The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP024245	Escherichia coli O27:H7 strain B4103-1 chromosome, complete genome	4708118	223211	281083	4708118	transposase,protease	Klosneuvirus(11.11%)	59	NA	NA
WP_001162184.1|223211_224564_-|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
WP_000166270.1|224657_225209_+	ribosome-associated protein	NA	NA	NA	NA	NA
WP_001219792.1|225364_226738_-	UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl- meso-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_000853753.1|226913_227912_+	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.7	5.7e-70
WP_000596015.1|227944_228940_-	sugar ABC transporter permease YjfF	NA	NA	NA	NA	NA
WP_001594698.1|228926_229949_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_001594697.1|229962_231465_-	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.3	1.4e-11
WP_000265933.1|231604_232561_-	galactofuranose ABC transporter substrate-binding protein YtfQ	NA	NA	NA	NA	NA
WP_000055070.1|232870_233401_+	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.9	9.4e-56
WP_001219160.1|233780_234122_-	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_032201335.1|234124_237904_-	autotransporter assembly complex protein TamB	NA	NA	NA	NA	NA
WP_001269327.1|237900_239634_-	autotransporter assembly complex protein TamA	NA	NA	NA	NA	NA
WP_001295196.1|239839_240478_+	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_000935042.1|240800_242144_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_000689228.1|242205_242412_-	DUF1107 domain-containing protein	NA	NA	NA	NA	NA
WP_000175289.1|242737_243295_+	YtfJ family protein	NA	NA	NA	NA	NA
WP_000886909.1|243284_244025_-	3'(2'),5'-bisphosphate nucleotidase CysQ	NA	NA	NA	NA	NA
WP_001594696.1|244214_246158_+	2',3'-cyclic-nucleotide 2'-phosphodiesterase	NA	NA	NA	NA	NA
WP_000084622.1|246286_246667_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000560563.1|246755_247616_+	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_001296686.1|247723_248689_+	DMT family transporter	NA	NA	NA	NA	NA
WP_000331456.1|248796_249459_+	iron-sulfur cluster repair protein YtfE	NA	NA	NA	NA	NA
WP_000228346.1|249503_250916_-	D-serine/D-alanine/glycine transporter	NA	NA	NA	NA	NA
WP_000211225.1|251224_251845_-	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_001119478.1|252063_252702_+	cell division protein YtfB	NA	NA	NA	NA	NA
WP_000826425.1|252836_254045_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.0	9.2e-208
WP_000604912.1|254052_254484_+|transposase	IS200/IS605-like element IS609 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	60.6	1.9e-43
WP_001351393.1|255105_255900_+	DUF2686 family protein	NA	NA	NA	NA	NA
WP_001196062.1|255970_256420_-	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_000135199.1|256461_256689_-	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_001296681.1|256693_257008_-	primosomal replication protein N	NA	NA	NA	NA	NA
WP_001216676.1|257014_257410_-	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_000492914.1|257736_258012_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_000996728.1|258086_258638_-	DUF1440 domain-containing protein	NA	NA	NA	NA	NA
WP_001170812.1|258734_259421_-	L-ribulose-5-phosphate 4-epimerase UlaF	NA	NA	NA	NA	NA
WP_000949539.1|259420_260275_-	L-ribulose-5-phosphate 3-epimerase UlaE	NA	NA	NA	NA	NA
WP_000056760.1|260284_260935_-	3-keto-L-gulonate-6-phosphate decarboxylase UlaD	NA	NA	NA	NA	NA
WP_001594695.1|260948_261413_-	PTS ascorbate transporter subunit IIA	NA	NA	NA	NA	NA
WP_001594694.1|261422_261728_-	PTS ascorbate transporter subunit IIB	NA	NA	NA	NA	NA
WP_001300695.1|261743_263141_-	PTS ascorbate transporter subunit IIC	NA	NA	NA	NA	NA
WP_001295191.1|263495_264560_+	L-ascorbate 6-phosphate lactonase	NA	NA	NA	NA	NA
WP_000133631.1|264667_265423_+	HTH-type transcriptional regulator UlaR	NA	NA	NA	NA	NA
WP_000569708.1|265419_266169_-	esterase	NA	NA	NA	NA	NA
WP_000254636.1|266350_266680_+	biofilm peroxide resistance protein BsmA	NA	NA	NA	NA	NA
WP_000811566.1|266828_267104_+|protease	protease activator YjfN	protease	NA	NA	NA	NA
WP_001339483.1|267220_268846_-	isovaleryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_001594693.1|268929_270093_-	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.2	6.4e-81
WP_000101649.1|270095_270734_-	DUF1190 domain-containing protein	NA	NA	NA	NA	NA
WP_000547760.1|270743_271142_-	DUF350 domain-containing protein	NA	NA	NA	NA	NA
WP_000012553.1|271159_271819_-	YjfK family protein	NA	NA	NA	NA	NA
WP_000511955.1|271869_272568_-	PspA/IM30 family protein	NA	NA	NA	NA	NA
WP_000220137.1|272586_272988_-	DUF2170 family protein	NA	NA	NA	NA	NA
WP_001293282.1|273114_273846_-	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_000076316.1|274025_276467_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.1	6.4e-67
WP_001177639.1|276505_276931_-	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_000527955.1|277135_278434_-	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.9	2.2e-66
WP_001089295.1|278537_278735_-	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_001232412.1|278816_279821_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_000312488.1|279823_281083_-|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
>prophage 2
NZ_CP024245	Escherichia coli O27:H7 strain B4103-1 chromosome, complete genome	4708118	871747	879050	4708118		Sodalis_phage(33.33%)	8	NA	NA
WP_000230718.1|871747_872191_+	hypothetical protein	NA	A0A1W6JPI4	Morganella_phage	66.4	4.8e-45
WP_000204054.1|872207_872585_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000072645.1|872588_873071_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A142KB62	Gordonia_phage	43.9	1.5e-28
WP_000560496.1|873983_874373_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001029844.1|874391_876497_-	hypothetical protein	NA	A0A2I7QQN9	Vibrio_phage	37.1	7.2e-91
WP_001555748.1|876496_877918_-	hypothetical protein	NA	B6SCW4	Bacteriophage	53.0	3.7e-123
WP_000909176.1|877917_878595_-	hypothetical protein	NA	Q2A0B2	Sodalis_phage	71.6	7.0e-56
WP_000420674.1|878588_879050_-	DUF2824 family protein	NA	Q2A0B3	Sodalis_phage	72.2	2.9e-61
>prophage 3
NZ_CP024245	Escherichia coli O27:H7 strain B4103-1 chromosome, complete genome	4708118	1866699	1873839	4708118		Escherichia_phage(83.33%)	6	NA	NA
WP_001278994.1|1866699_1867338_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_000590392.1|1867334_1868597_-	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	1.3e-135
WP_000847985.1|1868593_1869502_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_001297141.1|1869697_1870465_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	3.3e-70
WP_001594412.1|1870515_1871172_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	47.9	1.5e-50
WP_001272898.1|1871277_1873839_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.3e-30
>prophage 4
NZ_CP024245	Escherichia coli O27:H7 strain B4103-1 chromosome, complete genome	4708118	2262342	2271690	4708118	integrase	Enterobacteria_phage(45.45%)	13	2255462:2255478	2274944:2274960
2255462:2255478	attL	GGTTGTCGATACCAATA	NA	NA	NA	NA
WP_001163428.1|2262342_2262543_-	response regulator inhibitor TorI	NA	K7P7V0	Enterobacteria_phage	100.0	2.4e-33
WP_001277766.1|2262674_2262854_-	Eag protein	NA	K7PL40	Enterobacteria_phage	96.6	2.8e-28
WP_096842175.1|2263030_2263825_+	replication protein	NA	A0A192Y6S6	Salmonella_phage	99.2	6.4e-141
WP_096842176.1|2263821_2265591_+	AAA family ATPase	NA	A0A0P0ZC27	Stx2-converting_phage	98.9	5.7e-150
WP_071598256.1|2265651_2265858_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085910264.1|2265868_2266237_-	hypothetical protein	NA	I6S5X4	Salmonella_phage	97.5	5.5e-63
WP_058109236.1|2266283_2266469_+	hypothetical protein	NA	I6RSG3	Salmonella_phage	96.7	4.7e-07
WP_001036007.1|2266443_2266653_-	hypothetical protein	NA	I6R975	Salmonella_phage	98.6	5.9e-30
WP_001283827.1|2266649_2266901_-	Arc family DNA-binding protein	NA	A5VW59	Enterobacteria_phage	95.1	1.2e-34
WP_001386205.1|2267006_2267147_+	Arc family DNA-binding protein	NA	A0A0M4S6R9	Salmonella_phage	59.1	4.4e-05
WP_096842177.1|2267143_2267386_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096842178.1|2267449_2268379_+	phage antirepressor Ant	NA	A5VW58	Enterobacteria_phage	90.6	8.5e-161
WP_073991017.1|2270532_2271690_-|integrase	prophage integrase IntS	integrase	A5VW56	Enterobacteria_phage	99.5	6.3e-222
2274944:2274960	attR	GGTTGTCGATACCAATA	NA	NA	NA	NA
>prophage 5
NZ_CP024245	Escherichia coli O27:H7 strain B4103-1 chromosome, complete genome	4708118	2511299	2520741	4708118		Enterobacteria_phage(85.71%)	10	NA	NA
WP_000569313.1|2511299_2512226_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.3	3.1e-22
WP_000783120.1|2512230_2512962_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|2512942_2513050_-	protein YohO	NA	NA	NA	NA	NA
WP_001240401.1|2513109_2513841_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001295431.1|2514062_2515748_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_000598641.1|2515744_2516464_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295430.1|2516510_2516981_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_001295429.1|2517021_2517483_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001317947.1|2517607_2519608_-	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	96.1	0.0e+00
WP_001292774.1|2519604_2520741_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.7	1.1e-162
>prophage 6
NZ_CP024245	Escherichia coli O27:H7 strain B4103-1 chromosome, complete genome	4708118	3079400	3099345	4708118	lysis,integrase	Enterobacteria_phage(28.57%)	25	3077104:3077117	3089469:3089482
3077104:3077117	attL	GCGGCAATCAGCAT	NA	NA	NA	NA
WP_000041556.1|3079400_3081827_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.0	7.7e-214
WP_001307224.1|3082025_3082331_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_001321287.1|3082438_3083149_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001138581.1|3083151_3083712_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_000705211.1|3083746_3084088_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_000598292.1|3084222_3084549_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_001295394.1|3084754_3085969_+	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_000836054.1|3085980_3087000_+	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	26.2	7.4e-17
WP_001594117.1|3087057_3087168_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001594115.1|3087187_3088468_-|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	62.3	1.1e-155
WP_001296941.1|3088502_3088739_-	excisionase family protein	NA	S4TND0	Salmonella_phage	50.7	6.1e-15
WP_099590287.1|3088826_3091304_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	57.2	7.7e-60
3089469:3089482	attR	ATGCTGATTGCCGC	NA	NA	NA	NA
WP_001083273.1|3091397_3091589_-	YebW family protein	NA	NA	NA	NA	NA
WP_000854559.1|3091585_3091774_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_024191391.1|3092260_3092836_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379589.1|3092837_3092993_-	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	51.1	8.8e-07
WP_000381212.1|3093161_3093569_-	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	51.9	7.2e-32
WP_001594109.1|3093649_3093877_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000904112.1|3094998_3095373_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	8.4e-35
WP_000762866.1|3095369_3096191_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	59.0	1.2e-78
WP_029380182.1|3097089_3097218_+	DUF3927 domain-containing protein	NA	H6WZJ7	Escherichia_phage	96.4	4.7e-06
WP_000506936.1|3097584_3098013_+	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
WP_001348108.1|3098184_3098559_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000839561.1|3098810_3099026_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	95.8	5.9e-33
WP_000192454.1|3099030_3099345_+	DUF1327 domain-containing protein	NA	K7PGU6	Enterobacteria_phage	97.1	9.1e-51
>prophage 7
NZ_CP024245	Escherichia coli O27:H7 strain B4103-1 chromosome, complete genome	4708118	3301901	3337521	4708118	tail,integrase,tRNA	Escherichia_phage(80.0%)	44	3299612:3299627	3336682:3336697
3299612:3299627	attL	TCAGAAAAAAGCGCGC	NA	NA	NA	NA
WP_000837924.1|3301901_3303035_+	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	58.8	8.3e-118
WP_001082294.1|3303175_3303610_+	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.0e-28
WP_099590293.1|3304214_3306041_-|tail	phage tail protein	tail	Q8W611	Enterobacteria_phage	98.2	1.9e-55
WP_001594028.1|3306064_3306613_-|tail	tail assembly chaperone	tail	Q8W612	Enterobacteria_phage	96.7	1.2e-98
WP_001594026.1|3306615_3307959_-	hypothetical protein	NA	A0A0U2SAV1	Escherichia_phage	85.6	9.5e-222
WP_001199728.1|3307955_3308582_-	hypothetical protein	NA	A0A0U2RK03	Escherichia_phage	99.5	5.8e-121
WP_001507427.1|3308565_3309195_-	hypothetical protein	NA	A0A0U2RJZ0	Escherichia_phage	100.0	8.4e-112
WP_001700818.1|3309865_3311941_-	hypothetical protein	NA	A0A0U2QV45	Escherichia_phage	42.8	2.1e-127
WP_000703984.1|3312005_3312623_-	hypothetical protein	NA	A0A0U2S634	Escherichia_phage	75.5	2.1e-83
WP_024191384.1|3312619_3313048_-	hypothetical protein	NA	A0A0U2S616	Escherichia_phage	99.3	4.1e-70
WP_001594019.1|3313357_3313510_-	DUF3927 domain-containing protein	NA	NA	NA	NA	NA
WP_074518622.1|3313506_3313743_-	hypothetical protein	NA	Q71TK7	Escherichia_phage	57.7	4.8e-12
WP_001409120.1|3313753_3313951_-	tellurite resistance TerB family protein	NA	Q71TK7	Escherichia_phage	86.5	7.0e-17
WP_001594017.1|3315030_3315573_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	76.8	8.9e-78
WP_001594016.1|3315569_3315860_-	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	85.4	3.1e-45
WP_001594015.1|3315859_3316459_-	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	92.5	7.7e-107
WP_000813254.1|3316925_3317081_-	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_001594014.1|3317637_3318735_+	hypothetical protein	NA	A0A0U2S621	Escherichia_phage	99.7	7.3e-212
WP_001204665.1|3318700_3319273_-	sce7726 family protein	NA	A0A0U2RXY7	Escherichia_phage	100.0	6.5e-103
WP_001353219.1|3319578_3319890_-	hypothetical protein	NA	A0A0U2QV73	Escherichia_phage	97.1	1.8e-59
WP_000004329.1|3319882_3320137_-	hypothetical protein	NA	A0A0U2RK51	Escherichia_phage	94.0	4.8e-42
WP_001151114.1|3320133_3320556_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	89.2	3.1e-62
WP_001594011.1|3320571_3321333_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	90.1	1.7e-119
WP_001409092.1|3321367_3321790_-	phage replication protein P	NA	A0A0U2JGJ0	Escherichia_phage	95.0	1.9e-75
WP_001684845.1|3321821_3322730_-	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	90.1	2.2e-97
WP_000010975.1|3323019_3323271_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000417086.1|3323271_3323568_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001594005.1|3323580_3324003_-	phage protein	NA	A0A0U2RXZ9	Escherichia_phage	94.3	7.7e-69
WP_001072340.1|3323999_3324254_-	hypothetical protein	NA	A0A2I6PIE5	Escherichia_phage	63.0	5.7e-19
WP_000233319.1|3324333_3324753_+	helix-turn-helix domain-containing protein	NA	A0A2I6PIE7	Escherichia_phage	46.5	5.5e-19
WP_001594003.1|3325185_3325338_+	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	55.3	3.5e-08
WP_000560220.1|3325758_3325980_+	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	100.0	6.2e-38
WP_001594002.1|3325973_3326150_+	phage protein	NA	A0A0U2SHB5	Escherichia_phage	87.9	1.5e-23
WP_001594001.1|3326224_3326500_+	phage protein	NA	A0A0U2QW85	Escherichia_phage	96.7	2.3e-42
WP_001593999.1|3326598_3329274_+	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	81.7	0.0e+00
WP_000166322.1|3329266_3330100_+	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	66.8	7.2e-95
WP_072130784.1|3330156_3330351_+	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	92.2	9.3e-30
WP_001302840.1|3330343_3330532_+	DUF1187 family protein	NA	A0A0U2QL97	Escherichia_phage	98.4	5.5e-27
WP_000079604.1|3330631_3330847_+	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_001593997.1|3330848_3332084_+|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	98.5	1.8e-238
WP_001157377.1|3332135_3333071_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	100.0	2.8e-148
WP_000123738.1|3333199_3334573_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_000387388.1|3335050_3336034_-	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_000628065.1|3336288_3337521_+	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
3336682:3336697	attR	GCGCGCTTTTTTCTGA	NA	NA	NA	NA
>prophage 8
NZ_CP024245	Escherichia coli O27:H7 strain B4103-1 chromosome, complete genome	4708118	3540137	3577428	4708118	holin,tail,tRNA	Enterobacteria_phage(28.12%)	50	NA	NA
WP_001297484.1|3540137_3541244_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_001297479.1|3541279_3541921_+	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_000423729.1|3541924_3543295_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	4.2e-108
WP_001265481.1|3543462_3544134_+	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000735412.1|3544133_3545594_+	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_001295435.1|3545669_3546791_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_000359438.1|3546936_3548166_-	peptidase T	NA	NA	NA	NA	NA
WP_000531594.1|3548415_3549552_+	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
WP_000799406.1|3549535_3550399_+	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_001394135.1|3550630_3550897_-|tail	caudovirales tail fiber assembly family protein	tail	K7PMH7	Enterobacteria_phage	81.7	9.2e-20
WP_000239880.1|3550953_3551622_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_071600060.1|3551676_3551775_-|tail	phage tail protein	tail	K7PMH7	Enterobacteria_phage	75.0	3.6e-06
WP_099590296.1|3552069_3553497_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_001161009.1|3554307_3554637_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_001341514.1|3554645_3555032_-|tail	phage minor tail protein G	tail	K7PLV8	Enterobacteria_phage	97.7	5.2e-64
WP_000211132.1|3555092_3555836_-|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	97.2	8.1e-130
WP_000373425.1|3558526_3559021_-	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	100.0	9.9e-84
WP_001595003.1|3559474_3559837_-	hypothetical protein	NA	A5LH85	Enterobacteria_phage	98.3	3.4e-65
WP_001228685.1|3559920_3560106_-	hypothetical protein	NA	A0A0P0ZE50	Stx2-converting_phage	80.3	6.4e-20
WP_157186075.1|3560327_3560465_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001459769.1|3561028_3561562_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	98.3	1.3e-100
WP_097344620.1|3561617_3561932_-	DUF1327 domain-containing protein	NA	K7PGU6	Enterobacteria_phage	98.1	4.1e-51
WP_000839567.1|3561936_3562152_-|holin	holin	holin	M1FN85	Enterobacteria_phage	97.2	6.9e-34
WP_001594995.1|3562964_3563654_-	antitermination protein Q	NA	I6PDF8	Cronobacter_phage	50.2	3.7e-60
WP_001594992.1|3563650_3564010_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	64.9	1.0e-37
WP_024191419.1|3564022_3565072_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	1.1e-108
WP_032159638.1|3565073_3565352_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	47.5	1.4e-10
WP_032159637.1|3565292_3565496_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001594988.1|3565703_3565949_-	DNA polymerase III, theta subunit	NA	Q71T70	Escherichia_phage	72.0	5.9e-21
WP_001594987.1|3566301_3566667_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000089143.1|3566654_3566930_+	hypothetical protein	NA	A0A2P1CKQ3	Pantoea_phage	45.3	1.0e-05
WP_157774460.1|3567024_3567339_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001594984.1|3567695_3568076_-	HNH endonuclease	NA	A0A2R2Z2X9	Escherichia_phage	98.3	5.5e-66
WP_001594983.1|3568077_3568296_-	DUF4014 domain-containing protein	NA	A0A1I9LJM2	Stx_converting_phage	94.4	3.6e-30
WP_001594981.1|3568328_3568541_-	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	91.4	1.5e-33
WP_000403783.1|3568591_3568948_-	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	100.0	4.6e-59
WP_099590311.1|3568925_3569336_-	hypothetical protein	NA	A0A0H4ISY5	Shigella_phage	92.9	9.7e-69
WP_001266136.1|3569382_3569682_-	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	98.0	1.9e-50
WP_001594978.1|3569678_3570101_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	93.6	1.1e-67
WP_001594977.1|3570141_3571089_-	phage replication protein O	NA	U5P0A0	Shigella_phage	57.7	1.9e-83
WP_001394127.1|3571112_3571538_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000747951.1|3571521_3571764_-	hypothetical protein	NA	H9C161	Pectobacterium_phage	55.8	4.8e-07
WP_001397087.1|3572155_3572494_+	peptidase S24-like family protein	NA	H9C160	Pectobacterium_phage	30.7	2.5e-06
WP_000379589.1|3572786_3572942_+	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	51.1	8.8e-07
WP_001171936.1|3573101_3573320_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394538.1|3573342_3573717_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000202162.1|3573706_3573928_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000854559.1|3574486_3574675_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001083273.1|3574671_3574863_+	YebW family protein	NA	NA	NA	NA	NA
WP_099590298.1|3574956_3577428_+	exonuclease	NA	K7PLW7	Enterobacteria_phage	60.3	8.5e-59
>prophage 9
NZ_CP024245	Escherichia coli O27:H7 strain B4103-1 chromosome, complete genome	4708118	4173487	4205373	4708118	transposase,lysis,protease,integrase,tail	Enterobacteria_phage(45.45%)	34	4181968:4182014	4205387:4205433
WP_001594856.1|4173487_4174624_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_000383951.1|4174892_4177130_+	phage adsorption protein NrfB	NA	NA	NA	NA	NA
WP_000662366.1|4177116_4180089_+	phage receptor	NA	NA	NA	NA	NA
WP_001224569.1|4180089_4180980_+	DUF4434 family protein	NA	NA	NA	NA	NA
WP_001177453.1|4181162_4181924_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
4181968:4182014	attL	AATGGCGCGCCCTGCAGGATTCGAACCTGCGGCCCACGACTTAGAAG	NA	NA	NA	NA
WP_001201825.1|4182438_4183392_+|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_001226375.1|4183578_4185063_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001594855.1|4185245_4185551_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	76.5	2.8e-12
WP_000239881.1|4185607_4186276_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000134810.1|4186773_4186956_+	general stress protein	NA	NA	NA	NA	NA
WP_001166090.1|4187034_4187535_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001079482.1|4187571_4188078_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000488336.1|4188096_4188987_+	manganese catalase family protein	NA	NA	NA	NA	NA
WP_001594853.1|4189106_4189688_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.2	2.1e-101
WP_001594850.1|4189687_4191676_-	hypothetical protein	NA	X2KTY7	Enterobacteria_phage	58.0	7.8e-188
WP_001421937.1|4193255_4193450_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	100.0	8.7e-28
WP_001031427.1|4193614_4193821_-	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
WP_000079503.1|4194106_4194517_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	98.5	1.2e-71
WP_000738500.1|4194807_4195101_+	serum resistance lipoprotein Bor	NA	A0A2R2X2B2	Escherichia_phage	97.9	5.7e-47
WP_001228697.1|4195191_4195374_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	78.3	1.4e-16
WP_001135281.1|4195590_4196088_-	lysozyme	NA	M1FJA0	Enterobacteria_phage	98.2	1.1e-90
WP_000670959.1|4196087_4196303_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	98.6	3.4e-33
WP_000737283.1|4196891_4197989_+	porin	NA	Q1MVN1	Enterobacteria_phage	76.3	4.8e-155
WP_001204780.1|4198178_4198562_-	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	84.2	4.0e-56
WP_001358249.1|4198579_4199569_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	97.0	2.4e-190
WP_001061408.1|4199576_4200374_-	KilA-N domain-containing protein	NA	A0A0P0ZCS0	Stx2-converting_phage	99.6	7.5e-150
WP_000767127.1|4200393_4200783_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	99.2	1.6e-68
WP_000210176.1|4200779_4201106_-	LexA family transcriptional regulator	NA	A0A0N7KZF7	Stx2-converting_phage	97.2	2.3e-52
WP_001594845.1|4201836_4202661_+	DUF2303 family protein	NA	U5P439	Shigella_phage	98.5	1.2e-147
WP_000008165.1|4202788_4203325_+	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	98.3	4.8e-100
WP_001242717.1|4203315_4203678_+	phage protein	NA	K7PH61	Enterobacteria_phage	99.1	2.0e-65
WP_000206811.1|4203677_4203983_+	hypothetical protein	NA	U5P0J0	Shigella_phage	96.0	4.9e-49
WP_012599996.1|4203898_4204354_+	helix-turn-helix domain-containing protein	NA	U5P4J3	Shigella_phage	83.3	3.4e-62
WP_001298992.1|4204209_4205373_+|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.6	3.0e-200
4205387:4205433	attR	AATGGCGCGCCCTGCAGGATTCGAACCTGCGGCCCACGACTTAGAAG	NA	NA	NA	NA
>prophage 1
NZ_CP024248	Escherichia coli O27:H7 strain B4103-1 plasmid unnamed3, complete sequence	138289	7615	52711	138289	transposase	Stx2-converting_phage(38.46%)	41	NA	NA
WP_001595195.1|7615_8767_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
WP_157774462.1|9248_9674_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	49.2	2.6e-32
WP_001595191.1|9733_10222_-	helix-turn-helix domain-containing protein	NA	A0A1B1P776	Bacillus_phage	27.3	8.7e-08
WP_001595189.1|11002_11221_+	heat-stable enterotoxin ST-I group a	NA	NA	NA	NA	NA
WP_064754141.1|13868_14198_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085947598.1|14247_15409_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	4.0e-51
WP_071600075.1|15926_16283_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001595179.1|17510_18098_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	59.3	1.0e-50
WP_148717952.1|18015_18822_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	68.3	3.2e-100
WP_099590316.1|18963_20577_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	62.6	1.3e-177
WP_000624720.1|20607_20958_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	6.2e-40
WP_000436083.1|20954_21380_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	78.4	1.7e-36
WP_001464094.1|21925_22276_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	62.1	1.8e-39
WP_001309734.1|22272_22707_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	60.3	1.5e-19
WP_024191431.1|23823_25068_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001309734.1|25853_26288_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	60.3	1.5e-19
WP_001594393.1|26284_26635_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	62.9	1.8e-39
WP_001392052.1|26665_28279_+|transposase	IS66-like element ISEc43 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	60.8	2.0e-170
WP_024191430.1|28523_28739_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000540593.1|29080_29323_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000107524.1|29282_29645_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099590317.1|30129_31665_+|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	40.4	1.1e-99
WP_001282653.1|31681_32437_+	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	43.8	6.2e-45
WP_000775238.1|33189_33351_-	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_000872086.1|33558_33873_-	hypothetical protein	NA	I3UM57	Rhodobacter_phage	39.3	1.5e-13
WP_001719371.1|33869_34544_-	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
WP_001719370.1|34540_34975_-	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
WP_099590318.1|35029_36997_-	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	27.2	6.0e-23
WP_001297827.1|37057_37291_-	DUF905 domain-containing protein	NA	NA	NA	NA	NA
WP_032201449.1|37347_37869_-	single-stranded DNA-binding protein	NA	I3PGW4	Xanthomonas_phage	73.5	2.3e-46
WP_001282653.1|41192_41948_+	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	43.8	6.2e-45
WP_001595165.1|42750_42939_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001595163.1|43086_44298_+	biotin/lipoyl-binding protein	NA	NA	NA	NA	NA
WP_001595162.1|44294_46391_+	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	28.6	1.6e-29
WP_001595161.1|46532_47285_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001595160.1|47424_47844_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	92.8	6.9e-46
WP_001464094.1|47840_48191_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	62.1	1.8e-39
WP_001595158.1|49221_49656_+	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_099492829.1|50294_51908_-|transposase	IS66-like element ISEc23 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.2	2.0e-181
WP_000624720.1|51938_52289_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	6.2e-40
WP_099590319.1|52285_52711_-|transposase	transposase	transposase	Q6H9S5	Enterobacteria_phage	77.3	5.1e-36
