744208_2746050_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.3e-35
WP_000228930.1|2746128_2746635_-	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
WP_001066498.1|2746887_2747652_-	NADPH-dependent ferric chelate reductase	NA	NA	NA	NA	NA
WP_000018005.1|2747939_2748563_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000094712.1|2748716_2750237_-	methyl-accepting chemotaxis protein	NA	A0A1B0V854	Salmonella_phage	51.5	4.0e-35
WP_000633381.1|2750543_2752034_+	putrescine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	28.6	4.8e-33
WP_001718888.1|2752075_2752408_-|tRNA	tRNA-binding protein	tRNA	NA	NA	NA	NA
WP_001613871.1|2752626_2753610_+	transcriptional regulator EbgR	NA	NA	NA	NA	NA
WP_001613872.1|2753793_2756886_+	beta-galactosidase subunit alpha	NA	L0N6M2	Herpes_simplex_virus	34.2	4.5e-158
>prophage 203
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	2768893	2769859	4934701		Escherichia_phage(100.0%)	1	NA	NA
WP_001098809.1|2768893_2769859_+	TerC family membrane protein Alx	NA	A0A291LBC5	Escherichia_phage	33.8	6.7e-36
>prophage 204
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	2790505	2792800	4934701		Tetraselmis_virus(100.0%)	1	NA	NA
WP_032200717.1|2790505_2792800_-	2-ketobutyrate formate-lyase/pyruvate formate-lyase	NA	A0A2P0VNR5	Tetraselmis_virus	40.8	2.2e-157
>prophage 205
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	2800776	2801922	4934701		Streptococcus_phage(100.0%)	1	NA	NA
WP_001718909.1|2800776_2801922_-	glycerate 2-kinase	NA	W6LM47	Streptococcus_phage	41.6	5.7e-50
>prophage 206
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	2821914	2829711	4934701		Streptococcus_phage(25.0%)	10	NA	NA
WP_001613902.1|2821914_2822778_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	43.6	7.3e-50
WP_001613903.1|2822842_2824879_+	penicillin-binding protein activator	NA	NA	NA	NA	NA
WP_000246855.1|2824836_2825232_+	YraN family protein	NA	NA	NA	NA	NA
WP_001613904.1|2825251_2825842_+	DnaA initiator-associating protein DiaA	NA	A0A067XQR2	Caulobacter_phage	31.1	9.2e-12
WP_000646033.1|2825851_2826427_+	divisome-associated lipoprotein YraP	NA	NA	NA	NA	NA
WP_000147606.1|2826540_2827581_-	permease	NA	NA	NA	NA	NA
WP_000084526.1|2827653_2828289_-	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_000037608.1|2828416_2828935_+	protein/nucleic acid deglycase	NA	A0A0N7KVR4	Yellowstone_lake_phycodnavirus	27.0	4.4e-10
WP_001613905.1|2828914_2829358_-	YhbP family protein	NA	NA	NA	NA	NA
WP_000189315.1|2829408_2829711_+	DNA damage response exodeoxyribonuclease YhbQ	NA	F2NZ06	Diadromus_pulchellus_ascovirus	52.5	3.9e-14
>prophage 207
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	2835537	2837427	4934701		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_001301504.1|2835537_2837427_-	DEAD/DEAH family ATP-dependent RNA helicase	NA	A0A0N9Q9J4	Chrysochromulina_ericina_virus	30.8	2.0e-52
>prophage 208
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	2842908	2849547	4934701		Cafeteria_roenbergensis_virus(50.0%)	4	NA	NA
WP_000133044.1|2842908_2845581_-	translation initiation factor IF-2	NA	E3T4N3	Cafeteria_roenbergensis_virus	26.3	2.5e-24
WP_001031057.1|2845605_2847093_-	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_001300397.1|2847120_2847573_-	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_000207683.1|2848203_2849547_+	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	92.9	1.1e-63
>prophage 209
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	2853629	2856502	4934701	protease	Pandoravirus(50.0%)	2	NA	NA
WP_000764731.1|2853629_2854478_-	dihydropteroate synthase	NA	S4W084	Pandoravirus	29.9	3.4e-23
WP_001107467.1|2854567_2856502_-|protease	ATP-dependent zinc metalloprotease FtsH	protease	G8DDJ2	Micromonas_pusilla_virus	43.6	6.3e-118
>prophage 210
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	2863130	2864608	4934701		Indivirus(50.0%)	2	NA	NA
WP_001047336.1|2863130_2864102_+	octaprenyl diphosphate synthase	NA	A0A1V0SE37	Indivirus	25.8	6.0e-08
WP_000445413.1|2864329_2864608_+	DNA-binding transcriptional regulator SfsB	NA	A0A2I7S995	Vibrio_phage	71.4	2.6e-17
>prophage 211
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	2868676	2883470	4934701		Staphylococcus_phage(25.0%)	17	NA	NA
WP_099560749.1|2868676_2869486_-	phospholipid ABC transporter ATP-binding protein MlaF	NA	G3M9Y6	Bacillus_virus	29.3	2.8e-19
WP_001613911.1|2869695_2870673_+	calcium/sodium antiporter	NA	NA	NA	NA	NA
WP_001295557.1|2870686_2871673_+	arabinose-5-phosphate isomerase KdsD	NA	A0A2P0VNK5	Tetraselmis_virus	31.5	1.9e-38
WP_000030005.1|2871693_2872260_+	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	75.7	1.4e-54
WP_000030537.1|2872256_2872832_+	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_000669785.1|2872800_2873358_+	lipopolysaccharide ABC transporter substrate-binding protein LptA	NA	NA	NA	NA	NA
WP_000224099.1|2873364_2874090_+	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	3.2e-22
WP_000809051.1|2874137_2875571_+	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_001176599.1|2875593_2875881_+	ribosome hibernation promoting factor	NA	A0A0M7QCF2	Escherichia_phage	44.3	2.5e-10
WP_000183676.1|2875998_2876490_+	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
WP_000243741.1|2876535_2877390_+	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	28.4	1.1e-05
WP_000216791.1|2877386_2877659_+	PTS phosphocarrier protein NPr	NA	NA	NA	NA	NA
WP_000620409.1|2877871_2878504_+	PhoP regulatory network protein YrbL	NA	NA	NA	NA	NA
WP_001613914.1|2878500_2879229_-	monofunctional biosynthetic peptidoglycan transglycosylase	NA	NA	NA	NA	NA
WP_001613915.1|2879225_2879879_-	isoprenoid biosynthesis glyoxalase ElbB	NA	NA	NA	NA	NA
WP_000809774.1|2880108_2882445_-	aerobic respiration two-component sensor histidine kinase ArcB	NA	A0A1V0SGX0	Hokovirus	31.2	1.7e-40
WP_001613917.1|2882540_2883470_-	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	35.0	8.8e-17
>prophage 212
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	2893166	2894657	4934701		Burkholderia_virus(100.0%)	1	NA	NA
WP_000108459.1|2893166_2894657_-	sialic acid transporter NanT	NA	Q6JIH2	Burkholderia_virus	23.6	4.9e-09
>prophage 213
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	2898360	2898858	4934701	protease	Pseudomonas_phage(100.0%)	1	NA	NA
WP_000366126.1|2898360_2898858_-|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	54.8	2.5e-26
>prophage 214
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	2902824	2905349	4934701	protease	uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_001295271.1|2902824_2904192_+|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	25.6	2.3e-21
WP_000497723.1|2904281_2905349_+	outer membrane-stress sensor serine endopeptidase DegS	NA	A0A1S5Y2X3	uncultured_archaeal_virus	24.2	6.8e-05
>prophage 215
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	2922028	2923072	4934701		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_000913396.1|2922028_2923072_-	rod shape-determining protein	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
>prophage 216
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	2933637	2934522	4934701		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_001718937.1|2933637_2934522_+	adenine-specific DNA-methyltransferase	NA	M4QNN5	Ostreococcus_lucimarinus_virus	30.2	1.4e-24
>prophage 217
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	2941027	2945181	4934701		uncultured_Mediterranean_phage(50.0%)	4	NA	NA
WP_000738579.1|2941027_2942053_+	amino acid ABC transporter substrate-binding protein	NA	A0A1B1IT51	uncultured_Mediterranean_phage	39.8	2.4e-71
WP_001613932.1|2942120_2943302_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_001613934.1|2943311_2944415_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_000078349.1|2944422_2945181_+	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.8	9.1e-20
>prophage 218
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	2955518	2956990	4934701	tRNA	Synechococcus_phage(50.0%)	2	NA	NA
WP_000114984.1|2955518_2956028_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	41.9	3.9e-19
WP_001613940.1|2956042_2956990_+|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	35.7	1.4e-06
>prophage 219
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	2976867	2982441	4934701		uncultured_Caudovirales_phage(50.0%)	7	NA	NA
WP_000031783.1|2976867_2978052_-	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.1	4.4e-13
WP_000124700.1|2978122_2980237_-	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	27.5	5.2e-57
WP_001138043.1|2980333_2980804_-	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_000246815.1|2980900_2981275_-	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_000903375.1|2981400_2981688_-	sulfurtransferase complex subunit TusB	NA	NA	NA	NA	NA
WP_001613947.1|2981695_2982055_-	sulfurtransferase complex subunit TusC	NA	A0A2H4J8C0	uncultured_Caudovirales_phage	29.3	9.0e-10
WP_001209707.1|2982054_2982441_-	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	39.1	7.4e-18
>prophage 220
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	2988011	2997552	4934701		Tupanvirus(25.0%)	9	NA	NA
WP_001613950.1|2988011_2989925_+	ABC transporter ATP-binding protein	NA	A0A2K9L0W2	Tupanvirus	33.7	1.5e-74
WP_000057392.1|2989924_2990947_+	hydrolase	NA	NA	NA	NA	NA
WP_000907085.1|2990940_2991159_+	YheU family protein	NA	A0A2H4J8A7	uncultured_Caudovirales_phage	40.3	3.1e-05
WP_001274680.1|2991212_2992082_+	phosphoribulokinase	NA	NA	NA	NA	NA
WP_001148908.1|2992136_2992541_-	OsmC family protein	NA	NA	NA	NA	NA
WP_000242755.1|2992842_2993475_+	cAMP-activated global transcriptional regulator CRP	NA	NA	NA	NA	NA
WP_001295162.1|2993525_2995616_+	membrane protein	NA	H9YQA8	environmental_Halophage	100.0	1.7e-76
WP_001718947.1|2995682_2996903_-	bifunctional acetylornithine/succinyldiaminopimelate transaminase	NA	NA	NA	NA	NA
WP_001718948.1|2996988_2997552_-	aminodeoxychorismate synthase component 2	NA	A0A0P0IKJ1	Acinetobacter_phage	55.8	7.1e-62
>prophage 221
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	3021670	3022507	4934701		Vibrio_phage(100.0%)	1	NA	NA
WP_000742141.1|3021670_3022507_-	adenine-specific DNA-methyltransferase	NA	A0A1S6L1V5	Vibrio_phage	49.1	2.9e-67
>prophage 222
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	3039410	3043177	4934701		Bacillus_phage(66.67%)	3	NA	NA
WP_001309803.1|3039410_3041033_+	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	52.3	1.5e-141
WP_001253696.1|3041108_3042461_-	two-component system sensor histidine kinase EnvZ	NA	W8CYF6	Bacillus_phage	23.8	3.6e-11
WP_001157751.1|3042457_3043177_-	two-component system response regulator OmpR	NA	W8CYM9	Bacillus_phage	34.7	3.5e-29
>prophage 223
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	3049741	3050620	4934701		Sodalis_phage(100.0%)	1	NA	NA
WP_001613984.1|3049741_3050620_+	recombination-promoting nuclease RpnA	NA	Q2A0A7	Sodalis_phage	53.3	2.5e-69
>prophage 224
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	3056587	3058981	4934701		Iris_mild_mosaic_virus(100.0%)	1	NA	NA
WP_000081909.1|3056587_3058981_-	maltodextrin phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	42.5	4.3e-15
>prophage 225
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	3063360	3064587	4934701		Ralstonia_phage(100.0%)	1	NA	NA
WP_001105504.1|3063360_3064587_-	RNA-splicing ligase RtcB	NA	A0A1L7N133	Ralstonia_phage	60.0	4.0e-134
>prophage 226
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	3072397	3074845	4934701		Dickeya_phage(100.0%)	1	NA	NA
WP_000993449.1|3072397_3074845_-	glycogen phosphorylase	NA	A0A140XAG6	Dickeya_phage	81.0	2.1e-33
>prophage 227
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	3085174	3087271	4934701		Diadromus_pulchellus_ascovirus(100.0%)	1	NA	NA
WP_001613995.1|3085174_3087271_-	RecQ family ATP-dependent DNA helicase	NA	F2NZ48	Diadromus_pulchellus_ascovirus	34.1	1.6e-42
>prophage 228
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	3098283	3100094	4934701		Enterococcus_phage(50.0%)	2	NA	NA
WP_001614000.1|3098283_3099027_-	glycerophosphodiester phosphodiesterase	NA	A0A0S2MYI4	Enterococcus_phage	24.5	8.3e-10
WP_000907798.1|3099023_3100094_-	sn-glycerol-3-phosphate import ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	33.7	1.7e-19
>prophage 229
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	3103635	3105118	4934701		Planktothrix_phage(50.0%)	2	NA	NA
WP_000416895.1|3103635_3104349_-	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivF	NA	G9BWD6	Planktothrix_phage	31.1	9.1e-14
WP_000082101.1|3104350_3105118_-	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivG	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.6	4.9e-13
>prophage 230
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	3111599	3114418	4934701		Salicola_phage(50.0%)	3	NA	NA
WP_000130217.1|3111599_3112454_-	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	41.9	3.5e-44
WP_001042003.1|3112698_3113757_-	cell division protein FtsX	NA	NA	NA	NA	NA
WP_001718990.1|3113749_3114418_-	cell division ATP-binding protein FtsE	NA	A0A2H4PQG7	Staphylococcus_phage	25.1	5.0e-14
>prophage 231
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	3117424	3121556	4934701		Dickeya_phage(50.0%)	4	NA	NA
WP_000964718.1|3117424_3118051_+	lysoplasmalogenase	NA	A0A140XAH6	Dickeya_phage	61.9	1.2e-30
WP_001614011.1|3118124_3120323_+	Zn(II)/Cd(II)/Pb(II) translocating P-type ATPase ZntA	NA	E4ZFI9	Streptococcus_phage	38.3	2.5e-118
WP_000130621.1|3120424_3120670_-	sulfurtransferase TusA	NA	A0A140XB86	Dickeya_phage	83.3	8.0e-10
WP_001100467.1|3120890_3121556_+	7-cyano-7-deazaguanine/7-aminomethyl-7- deazaguanine transporter	NA	A0A2I7SAW6	Vibrio_phage	53.6	5.6e-58
>prophage 232
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	3129449	3135346	4934701		Bacillus_virus(33.33%)	6	NA	NA
WP_001614017.1|3129449_3130256_+	nickel import ATP-binding protein NikE	NA	G3M9Y6	Bacillus_virus	27.8	1.0e-16
WP_001190062.1|3130261_3130663_+	nickel-responsive transcriptional regulator NikR	NA	NA	NA	NA	NA
WP_000593555.1|3130782_3131142_-	type II toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_001259385.1|3131138_3131414_-	type II toxin-antitoxin system HicA family toxin	NA	R4JMD3	Burkholderia_phage	50.0	3.7e-16
WP_001314210.1|3131486_3132611_-	ABC-2 transporter permease	NA	NA	NA	NA	NA
WP_001614021.1|3132610_3135346_-	ribosome-associated ATPase/putative transporter RbbA	NA	A0A2H4PQG7	Staphylococcus_phage	30.6	4.1e-22
>prophage 233
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	3148797	3150840	4934701		Indivirus(100.0%)	1	NA	NA
WP_001614027.1|3148797_3150840_-	oligopeptidase A	NA	A0A1V0SD92	Indivirus	23.1	1.5e-45
>prophage 234
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	3153935	3157905	4934701	transposase	uncultured_Caudovirales_phage(75.0%)	4	NA	NA
WP_099490865.1|3153935_3155144_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.8	3.7e-209
WP_000008965.1|3155769_3156123_+	arsenical resistance operon transcriptional regulator ArsR	NA	A0A2H4J145	uncultured_Caudovirales_phage	50.0	1.3e-24
WP_000922639.1|3156177_3157467_+	arsenite/antimonite:H(+) antiporter ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	73.5	4.6e-173
WP_001719018.1|3157479_3157905_+	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.7	4.3e-51
>prophage 235
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	3169492	3170962	4934701		Pithovirus(50.0%)	2	NA	NA
WP_001614044.1|3169492_3170263_+	heme ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	30.0	1.7e-18
WP_032201192.1|3170314_3170962_-	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	38.5	6.1e-17
>prophage 236
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	3217440	3219425	4934701		Bacillus_virus(50.0%)	2	NA	NA
WP_001719053.1|3217440_3218445_-	dipeptide ABC transporter ATP binding subunit DppF	NA	G3M9Y6	Bacillus_virus	29.9	6.6e-18
WP_001196496.1|3218441_3219425_-	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.8	8.7e-15
>prophage 237
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	3235067	3237401	4934701		Escherichia_phage(100.0%)	1	NA	NA
WP_071607555.1|3235067_3237401_-	molybdopterin guanine dinucleotide-containing S/N-oxide reductase	NA	A0A077SK27	Escherichia_phage	29.4	1.8e-71
>prophage 238
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	3241055	3241268	4934701		Morganella_phage(100.0%)	1	NA	NA
WP_001719061.1|3241055_3241268_+	RNA chaperone/antiterminator CspA	NA	A0A1W6JNX5	Morganella_phage	74.3	7.1e-23
>prophage 239
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	3245488	3246484	4934701		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
WP_001614068.1|3245488_3246484_+	acyltransferase	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	27.1	9.1e-12
>prophage 240
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	3251802	3253344	4934701		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001614070.1|3251802_3253344_+	D-xylose ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.3	1.1e-16
>prophage 241
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	3271382	3279734	4934701	tRNA	Clostridioides_phage(33.33%)	6	NA	NA
WP_001614077.1|3271382_3272678_-	Fic family protein	NA	A0A1V0E025	Clostridioides_phage	30.9	2.8e-21
WP_000741518.1|3272807_3273959_-	L-threonine dehydrogenase	NA	NA	NA	NA	NA
WP_001614078.1|3274148_3275993_-	selenocysteine-specific translation elongation factor	NA	A0A2K9KZ60	Tupanvirus	27.2	1.9e-15
WP_001719071.1|3275989_3277381_-|tRNA	L-seryl-tRNA(Sec) selenium transferase	tRNA	NA	NA	NA	NA
WP_001719072.1|3277478_3278087_-	glutathione S-transferase	NA	NA	NA	NA	NA
WP_137461403.1|3278609_3279734_+	RHS repeat protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	32.5	3.3e-26
>prophage 242
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	3282996	3283875	4934701		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_001719078.1|3282996_3283875_+	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	40.4	1.3e-22
>prophage 243
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	3305220	3314727	4934701		Rhizobium_phage(16.67%)	9	NA	NA
WP_000024392.1|3305220_3305472_-	glutaredoxin 3	NA	V9QKN6	Rhizobium_phage	54.8	2.0e-16
WP_001156181.1|3305613_3306045_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_000116565.1|3306289_3307834_+	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_001214147.1|3307843_3309127_+	murein hydrolase activator EnvC	NA	G9BW84	Planktothrix_phage	34.3	1.0e-07
WP_001614097.1|3309130_3310090_+	divergent polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_000982091.1|3310076_3311111_-	UDP-glucuronate:LPS(HepIII) glycosyltransferase	NA	A0A1V0SAH6	Catovirus	28.7	5.8e-09
WP_000646014.1|3311349_3312375_-	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	84.6	2.1e-19
WP_001719089.1|3312384_3313581_-	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	29.4	4.9e-36
WP_000587750.1|3313794_3314727_+	ADP-glyceromanno-heptose 6-epimerase	NA	E3SL51	Synechococcus_phage	39.3	8.5e-36
>prophage 244
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	3318886	3319915	4934701		Archaeal_BJ1_virus(100.0%)	1	NA	NA
WP_001719092.1|3318886_3319915_-	glycosyl transferase 8 family protein	NA	A0ZYL4	Archaeal_BJ1_virus	25.9	4.2e-12
>prophage 245
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	3327353	3331916	4934701		uncultured_Mediterranean_phage(25.0%)	7	NA	NA
WP_001171873.1|3327353_3327833_+	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	42.6	6.3e-27
WP_001114533.1|3327871_3328681_-	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	F8WPX6	Bacillus_phage	32.2	2.6e-25
WP_001051798.1|3328778_3328946_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_000091955.1|3328966_3329203_-	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_001297375.1|3329419_3330088_-	JAB domain-containing protein	NA	NA	NA	NA	NA
WP_001614110.1|3330259_3331480_+	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	34.2	2.9e-44
WP_001298007.1|3331460_3331916_+	dUTP diphosphatase	NA	Q2NP83	Xanthomonas_phage	59.5	7.3e-49
>prophage 246
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	3335879	3342039	4934701		Morganella_phage(25.0%)	6	NA	NA
WP_001614115.1|3335879_3336113_+	hypothetical protein	NA	A0A1W6JPJ7	Morganella_phage	72.7	3.0e-22
WP_000924289.1|3336404_3337022_+	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
WP_001719101.1|3337018_3338701_-	NAD-dependent DNA ligase LigB	NA	A0A1Q2U2Q6	Vibrio_phage	23.9	5.7e-22
WP_001295237.1|3338958_3339582_+	guanylate kinase	NA	K4JYM5	Abalone_herpesvirus	34.5	4.1e-18
WP_000135058.1|3339636_3339912_+	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_000280488.1|3339930_3342039_+	bifunctional GTP diphosphokinase/guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase	NA	A0A291L9W9	Bordetella_phage	34.5	4.8e-10
>prophage 247
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	3346475	3347867	4934701		environmental_Halophage(100.0%)	1	NA	NA
WP_001295238.1|3346475_3347867_+	xanthine/proton symporter XanP	NA	H9YQ34	environmental_Halophage	100.0	1.4e-71
>prophage 248
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	3354145	3355336	4934701	integrase	Enterobacteria_phage(100.0%)	1	3345288:3345302	3368676:3368690
3345288:3345302	attL	CGCCAGCGAAGCCAG	NA	NA	NA	NA
WP_001218920.1|3354145_3355336_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	69.9	8.9e-163
WP_001218920.1|3354145_3355336_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	69.9	8.9e-163
3368676:3368690	attR	CTGGCTTCGCTGGCG	NA	NA	NA	NA
>prophage 249
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	3368729	3381132	4934701	transposase	Acidithiobacillus_phage(33.33%)	8	NA	NA
WP_021554595.1|3368729_3369920_-	restriction endonuclease subunit S	NA	F2Y1N5	Organic_Lake_phycodnavirus	32.7	3.3e-08
WP_000627733.1|3369916_3371551_-	N-6 DNA methylase	NA	J7I0U9	Acinetobacter_phage	29.0	6.9e-33
WP_000438164.1|3371614_3375028_-	DEAD/DEAH box helicase family protein	NA	Q6NDX2	Leptospira_phage	26.2	8.5e-17
WP_001282653.1|3376169_3376925_-	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	43.8	6.2e-45
WP_000447015.1|3376941_3378477_-|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	40.7	8.6e-102
WP_000658303.1|3378948_3379572_+	MmcB family DNA repair protein	NA	NA	NA	NA	NA
WP_000714421.1|3379557_3380586_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000875105.1|3380589_3381132_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A142KB62	Gordonia_phage	29.3	3.6e-10
>prophage 250
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	3384326	3389417	4934701	transposase	Stx2-converting_phage(75.0%)	7	NA	NA
WP_021554597.1|3384326_3385898_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	7.6e-170
WP_000624622.1|3385917_3386265_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_000993921.1|3386264_3386915_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	42.7	6.8e-16
WP_021554598.1|3386946_3387150_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001260379.1|3387246_3387870_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155522400.1|3388388_3388616_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000258198.1|3388940_3389417_+	ProQ/FinO family protein	NA	Q2A0A1	Sodalis_phage	41.1	1.3e-08
>prophage 251
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	3398191	3400369	4934701		Yersinia_phage(33.33%)	4	NA	NA
WP_001175173.1|3398191_3399010_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	39.7	9.4e-47
WP_000213721.1|3399101_3399587_+	antirestriction protein	NA	A9J566	Pseudomonas_phage	31.7	9.0e-13
WP_001186201.1|3399602_3400079_+	RadC family protein	NA	NA	NA	NA	NA
WP_099560753.1|3400147_3400369_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	6.5e-11
>prophage 252
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	3429535	3430870	4934701		Moraxella_phage(100.0%)	1	NA	NA
WP_072148461.1|3429535_3430870_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	36.7	1.1e-65
>prophage 253
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	3441513	3450674	4934701		Micromonas_sp._RCC1109_virus(25.0%)	10	NA	NA
WP_032223176.1|3441513_3443202_-	acetolactate synthase large subunit	NA	E5EQ70	Micromonas_sp._RCC1109_virus	29.4	3.5e-56
WP_001312198.1|3443307_3443406_-	ilvB operon leader peptide IvbL	NA	NA	NA	NA	NA
WP_000060506.1|3443970_3444060_+	type I toxin-antitoxin system toxin TisB	NA	NA	NA	NA	NA
WP_001614150.1|3444478_3445663_+	multidrug efflux MFS transporter EmrD	NA	S4TR35	Salmonella_phage	23.5	1.2e-13
WP_000148074.1|3445670_3446168_-	radical SAM protein	NA	NA	NA	NA	NA
WP_001113432.1|3446164_3446527_-	DUF202 domain-containing protein	NA	NA	NA	NA	NA
WP_000703959.1|3446516_3446864_-	YidH family protein	NA	NA	NA	NA	NA
WP_001614152.1|3446972_3447422_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001614153.1|3447468_3448962_-	sulfatase-like hydrolase/transferase	NA	A0A2K9L1A5	Tupanvirus	25.6	2.9e-30
WP_001614154.1|3448958_3450674_-	solute:sodium symporter family transporter	NA	A0A240F3J2	Aeromonas_phage	29.4	2.5e-41
>prophage 254
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	3457534	3458488	4934701		Synechococcus_phage(50.0%)	2	NA	NA
WP_001243431.1|3457534_3457963_-	heat shock chaperone IbpB	NA	A0A1D8KPX5	Synechococcus_phage	36.4	2.1e-13
WP_001243437.1|3458074_3458488_-	heat shock chaperone IbpA	NA	A0A1D7SU06	Cyanophage	36.2	1.0e-17
>prophage 255
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	3464019	3471388	4934701		Bacillus_virus(33.33%)	8	NA	NA
WP_000072067.1|3464019_3466434_-	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	34.6	3.7e-115
WP_000060112.1|3466462_3467536_-	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_000673464.1|3467535_3468636_-	DNA polymerase III subunit beta	NA	B4UTW9	Rhizobium_phage	35.0	4.1e-53
WP_000059111.1|3468640_3470044_-	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
WP_122134670.1|3470340_3470421_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000831330.1|3470650_3470791_+	50S ribosomal protein L34	NA	NA	NA	NA	NA
WP_000239730.1|3470807_3471167_+	ribonuclease P protein component	NA	NA	NA	NA	NA
WP_001307474.1|3471130_3471388_+	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	56.7	5.4e-17
>prophage 256
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	3484058	3485396	4934701		Moraxella_phage(100.0%)	1	NA	NA
WP_000082693.1|3484058_3485396_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	35.7	2.6e-62
>prophage 257
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	3494385	3498226	4934701		Bacillus_phage(50.0%)	4	NA	NA
WP_000063125.1|3494385_3495159_-	phosphate ABC transporter ATP-binding protein PstB	NA	W8CYL7	Bacillus_phage	31.7	4.0e-15
WP_001614176.1|3495249_3496140_-	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_000741620.1|3496139_3497099_-	phosphate ABC transporter permease PstC	NA	NA	NA	NA	NA
WP_000867146.1|3497185_3498226_-	phosphate ABC transporter substrate-binding protein PstS	NA	A0A1D7SRJ6	Cyanophage	38.3	2.7e-51
>prophage 258
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	3503764	3507126	4934701		Paramecium_bursaria_Chlorella_virus(50.0%)	2	NA	NA
WP_000334086.1|3503764_3505594_-	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	43.2	5.6e-132
WP_000933736.1|3505755_3507126_-	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A0N7G7I9	Chrysochromulina_ericina_virus	36.7	3.1e-34
>prophage 259
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	3519080	3520073	4934701		Heterosigma_akashiwo_virus(100.0%)	1	NA	NA
WP_000845104.1|3519080_3520073_+	aspartate--ammonia ligase	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	37.7	2.2e-50
>prophage 260
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	3523241	3529094	4934701		Paramecium_bursaria_Chlorella_virus(33.33%)	5	NA	NA
WP_000102319.1|3523241_3525110_+	low affinity potassium transporter Kup	NA	M1I6H8	Paramecium_bursaria_Chlorella_virus	30.6	6.0e-65
WP_000715936.1|3525276_3525696_+	D-ribose pyranase	NA	NA	NA	NA	NA
WP_000387770.1|3525703_3527209_+	ribose ABC transporter ATP-binding protein RbsA	NA	G3M9Y6	Bacillus_virus	27.7	5.1e-14
WP_000211858.1|3527213_3528179_+	ribose ABC transporter permease	NA	NA	NA	NA	NA
WP_001056273.1|3528203_3529094_+	ribose ABC transporter substrate-binding protein RbsB	NA	C6ZCU4	Enterobacteria_phage	23.4	4.3e-05
>prophage 261
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	3542487	3544134	4934701		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_032201130.1|3542487_3544134_+	acetolactate synthase 2 catalytic subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	31.8	2.2e-66
>prophage 262
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	3552566	3557978	4934701		Bacillus_phage(33.33%)	4	NA	NA
WP_032201127.1|3552566_3554588_+	DNA helicase Rep	NA	A7KV33	Bacillus_phage	37.5	1.1e-112
WP_001612063.1|3554634_3556119_-	guanosine-5'-triphosphate,3'-diphosphate diphosphatase	NA	NA	NA	NA	NA
WP_000047499.1|3556252_3557518_-	ATP-dependent RNA helicase RhlB	NA	E3T5E1	Cafeteria_roenbergensis_virus	31.2	3.1e-41
WP_001280776.1|3557648_3557978_+	thioredoxin TrxA	NA	A0A1V0SD63	Indivirus	38.5	4.2e-14
>prophage 263
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	3562020	3568164	4934701		Enterobacteria_phage(40.0%)	6	NA	NA
WP_000866672.1|3562020_3563151_+	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	31.3	3.9e-27
WP_000006621.1|3563147_3564410_+	UDP-N-acetyl-D-mannosamine dehydrogenase	NA	M1HNJ7	Paramecium_bursaria_Chlorella_virus	27.0	1.0e-23
WP_001226601.1|3564409_3565477_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.4	2.3e-101
WP_000676056.1|3565495_3566377_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	66.3	8.7e-107
WP_001719163.1|3566354_3567029_+	dTDP-4-amino-4,6-dideoxy-D-galactose acyltransferase	NA	NA	NA	NA	NA
WP_000612044.1|3567033_3568164_+	dTDP-4-amino-4,6-dideoxygalactose transaminase	NA	A0A0F7LAY0	uncultured_marine_virus	41.7	2.0e-18
>prophage 264
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	3576248	3577904	4934701		Tetraselmis_virus(100.0%)	1	NA	NA
WP_000395856.1|3576248_3577904_-	arylsulfatase	NA	A0A2P0VMN7	Tetraselmis_virus	29.7	1.0e-44
>prophage 265
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	3588195	3592054	4934701		Bacillus_phage(100.0%)	3	NA	NA
WP_000130691.1|3588195_3589092_+	tyrosine recombinase XerC	NA	A0A142F1N9	Bacillus_phage	29.6	3.8e-25
WP_001213584.1|3589091_3589808_+	5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase YigB	NA	NA	NA	NA	NA
WP_000383407.1|3589891_3592054_+	DNA helicase II	NA	A7KV33	Bacillus_phage	37.2	4.6e-117
>prophage 266
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	3597771	3599601	4934701		Catovirus(100.0%)	1	NA	NA
WP_000035581.1|3597771_3599601_+	ATP-dependent DNA helicase RecQ	NA	A0A1V0SBK0	Catovirus	37.8	7.4e-84
>prophage 267
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	3614150	3617437	4934701		Ostreococcus_lucimarinus_virus(50.0%)	4	NA	NA
WP_000187530.1|3614150_3615791_+	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	M4R0M8	Ostreococcus_lucimarinus_virus	29.0	8.2e-42
WP_001295260.1|3615869_3616139_+	Sec-independent protein translocase subunit TatA	NA	NA	NA	NA	NA
WP_000459594.1|3616142_3616658_+	Sec-independent protein translocase subunit TatB	NA	NA	NA	NA	NA
WP_000109943.1|3616660_3617437_+	Sec-independent protein translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	32.6	5.1e-26
>prophage 268
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	3626227	3626842	4934701		Streptococcus_phage(100.0%)	1	NA	NA
WP_001719182.1|3626227_3626842_+	IMPACT family protein	NA	A0A1X9I5T8	Streptococcus_phage	32.4	2.4e-18
>prophage 269
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	3640527	3643314	4934701		uncultured_virus(100.0%)	1	NA	NA
WP_032201343.1|3640527_3643314_+	DNA polymerase I	NA	A0A218MKQ4	uncultured_virus	32.1	4.9e-71
>prophage 270
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	3647389	3649860	4934701		Bacillus_thuringiensis_phage(50.0%)	2	NA	NA
WP_001188777.1|3647389_3648799_-	nitrogen regulation protein NR(I)	NA	Q56AR1	Bacillus_thuringiensis_phage	28.7	2.4e-05
WP_000190577.1|3648810_3649860_-	nitrogen regulation protein NR(II)	NA	Q8QKV7	Ectocarpus_siliculosus_virus	26.1	2.5e-07
>prophage 271
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	3666078	3668858	4934701		Staphylococcus_phage(50.0%)	3	NA	NA
WP_000718901.1|3666078_3666975_-	sulfolactaldehyde 3-reductase	NA	D2K0C8	Staphylococcus_phage	90.7	1.3e-60
WP_000621647.1|3667142_3668039_+	sulfofructose kinase	NA	NA	NA	NA	NA
WP_000059678.1|3668072_3668858_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.9	8.2e-24
>prophage 272
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	3678209	3681260	4934701		Escherichia_phage(100.0%)	1	NA	NA
WP_077841582.1|3678209_3681260_-	formate dehydrogenase-N subunit alpha	NA	A0A077SK27	Escherichia_phage	24.1	1.9e-07
>prophage 273
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	3697904	3702765	4934701		Bacillus_thuringiensis_phage(33.33%)	5	NA	NA
WP_001297064.1|3697904_3698525_+	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	59.8	4.9e-64
WP_001166063.1|3698784_3699768_+	2-keto-3-deoxygluconate transporter	NA	NA	NA	NA	NA
WP_001270260.1|3699916_3700591_+	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_000580417.1|3700696_3702070_-	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.9	3.8e-16
WP_001033722.1|3702066_3702765_-	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
>prophage 274
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	3714434	3718938	4934701		Paramecium_bursaria_Chlorella_virus(50.0%)	5	NA	NA
WP_000084268.1|3714434_3715280_-	glycerol uptake facilitator protein GlpF	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.0	4.4e-15
WP_001296623.1|3715705_3715951_+	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
WP_000872908.1|3716035_3716521_-	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_000139496.1|3716613_3717540_-	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_001293341.1|3717606_3718938_-	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	29.9	1.7e-45
>prophage 275
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	3724575	3728760	4934701		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_099490885.1|3724575_3728760_+	RHS repeat protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	32.0	2.3e-24
>prophage 276
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	3741752	3748999	4934701		Synechococcus_phage(33.33%)	5	NA	NA
WP_000424845.1|3741752_3742415_-	fructose-6-phosphate aldolase	NA	A0A0E3F0E2	Synechococcus_phage	34.6	5.5e-29
WP_001612129.1|3742426_3744928_-	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	26.4	1.3e-11
WP_001004442.1|3745236_3746316_+	PTS fructose transporter subunit EIIC	NA	NA	NA	NA	NA
WP_000161265.1|3746330_3746651_+	PTS fructose-like transporter subunit IIB	NA	NA	NA	NA	NA
WP_032201177.1|3746701_3748999_+	formate C-acetyltransferase	NA	A0A1S6UAD4	Serratia_phage	48.1	4.6e-06
>prophage 277
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	3765036	3770858	4934701	tRNA	Burkholderia_virus(50.0%)	5	NA	NA
WP_032201179.1|3765036_3766353_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	35.4	7.0e-60
WP_001309117.1|3766456_3767107_+	HTH-type transcriptional repressor FabR	NA	NA	NA	NA	NA
WP_000806411.1|3767106_3767466_+	YijD family membrane protein	NA	NA	NA	NA	NA
WP_000187008.1|3767505_3768606_-|tRNA	tRNA (uridine(54)-C5)-methyltransferase TrmA	tRNA	NA	NA	NA	NA
WP_001612139.1|3768974_3770858_+	TonB-dependent vitamin B12 receptor BtuB	NA	A0A0P0I887	Acinetobacter_phage	27.5	4.0e-08
>prophage 278
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	3779287	3782340	4934701		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_000023081.1|3779287_3780238_-	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	32.0	8.7e-28
WP_000031784.1|3781155_3782340_+	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.1	4.4e-13
>prophage 279
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	3786335	3794664	4934701		Chrysochromulina_ericina_virus(50.0%)	2	NA	NA
WP_000263098.1|3786335_3790364_+	DNA-directed RNA polymerase subunit beta	NA	A0A0N9R0J7	Chrysochromulina_ericina_virus	29.0	9.4e-23
WP_000653944.1|3790440_3794664_+	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	26.5	2.5e-66
>prophage 280
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	3803881	3805645	4934701		Klosneuvirus(50.0%)	3	NA	NA
WP_000362395.1|3803881_3804553_+	deoxyribonuclease V	NA	A0A1V0SJW5	Klosneuvirus	29.2	2.8e-20
WP_000940106.1|3804595_3805186_+	YjaG family protein	NA	NA	NA	NA	NA
WP_001044513.1|3805372_3805645_+	DNA-binding protein HU-alpha	NA	A7KV42	Bacillus_phage	58.9	3.2e-20
>prophage 281
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	3811013	3812603	4934701		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_001612147.1|3811013_3812603_-	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	47.7	7.6e-69
>prophage 282
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	3828592	3832276	4934701		Dickeya_phage(100.0%)	1	NA	NA
WP_001612152.1|3828592_3832276_+	methionine synthase	NA	A0A140XBC7	Dickeya_phage	90.2	1.3e-26
>prophage 283
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	3857646	3858762	4934701		Mycoplasma_phage(100.0%)	1	NA	NA
WP_000179165.1|3857646_3858762_+	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	31.7	4.3e-18
>prophage 284
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	3867977	3868586	4934701		Lactococcus_phage(100.0%)	1	NA	NA
WP_000646078.1|3867977_3868586_+	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
>prophage 285
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	3875215	3877763	4934701		Escherichia_phage(50.0%)	2	NA	NA
WP_000918363.1|3875215_3876631_+	replicative DNA helicase DnaB	NA	O80281	Escherichia_phage	78.3	4.8e-200
WP_001147332.1|3876683_3877763_+	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	28.2	4.0e-29
>prophage 286
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	3881972	3885586	4934701		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_000357740.1|3881972_3884795_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	56.1	0.0e+00
WP_000168305.1|3885049_3885586_+	single-stranded DNA-binding protein SSB1	NA	A0A0A0P1Q9	Enterobacteria_phage	78.7	1.1e-56
>prophage 287
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	3889403	3890753	4934701		Moraxella_phage(100.0%)	1	NA	NA
WP_000106882.1|3889403_3890753_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	71.6	1.8e-159
>prophage 288
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	3896338	3898297	4934701		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000078209.1|3896338_3898297_-	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	40.4	1.9e-90
>prophage 289
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	3907692	3909840	4934701		Escherichia_phage(100.0%)	1	NA	NA
WP_001300547.1|3907692_3909840_-	formate dehydrogenase subunit alpha	NA	A0A077SK27	Escherichia_phage	23.9	7.0e-33
>prophage 290
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	3915085	3917071	4934701		Tetraselmis_virus(100.0%)	1	NA	NA
WP_032201355.1|3915085_3917071_-	alkyl sulfatase YjcS	NA	A0A2P0VMX1	Tetraselmis_virus	44.3	4.2e-149
>prophage 291
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	3922607	3924128	4934701		Pithovirus(100.0%)	1	NA	NA
WP_001089390.1|3922607_3924128_-	sugar ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	21.5	5.5e-08
>prophage 292
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	3929814	3931364	4934701		Organic_Lake_phycodnavirus(50.0%)	2	NA	NA
WP_000611426.1|3929814_3930495_-	phosphonate C-P lyase system protein PhnL	NA	F2Y1V6	Organic_Lake_phycodnavirus	25.0	8.7e-06
WP_001075518.1|3930605_3931364_-	phosphonate C-P lyase system protein PhnK	NA	G3M9Y6	Bacillus_virus	28.2	4.7e-16
>prophage 293
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	3936968	3937757	4934701		Cedratvirus(100.0%)	1	NA	NA
WP_001612206.1|3936968_3937757_-	phosphonate ABC transporter ATP-binding protein	NA	A0A285PWH2	Cedratvirus	29.6	1.6e-11
>prophage 294
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	3942801	3944304	4934701		Burkholderia_virus(100.0%)	1	NA	NA
WP_001313516.1|3942801_3944304_+	glycine betaine/L-proline transporter ProP	NA	Q6JIH2	Burkholderia_virus	31.0	3.1e-56
>prophage 295
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	3965501	3968713	4934701	tRNA	Catovirus(50.0%)	2	NA	NA
WP_001295087.1|3965501_3967019_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	38.0	2.0e-87
WP_000856835.1|3967255_3968713_-	dipeptide/tripeptide permease DtpC	NA	A0A0P0IY73	Acinetobacter_phage	29.6	1.8e-48
>prophage 296
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	3982990	3984974	4934701		Cronobacter_phage(50.0%)	2	NA	NA
WP_001026276.1|3982990_3983284_+	co-chaperone GroES	NA	K4F9I2	Cronobacter_phage	45.4	9.2e-13
WP_000729117.1|3983327_3984974_+	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	68.9	5.3e-190
>prophage 297
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	3989480	3990014	4934701		Morganella_phage(100.0%)	1	NA	NA
WP_001238369.1|3989480_3990014_-	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	55.0	2.7e-47
>prophage 298
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	3994934	3995912	4934701		Tupanvirus(100.0%)	1	NA	NA
WP_001612227.1|3994934_3995912_+	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9KZX5	Tupanvirus	28.2	1.5e-27
>prophage 299
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	4003340	4003886	4934701		Diachasmimorpha_longicaudata_entomopoxvirus(100.0%)	1	NA	NA
WP_001295188.1|4003340_4003886_+	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	40.4	2.2e-28
>prophage 300
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	4007801	4075520	4934701	transposase,tRNA,protease	Vibrio_phage(23.08%)	67	NA	NA
WP_000990296.1|4007801_4009139_+	N-acetylmuramoyl-L-alanine amidase AmiB	NA	A0A067ZJB6	Vibrio_phage	31.0	8.8e-18
WP_001122499.1|4009148_4010996_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	41.3	4.4e-60
WP_001280339.1|4010988_4011939_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_001051883.1|4012024_4012333_+	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_000460360.1|4012409_4013690_+	GTPase HflX	NA	NA	NA	NA	NA
WP_000312488.1|4013775_4015035_+|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
WP_001232412.1|4015037_4016042_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_001089295.1|4016123_4016321_+	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_000527955.1|4016424_4017723_+	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.9	2.2e-66
WP_001177644.1|4017927_4018353_+	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_000076316.1|4018391_4020833_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.1	6.4e-67
WP_001293282.1|4021013_4021745_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_000220137.1|4021871_4022273_+	DUF2170 family protein	NA	NA	NA	NA	NA
WP_000511955.1|4022291_4022990_+	PspA/IM30 family protein	NA	NA	NA	NA	NA
WP_000012553.1|4023040_4023700_+	YjfK family protein	NA	NA	NA	NA	NA
WP_000547760.1|4023717_4024116_+	DUF350 domain-containing protein	NA	NA	NA	NA	NA
WP_000101670.1|4024125_4024764_+	DUF1190 domain-containing protein	NA	NA	NA	NA	NA
WP_000943991.1|4024766_4025930_+	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.8	4.9e-81
WP_001719326.1|4026013_4027639_+	isovaleryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000811566.1|4027755_4028031_-|protease	protease activator YjfN	protease	NA	NA	NA	NA
WP_000254636.1|4028179_4028509_-	biofilm peroxide resistance protein BsmA	NA	NA	NA	NA	NA
WP_001719327.1|4028690_4029440_+	esterase	NA	NA	NA	NA	NA
WP_000133631.1|4029436_4030192_-	HTH-type transcriptional regulator UlaR	NA	NA	NA	NA	NA
WP_001295191.1|4030299_4031364_-	L-ascorbate 6-phosphate lactonase	NA	NA	NA	NA	NA
WP_032201196.1|4031718_4033116_+	PTS ascorbate transporter subunit IIC	NA	NA	NA	NA	NA
WP_000218362.1|4033131_4033437_+	PTS ascorbate transporter subunit IIB	NA	NA	NA	NA	NA
WP_000776543.1|4033446_4033911_+	PTS ascorbate transporter subunit IIA	NA	NA	NA	NA	NA
WP_001719329.1|4033924_4034575_+	3-keto-L-gulonate-6-phosphate decarboxylase UlaD	NA	NA	NA	NA	NA
WP_000949511.1|4034584_4035439_+	L-ribulose-5-phosphate 3-epimerase UlaE	NA	NA	NA	NA	NA
WP_001601324.1|4035438_4036125_+	L-ribulose-5-phosphate 4-epimerase	NA	NA	NA	NA	NA
WP_000492914.1|4036253_4036529_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001216676.1|4036855_4037251_+	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_001296681.1|4037257_4037572_+	primosomal replication protein N	NA	NA	NA	NA	NA
WP_000135199.1|4037576_4037804_+	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_001196062.1|4037845_4038295_+	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_001308220.1|4038365_4039160_-	DUF2686 family protein	NA	NA	NA	NA	NA
WP_000604912.1|4039783_4040215_-|transposase	IS200/IS605-like element IS609 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	60.6	1.9e-43
WP_069903738.1|4040222_4041431_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A1W6JP07	Morganella_phage	97.6	6.0e-207
WP_001119478.1|4041565_4042204_-	cell division protein YtfB	NA	NA	NA	NA	NA
WP_000211225.1|4042421_4043042_+	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_000228346.1|4043350_4044763_+	D-serine/D-alanine/glycine transporter	NA	NA	NA	NA	NA
WP_001719334.1|4044807_4045470_-	iron-sulfur cluster repair protein YtfE	NA	NA	NA	NA	NA
WP_032201334.1|4045577_4046543_-	DMT family transporter	NA	NA	NA	NA	NA
WP_001719336.1|4046650_4047511_-	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_001317588.1|4047599_4047980_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001719337.1|4048108_4050052_-	2',3'-cyclic-nucleotide 2'-phosphodiesterase	NA	NA	NA	NA	NA
WP_000886909.1|4050241_4050982_+	3'(2'),5'-bisphosphate nucleotidase CysQ	NA	NA	NA	NA	NA
WP_001719338.1|4051193_4052105_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000175287.1|4052194_4052749_-	YtfJ family protein	NA	NA	NA	NA	NA
WP_000689228.1|4053073_4053280_+	DUF1107 domain-containing protein	NA	NA	NA	NA	NA
WP_000935036.1|4053341_4054685_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001295196.1|4055007_4055646_-	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_001269327.1|4055851_4057585_+	autotransporter assembly complex protein TamA	NA	NA	NA	NA	NA
WP_032201335.1|4057581_4061361_+	autotransporter assembly complex protein TamB	NA	NA	NA	NA	NA
WP_001219160.1|4061363_4061705_+	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_000055070.1|4062084_4062615_-	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.9	9.4e-56
WP_000265933.1|4062924_4063881_+	galactofuranose ABC transporter substrate-binding protein YtfQ	NA	NA	NA	NA	NA
WP_001594697.1|4064020_4065523_+	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.3	1.4e-11
WP_001594698.1|4065536_4066559_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000596015.1|4066545_4067541_+	sugar ABC transporter permease YjfF	NA	NA	NA	NA	NA
WP_000853753.1|4067573_4068572_-	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.7	5.7e-70
WP_001219792.1|4068747_4070121_+	UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl- meso-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_000166270.1|4070276_4070828_-	ribosome-associated protein	NA	NA	NA	NA	NA
WP_001162184.1|4070921_4072274_+|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
WP_001232255.1|4072328_4072715_+	cytochrome b562	NA	NA	NA	NA	NA
WP_001106226.1|4072759_4073224_-	anaerobic ribonucleoside-triphosphate reductase-activating protein	NA	H6WXC9	Vibrio_phage	59.7	2.5e-52
WP_000187776.1|4073381_4075520_-	anaerobic ribonucleoside-triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	64.5	1.5e-266
>prophage 301
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	4079158	4085255	4934701		Paramecium_bursaria_Chlorella_virus(66.67%)	6	NA	NA
WP_001181324.1|4079158_4080106_-	HTH-type transcriptional regulator TreR	NA	C6ZCU4	Enterobacteria_phage	21.8	7.9e-13
WP_001387276.1|4080290_4080344_+	mgtA regulatory leader peptide MgtL	NA	NA	NA	NA	NA
WP_000471889.1|4080484_4083181_+	magnesium-translocating P-type ATPase	NA	M1HLC0	Paramecium_bursaria_Chlorella_virus	27.4	9.0e-46
WP_000047539.1|4083386_4083773_-	2-iminobutanoate/2-iminopropanoate deaminase	NA	NA	NA	NA	NA
WP_000148581.1|4083845_4084307_-	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_000013046.1|4084319_4085255_-	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	40.2	2.9e-52
>prophage 302
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	4093545	4115950	4934701	transposase,tRNA	Escherichia_phage(20.0%)	16	NA	NA
WP_000416400.1|4093545_4096401_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.7	1.3e-140
WP_000786399.1|4096400_4096844_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_000397144.1|4097197_4098709_-	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.0	6.0e-47
WP_000584114.1|4098975_4100076_+	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_001295681.1|4100075_4101158_+	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_001294554.1|4101318_4102821_-	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	44.6	1.4e-83
WP_001594701.1|4102948_4103968_-	NADPH-dependent aldehyde reductase Ahr	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	30.7	1.1e-44
WP_152932165.1|4105475_4105625_-	hypothetical protein	NA	A0A0N7BTS3	Escherichia_phage	85.7	5.5e-06
WP_001189112.1|4106153_4107662_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	3.6e-44
WP_032159631.1|4107970_4108342_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049828170.1|4109152_4109542_+	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	99.2	1.9e-61
WP_000145481.1|4109592_4109811_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_085949416.1|4109877_4111039_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.2	2.0e-50
WP_000625670.1|4111319_4112597_-	DUF2254 domain-containing protein	NA	NA	NA	NA	NA
WP_001293435.1|4112659_4114657_-	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	25.9	7.4e-21
WP_000088357.1|4114810_4115950_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.5e-68
>prophage 303
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	4121603	4126302	4934701		Pseudomonas_phage(33.33%)	4	NA	NA
WP_001189112.1|4121603_4123112_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	3.6e-44
WP_000177057.1|4123762_4124020_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000175457.1|4124577_4125345_-	Fe(3+) dicitrate ABC transporter ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	24.8	6.4e-13
WP_000684856.1|4125345_4126302_-	Fe(3+) dicitrate ABC transporter permease subunit FecD	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.1	1.1e-17
>prophage 304
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	4134292	4134502	4934701		Escherichia_phage(100.0%)	1	NA	NA
WP_000937727.1|4134292_4134502_-	hypothetical protein	NA	A0A0N7BTS3	Escherichia_phage	96.0	5.9e-06
>prophage 305
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	4137911	4138259	4934701		Stx2-converting_phage(100.0%)	1	NA	NA
WP_000612591.1|4137911_4138259_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
>prophage 306
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	4149836	4160867	4934701		Yersinia_phage(20.0%)	11	NA	NA
WP_001234652.1|4149836_4150655_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	39.7	1.6e-46
WP_000855059.1|4150996_4151470_+	antirestriction protein	NA	A9J566	Pseudomonas_phage	30.3	1.5e-12
WP_001186775.1|4151485_4151962_+	RadC family protein	NA	NA	NA	NA	NA
WP_000692345.1|4152024_4152246_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.9e-10
WP_001295723.1|4152408_4152777_+	antitoxin	NA	NA	NA	NA	NA
WP_000854765.1|4152866_4153241_+	toxin	NA	NA	NA	NA	NA
WP_072148473.1|4153237_4153729_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000839290.1|4153745_4153922_+	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_001467148.1|4154021_4154180_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000580534.1|4154832_4157724_+	DEAD/DEAH box helicase family protein	NA	A0A2H4J643	uncultured_Caudovirales_phage	53.6	1.9e-288
WP_001594716.1|4157744_4160867_+	site-specific DNA-methyltransferase	NA	H6W8D6	Escherichia_phage	26.6	1.1e-15
>prophage 307
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	4165995	4166976	4934701		Stx2-converting_phage(100.0%)	1	NA	NA
WP_001330175.1|4165995_4166976_-	9-O-acetyl-N-acetylneuraminic acid deacetylase	NA	Q08JA2	Stx2-converting_phage	56.2	1.2e-101
>prophage 308
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	4177011	4178472	4934701		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_000208224.1|4177011_4178472_+	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	32.4	1.4e-48
>prophage 309
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	4184995	4185550	4934701		Clostridioides_phage(100.0%)	1	NA	NA
WP_001151855.1|4184995_4185550_+	RNA 2'-phosphotransferase	NA	A0A2R2ZGT8	Clostridioides_phage	45.6	2.7e-37
>prophage 310
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	4198150	4202313	4934701	transposase	uncultured_Caudovirales_phage(50.0%)	3	NA	NA
WP_000919540.1|4198150_4199815_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	39.6	6.2e-13
WP_001594722.1|4199863_4201162_-	MFS transporter	NA	NA	NA	NA	NA
WP_001594591.1|4201332_4202313_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.8	2.0e-184
>prophage 311
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	4206835	4208115	4934701		Shigella_phage(50.0%)	2	NA	NA
WP_000799911.1|4206835_4207573_-	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	50.8	7.6e-64
WP_000098818.1|4207575_4208115_-	primosomal protein DnaT	NA	T1SA92	Salmonella_phage	62.8	2.9e-28
>prophage 312
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	4216044	4218920	4934701		Streptococcus_phage(50.0%)	3	NA	NA
WP_000175943.1|4216044_4217634_+	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	24.9	5.3e-30
WP_001295748.1|4218026_4218632_+	molecular chaperone OsmY	NA	NA	NA	NA	NA
WP_000490275.1|4218758_4218920_+	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	64.2	1.8e-10
>prophage 313
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	4224473	4225796	4934701		Geobacillus_virus(100.0%)	1	NA	NA
WP_000477811.1|4224473_4225796_+	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	39.8	2.3e-79
>prophage 314
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	4232516	4237872	4934701		Enterococcus_phage(33.33%)	3	NA	NA
WP_000093814.1|4232516_4233749_+	multifunctional transcriptional regulator/nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase NadR	NA	A0A0C5K935	Enterococcus_phage	42.6	3.6e-82
WP_000046749.1|4234056_4235724_-	energy-dependent translational throttle protein EttA	NA	A0A1V0SKJ1	Klosneuvirus	26.4	3.7e-42
WP_000409457.1|4235934_4237872_+	murein transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	34.8	4.0e-11
>prophage 315
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	4241208	4241898	4934701		Bacillus_phage(100.0%)	1	NA	NA
WP_001188659.1|4241208_4241898_+	two-component system response regulator CreB	NA	W8CYM9	Bacillus_phage	35.3	8.8e-30
>prophage 316
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	4255090	4265508	4934701	transposase	Cyanophage(20.0%)	10	NA	NA
WP_000130185.1|4255090_4256044_+	transaldolase	NA	A0A127KNC6	Cyanophage	31.5	1.7e-10
WP_001094685.1|4256158_4256746_+	molybdopterin adenylyltransferase	NA	NA	NA	NA	NA
WP_000528538.1|4256780_4257347_-	acetate uptake transporter	NA	NA	NA	NA	NA
WP_001102367.1|4257495_4258209_-	acidic protein MsyB	NA	NA	NA	NA	NA
WP_001612303.1|4258234_4258639_-	DUF2541 family protein	NA	NA	NA	NA	NA
WP_000516135.1|4259015_4260932_+	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	51.1	6.9e-149
WP_001118464.1|4261020_4262151_+	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	34.6	4.6e-28
WP_001300563.1|4262413_4263526_-|transposase	IS4-like element IS421 family transposase	transposase	NA	NA	NA	NA
WP_001181672.1|4263603_4263813_-	type I toxin-antitoxin system toxin MokC	NA	A0A0P0ZAX5	Stx2-converting_phage	72.5	5.2e-18
WP_000681360.1|4264341_4265508_+	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	50.3	7.5e-90
>prophage 317
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	4274981	4277798	4934701	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_001286887.1|4274981_4277798_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A2K9L260	Tupanvirus	26.1	2.1e-77
>prophage 318
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	4282204	4283353	4934701		Halovirus(100.0%)	1	NA	NA
WP_000597260.1|4282204_4283353_+	carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	32.6	1.7e-49
>prophage 319
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	4288856	4294517	4934701		Hepacivirus(50.0%)	4	NA	NA
WP_000351348.1|4288856_4290410_-	crotonobetaine/carnitine-CoA ligase	NA	Q75ZG1	Hepacivirus	25.4	2.1e-31
WP_000349932.1|4290483_4291701_-	L-carnitine CoA-transferase	NA	NA	NA	NA	NA
WP_000347117.1|4291829_4292972_-	crotonobetainyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000787111.1|4293002_4294517_-	L-carnitine/gamma-butyrobetaine antiporter	NA	A0A2I7QNT1	Vibrio_phage	21.1	3.5e-07
>prophage 320
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	4302414	4303814	4934701		Bacillus_phage(50.0%)	2	NA	NA
WP_000624375.1|4302414_4302894_+	type 3 dihydrofolate reductase	NA	A0A219UQN5	Bacillus_phage	46.4	1.0e-29
WP_000257194.1|4302971_4303814_-	bis(5'-nucleosyl)-tetraphosphatase (symmetrical)	NA	A0A075BTY6	Microcystis_phage	42.0	1.0e-08
>prophage 321
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	4311558	4316980	4934701		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_001717640.1|4311558_4314465_-	RNA polymerase-associated protein RapA	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	37.9	5.7e-22
WP_001717641.1|4314628_4316980_-	DNA polymerase II	NA	A0A0P0YM26	Yellowstone_lake_phycodnavirus	25.4	3.0e-37
>prophage 322
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	4323343	4324042	4934701		Planktothrix_phage(100.0%)	1	NA	NA
WP_001717645.1|4323343_4324042_-	thiamine ABC transporter ATP-binding protein ThiQ	NA	G9BWD6	Planktothrix_phage	36.7	3.1e-22
>prophage 323
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	4337752	4339477	4934701		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_000425668.1|4337752_4339477_+	acetolactate synthase 3 large subunit	NA	E5ERI2	Ostreococcus_lucimarinus_virus	26.9	1.9e-36
>prophage 324
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	4365450	4366494	4934701		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_001217337.1|4365450_4366494_+	GMP reductase	NA	A0A0N9Q9A5	Chrysochromulina_ericina_virus	56.3	6.3e-104
>prophage 325
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	4370739	4371291	4934701		Sphingobium_phage(100.0%)	1	NA	NA
WP_000923722.1|4370739_4371291_+	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	A0A1W6DX33	Sphingobium_phage	31.6	1.1e-11
>prophage 326
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	4379801	4381226	4934701		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_000102485.1|4379801_4381226_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.8	4.2e-42
>prophage 327
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	4388876	4395499	4934701		Mamastrovirus(33.33%)	5	NA	NA
WP_001717663.1|4388876_4390427_+	multicopper oxidase CueO	NA	A0A0C6DWA2	Mamastrovirus	55.4	2.7e-18
WP_001717665.1|4390628_4393019_-	pyrroloquinoline quinone-dependent dehydrogenase	NA	NA	NA	NA	NA
WP_000683335.1|4393224_4393761_+	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	33.1	5.1e-17
WP_000651599.1|4393801_4394464_-	carbonate dehydratase	NA	NA	NA	NA	NA
WP_000150637.1|4394572_4395499_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	34.0	1.2e-21
>prophage 328
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	4398761	4399634	4934701	transposase	Sodalis_phage(100.0%)	1	NA	NA
WP_001717668.1|4398761_4399634_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	50.2	3.5e-60
>prophage 329
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	4409533	4416339	4934701	tRNA	unidentified_phage(50.0%)	6	NA	NA
WP_071607517.1|4409533_4410952_-	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	37.9	5.5e-26
WP_024171430.1|4410990_4411917_-|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
WP_001155227.1|4411953_4412409_-	RNA polymerase-binding transcription factor DksA	NA	NA	NA	NA	NA
WP_000396036.1|4412586_4413291_-	DNA/RNA nuclease SfsA	NA	NA	NA	NA	NA
WP_001612365.1|4413305_4413836_-	RNA 2',3'-cyclic phosphodiesterase	NA	NA	NA	NA	NA
WP_001612367.1|4413909_4416339_+	ATP-dependent helicase HrpB	NA	A0A0G2Y9F4	Acanthamoeba_polyphaga_mimivirus	30.3	3.0e-40
>prophage 330
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	4421528	4422326	4934701		Planktothrix_phage(100.0%)	1	NA	NA
WP_001158929.1|4421528_4422326_+	Fe3+-hydroxamate ABC transporter ATP-binding protein FhuC	NA	G9BWD6	Planktothrix_phage	26.9	6.0e-14
>prophage 331
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	4428360	4428705	4934701		Lake_Baikal_phage(100.0%)	1	NA	NA
WP_001295564.1|4428360_4428705_+	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	51.4	4.5e-27
>prophage 332
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	4432634	4434059	4934701	protease	uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_000753946.1|4432634_4434059_+|protease	serine endoprotease DegP	protease	A0A1B1IT49	uncultured_Mediterranean_phage	28.8	1.9e-26
>prophage 333
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	4445819	4446578	4934701		Flavobacterium_phage(100.0%)	1	NA	NA
WP_001295562.1|4445819_4446578_+	(2E,6E)-farnesyl-diphosphate-specific ditrans,polycis-undecaprenyl-diphosphate synthase	NA	R9W0U9	Flavobacterium_phage	44.4	7.7e-27
>prophage 334
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	4455406	4459522	4934701		Emiliania_huxleyi_virus(50.0%)	2	NA	NA
WP_000569431.1|4455406_4456003_+	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.0	1.8e-26
WP_001612380.1|4456039_4459522_+	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.9	2.8e-209
>prophage 335
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	4472525	4473557	4934701		Planktothrix_phage(100.0%)	1	NA	NA
WP_000593994.1|4472525_4473557_-	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	7.2e-36
>prophage 336
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	4480067	4487920	4934701		Indivirus(25.0%)	9	NA	NA
WP_000997018.1|4480067_4480871_+	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.6	5.4e-39
WP_001612387.1|4480867_4481782_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001230983.1|4482022_4482823_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_001612389.1|4482900_4483671_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000644685.1|4483718_4485077_-	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_001612392.1|4485148_4485904_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_001612393.1|4485937_4486660_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000917883.1|4486656_4487124_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001301976.1|4487188_4487920_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.5	9.9e-40
>prophage 337
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	4495986	4567805	4934701	transposase,head,terminase,integrase,plate,tail,portal,protease,capsid,holin	Shigella_phage(52.54%)	94	4538476:4538490	4567950:4567964
WP_059321394.1|4495986_4497123_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_001118037.1|4497596_4498364_-	2-oxoglutaramate amidase	NA	NA	NA	NA	NA
WP_000532698.1|4498517_4498991_+	C-lysozyme inhibitor	NA	NA	NA	NA	NA
WP_001612411.1|4499033_4501478_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000284050.1|4501717_4502296_+	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
WP_000333380.1|4502501_4503269_+	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_001225679.1|4503239_4503980_-	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_024171431.1|4504135_4504414_-	type II toxin-antitoxin system mRNA interferase toxin YafQ	NA	NA	NA	NA	NA
WP_000729704.1|4504416_4504677_-	type II toxin-antitoxin system antitoxin DinJ	NA	NA	NA	NA	NA
WP_000056850.1|4504886_4505636_+	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	37.7	1.2e-19
WP_001612413.1|4505811_4506309_+|transposase	REP-associated tyrosine transposase RayT	transposase	NA	NA	NA	NA
WP_001717708.1|4506495_4508235_-	flagellar type III secretion system protein FlhA	NA	NA	NA	NA	NA
WP_001301640.1|4508194_4508965_+	putative lateral flagellar export/assembly protein LafU	NA	NA	NA	NA	NA
WP_001226164.1|4509035_4510091_+	DNA polymerase IV	NA	NA	NA	NA	NA
WP_001717709.1|4510087_4510540_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001612416.1|4510845_4511112_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077823164.1|4511044_4511581_+	peptide chain release factor H	NA	NA	NA	NA	NA
WP_001612419.1|4511637_4513095_-	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
WP_001291990.1|4513355_4513814_+	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000189543.1|4513905_4515150_+	esterase FrsA	NA	NA	NA	NA	NA
WP_000174677.1|4515207_4515609_+	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
WP_000749879.1|4515647_4516703_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.9	4.5e-118
WP_001285288.1|4516990_4518094_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000893266.1|4518105_4519359_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	5.8e-96
WP_000051887.1|4519563_4520727_-|integrase	site-specific integrase	integrase	U5P434	Shigella_phage	100.0	2.4e-229
WP_077873866.1|4520603_4521038_-	helix-turn-helix domain-containing protein	NA	U5P4J3	Shigella_phage	100.0	6.4e-79
WP_000206732.1|4520953_4521259_-	hypothetical protein	NA	U5P0J0	Shigella_phage	100.0	6.8e-51
WP_001242749.1|4521258_4521621_-	phage protein	NA	U5P092	Shigella_phage	100.0	2.1e-67
WP_000008200.1|4521611_4522148_-	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	100.0	4.3e-101
WP_000081287.1|4522275_4523100_-	DUF2303 family protein	NA	U5P439	Shigella_phage	100.0	6.0e-150
WP_000135682.1|4523165_4523528_-	hypothetical protein	NA	U5P4J6	Shigella_phage	100.0	3.3e-60
WP_000016389.1|4523995_4524430_+	hypothetical protein	NA	U5P096	Shigella_phage	100.0	8.4e-79
WP_000549626.1|4524401_4524608_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000848748.1|4524843_4525518_-	LexA family transcriptional repressor	NA	U5P0T5	Shigella_phage	100.0	1.2e-132
WP_000649477.1|4525608_4525809_+	transcriptional regulator	NA	U5P445	Shigella_phage	100.0	7.9e-32
WP_000515845.1|4525852_4526404_+	protein YmfL	NA	S5FXP0	Shigella_phage	99.5	3.4e-101
WP_001250269.1|4526579_4526759_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_000104941.1|4526748_4527690_+	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	93.0	6.4e-140
WP_002431701.1|4527686_4528181_+	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	97.5	3.6e-86
WP_000210170.1|4528180_4528507_+	LexA family transcriptional regulator	NA	A0A291AWY9	Escherichia_phage	100.0	5.4e-54
WP_032201140.1|4528503_4528893_+	RusA family crossover junction endodeoxyribonuclease	NA	Q8SBE7	Shigella_phage	99.2	2.7e-68
WP_001459460.1|4528912_4529722_+	KilA-N domain-containing protein	NA	A0A291AWU7	Escherichia_phage	99.6	5.3e-151
WP_024168600.1|4529729_4530719_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.7	4.3e-195
WP_032201142.1|4530732_4531485_+	antitermination protein	NA	Q8SBE4	Shigella_phage	98.8	2.6e-136
WP_000779379.1|4531699_4531969_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001459463.1|4532178_4532973_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001283162.1|4533081_4533468_+	membrane protein	NA	A0A192Y8P2	Salmonella_phage	99.2	9.2e-61
WP_000422366.1|4533454_4533736_+|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	45.2	9.7e-20
WP_032201144.1|4533735_4534350_+	glycoside hydrolase family 19 protein	NA	Q8HA86	Salmonella_phage	79.9	4.2e-92
WP_032201145.1|4534357_4534627_+	hypothetical protein	NA	G8C7W1	Escherichia_phage	71.3	5.8e-22
WP_032201148.1|4534767_4534998_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050437385.1|4535072_4535636_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032201150.1|4535738_4536089_+	HNH endonuclease	NA	A0A1B5FP94	Escherichia_phage	80.0	6.6e-50
WP_000929175.1|4536215_4536710_+|terminase	phage terminase small subunit P27 family	terminase	U5P067	Shigella_phage	99.4	3.9e-88
WP_149009932.1|4536943_4538440_+|terminase	terminase large subunit	terminase	A0A1C9IIA1	Salmonella_phage	99.0	3.1e-298
WP_000605606.1|4538451_4538634_+	hypothetical protein	NA	S5FXQ9	Shigella_phage	100.0	1.7e-25
4538476:4538490	attL	CTGGTGGGCGTGCTG	NA	NA	NA	NA
WP_001524100.1|4538633_4539875_+|portal	phage portal protein	portal	U5P411	Shigella_phage	100.0	6.9e-243
WP_001193631.1|4539852_4540503_+|head,protease	HK97 family phage prohead protease	head,protease	U5P4H2	Shigella_phage	100.0	2.5e-119
WP_000257507.1|4540517_4541723_+|capsid	phage major capsid protein	capsid	M1FPN2	Enterobacteria_phage	100.0	1.8e-224
WP_000601360.1|4541772_4541973_+	hypothetical protein	NA	S5FNU1	Shigella_phage	97.0	3.8e-26
WP_000927719.1|4541975_4542299_+|head,tail	phage gp6-like head-tail connector protein	head,tail	U5P072	Shigella_phage	99.1	1.1e-56
WP_000702388.1|4542295_4542706_+|head	phage head closure protein	head	M1FJ87	Enterobacteria_phage	97.8	5.9e-74
WP_000213502.1|4542680_4543187_+	hypothetical protein	NA	M1FPE2	Enterobacteria_phage	100.0	1.7e-91
WP_000779276.1|4543183_4543744_+	hypothetical protein	NA	Q8SBH4	Shigella_phage	97.8	2.6e-104
WP_000497751.1|4543752_4543923_+	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	100.0	9.3e-26
WP_000155715.1|4543906_4545403_+|tail	tail sheath protein	tail	M1FN90	Enterobacteria_phage	98.8	2.2e-272
WP_000090998.1|4545402_4545759_+	hypothetical protein	NA	U5P076	Shigella_phage	100.0	5.3e-63
WP_000661047.1|4545758_4546028_+|tail	phage tail assembly protein	tail	S5FNR3	Shigella_phage	100.0	3.5e-43
WP_032201156.1|4546169_4548002_+|tail	phage tail tape measure protein	tail	S5FM63	Shigella_phage	98.5	3.9e-303
WP_000734912.1|4548033_4548480_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032201158.1|4548590_4549919_+	DNA circularization protein	NA	Q8SBG8	Shigella_phage	98.4	1.0e-244
WP_032201160.1|4549915_4550995_+|plate	baseplate protein	plate	U5P0H6	Shigella_phage	99.4	4.5e-206
WP_001259079.1|4550994_4551543_+|plate	phage baseplate assembly protein	plate	Q8SBG6	Shigella_phage	100.0	2.3e-97
WP_032201161.1|4551542_4551968_+|tail	phage tail protein	tail	U5P0R9	Shigella_phage	99.3	1.5e-80
WP_032201162.1|4551954_4553013_+|plate	baseplate J/gp47 family protein	plate	S5FM68	Shigella_phage	98.3	1.4e-199
WP_001560831.1|4553003_4553588_+	YmfQ family protein	NA	O22003	Shigella_phage	99.0	9.2e-113
WP_000554687.1|4553591_4554377_+|tail	tail fiber protein	tail	Q9MCR6	Enterobacteria_phage	69.0	3.5e-59
WP_001030518.1|4554376_4554979_+|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	88.0	5.6e-97
WP_001089534.1|4554950_4555394_-|tail	tail assembly chaperone	tail	A0A0F7LDZ0	Escherichia_phage	49.7	3.6e-37
WP_001115559.1|4555396_4555888_-	hypothetical protein	NA	F1BUP1	Erwinia_phage	35.3	4.8e-06
WP_157774360.1|4556973_4557813_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000749408.1|4558079_4558511_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032201167.1|4559058_4560273_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	56.7	8.8e-134
WP_000565285.1|4560401_4561199_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000072422.1|4561426_4561624_+	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_001723119.1|4561701_4562502_+	antA/AntB antirepressor family protein	NA	A0A0R6PJV6	Moraxella_phage	40.9	9.3e-23
WP_099492725.1|4562494_4563802_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_000335966.1|4563794_4564019_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001723121.1|4564011_4564377_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204082.1|4564369_4564603_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000551487.1|4564595_4564796_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001723122.1|4564800_4565091_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_032201487.1|4565087_4566893_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	49.4	2.3e-122
WP_001723124.1|4567274_4567805_+	ProQ/FinO family protein	NA	Q2A0A1	Sodalis_phage	34.0	4.7e-07
4567950:4567964	attR	CAGCACGCCCACCAG	NA	NA	NA	NA
>prophage 338
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	4581090	4583289	4934701		Acinetobacter_phage(100.0%)	1	NA	NA
WP_001612429.1|4581090_4583289_-	xanthine dehydrogenase family protein molybdopterin-binding subunit	NA	A0A0P0I429	Acinetobacter_phage	25.8	3.3e-38
>prophage 339
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	4601589	4602441	4934701		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001717723.1|4601589_4602441_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	40.3	2.0e-47
>prophage 340
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	4608485	4611790	4934701		Staphylococcus_phage(50.0%)	4	NA	NA
WP_001612446.1|4608485_4609355_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	42.1	3.2e-53
WP_001306921.1|4609514_4610108_-	reactive chlorine species resistance protein RclC	NA	NA	NA	NA	NA
WP_000474084.1|4610119_4610356_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001612447.1|4610464_4611790_-	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	47.6	2.5e-113
>prophage 341
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	4621716	4629274	4934701	holin,integrase	Escherichia_phage(33.33%)	6	4620676:4620689	4635748:4635761
4620676:4620689	attL	TTCACCAACGGCAA	NA	NA	NA	NA
WP_001362381.1|4621716_4622280_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	52.7	1.8e-52
WP_001612454.1|4622523_4622658_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001612455.1|4623336_4625025_-|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.1	1.8e-60
WP_001612456.1|4625038_4626511_-	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001301903.1|4626524_4627112_-	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_000131044.1|4627240_4629274_+|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	27.4	3.4e-21
4635748:4635761	attR	TTCACCAACGGCAA	NA	NA	NA	NA
>prophage 342
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	4640663	4641713	4934701		Tupanvirus(100.0%)	1	NA	NA
WP_000692746.1|4640663_4641713_+	NADPH-dependent aldehyde reductase YahK	NA	A0A2K9L339	Tupanvirus	45.0	1.1e-71
>prophage 343
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	4650393	4652280	4934701		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000010270.1|4650393_4652280_+	propionate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	29.4	3.1e-53
>prophage 344
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	4655556	4656456	4934701		Lactobacillus_phage(100.0%)	1	NA	NA
WP_032200772.1|4655556_4656456_-	transcriptional regulator CynR	NA	A0A2P0ZL89	Lactobacillus_phage	27.3	2.5e-16
>prophage 345
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	4660997	4665277	4934701		Herpes_simplex_virus(50.0%)	2	NA	NA
WP_001612474.1|4660997_4664072_-	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	97.4	0.0e+00
WP_000805900.1|4664194_4665277_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	99.7	9.8e-193
>prophage 346
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	4670687	4672648	4934701		Ostreococcus_lucimarinus_virus(50.0%)	2	NA	NA
WP_000044314.1|4670687_4671638_+	acetaldehyde dehydrogenase (acetylating)	NA	G9E526	Ostreococcus_lucimarinus_virus	35.2	8.7e-36
WP_001013510.1|4671634_4672648_+	4-hydroxy-2-oxovalerate aldolase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	31.1	3.2e-44
>prophage 347
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	4676130	4678756	4934701		Prochlorococcus_phage(50.0%)	3	NA	NA
WP_000842102.1|4676130_4677240_-	S-(hydroxymethyl)glutathione dehydrogenase	NA	A0A0K0KVL7	Prochlorococcus_phage	28.6	1.2e-31
WP_001141271.1|4677274_4677550_-	formaldehyde-responsive transcriptional repressor FrmR	NA	NA	NA	NA	NA
WP_001717740.1|4677709_4678756_-	ferric ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.7	8.1e-35
>prophage 348
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	4686779	4687547	4934701		Planktothrix_phage(100.0%)	1	NA	NA
WP_000939373.1|4686779_4687547_+	taurine ABC transporter ATP-binding subunit	NA	G9BWD6	Planktothrix_phage	40.3	8.6e-26
>prophage 349
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	4694446	4695604	4934701		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_001612488.1|4694446_4695604_-	D-alanyl-D-alanine- carboxypeptidase/endopeptidase AmpH	NA	A0A2H4JAN9	uncultured_Caudovirales_phage	22.1	5.1e-06
>prophage 350
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	4703019	4704135	4934701		Bacillus_phage(100.0%)	1	NA	NA
WP_000484044.1|4703019_4704135_+	diguanylate cyclase AdrA	NA	A0A127AWB9	Bacillus_phage	34.5	1.1e-18
>prophage 351
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	4708797	4718769	4934701		Bacillus_phage(60.0%)	7	NA	NA
WP_001298537.1|4708797_4709709_-	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	63.6	2.7e-103
WP_001612495.1|4709833_4710742_+	fructokinase	NA	NA	NA	NA	NA
WP_001306939.1|4710884_4712069_-	MFS transporter AraJ	NA	NA	NA	NA	NA
WP_001612498.1|4712194_4715338_-	exonuclease subunit SbcC	NA	G3MAB6	Bacillus_virus	27.4	5.3e-13
WP_001612499.1|4715334_4716537_-	exonuclease subunit SbcD	NA	R4JGS2	Bacillus_phage	31.5	3.1e-06
WP_000113933.1|4716726_4717416_+	phosphate response regulator transcription factor PhoB	NA	W8CYM9	Bacillus_phage	38.0	4.4e-37
WP_000893611.1|4717473_4718769_+	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	30.8	1.7e-26
>prophage 352
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	4727367	4736209	4934701	tRNA	uncultured_Mediterranean_phage(60.0%)	10	NA	NA
WP_000667319.1|4727367_4728495_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	46.1	2.1e-89
WP_000007629.1|4728517_4728850_+	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	33.0	2.8e-10
WP_000934822.1|4728877_4730725_+	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_000046637.1|4730735_4731707_+	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	37.9	1.0e-44
WP_000974813.1|4731835_4732183_+	HNH nuclease family protein	NA	NA	NA	NA	NA
WP_001295328.1|4732220_4733105_-	nucleoside-specific channel-forming protein Tsx	NA	NA	NA	NA	NA
WP_001314529.1|4733403_4733943_-	DUF3251 domain-containing protein	NA	NA	NA	NA	NA
WP_000543535.1|4734093_4734543_+	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_001612504.1|4734546_4735650_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	35.8	1.8e-53
WP_001021161.1|4735738_4736209_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	47.4	1.3e-29
>prophage 353
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	4759567	4764614	4934701	protease	Agrobacterium_phage(25.0%)	4	NA	NA
WP_000122253.1|4759567_4760191_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	63.9	2.9e-64
WP_000130305.1|4760316_4761591_+|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	56.4	8.7e-132
WP_001295325.1|4761778_4764133_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.4	1.6e-224
WP_001043542.1|4764341_4764614_+	DNA-binding protein HU-beta	NA	A7KV42	Bacillus_phage	58.4	1.1e-20
>prophage 354
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	4767754	4768450	4934701		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000817227.1|4767754_4768450_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	68.0	1.9e-88
>prophage 355
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	4771774	4775321	4934701		Bacillus_phage(100.0%)	2	NA	NA
WP_032200872.1|4771774_4773547_+	SmdA family multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.1	2.6e-49
WP_001256174.1|4773539_4775321_+	SmdB family multidrug efflux ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.1	1.4e-42
>prophage 356
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	4784156	4787306	4934701		Leptospira_phage(100.0%)	1	NA	NA
WP_001132469.1|4784156_4787306_-	multidrug efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	23.9	6.2e-54
>prophage 357
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	4794314	4802772	4934701		Klosneuvirus(25.0%)	8	NA	NA
WP_000127356.1|4794314_4794866_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	47.3	3.7e-31
WP_024171443.1|4794994_4796926_+	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	41.5	5.1e-43
WP_000467098.1|4796978_4797308_+	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_001195025.1|4797307_4797913_+	recombination protein RecR	NA	NA	NA	NA	NA
WP_000678201.1|4798022_4799897_+	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	38.0	1.0e-117
WP_000261613.1|4800017_4800722_+	adenylate kinase	NA	NA	NA	NA	NA
WP_001250105.1|4800853_4801816_+	ferrochelatase	NA	NA	NA	NA	NA
WP_001717778.1|4801812_4802772_-	acetyl esterase	NA	L7RDF8	Acanthamoeba_polyphaga_moumouvirus	24.7	1.3e-15
>prophage 358
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	4811016	4814178	4934701		Escherichia_phage(50.0%)	2	NA	NA
WP_001717781.1|4811016_4811358_+	HigA family addiction module antidote protein	NA	A0A222YWD7	Escherichia_phage	70.9	7.4e-38
WP_001717782.1|4811673_4814178_-	copper-exporting P-type ATPase CopA	NA	A0A218MNH6	uncultured_virus	38.2	8.5e-115
>prophage 359
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	4839249	4841412	4934701		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_001612541.1|4839249_4841412_+	type I secretion system permease/ATPase	NA	F2Y302	Organic_Lake_phycodnavirus	31.9	4.1e-17
>prophage 360
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	4847141	4847819	4934701		Bacillus_virus(100.0%)	1	NA	NA
WP_001157535.1|4847141_4847819_+	iron ABC transporter ATP-binding protein FetA	NA	G3M9Y6	Bacillus_virus	34.3	2.4e-27
>prophage 361
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	4850955	4858684	4934701		Planktothrix_phage(50.0%)	3	NA	NA
WP_001110573.1|4850955_4851642_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.6	2.9e-33
WP_001717789.1|4851638_4854053_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_099490903.1|4854481_4858684_+	RHS repeat protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	44.6	1.3e-22
>prophage 362
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	4863941	4865723	4934701		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_001612552.1|4863941_4865723_+	glyoxylate carboligase	NA	E4WLQ6	Ostreococcus_tauri_virus	27.0	6.0e-38
>prophage 363
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	4871914	4873060	4934701		Streptococcus_phage(100.0%)	1	NA	NA
WP_001717805.1|4871914_4873060_+	glycerate 3-kinase	NA	W6LM47	Streptococcus_phage	41.4	1.2e-47
>prophage 364
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	4884492	4887623	4934701	tRNA	Moumouvirus(50.0%)	4	NA	NA
WP_001402080.1|4884492_4885878_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.9e-45
WP_001612564.1|4885913_4886435_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000190288.1|4886542_4886755_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_000729155.1|4886756_4887623_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
>prophage 365
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	4909387	4914004	4934701		Ralstonia_phage(33.33%)	3	NA	NA
WP_001612575.1|4909387_4911289_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	26.1	3.5e-28
WP_032201420.1|4911882_4913331_-	Cu(+)/Ag(+) sensor histidine kinase CusS	NA	A0A1V0SGX0	Hokovirus	26.1	3.0e-11
WP_000770953.1|4913320_4914004_-	copper response regulator transcription factor CusR	NA	W8CYM9	Bacillus_phage	35.1	1.0e-30
>prophage 366
NZ_CP024263	Escherichia coli O169:H41 strain F6326-C1 chromosome, complete genome	4934701	4917149	4920293	4934701		Leptospira_phage(100.0%)	1	NA	NA
WP_001717826.1|4917149_4920293_+	Cu(+)/Ag(+) efflux RND transporter permease subunit CusA	NA	S5VTK5	Leptospira_phage	22.5	1.7e-59
>prophage 1
NZ_CP024264	Escherichia coli O169:H41 strain F6326-C1 plasmid unnamed1	72060	1337	15274	72060	tail	Salmonella_phage(85.0%)	20	NA	NA
WP_099560762.1|1337_1727_+|tail	tail fiber domain-containing protein	tail	A0A1X7QGH6	Escherichia_phage	58.6	2.8e-41
WP_099560763.1|1787_2042_+	hypothetical protein	NA	J9Q7R5	Salmonella_phage	67.9	3.9e-28
WP_000274392.1|2041_2650_+	hypothetical protein	NA	J9Q7G0	Salmonella_phage	74.3	2.6e-78
WP_000064175.1|2972_3296_+	hypothetical protein	NA	J9Q6E7	Salmonella_phage	88.8	2.9e-44
WP_099560764.1|3309_4002_+	hypothetical protein	NA	J9Q7Y7	Salmonella_phage	93.9	1.4e-123
WP_000901561.1|4003_4255_+	hypothetical protein	NA	J9Q7R6	Salmonella_phage	81.9	1.1e-27
WP_000931257.1|4627_5011_+	hypothetical protein	NA	A0A077SLR3	Escherichia_phage	43.3	1.3e-11
WP_000035506.1|4995_5748_+	hypothetical protein	NA	J9Q7Y8	Salmonella_phage	31.1	3.5e-16
WP_000161228.1|5924_6593_+	AAA family ATPase	NA	J9Q7R7	Salmonella_phage	91.4	1.7e-110
WP_000062085.1|6592_6952_+	hypothetical protein	NA	J9Q7G3	Salmonella_phage	97.9	1.5e-44
WP_001404393.1|7012_8071_-	hypothetical protein	NA	A0A2I7RNF6	Vibrio_phage	43.8	5.8e-65
WP_021520501.1|8360_9101_+	hypothetical protein	NA	J9Q7R8	Salmonella_phage	89.2	1.1e-126
WP_000137333.1|9144_10485_+	AAA family ATPase	NA	J9Q7G4	Salmonella_phage	93.5	3.4e-235
WP_088556050.1|10566_11745_+	DNA primase	NA	J9Q720	Salmonella_phage	93.5	3.1e-208
WP_088556051.1|11823_12606_+	hypothetical protein	NA	J9Q7Z0	Salmonella_phage	41.1	3.4e-54
WP_099560765.1|12886_13144_+	hypothetical protein	NA	J9Q7R9	Salmonella_phage	59.0	2.5e-14
WP_000733192.1|13140_14463_+	DNA ligase	NA	J9Q7G5	Salmonella_phage	90.9	2.0e-240
WP_085949093.1|14462_14639_+	hypothetical protein	NA	J9Q729	Salmonella_phage	72.4	1.1e-16
WP_000636536.1|14622_14838_+	hypothetical protein	NA	J9Q6I3	Salmonella_phage	72.1	9.7e-20
WP_000067986.1|14983_15274_+	hypothetical protein	NA	J9Q7S1	Salmonella_phage	78.1	6.9e-37
>prophage 2
NZ_CP024264	Escherichia coli O169:H41 strain F6326-C1 plasmid unnamed1	72060	21021	67490	72060	tRNA	Salmonella_phage(88.64%)	48	NA	NA
WP_088556052.1|21021_23130_+	cobalamin biosynthesis protein CobT	NA	J9Q7G6	Salmonella_phage	66.6	2.8e-228
WP_000213833.1|23225_24461_+	AAA domain-containing protein	NA	J9Q733	Salmonella_phage	81.3	6.7e-198
WP_099560767.1|24641_28160_+	DNA polymerase III subunit alpha	NA	J9Q7Z2	Salmonella_phage	94.2	0.0e+00
WP_000459728.1|28378_28969_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099560768.1|29213_29645_+	hypothetical protein	NA	J9Q6I8	Salmonella_phage	86.0	2.0e-64
WP_000047685.1|29762_30791_+	hypothetical protein	NA	J9Q7Z3	Salmonella_phage	87.3	9.4e-145
WP_001108397.1|30852_31797_+	exonuclease	NA	J9Q7S6	Salmonella_phage	88.2	1.0e-161
WP_000920224.1|31796_32063_+	hypothetical protein	NA	J9Q7G8	Salmonella_phage	77.3	2.6e-30
WP_001051809.1|32065_33139_+	hypothetical protein	NA	J9Q736	Salmonella_phage	95.2	1.4e-196
WP_021533191.1|33231_33432_+	hypothetical protein	NA	J9Q6J0	Salmonella_phage	59.1	7.2e-09
WP_099560769.1|33435_34272_+	SPFH domain-containing protein	NA	J9Q7Z4	Salmonella_phage	91.7	2.9e-120
WP_099560775.1|34372_34789_+	hypothetical protein	NA	J9Q7G9	Salmonella_phage	75.4	3.8e-60
WP_099560770.1|34844_35120_+	hypothetical protein	NA	J9Q738	Salmonella_phage	76.9	1.0e-34
WP_000644408.1|35335_35671_+	hypothetical protein	NA	J9Q7Z5	Salmonella_phage	73.9	6.6e-39
WP_001229345.1|35670_35883_+	hypothetical protein	NA	J9Q7S8	Salmonella_phage	94.3	3.4e-33
WP_000105079.1|36462_37557_-	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	45.4	1.3e-75
WP_000364573.1|37878_38523_+	hypothetical protein	NA	J9Q739	Salmonella_phage	86.3	2.9e-107
WP_000174804.1|38777_39863_+	exonuclease	NA	J9Q7S9	Salmonella_phage	87.3	6.8e-186
WP_085949095.1|39904_40096_+	hypothetical protein	NA	J9Q7H1	Salmonella_phage	74.6	8.3e-23
WP_000670359.1|40092_42009_+	AAA family ATPase	NA	J9Q741	Salmonella_phage	72.9	8.4e-248
WP_088556057.1|41998_42757_+	hypothetical protein	NA	J9Q6J5	Salmonella_phage	46.9	3.4e-51
WP_000037962.1|42766_43336_+	hypothetical protein	NA	J9Q7Z7	Salmonella_phage	86.8	1.1e-91
WP_000623685.1|43409_45725_+	ribonucleoside-diphosphate reductase subunit alpha	NA	J9Q7T0	Salmonella_phage	84.4	0.0e+00
WP_000122502.1|45831_46974_+	ribonucleotide-diphosphate reductase subunit beta	NA	J9Q7H3	Salmonella_phage	88.7	2.6e-196
WP_001011859.1|47051_47921_+	hypothetical protein	NA	J9Q742	Salmonella_phage	81.0	3.1e-133
WP_088556058.1|48065_49196_+	thymidylate synthase	NA	J9Q6J6	Salmonella_phage	86.6	3.3e-191
WP_001348729.1|49197_49611_+	hypothetical protein	NA	J9Q7Z8	Salmonella_phage	84.7	2.3e-62
WP_000781810.1|49607_50084_+	dihydrofolate reductase	NA	J9Q7T1	Salmonella_phage	90.5	2.0e-81
WP_000386468.1|50083_50728_+	AAA family ATPase	NA	J9Q7H4	Salmonella_phage	80.8	1.7e-96
WP_001718079.1|50789_51209_+	hypothetical protein	NA	J9Q743	Salmonella_phage	71.9	3.2e-51
WP_016607532.1|51218_51776_+	3'-5' exonuclease	NA	J9Q6J8	Salmonella_phage	83.1	1.7e-87
WP_000559570.1|52927_53521_+	phage N-6-adenine-methyltransferase	NA	J9Q7T2	Salmonella_phage	86.3	3.4e-99
WP_000121543.1|53706_53937_+	hypothetical protein	NA	J9Q7H5	Salmonella_phage	84.2	5.9e-31
WP_001404443.1|54519_55110_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	83.8	3.7e-93
WP_001103988.1|55763_55952_+	hypothetical protein	NA	J9Q800	Salmonella_phage	53.2	7.2e-11
WP_000900261.1|56045_56471_+	tellurite/colicin resistance protein	NA	Q71TK7	Escherichia_phage	78.7	5.7e-56
WP_099560771.1|56768_57335_+	hypothetical protein	NA	J9Q7H6	Salmonella_phage	64.2	7.7e-56
WP_022644971.1|57476_59162_+	DUF4942 domain-containing protein	NA	J9Q747	Salmonella_phage	92.2	0.0e+00
WP_022644970.1|59222_59927_+	hypothetical protein	NA	J9Q6K2	Salmonella_phage	76.4	2.1e-87
WP_047659451.1|59926_60307_+	hypothetical protein	NA	J9Q801	Salmonella_phage	67.4	2.2e-27
WP_099560772.1|60445_60859_+	hypothetical protein	NA	A0A1B5FPC7	Escherichia_phage	49.0	1.4e-14
WP_024184642.1|60863_61049_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000206790.1|61048_61753_+	DUF551 domain-containing protein	NA	K7P7E4	Enterobacteria_phage	43.0	2.0e-45
WP_001030113.1|61745_61967_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000108704.1|62343_62970_+	hypothetical protein	NA	C6ZR26	Salmonella_phage	68.4	1.2e-06
WP_000506720.1|63771_64161_+	DNA repair protein	NA	A0A077SK24	Escherichia_phage	93.0	8.6e-67
WP_099560773.1|64198_65299_-	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_001718028.1|65456_67490_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SEZ7	Hokovirus	24.1	2.2e-44
>prophage 1
NZ_CP024265	Escherichia coli O169:H41 strain F6326-C1 plasmid unnamed2, complete sequence	150389	10494	72642	150389	integrase,transposase	Salmonella_phage(20.0%)	49	10407:10432	34046:34071
10407:10432	attL	TTGGCGGCGTTTTTCAAGGTAGTTGT	NA	NA	NA	NA
WP_001702847.1|10494_11646_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	1.5e-42
WP_024171406.1|15233_15455_-	hypothetical protein	NA	U5N3V8	Enterobacteria_phage	100.0	1.6e-25
WP_001717486.1|15526_15739_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024171396.1|16467_17034_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001595093.1|18193_19018_-	prepilin peptidase	NA	NA	NA	NA	NA
WP_001595094.1|19023_20088_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001595096.1|20102_21128_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024171392.1|21114_22446_-	Flp pilus assembly complex ATPase component	NA	NA	NA	NA	NA
WP_001595098.1|22643_23132_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001595099.1|23119_23947_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001595100.1|23948_24509_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001717441.1|24511_25969_-	type II/III secretion system protein	NA	NA	NA	NA	NA
WP_024171393.1|25985_26405_-	pilus assembly protein	NA	NA	NA	NA	NA
WP_024171394.1|26423_27992_-	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_149007421.1|28052_28763_-	type IV pilus major pilin	NA	Q8LTI3	Vibrio_virus	36.7	9.4e-19
WP_001595106.1|29066_29510_-	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_001595107.1|29517_30360_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_024171395.1|30634_30934_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_001717448.1|31671_32412_+|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	1.6e-24
WP_023486339.1|34380_35358_-	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	59.2	6.1e-101
34046:34071	attR	ACAACTACCTTGAAAAACGCCGCCAA	NA	NA	NA	NA
WP_000447015.1|35985_37521_+|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	40.7	8.6e-102
WP_001282653.1|37537_38293_+	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	43.8	6.2e-45
WP_000766063.1|40051_40348_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001595119.1|40451_40778_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	48.9	1.6e-18
WP_001595120.1|40774_41026_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001595122.1|41579_42446_+	ParA family protein	NA	NA	NA	NA	NA
WP_001595123.1|42445_43477_+	ParB/RepB/Spo0J family partition protein	NA	S5WII0	Leptospira_phage	26.6	7.5e-09
WP_032159708.1|43500_43914_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071600071.1|43973_44189_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001595125.1|44272_45547_-	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	63.3	5.2e-153
WP_001595126.1|45546_45969_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	52.4	1.6e-29
WP_001595131.1|47686_48034_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	99.1	4.8e-61
WP_099490844.1|48958_50071_+|transposase	IS4-like element IS421 family transposase	transposase	NA	NA	NA	NA
WP_001595132.1|50306_50615_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001413878.1|51129_51327_-	ANR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001595134.1|51524_52322_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_099490938.1|54571_55234_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001595151.1|56595_57156_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	87.1	1.9e-51
WP_001717584.1|57158_60128_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	66.2	0.0e+00
WP_000766063.1|60341_60638_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096842321.1|62579_63659_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_099560778.1|63627_65016_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_001595139.1|64972_65671_-	CS6 fimbrial biogenesis chaperone CssC	NA	NA	NA	NA	NA
WP_001595140.1|65719_66223_-	CS6 fimbrial subunit CssB	NA	NA	NA	NA	NA
WP_024171410.1|66240_66705_-	CS6 fimbrial subunit A	NA	NA	NA	NA	NA
WP_001717498.1|67302_67476_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000566440.1|68601_68874_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001400936.1|68866_69445_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	40.2	1.2e-27
WP_001717496.1|69594_72642_+|transposase	Tn3 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP024265	Escherichia coli O169:H41 strain F6326-C1 plasmid unnamed2, complete sequence	150389	91268	142845	150389	transposase	Stx2-converting_phage(45.83%)	44	NA	NA
WP_000447015.1|91268_92804_-|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	40.7	8.6e-102
WP_099490939.1|93526_93739_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099490891.1|93725_95318_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	61.2	3.0e-174
WP_000624718.1|95348_95699_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	2.1e-40
WP_000422741.1|95695_96121_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
WP_157757765.1|96174_96315_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001300563.1|97383_98496_+|transposase	IS4-like element IS421 family transposase	transposase	NA	NA	NA	NA
WP_024171399.1|99311_99662_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	62.1	1.5e-38
WP_001309734.1|99658_100093_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	60.3	1.5e-19
WP_157757766.1|100107_100563_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	49.2	3.3e-33
WP_001595189.1|101905_102124_+	heat-stable enterotoxin ST-I group a	NA	NA	NA	NA	NA
WP_000422741.1|103325_103751_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
WP_000624718.1|103747_104098_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	2.1e-40
WP_099490891.1|104128_105721_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	61.2	3.0e-174
WP_001717536.1|107265_107562_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071600075.1|108055_108412_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001595179.1|109639_110227_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	59.3	1.0e-50
WP_148717952.1|110144_110951_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	68.3	3.2e-100
WP_099490941.1|111669_111900_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_001719375.1|112437_113079_+	recombinase family protein	NA	NA	NA	NA	NA
WP_024171601.1|113982_115227_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000872086.1|116128_116443_-	hypothetical protein	NA	I3UM57	Rhodobacter_phage	39.3	1.5e-13
WP_001719371.1|116439_117114_-	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
WP_001719370.1|117110_117545_-	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
WP_032201451.1|117599_119567_-	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	27.2	1.0e-22
WP_001297827.1|119627_119861_-	DUF905 domain-containing protein	NA	NA	NA	NA	NA
WP_032201449.1|119917_120439_-	single-stranded DNA-binding protein	NA	I3PGW4	Xanthomonas_phage	73.5	2.3e-46
WP_001395724.1|120666_120861_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032201448.1|121297_121861_-	class I SAM-dependent methyltransferase	NA	A8HNV9	Thalassomonas_phage	35.4	1.0e-20
WP_032201446.1|121906_123268_-	DUF3560 domain-containing protein	NA	NA	NA	NA	NA
WP_000218642.1|123319_123550_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077841598.1|123811_124048_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000436083.1|124720_125146_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	78.4	1.7e-36
WP_001404526.1|125142_125493_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	65.5	2.8e-40
WP_099492829.1|125523_127137_+|transposase	IS66-like element ISEc23 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.2	2.0e-181
WP_001595158.1|127775_128210_-	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_001464094.1|129239_129590_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	62.1	1.8e-39
WP_001595160.1|129586_130006_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	92.8	6.9e-46
WP_001717880.1|130145_131036_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001717881.1|131039_133136_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	28.6	1.6e-29
WP_001717882.1|133132_134344_-	biotin/lipoyl-binding protein	NA	NA	NA	NA	NA
WP_001595165.1|134491_134680_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001282653.1|135482_136238_-	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	43.8	6.2e-45
WP_099492829.1|141231_142845_-|transposase	IS66-like element ISEc23 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.2	2.0e-181
