The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	0	6801	4978613	tRNA	Tupanvirus(50.0%)	5	NA	NA
WP_000173200.1|954_2211_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_001130692.1|2424_3048_+	lipoprotein localization protein LolB	NA	NA	NA	NA	NA
WP_001260333.1|3047_3899_+	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
WP_001298109.1|4049_4997_+	ribose-phosphate pyrophosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.8	3.9e-44
WP_001033352.1|5121_6801_+	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	23.6	1.3e-23
>prophage 2
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	33561	35249	4978613		Salmonella_phage(50.0%)	2	NA	NA
WP_000457616.1|33561_34830_-	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	83.4	7.9e-210
WP_000897378.1|34829_35249_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	62.1	6.9e-38
>prophage 3
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	43785	46107	4978613		Escherichia_phage(100.0%)	1	NA	NA
WP_001373188.1|43785_46107_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	43.0	2.3e-90
>prophage 4
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	51974	55703	4978613		Enterobacteria_phage(66.67%)	5	NA	NA
WP_000332303.1|51974_52706_+	DNA-binding transcriptional repressor BluR	NA	Q9EYF2	Enterobacteria_phage	50.5	2.7e-53
WP_000373101.1|52926_53331_+	DUF1398 domain-containing protein	NA	NA	NA	NA	NA
WP_032141808.1|53383_53494_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001307134.1|54026_54350_+	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	65.4	8.0e-42
WP_000444487.1|54452_55703_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
>prophage 5
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	58839	60210	4978613		Bodo_saltans_virus(100.0%)	1	NA	NA
WP_000423719.1|58839_60210_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	1.6e-107
>prophage 6
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	65330	67308	4978613		Mycoplasma_phage(100.0%)	2	NA	NA
WP_000531594.1|65330_66467_+	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
WP_000799401.1|66450_67308_+	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
>prophage 7
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	70584	74307	4978613		Vibrio_phage(50.0%)	4	NA	NA
WP_000952736.1|70584_71406_-	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	35.6	5.6e-23
WP_000291270.1|71421_72333_-	N-acetylglucosamine kinase	NA	NA	NA	NA	NA
WP_001251350.1|72361_73606_-	lipoprotein-releasing ABC transporter permease subunit LolE	NA	NA	NA	NA	NA
WP_001033694.1|73605_74307_-	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	40.3	1.1e-35
>prophage 8
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	81596	81854	4978613		Erwinia_phage(100.0%)	1	NA	NA
WP_000800153.1|81596_81854_-	multiple stress resistance protein BhsA	NA	A0A1B2IFR9	Erwinia_phage	37.1	9.6e-06
>prophage 9
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	94185	95828	4978613		Streptococcus_virus(50.0%)	2	NA	NA
WP_001267931.1|94185_95190_-	DNA polymerase III subunit delta'	NA	A0A1U9WR94	Streptococcus_virus	30.9	8.4e-05
WP_001257000.1|95186_95828_-	dTMP kinase	NA	Q2Z0N0	Pseudomonas_phage	36.9	4.5e-28
>prophage 10
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	99100	100282	4978613		Ralstonia_phage(50.0%)	2	NA	NA
WP_000103754.1|99100_99337_-	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	45.2	1.5e-10
WP_001008535.1|99547_100282_-	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	34.1	1.3e-15
>prophage 11
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	112640	113582	4978613		Brevibacillus_phage(100.0%)	1	NA	NA
WP_001295441.1|112640_113582_-	flagellar assembly peptidoglycan hydrolase FlgJ	NA	S5M633	Brevibacillus_phage	31.3	3.6e-10
>prophage 12
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	129428	129674	4978613		Salmonella_phage(100.0%)	1	NA	NA
WP_001217754.1|129428_129674_+	DNA damage-inducible protein I	NA	H6WRY5	Salmonella_phage	48.7	7.7e-13
>prophage 13
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	134336	135257	4978613		Morganella_phage(100.0%)	1	NA	NA
WP_000183364.1|134336_135257_+	LpxL/LpxP family Kdo(2)-lipid IV(A) lauroyl/palmitoleoyl acyltransferasee	NA	A0A1W6JP29	Morganella_phage	41.5	8.6e-57
>prophage 14
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	144565	145099	4978613		Red_sea_bream_iridovirus(100.0%)	1	NA	NA
WP_000857414.1|144565_145099_-	O-acetyl-ADP-ribose deacetylase	NA	Q71G61	Red_sea_bream_iridovirus	40.2	1.0e-25
>prophage 15
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	149232	150066	4978613		Pelagibacter_phage(100.0%)	1	NA	NA
WP_001189321.1|149232_150066_+	curli production assembly/transport protein CsgG	NA	M1ICK2	Pelagibacter_phage	40.1	5.1e-40
>prophage 16
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	154936	157498	4978613	transposase	Acinetobacter_phage(50.0%)	2	NA	NA
WP_085947771.1|154936_156098_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
WP_001474082.1|156139_157498_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	33.0	1.5e-20
>prophage 17
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	164317	165241	4978613		Cronobacter_phage(100.0%)	1	NA	NA
WP_001307105.1|164317_165241_-	phosphate starvation-inducible protein PhoH	NA	R4II13	Cronobacter_phage	76.7	9.2e-91
>prophage 18
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	180017	182117	4978613		Enterobacteria_phage(100.0%)	3	NA	NA
WP_001028095.1|180017_180512_+	pyrimidine utilization flavin reductase protein F	NA	Q9KX93	Enterobacteria_phage	97.9	5.0e-51
WP_001240629.1|180532_181861_+	pyrimidine utilization transport protein G	NA	Q9KX94	Enterobacteria_phage	98.9	5.3e-233
WP_001273658.1|181943_182117_-	general stress protein	NA	Q9KX95	Enterobacteria_phage	96.3	4.9e-06
>prophage 19
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	186420	198675	4978613		Klosneuvirus(20.0%)	13	NA	NA
WP_000420629.1|186420_187341_+	curved DNA-binding protein	NA	A0A1V0SIM1	Klosneuvirus	43.0	3.2e-11
WP_000024561.1|187340_187646_+	chaperone modulator CbpM	NA	NA	NA	NA	NA
WP_000209854.1|187738_188338_-	molecular chaperone TorD	NA	NA	NA	NA	NA
WP_001062102.1|188334_190881_-	trimethylamine-N-oxide reductase TorA	NA	A0A077SK27	Escherichia_phage	29.2	5.9e-71
WP_001230242.1|190880_192053_-	pentaheme c-type cytochrome TorC	NA	NA	NA	NA	NA
WP_001120112.1|192182_192875_+	two-component system response regulator TorR	NA	W8CYM9	Bacillus_phage	28.0	4.5e-18
WP_001264933.1|192847_193876_-	TMAO reductase system periplasmic protein TorT	NA	NA	NA	NA	NA
WP_001367057.1|193958_196703_+	TMAO reductase system sensor histidine kinase/response regulator TorS	NA	A0A1V0SGX0	Hokovirus	31.9	1.0e-36
WP_000829672.1|196774_197848_+	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_001019197.1|197895_198069_-	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_001315395.1|198058_198289_-	protein YmcE	NA	NA	NA	NA	NA
WP_071528578.1|198263_198452_-	cold-shock protein	NA	NA	NA	NA	NA
WP_000066490.1|198462_198675_-	cold shock protein CspG	NA	A0A1W6JNX5	Morganella_phage	71.4	7.8e-22
>prophage 20
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	217940	218600	4978613	protease	uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000375136.1|217940_218600_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	4.0e-48
>prophage 21
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	222833	224888	4978613		Bacillus_phage(100.0%)	1	NA	NA
WP_001315388.1|222833_224888_-	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.9	7.7e-21
>prophage 22
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	237498	239406	4978613		Tupanvirus(100.0%)	1	NA	NA
WP_000053120.1|237498_239406_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.5	3.2e-53
>prophage 23
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	255328	266461	4978613	tRNA	Bacillus_virus(20.0%)	8	NA	NA
WP_001090514.1|255328_256096_+	aliphatic sulfonates ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.6	1.7e-29
WP_000193844.1|256302_258915_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.8	7.0e-19
WP_001297200.1|259180_260383_+	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000117881.1|260551_261952_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	36.1	5.3e-82
WP_000977920.1|262553_263642_+	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	54.3	1.8e-98
WP_000462687.1|263826_265017_+	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_001109487.1|265238_265886_-	hydroxyacylglutathione hydrolase GloC	NA	NA	NA	NA	NA
WP_001295932.1|265912_266461_-	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	7.0e-06
>prophage 24
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	281166	285707	4978613		Bacillus_phage(100.0%)	3	NA	NA
WP_000551270.1|281166_282915_-	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	29.8	2.5e-57
WP_000705706.1|282951_285216_-	ComEC family protein	NA	NA	NA	NA	NA
WP_000167336.1|285422_285707_-	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	3.2e-10
>prophage 25
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	290793	291882	4978613		Streptococcus_phage(100.0%)	1	NA	NA
WP_000057149.1|290793_291882_-	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	46.8	3.5e-81
>prophage 26
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	295980	299195	4978613		Tetraselmis_virus(100.0%)	2	NA	NA
WP_001292822.1|295980_298263_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.5	1.0e-162
WP_000111043.1|298454_299195_+	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.5	8.0e-21
>prophage 27
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	305504	329302	4978613	protease,tRNA	Escherichia_phage(16.67%)	16	NA	NA
WP_000213098.1|305504_306122_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	60.6	5.0e-77
WP_000850317.1|306132_308577_-	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.7	1.1e-220
WP_000886683.1|308815_310108_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
WP_000067755.1|310198_311542_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.8	2.1e-80
WP_001295343.1|311552_312164_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_000077063.1|312318_316425_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
WP_000228473.1|316559_317054_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_000537418.1|317598_318564_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	8.5e-63
WP_001043587.1|318686_320453_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.3	4.1e-23
WP_001202188.1|320453_322175_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	25.2	1.9e-20
WP_001241678.1|322216_322921_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|323205_323424_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_000934041.1|324108_326385_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
WP_000520781.1|326415_326736_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_000410785.1|327058_327283_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
WP_000188180.1|327355_329302_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.1	1.1e-37
>prophage 28
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	338599	340318	4978613		Yellowstone_lake_phycodnavirus(100.0%)	1	NA	NA
WP_000815350.1|338599_340318_+	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.1	4.0e-31
>prophage 29
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	343905	346643	4978613		Roseobacter_phage(50.0%)	4	NA	NA
WP_001255144.1|343905_344736_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	30.0	5.7e-07
WP_001160737.1|344732_345056_-	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001270740.1|345181_345697_+	lipoprotein	NA	NA	NA	NA	NA
WP_000027205.1|345914_346643_+	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.7	6.0e-29
>prophage 30
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	349980	359131	4978613		Streptococcus_phage(25.0%)	11	NA	NA
WP_001149733.1|349980_351108_-	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	27.6	3.5e-28
WP_000389260.1|351148_351637_-	YbjO family protein	NA	NA	NA	NA	NA
WP_001061657.1|351696_352542_-	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_000105430.1|352538_353492_-	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_000996025.1|353501_354635_-	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.4	5.0e-30
WP_000126072.1|354729_355842_-	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_000203025.1|356193_356670_-	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_000684321.1|356757_357660_-	30S ribosomal protein S6--L-glutamate ligase	NA	I3ULC9	Synechococcus_phage	34.4	2.6e-37
WP_000189159.1|357720_358443_-	nitroreductase NfsA	NA	NA	NA	NA	NA
WP_001201560.1|358426_358714_-	DUF1418 family protein	NA	NA	NA	NA	NA
WP_001195240.1|358873_359131_+	glutaredoxin 1	NA	A0A2I7SAE2	Vibrio_phage	61.9	8.6e-23
>prophage 31
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	367697	368900	4978613		Stx2-converting_phage(100.0%)	1	NA	NA
WP_000195961.1|367697_368900_-	serine-type D-Ala-D-Ala carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	48.0	8.2e-100
>prophage 32
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	380234	382106	4978613		Planktothrix_phage(100.0%)	1	NA	NA
WP_001315369.1|380234_382106_-	glutathione ABC transporter ATP-binding protein GsiA	NA	G9BWD6	Planktothrix_phage	29.7	4.0e-16
>prophage 33
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	385424	490242	4978613	transposase,lysis,integrase,portal,terminase,capsid,head,tail	Enterobacteria_phage(40.85%)	118	418472:418507	491676:491711
WP_000424889.1|385424_386087_-	fructose-6-phosphate aldolase	NA	C7BV14	Synechococcus_phage	32.7	1.6e-25
WP_001295295.1|386217_387117_+	glycyl-radical enzyme activating protein	NA	NA	NA	NA	NA
WP_000209359.1|387122_389555_+	glycyl radical protein	NA	A0A076YHZ7	Citrobacter_phage	43.5	6.1e-09
WP_000114244.1|389700_390516_+	sugar-phosphatase YbiV	NA	NA	NA	NA	NA
WP_000168779.1|390667_391933_+	DUF1479 domain-containing protein	NA	NA	NA	NA	NA
WP_000399648.1|392193_393174_-|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
WP_000961458.1|393452_395045_-	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.7	6.9e-62
WP_001056384.1|395263_396184_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000056415.1|396242_397361_-	anion transporter	NA	NA	NA	NA	NA
WP_000091016.1|397357_397825_-	manganese-binding transcriptional regulator MntR	NA	NA	NA	NA	NA
WP_001001761.1|398010_398139_+	manganase accumulation protein MntS	NA	NA	NA	NA	NA
WP_001054662.1|398410_399994_+	phosphoethanolamine transferase	NA	NA	NA	NA	NA
WP_001295296.1|400042_400558_-	outer membrane protein OmpX	NA	H6WZM8	Escherichia_phage	33.8	1.1e-16
WP_120795379.1|400610_400676_-	protein YliM	NA	NA	NA	NA	NA
WP_001315365.1|400910_401798_+	threonine/homoserine exporter RhtA	NA	NA	NA	NA	NA
WP_000100800.1|402096_402600_+	DNA starvation/stationary phase protection protein Dps	NA	A0A222YYG6	Streptomyces_phage	29.0	4.9e-06
WP_000843866.1|403003_403750_+	glutamine ABC transporter substrate-binding protein GlnH	NA	NA	NA	NA	NA
WP_001159065.1|403888_404548_+	glutamine ABC transporter permease GlnP	NA	NA	NA	NA	NA
WP_000569080.1|404544_405267_+	glutamine ABC transporter ATP-binding protein GlnQ	NA	G9BWD6	Planktothrix_phage	41.8	2.5e-35
WP_001267250.1|405383_407606_+	mechanosensitive channel protein	NA	NA	NA	NA	NA
WP_000526040.1|407602_408610_-	23S rRNA (adenine(1618)-N(6))-methyltransferase RlmF	NA	NA	NA	NA	NA
WP_000710619.1|408804_409065_+	DUF1471 domain-containing protein	NA	A0A1B2ICL8	Erwinia_phage	51.0	1.6e-05
WP_000430045.1|409328_411611_+	catecholate siderophore receptor Fiu	NA	NA	NA	NA	NA
WP_000990177.1|411652_412330_+	PKHD-type hydroxylase YbiX	NA	Q5GQB0	Synechococcus_phage	30.1	1.2e-18
WP_000146369.1|412403_412670_+	C4-type zinc finger protein YbiI	NA	E5G6L7	Salmonella_phage	45.6	6.9e-07
WP_000849301.1|412934_413195_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_000443512.1|413422_414508_-	malate/lactate/ureidoglycolate dehydrogenase	NA	NA	NA	NA	NA
WP_000386551.1|414648_415611_-	DNA-binding protein YbiB	NA	NA	NA	NA	NA
WP_001307069.1|415638_417789_-	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	26.3	5.7e-43
WP_001145128.1|417908_418391_+	N-glycosidase YbiA	NA	A0A0H3TLU0	Faustovirus	52.7	1.5e-36
418472:418507	attL	TGCCGGATGCGGCGTAAACGCCTTATCCGGCCTACA	NA	NA	NA	NA
WP_000007102.1|418622_419987_-	ATP-dependent RNA helicase RhlE	NA	A0A1V0SBR7	Catovirus	31.8	1.5e-52
WP_001315358.1|420215_420887_+	DNA-binding transcriptional regulator CecR	NA	NA	NA	NA	NA
WP_000743444.1|420889_421885_+	secretion protein HlyD	NA	NA	NA	NA	NA
WP_000996092.1|421877_423614_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	29.8	2.3e-18
WP_000070131.1|423606_424740_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000469031.1|424750_425857_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000871982.1|425818_426229_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001113351.1|426361_427123_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000650337.1|427119_428361_+	cardiolipin synthase ClsB	NA	NA	NA	NA	NA
WP_000045448.1|428360_429317_+	UPF0104 family protein	NA	NA	NA	NA	NA
WP_001088641.1|429352_430066_-	Bax inhibitor-1/YccA family protein	NA	NA	NA	NA	NA
WP_001331162.1|430135_430783_-	membrane protein	NA	NA	NA	NA	NA
WP_000373624.1|430984_431689_-	Bax inhibitor-1/YccA family protein	NA	NA	NA	NA	NA
WP_000852287.1|431825_432278_-	molybdopterin synthase catalytic subunit MoaE	NA	NA	NA	NA	NA
WP_000598619.1|432279_432525_-	molybdopterin synthase sulfur carrier subunit	NA	NA	NA	NA	NA
WP_000080885.1|432517_433003_-	cyclic pyranopterin monophosphate synthase MoaC	NA	NA	NA	NA	NA
WP_000084639.1|433005_433518_-	molybdenum cofactor biosynthesis protein B	NA	NA	NA	NA	NA
WP_001315357.1|433539_434529_-	GTP 3',8-cyclase MoaA	NA	NA	NA	NA	NA
WP_001295302.1|434925_435834_+	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	31.1	1.4e-27
WP_000042533.1|436025_438047_-	excinuclease ABC subunit B	NA	NA	NA	NA	NA
WP_000044882.1|438625_439303_-	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_000246805.1|439295_440051_-	malonyl-ACP O-methyltransferase BioC	NA	NA	NA	NA	NA
WP_000118822.1|440037_441192_-	8-amino-7-oxononanoate synthase	NA	NA	NA	NA	NA
WP_000951213.1|441188_442229_-	biotin synthase BioB	NA	NA	NA	NA	NA
WP_001367048.1|442315_443605_+	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	29.0	1.0e-18
WP_000767389.1|443663_444140_+	kinase inhibitor	NA	NA	NA	NA	NA
WP_016245831.1|444885_446217_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	37.1	1.4e-20
WP_001657981.1|446290_446875_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.3	1.1e-102
WP_072006352.1|446874_449835_-	hypothetical protein	NA	A0A0K2FIZ6	Escherichia_phage	53.7	4.0e-55
WP_032197816.1|449899_450499_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	98.0	1.1e-108
WP_099588335.1|450569_454067_-	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	97.9	0.0e+00
WP_000090891.1|454126_454759_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.5	2.2e-96
WP_000194780.1|454695_455439_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.8	2.5e-147
WP_085453437.1|455444_456143_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.7	1.6e-132
WP_000847345.1|456142_456472_-|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	98.2	8.1e-58
WP_097497322.1|456468_459048_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	95.8	0.0e+00
WP_000459457.1|459040_459475_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000479135.1|459456_459879_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	97.1	2.4e-70
WP_001543784.1|459894_460635_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	97.2	5.2e-129
WP_099588336.1|460642_461038_-|tail	phage tail protein	tail	A0A2R9YJI2	Escherichia_phage	98.5	1.9e-69
WP_000975081.1|461034_461613_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.5	5.9e-80
WP_000785282.1|461624_461978_-|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	97.4	6.4e-61
WP_000158875.1|461989_462385_-	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	95.5	1.1e-58
WP_000063254.1|462426_463452_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.2	2.8e-189
WP_032198469.1|463507_463840_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	97.3	4.2e-54
WP_032198468.1|463849_465169_-	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	98.9	2.1e-234
WP_001345555.1|465149_466751_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.4	1.3e-310
WP_000198149.1|466747_466954_-|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_001027267.1|466950_468876_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.5	0.0e+00
WP_000453587.1|468850_469396_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.9	1.4e-94
WP_001307652.1|469784_469979_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	96.8	9.7e-27
WP_000738423.1|470340_470634_+	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	91.8	2.0e-44
WP_077628513.1|470724_470907_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	96.7	2.5e-16
WP_001135274.1|471123_471621_-	lysozyme	NA	M1FJA0	Enterobacteria_phage	97.0	3.2e-90
WP_000839596.1|471620_471836_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_000737275.1|472425_473508_+	porin OmpD	NA	Q1MVN1	Enterobacteria_phage	76.3	8.9e-154
WP_001204791.1|473696_474080_-	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	83.3	4.4e-55
WP_000971074.1|474165_474306_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	6.5e-09
WP_001099712.1|474302_474665_-	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
WP_000774504.1|474661_474952_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	92.7	2.8e-46
WP_000224914.1|474944_475115_-	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	69.8	2.4e-13
WP_032197919.1|475114_475570_-	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	68.2	2.8e-61
WP_072146437.1|475566_475668_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000990013.1|475764_476274_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000338663.1|476592_476832_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000709099.1|476943_478470_-	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	27.5	1.0e-30
WP_001348591.1|478527_478677_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001070442.1|478725_479058_-	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_000145901.1|479125_479428_-	protein ren	NA	M1FPD5	Enterobacteria_phage	97.8	6.1e-44
WP_032197920.1|479424_480126_-	Replication protein P	NA	M1FJ72	Enterobacteria_phage	97.0	3.9e-126
WP_032197923.1|480122_481052_-	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	64.4	1.2e-111
WP_001182878.1|481138_481678_-	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	66.1	1.2e-61
WP_000184665.1|481708_481936_-	helix-turn-helix domain-containing protein	NA	Q76H55	Enterobacteria_phage	69.0	3.8e-22
WP_000712396.1|482046_482739_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	85.3	2.5e-109
WP_000380252.1|482819_483881_+	hypothetical protein	NA	Q6SE88	Lactobacillus_prophage	42.0	2.9e-64
WP_000866321.1|483858_484236_+	ASCH domain-containing protein	NA	Q6SE87	Lactobacillus_prophage	49.2	1.3e-30
WP_000233576.1|484711_484918_+	phage encoded cell division inhibitor protein	NA	K7P6H3	Enterobacteria_phage	85.3	3.2e-28
WP_000995419.1|484993_485290_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	98.0	6.8e-48
WP_000100847.1|485295_486081_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_032198488.1|486077_486758_+	YqaJ viral recombinase family protein	NA	A0A0N6WET1	Escherichia_phage	99.6	4.6e-132
WP_000682311.1|486754_486937_+	DUF1317 domain-containing protein	NA	A0A0P0ZD61	Stx2-converting_phage	96.7	1.4e-27
WP_000548531.1|486909_487101_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	100.0	7.3e-27
WP_001360114.1|487111_487393_+	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	98.9	5.5e-47
WP_000763367.1|487491_487713_+	TraR/DksA family transcriptional regulator	NA	A0A0K2FI84	Escherichia_phage	100.0	2.9e-35
WP_001348592.1|487923_488526_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000545745.1|488768_488936_+	hypothetical protein	NA	A5VWB7	Enterobacteria_phage	98.2	2.9e-27
WP_001303849.1|488975_489194_+	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_000533643.1|489171_490242_+|integrase	tyrosine-type recombinase/integrase	integrase	K7P6P6	Enterobacteria_phage	100.0	3.9e-202
491676:491711	attR	TGCCGGATGCGGCGTAAACGCCTTATCCGGCCTACA	NA	NA	NA	NA
>prophage 34
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	499953	506527	4978613		Planktothrix_phage(33.33%)	7	NA	NA
WP_000891683.1|499953_501012_-	molybdenum ABC transporter ATP-binding protein ModC	NA	G9BWD6	Planktothrix_phage	35.7	2.6e-20
WP_000604034.1|501014_501704_-	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_000101990.1|501703_502477_-	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000891515.1|502643_502793_-	multidrug efflux pump accessory protein AcrZ	NA	NA	NA	NA	NA
WP_001147439.1|502921_503710_+	molybdenum-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_000096881.1|503777_505250_+	molybdate ABC transporter ATP-binding protein ModF	NA	A0A1M7XV31	Cedratvirus	28.3	4.2e-13
WP_001265438.1|505510_506527_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	46.0	6.1e-80
>prophage 35
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	510883	514403	4978613		Klebsiella_phage(33.33%)	4	NA	NA
WP_001109196.1|510883_511936_-	3-deoxy-7-phosphoheptulonate synthase AroG	NA	A0A2I6UFP9	Klebsiella_phage	49.4	3.4e-81
WP_000784351.1|512251_512632_+	periplasmic protein	NA	NA	NA	NA	NA
WP_000951292.1|512745_513687_+	CDF family zinc transporter ZitB	NA	A0A1V0SED0	Indivirus	28.2	2.2e-23
WP_000345410.1|513683_514403_-	nicotinamide riboside transporter PnuC	NA	A0A126HGA3	Vibrio_phage	32.7	9.2e-22
>prophage 36
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	550443	551235	4978613		Kaumoebavirus(100.0%)	1	NA	NA
WP_001114025.1|550443_551235_-	endonuclease VIII	NA	A0A1V0CNR6	Kaumoebavirus	28.8	3.7e-08
>prophage 37
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	554613	557555	4978613		Acinetobacter_phage(50.0%)	2	NA	NA
WP_001032694.1|554613_556095_+	dipeptide permease DtpD	NA	A0A0P0IY73	Acinetobacter_phage	28.2	2.5e-45
WP_000207157.1|556136_557555_-	deoxyribodipyrimidine photo-lyase	NA	A0A1V0SGL1	Hokovirus	32.0	3.1e-61
>prophage 38
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	562018	574739	4978613		uncultured_Caudovirales_phage(25.0%)	8	NA	NA
WP_000015095.1|562018_566212_-	RHS repeat protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	32.9	2.5e-26
WP_000424924.1|566454_566661_-	YbfA family protein	NA	NA	NA	NA	NA
WP_001272653.1|566973_567063_+	K(+)-transporting ATPase subunit F	NA	NA	NA	NA	NA
WP_000741137.1|567062_568736_+	potassium-transporting ATPase subunit KdpA	NA	NA	NA	NA	NA
WP_000087972.1|568758_570807_+	potassium-transporting ATPase subunit KdpB	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	22.8	9.3e-27
WP_001297248.1|570815_571388_+	K(+)-transporting ATPase subunit C	NA	NA	NA	NA	NA
WP_001306984.1|571380_574065_+	two-component system sensor histidine kinase KdbD	NA	A0A1V0SGX0	Hokovirus	26.5	1.4e-11
WP_000186103.1|574061_574739_+	two-component system response regulator KdpE	NA	W8CYM9	Bacillus_phage	31.1	8.9e-27
>prophage 39
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	581394	582159	4978613		Mycobacterium_phage(100.0%)	1	NA	NA
WP_000773301.1|581394_582159_+	esterase	NA	A0A1J0GVH7	Mycobacterium_phage	35.4	4.4e-06
>prophage 40
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	586308	590122	4978613	tRNA	Escherichia_phage(50.0%)	2	NA	NA
WP_001287154.1|586308_587973_-|tRNA	glutamine--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	99.1	0.0e+00
WP_001023134.1|588175_590122_-	PTS N-acetyl glucosamine transporter subunit IIABC	NA	A0A2I7SAJ6	Vibrio_phage	47.3	1.6e-07
>prophage 41
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	594748	596413	4978613		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_000337088.1|594748_596413_+	asparagine synthase B	NA	A9YVS6	Ostreococcus_tauri_virus	39.1	1.4e-84
>prophage 42
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	600509	601589	4978613		Pseudomonas_phage(100.0%)	1	NA	NA
WP_000490838.1|600509_601589_+	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	46.6	4.3e-47
>prophage 43
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	609485	613018	4978613		Planktothrix_phage(50.0%)	3	NA	NA
WP_000631384.1|609485_610211_+	glutamate/aspartate ABC transporter ATP binding protein GltL	NA	G9BWD6	Planktothrix_phage	38.6	7.6e-32
WP_001207519.1|610328_611264_+	pyrimidine-specific ribonucleoside hydrolase RihA	NA	NA	NA	NA	NA
WP_000367891.1|611347_613018_+	molecular chaperone HscC	NA	E5EQT9	Bathycoccus_sp._RCC1105_virus	35.7	1.8e-76
>prophage 44
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	619956	622539	4978613	tRNA	Staphylococcus_phage(100.0%)	1	NA	NA
WP_001157890.1|619956_622539_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	42.3	5.2e-184
>prophage 45
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	629549	631989	4978613		Synechococcus_phage(50.0%)	2	NA	NA
WP_001231415.1|629549_630638_+	endolytic peptidoglycan transglycosylase RlpA	NA	F5B3X9	Synechococcus_phage	53.2	3.6e-09
WP_001092082.1|630777_631989_+	D-alanyl-D-alanine carboxypeptidase DacA	NA	B6DZZ7	Stx2-converting_phage	47.4	1.2e-101
>prophage 46
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	636804	637451	4978613		uncultured_Caudovirales_phage(50.0%)	2	NA	NA
WP_000939738.1|636804_637188_+	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	53.6	6.8e-24
WP_000034825.1|637241_637451_-	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	2.7e-22
>prophage 47
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	652875	654990	4978613		Morganella_phage(50.0%)	2	NA	NA
WP_000278505.1|652875_653304_+	universal stress protein UspG	NA	A0A1W6JNV4	Morganella_phage	39.2	1.1e-19
WP_000887629.1|653424_654990_-	alkyl hydroperoxide reductase subunit F	NA	G3MA85	Bacillus_virus	34.3	2.2e-44
>prophage 48
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	658057	659880	4978613		Streptococcus_phage(50.0%)	2	NA	NA
WP_000029802.1|658057_659278_+	phosphoadenosine phosphosulfate reductase	NA	A0A220GKF8	Streptococcus_phage	33.0	1.2e-58
WP_000502941.1|659250_659880_+	ParB-like nuclease domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	52.8	2.9e-56
>prophage 49
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	674426	680469	4978613		Klosneuvirus(50.0%)	3	NA	NA
WP_000140647.1|674426_675242_+	iron-enterobactin ABC transporter ATP-binding protein	NA	A0A1V0SJ29	Klosneuvirus	22.0	7.3e-07
WP_000096702.1|675238_676372_-	LPS O-antigen length regulator	NA	NA	NA	NA	NA
WP_000077727.1|676587_680469_-	enterobactin non-ribosomal peptide synthetase EntF	NA	A0A2K9KZV5	Tupanvirus	29.4	3.8e-61
>prophage 50
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	691394	694538	4978613		Leptospira_phage(100.0%)	1	NA	NA
WP_000573957.1|691394_694538_-	Cu(+)/Ag(+) efflux RND transporter permease subunit CusA	NA	S5VTK5	Leptospira_phage	22.4	2.9e-59
>prophage 51
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	697683	707813	4978613		Bacillus_phage(33.33%)	6	NA	NA
WP_000770941.1|697683_698367_+	copper response regulator transcription factor CusR	NA	W8CYM9	Bacillus_phage	34.7	2.3e-30
WP_000253830.1|698356_699805_+	Cu(+)/Ag(+) sensor histidine kinase CusS	NA	NA	NA	NA	NA
WP_000103243.1|700541_702443_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	26.3	1.7e-27
WP_001160804.1|702470_702932_+	DcrB-related protein	NA	NA	NA	NA	NA
WP_099588338.1|702951_703185_+	type IV secretion protein Rhs	NA	NA	NA	NA	NA
WP_099588452.1|703211_707813_+	type IV secretion protein Rhs	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	32.0	6.5e-20
>prophage 52
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	724147	727278	4978613	tRNA	Enterococcus_phage(50.0%)	4	NA	NA
WP_000729154.1|724147_725014_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
WP_000190288.1|725015_725228_+	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_001143552.1|725335_725857_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000912345.1|725892_727278_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.9e-45
>prophage 53
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	738698	739844	4978613		Streptococcus_phage(100.0%)	1	NA	NA
WP_001315307.1|738698_739844_-	glycerate 3-kinase	NA	W6LM47	Streptococcus_phage	41.9	1.1e-48
>prophage 54
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	746034	747816	4978613		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_001096881.1|746034_747816_-	glyoxylate carboligase	NA	E4WLQ6	Ostreococcus_tauri_virus	27.0	3.5e-38
>prophage 55
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	754723	755410	4978613		Planktothrix_phage(100.0%)	1	NA	NA
WP_001110579.1|754723_755410_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.6	1.7e-33
>prophage 56
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	758546	759224	4978613		Bacillus_virus(100.0%)	1	NA	NA
WP_001157535.1|758546_759224_-	iron ABC transporter ATP-binding protein FetA	NA	G3M9Y6	Bacillus_virus	34.3	2.4e-27
>prophage 57
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	763763	766723	4978613		uncultured_virus(50.0%)	2	NA	NA
WP_000078268.1|763763_766268_+	copper-exporting P-type ATPase CopA	NA	A0A218MNH6	uncultured_virus	38.2	3.8e-115
WP_001344274.1|766381_766723_-	HigA family addiction module antidote protein	NA	A0A222YWD7	Escherichia_phage	74.5	1.8e-39
>prophage 58
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	774917	783479	4978613		Acanthamoeba_polyphaga_moumouvirus(25.0%)	8	NA	NA
WP_000801832.1|774917_775877_+	acetyl esterase	NA	L7RDF8	Acanthamoeba_polyphaga_moumouvirus	24.3	1.1e-14
WP_001250088.1|775873_776836_-	ferrochelatase	NA	NA	NA	NA	NA
WP_001220233.1|777071_777716_-	adenylate kinase	NA	NA	NA	NA	NA
WP_000678208.1|777896_779771_-	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	38.0	1.0e-117
WP_001195025.1|779880_780486_-	recombination protein RecR	NA	NA	NA	NA	NA
WP_000467098.1|780485_780815_-	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_000122008.1|780867_782799_-	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	41.5	5.1e-43
WP_000127356.1|782927_783479_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	47.3	3.7e-31
>prophage 59
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	790487	793637	4978613		Leptospira_phage(100.0%)	1	NA	NA
WP_001132469.1|790487_793637_+	multidrug efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	23.9	6.2e-54
>prophage 60
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	802472	806019	4978613		Bacillus_phage(100.0%)	2	NA	NA
WP_001256174.1|802472_804254_-	SmdB family multidrug efflux ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.1	1.4e-42
WP_001235609.1|804246_806019_-	SmdA family multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.1	2.6e-49
>prophage 61
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	809342	810038	4978613		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000817229.1|809342_810038_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	68.0	1.9e-88
>prophage 62
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	813166	818213	4978613	protease	Bacillus_phage(25.0%)	4	NA	NA
WP_001043542.1|813166_813439_-	DNA-binding protein HU-beta	NA	A7KV42	Bacillus_phage	58.4	1.1e-20
WP_001295325.1|813647_816002_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.4	1.6e-224
WP_000130305.1|816189_817464_-|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	56.4	8.7e-132
WP_000122253.1|817589_818213_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	63.9	2.9e-64
>prophage 63
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	842044	851025	4978613	tRNA	uncultured_Mediterranean_phage(60.0%)	10	NA	NA
WP_001021161.1|842044_842515_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	47.4	1.3e-29
WP_001150472.1|842603_843707_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	35.5	5.3e-53
WP_000543535.1|843710_844160_-	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_001297136.1|844310_844850_+	DUF3251 domain-containing protein	NA	NA	NA	NA	NA
WP_001295328.1|845148_846033_+	nucleoside-specific channel-forming protein Tsx	NA	NA	NA	NA	NA
WP_000974813.1|846209_846557_-	HNH nuclease family protein	NA	NA	NA	NA	NA
WP_000046637.1|846685_847657_-	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	37.9	1.0e-44
WP_000934822.1|847667_849515_-	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_000007629.1|849542_849875_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	33.0	2.8e-10
WP_000667319.1|849897_851025_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	46.1	2.1e-89
>prophage 64
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	857977	867949	4978613		Bacillus_phage(60.0%)	7	NA	NA
WP_000893578.1|857977_859273_-	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	30.8	1.3e-26
WP_000113933.1|859330_860020_-	phosphate response regulator transcription factor PhoB	NA	W8CYM9	Bacillus_phage	38.0	4.4e-37
WP_001221319.1|860209_861412_+	exonuclease subunit SbcD	NA	R4JGS2	Bacillus_phage	32.4	2.4e-06
WP_000698839.1|861408_864552_+	exonuclease subunit SbcC	NA	G3MAB6	Bacillus_virus	26.9	5.8e-12
WP_001306939.1|864677_865862_+	MFS transporter AraJ	NA	NA	NA	NA	NA
WP_001219320.1|866004_866913_-	fructokinase	NA	NA	NA	NA	NA
WP_001298537.1|867037_867949_+	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	63.6	2.7e-103
>prophage 65
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	872292	873408	4978613		Bacillus_phage(100.0%)	1	NA	NA
WP_000484055.1|872292_873408_-	diguanylate cyclase AdrA	NA	A0A127AWB9	Bacillus_phage	34.5	1.5e-18
>prophage 66
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	880823	885599	4978613	transposase	uncultured_Caudovirales_phage(50.0%)	3	NA	NA
WP_000830741.1|880823_881981_+	OXA-12 family class D beta-lactamase AmpH	NA	A0A2H4JAN9	uncultured_Caudovirales_phage	22.1	5.1e-06
WP_001295817.1|881981_882605_-	hydrogen peroxide resistance inhibitor IprA	NA	NA	NA	NA	NA
WP_085947771.1|884437_885599_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
>prophage 67
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	890135	890903	4978613		Planktothrix_phage(100.0%)	1	NA	NA
WP_000939395.1|890135_890903_-	taurine ABC transporter ATP-binding subunit	NA	G9BWD6	Planktothrix_phage	40.9	3.8e-26
>prophage 68
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	896199	897309	4978613		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_000842102.1|896199_897309_+	S-(hydroxymethyl)glutathione dehydrogenase	NA	A0A0K0KVL7	Prochlorococcus_phage	28.6	1.2e-31
>prophage 69
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	900387	902348	4978613		Micromonas_sp._RCC1109_virus(50.0%)	2	NA	NA
WP_001013499.1|900387_901401_-	4-hydroxy-2-oxovalerate aldolase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	31.1	1.2e-43
WP_000044314.1|901397_902348_-	acetaldehyde dehydrogenase	NA	G9E526	Ostreococcus_lucimarinus_virus	35.2	8.7e-36
>prophage 70
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	907759	912039	4978613		Enterobacteria_phage(50.0%)	2	NA	NA
WP_000805902.1|907759_908842_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	100.0	7.5e-193
WP_001475036.1|908964_912039_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	98.7	0.0e+00
>prophage 71
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	916580	922175	4978613		Lactobacillus_phage(50.0%)	4	NA	NA
WP_000952482.1|916580_917480_+	transcriptional regulator CynR	NA	A0A2P0ZL89	Lactobacillus_phage	27.3	3.2e-16
WP_001299008.1|917519_918803_-	cytosine deaminase	NA	NA	NA	NA	NA
WP_000076236.1|918792_920052_-	cytosine permease	NA	NA	NA	NA	NA
WP_000010276.1|920288_922175_-	propionate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	29.4	9.1e-53
>prophage 72
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	930555	935093	4978613		Acanthamoeba_polyphaga_mimivirus(50.0%)	4	NA	NA
WP_000692742.1|930555_931605_-	NADPH-dependent aldehyde reductase YahK	NA	A0A0G2YAX3	Acanthamoeba_polyphaga_mimivirus	42.3	1.1e-71
WP_000750340.1|931691_932648_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000818900.1|932644_933616_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000447335.1|933608_935093_-	sugar ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.7	8.0e-12
>prophage 73
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	947087	1055603	4978613	transposase,integrase,plate,portal,terminase,protease,holin,capsid,head,tail	Shigella_phage(57.38%)	105	1008422:1008467	1051702:1051747
WP_074581750.1|947087_951071_-	autotransporter adhesin EhaA	NA	A0A2L1IV18	Escherichia_phage	37.8	1.0e-122
WP_001473854.1|951644_953678_-|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	27.4	2.0e-21
WP_001295527.1|953806_954394_+	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_000089077.1|954407_955880_+	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001159102.1|955893_957564_+|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.2	4.7e-61
WP_001295805.1|958638_959202_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	53.3	6.0e-53
WP_001315275.1|959531_960326_+	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001406334.1|960488_961250_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071593451.1|962395_963589_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_001209088.1|963772_964438_+	membrane protein	NA	NA	NA	NA	NA
WP_099588343.1|964683_965379_-	lactate utilization protein C	NA	NA	NA	NA	NA
WP_000023914.1|965371_966799_-	iron-sulfur cluster-binding protein	NA	NA	NA	NA	NA
WP_001102101.1|966809_967529_-	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_000339593.1|968057_968912_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001046293.1|969137_970463_+	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	47.8	8.5e-114
WP_000474077.1|970571_970808_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001299021.1|970819_971413_+	reactive chlorine species resistance protein RclC	NA	NA	NA	NA	NA
WP_001299025.1|971572_972442_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	41.7	9.3e-53
WP_001315271.1|972690_973548_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000092603.1|973669_977923_-	intimin-like adhesin FdeC	NA	NA	NA	NA	NA
WP_000662258.1|979038_979140_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000803999.1|979502_979766_+	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_000866436.1|979765_979906_+	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_001147277.1|979940_980168_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001296902.1|980990_981533_+	ECP biosynthesis operon DNA-binding transcriptional regulator EcpR	NA	NA	NA	NA	NA
WP_000730974.1|981607_982195_+	common pilus major fimbrillin subunit EcpA	NA	NA	NA	NA	NA
WP_000716398.1|982252_982921_+	fimbrial chaperone EcpB	NA	NA	NA	NA	NA
WP_042049000.1|982946_985472_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_001315269.1|985461_987105_+	fimbrial adhesin EcpD	NA	NA	NA	NA	NA
WP_001305432.1|987073_987784_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303809.1|988096_988426_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_001019920.1|988673_989288_-	YagU family protein	NA	NA	NA	NA	NA
WP_000070694.1|989705_990395_+	aldehyde dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_000643333.1|990391_991348_+	xanthine dehydrogenase family protein subunit M	NA	NA	NA	NA	NA
WP_000667026.1|991344_993543_+	xanthine dehydrogenase family protein molybdopterin-binding subunit	NA	A0A0P0I429	Acinetobacter_phage	25.8	2.5e-38
WP_000121354.1|993552_994509_+	molybdenum cofactor insertion chaperone PaoD	NA	NA	NA	NA	NA
WP_001111353.1|994487_994898_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053266751.1|995340_995910_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053266752.1|995911_996304_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053266753.1|996503_996968_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_053266762.1|997207_997705_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053266754.1|997843_999550_-	RNA-directed DNA polymerase	NA	NA	NA	NA	NA
WP_053266763.1|1000756_1001101_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099588344.1|1001451_1002378_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053266758.1|1003306_1003639_+	NIPSNAP family containing protein	NA	NA	NA	NA	NA
WP_099588346.1|1004012_1006307_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_053266760.1|1006393_1008334_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
1008422:1008467	attL	TGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
WP_000246059.1|1009221_1009965_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000355484.1|1010789_1011563_+	hypothetical protein	NA	G9IA57	Pseudomonas_phage	38.5	2.4e-36
WP_000904961.1|1011623_1012178_-	site-specific DNA recombinase	NA	A0A1S6L009	Salmonella_phage	89.5	1.5e-88
WP_038977180.1|1014426_1015011_-	YmfQ family protein	NA	O22003	Shigella_phage	99.0	3.5e-112
WP_000785313.1|1015001_1016060_-|plate	baseplate J/gp47 family protein	plate	M1FQW3	Enterobacteria_phage	99.4	4.3e-201
WP_000424732.1|1016046_1016472_-	hypothetical protein	NA	U5P0R9	Shigella_phage	100.0	2.3e-81
WP_001259088.1|1016471_1017020_-|plate	phage baseplate assembly protein	plate	U5P081	Shigella_phage	98.4	3.3e-96
WP_057770346.1|1017019_1018099_-|plate	baseplate protein	plate	U5P0H6	Shigella_phage	99.4	2.0e-206
WP_057762763.1|1018095_1019424_-	DNA circularization protein	NA	Q8SBG8	Shigella_phage	98.0	1.8e-244
WP_000866660.1|1019477_1020155_-	hypothetical protein	NA	A0A0R6PJY5	Moraxella_phage	46.1	5.0e-46
WP_057762766.1|1020224_1022078_-|tail	phage tail tape measure protein	tail	Q8SBG9	Shigella_phage	99.0	1.2e-304
WP_000661047.1|1022219_1022489_-|tail	phage tail assembly protein	tail	S5FNR3	Shigella_phage	100.0	3.5e-43
WP_000090998.1|1022488_1022845_-	hypothetical protein	NA	U5P076	Shigella_phage	100.0	5.3e-63
WP_057762768.1|1022844_1024341_-|tail	phage tail protein	tail	S5FKL0	Shigella_phage	99.2	9.8e-276
WP_000497751.1|1024324_1024495_-	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	100.0	9.3e-26
WP_000779293.1|1024503_1025064_-	hypothetical protein	NA	S5FM61	Shigella_phage	100.0	4.7e-106
WP_099588347.1|1025060_1025567_-	hypothetical protein	NA	M1FPE2	Enterobacteria_phage	92.3	1.5e-82
WP_057762772.1|1025541_1025952_-|head	phage head closure protein	head	M1FJ87	Enterobacteria_phage	94.1	3.9e-70
WP_099588348.1|1025948_1026272_-|head,tail	phage gp6-like head-tail connector protein	head,tail	U5P072	Shigella_phage	98.1	2.6e-56
WP_024221346.1|1026274_1026475_-	hypothetical protein	NA	S5FNU1	Shigella_phage	98.5	4.5e-27
WP_024221345.1|1026523_1027729_-|capsid	phage major capsid protein	capsid	M1FPN2	Enterobacteria_phage	99.3	5.9e-223
WP_001193631.1|1027743_1028394_-|head,protease	HK97 family phage prohead protease	head,protease	U5P4H2	Shigella_phage	100.0	2.5e-119
WP_000466255.1|1028371_1029613_-|portal	phage portal protein	portal	U5P411	Shigella_phage	99.8	2.0e-242
WP_000605605.1|1029612_1029795_-	hypothetical protein	NA	S5FXQ9	Shigella_phage	98.3	3.8e-25
WP_134237377.1|1029806_1031303_-|terminase	terminase large subunit	terminase	A0A1C9IIA1	Salmonella_phage	99.6	2.2e-299
WP_000929181.1|1031536_1032031_-|terminase	phage terminase small subunit P27 family	terminase	A0A1B3B2F4	Salmonella_phage	99.4	8.6e-88
WP_001135214.1|1032156_1032507_-	HNH endonuclease	NA	Q8SBD7	Shigella_phage	97.4	4.7e-64
WP_109161702.1|1032559_1032754_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099588349.1|1033284_1033677_-	DUF2570 domain-containing protein	NA	U5P0U9	Shigella_phage	90.8	8.2e-57
WP_099588350.1|1033660_1034137_-	glycoside hydrolase family protein	NA	S5FV07	Shigella_phage	95.6	3.0e-85
WP_001120496.1|1034140_1034467_-|holin	phage holin, lambda family	holin	U5P0K7	Shigella_phage	99.1	1.2e-56
WP_099588351.1|1034783_1037936_+	NACHT domain-containing protein	NA	NA	NA	NA	NA
WP_039268256.1|1038039_1038219_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039268254.1|1038450_1038795_-	antitermination protein	NA	A0A0P0ZCW0	Stx2-converting_phage	89.8	5.1e-55
WP_001360050.1|1038812_1039802_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	100.0	1.5e-195
WP_001061444.1|1039809_1040619_-	KilA-N domain-containing protein	NA	A0A291AWU7	Escherichia_phage	100.0	1.8e-151
WP_000767095.1|1040638_1041028_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	99.2	1.6e-68
WP_000210164.1|1041024_1041351_-	LexA family transcriptional regulator	NA	A0A0N7KZF7	Stx2-converting_phage	100.0	9.2e-54
WP_074676383.1|1041347_1042001_-	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	98.6	1.6e-126
WP_099588352.1|1042000_1042495_-	PerC family transcriptional regulator	NA	U5P0U0	Shigella_phage	93.3	2.9e-83
WP_021575887.1|1042491_1043433_-	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	93.0	4.9e-140
WP_001250269.1|1043422_1043602_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_000515829.1|1043777_1044335_-	protein YmfL	NA	S5FXP0	Shigella_phage	96.2	1.1e-96
WP_000649477.1|1044378_1044579_-	transcriptional regulator	NA	U5P445	Shigella_phage	100.0	7.9e-32
WP_000848748.1|1044669_1045344_+	LexA family transcriptional repressor	NA	U5P0T5	Shigella_phage	100.0	1.2e-132
WP_000159356.1|1045756_1045948_-	hypothetical protein	NA	S5FM78	Shigella_phage	100.0	3.3e-27
WP_000135680.1|1046386_1046749_+	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
WP_000081269.1|1046814_1047639_+	DUF2303 family protein	NA	U5P439	Shigella_phage	99.6	6.0e-150
WP_000008200.1|1047766_1048303_+	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	100.0	4.3e-101
WP_157774449.1|1048293_1048437_+	hypothetical protein	NA	U5P092	Shigella_phage	100.0	3.2e-11
WP_085948316.1|1048433_1049706_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	95.7	2.8e-170
WP_099588354.1|1049722_1049992_+	hypothetical protein	NA	U5P092	Shigella_phage	97.8	6.2e-48
WP_000206732.1|1049991_1050297_+	hypothetical protein	NA	U5P0J0	Shigella_phage	100.0	6.8e-51
WP_077941726.1|1050212_1050647_+	helix-turn-helix domain-containing protein	NA	U5P4J3	Shigella_phage	99.3	3.2e-78
WP_000051887.1|1050523_1051687_+|integrase	site-specific integrase	integrase	U5P434	Shigella_phage	100.0	2.4e-229
WP_000893255.1|1051891_1053145_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	5.8e-96
1051702:1051747	attR	TGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
WP_001285288.1|1053156_1054260_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000749882.1|1054547_1055603_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.6	1.3e-117
>prophage 74
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	1060280	1061447	4978613		Mycobacterium_phage(100.0%)	1	NA	NA
WP_001316884.1|1060280_1061447_-	RNA ligase RtcB family protein	NA	A0A222ZMP7	Mycobacterium_phage	31.7	2.1e-31
>prophage 75
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	1066498	1070417	4978613		Clostridioides_phage(50.0%)	6	NA	NA
WP_000543895.1|1066498_1067272_-	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	37.7	1.2e-19
WP_000729704.1|1067457_1067718_+	type II toxin-antitoxin system antitoxin DinJ	NA	NA	NA	NA	NA
WP_000615976.1|1067720_1067999_+	type II toxin-antitoxin system mRNA interferase toxin YafQ	NA	NA	NA	NA	NA
WP_001225679.1|1068154_1068895_+	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000333380.1|1068865_1069633_-	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_000284050.1|1069838_1070417_-	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
>prophage 76
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	1081321	1083463	4978613		Ralstonia_phage(100.0%)	1	NA	NA
WP_000103320.1|1081321_1083463_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.0	1.1e-25
>prophage 77
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	1087179	1151008	4978613	protease,transposase,tRNA,plate	Enterobacteria_phage(11.11%)	53	NA	NA
WP_000611742.1|1087179_1087593_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000393844.1|1087596_1089447_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000348793.1|1089410_1090493_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_001113703.1|1090517_1091798_+	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_001080149.1|1091794_1092319_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_000246416.1|1092321_1093653_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_000343293.1|1093657_1094419_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_001420567.1|1094427_1097187_+	type VI secretion system ATPase TssH	NA	H6X3M6	Enterobacteria_phage	28.3	3.0e-81
WP_000088859.1|1097183_1097927_+	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_001240530.1|1097931_1099344_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_122985538.1|1099452_1102887_+	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_001087745.1|1102897_1104250_+	membrane protein	NA	NA	NA	NA	NA
WP_001284199.1|1104273_1104756_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000908057.1|1104799_1105714_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001236649.1|1105723_1106203_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001086142.1|1106339_1107125_-	aminopeptidase	NA	NA	NA	NA	NA
WP_001297205.1|1107664_1108396_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.0	3.4e-40
WP_000917883.1|1108460_1108928_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001297210.1|1108924_1109647_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001052720.1|1109680_1110436_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000644685.1|1110507_1111866_+	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_000211690.1|1111913_1112684_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001230983.1|1112761_1113562_-	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000648606.1|1113802_1114717_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000997010.1|1114713_1115517_-	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.2	2.4e-39
WP_001140174.1|1121276_1121849_-	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_000593994.1|1122036_1123068_+	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	7.2e-36
WP_001294600.1|1123060_1123714_+	methionine ABC transporter permease MetI	NA	NA	NA	NA	NA
WP_000874224.1|1123753_1124569_+	methionine ABC transporter substrate-binding lipoprotein MetQ	NA	NA	NA	NA	NA
WP_001202335.1|1124686_1125091_+	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
WP_000094011.1|1125087_1125795_+|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_001260712.1|1125905_1127624_+|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000399648.1|1128704_1129685_-|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
WP_000239192.1|1129934_1130645_-	envelope stress response activation lipoprotein NlpE	NA	NA	NA	NA	NA
WP_000635545.1|1130658_1131081_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_001185290.1|1131077_1131623_-	YaeQ family protein	NA	NA	NA	NA	NA
WP_000417058.1|1131788_1131989_+	YaeP family protein	NA	NA	NA	NA	NA
WP_000062312.1|1131975_1132236_+	Rho-binding antiterminator	NA	NA	NA	NA	NA
WP_000176578.1|1132284_1133583_-|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_001473803.1|1133647_1134037_-	VOC family protein	NA	NA	NA	NA	NA
WP_001020973.1|1134093_1136235_-	lysine decarboxylase LdcC	NA	NA	NA	NA	NA
WP_000055741.1|1136333_1137293_-	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
WP_001294757.1|1137305_1140788_-	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.9	2.2e-209
WP_000569430.1|1140824_1141421_-	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.0	1.0e-26
WP_000139667.1|1141417_1142566_-	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_000565966.1|1142565_1143354_-	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_000210739.1|1143357_1143813_-	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_001139279.1|1143917_1144943_-	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_000758956.1|1144946_1145432_-	molecular chaperone Skp	NA	NA	NA	NA	NA
WP_001240896.1|1145553_1147986_-	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_001295561.1|1148015_1149368_-|protease	sigma E protease regulator RseP	protease	NA	NA	NA	NA
WP_000922446.1|1149379_1150237_-	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_001295562.1|1150249_1151008_-	(2E,6E)-farnesyl-diphosphate-specific ditrans,polycis-undecaprenyl-diphosphate synthase	NA	R9W0U9	Flavobacterium_phage	44.4	7.7e-27
>prophage 78
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	1162891	1164316	4978613	protease	uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_001473795.1|1162891_1164316_-|protease	serine endoprotease DegP	protease	A0A1B1IT49	uncultured_Mediterranean_phage	28.8	1.9e-26
>prophage 79
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	1168245	1168590	4978613		Lake_Baikal_phage(100.0%)	1	NA	NA
WP_001295564.1|1168245_1168590_-	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	51.4	4.5e-27
>prophage 80
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	1174501	1175299	4978613		Planktothrix_phage(100.0%)	1	NA	NA
WP_001315242.1|1174501_1175299_-	Fe3+-hydroxamate ABC transporter ATP-binding protein FhuC	NA	G9BWD6	Planktothrix_phage	26.9	1.0e-13
>prophage 81
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	1180542	1187348	4978613	tRNA	Acanthamoeba_polyphaga_mimivirus(50.0%)	6	NA	NA
WP_001367042.1|1180542_1182972_-	ATP-dependent helicase HrpB	NA	A0A0G2Y9F4	Acanthamoeba_polyphaga_mimivirus	30.6	6.7e-40
WP_001294700.1|1183045_1183576_+	RNA 2',3'-cyclic phosphodiesterase	NA	NA	NA	NA	NA
WP_000396036.1|1183590_1184295_+	DNA/RNA nuclease SfsA	NA	NA	NA	NA	NA
WP_001155227.1|1184472_1184928_+	RNA polymerase-binding protein DksA	NA	NA	NA	NA	NA
WP_000937432.1|1184964_1185891_+|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
WP_000174639.1|1185929_1187348_+	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	37.9	3.2e-26
>prophage 82
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	1197254	1198157	4978613		Sodalis_phage(100.0%)	1	NA	NA
WP_000339945.1|1197254_1198157_-	recombination-promoting nuclease RpnC	NA	Q2A0A7	Sodalis_phage	49.2	5.7e-61
>prophage 83
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	1201419	1203694	4978613		Anomala_cuprea_entomopoxvirus(50.0%)	3	NA	NA
WP_000150637.1|1201419_1202346_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	34.0	1.2e-21
WP_000651599.1|1202454_1203117_+	carbonate dehydratase	NA	NA	NA	NA	NA
WP_000683335.1|1203157_1203694_-	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	33.1	5.1e-17
>prophage 84
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	1207770	1209321	4978613		Mamastrovirus(100.0%)	1	NA	NA
WP_001189608.1|1207770_1209321_-	multicopper oxidase CueO	NA	A0A0C6DWA2	Mamastrovirus	55.4	2.7e-18
>prophage 85
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	1216970	1218395	4978613		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_000102485.1|1216970_1218395_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.8	4.2e-42
>prophage 86
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	1227022	1227574	4978613		Sphingobium_phage(100.0%)	1	NA	NA
WP_000923721.1|1227022_1227574_-	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	A0A1W6DX33	Sphingobium_phage	32.3	3.0e-12
>prophage 87
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	1231819	1232863	4978613		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_001217338.1|1231819_1232863_-	GMP reductase	NA	A0A0N9Q9A5	Chrysochromulina_ericina_virus	56.3	6.3e-104
>prophage 88
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	1258836	1260561	4978613		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_000425668.1|1258836_1260561_-	acetolactate synthase 3 large subunit	NA	E5ERI2	Ostreococcus_lucimarinus_virus	26.9	1.9e-36
>prophage 89
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	1273263	1273962	4978613		Planktothrix_phage(100.0%)	1	NA	NA
WP_000916310.1|1273263_1273962_+	thiamine ABC transporter ATP-binding protein ThiQ	NA	G9BWD6	Planktothrix_phage	36.7	2.3e-22
>prophage 90
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	1280294	1285717	4978613		Yellowstone_lake_phycodnavirus(50.0%)	2	NA	NA
WP_000035650.1|1280294_1282646_+	DNA polymerase II	NA	A0A0P0YM26	Yellowstone_lake_phycodnavirus	25.5	1.8e-37
WP_001117011.1|1282810_1285717_+	RNA polymerase-associated protein RapA	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	37.9	5.7e-22
>prophage 91
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	1293461	1294861	4978613		Microcystis_phage(50.0%)	2	NA	NA
WP_000257186.1|1293461_1294304_+	bis(5'-nucleosyl)-tetraphosphatase (symmetrical)	NA	A0A075BTY6	Microcystis_phage	42.0	1.0e-08
WP_000624375.1|1294381_1294861_-	type 3 dihydrofolate reductase	NA	A0A219UQN5	Bacillus_phage	46.4	1.0e-29
>prophage 92
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	1302756	1308415	4978613		Vibrio_phage(50.0%)	4	NA	NA
WP_000787111.1|1302756_1304271_+	L-carnitine/gamma-butyrobetaine antiport BCCT transporter	NA	A0A2I7QNT1	Vibrio_phage	21.1	3.5e-07
WP_000347117.1|1304301_1305444_+	crotonobetainyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000349932.1|1305572_1306790_+	L-carnitine CoA-transferase	NA	NA	NA	NA	NA
WP_001297614.1|1306861_1308415_+	crotonobetaine/carnitine-CoA ligase	NA	Q75ZG1	Hepacivirus	25.4	4.7e-31
>prophage 93
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	1313885	1315034	4978613		Halovirus(100.0%)	1	NA	NA
WP_000597260.1|1313885_1315034_-	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	32.6	1.7e-49
>prophage 94
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	1319440	1322257	4978613	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_001286857.1|1319440_1322257_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A2K9L260	Tupanvirus	26.1	2.7e-77
>prophage 95
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	1329290	1338359	4978613		uncultured_Caudovirales_phage(20.0%)	9	NA	NA
WP_000681360.1|1329290_1330457_-	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	50.3	7.5e-90
WP_000935262.1|1330985_1331195_+	type I toxin-antitoxin system toxin MokC	NA	A0A0P0ZAX5	Stx2-converting_phage	73.9	8.0e-19
WP_001118464.1|1331298_1332429_-	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	34.6	4.6e-28
WP_000516135.1|1332517_1334434_-	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	51.1	6.9e-149
WP_000843568.1|1334810_1335215_+	DUF2541 family protein	NA	NA	NA	NA	NA
WP_001102379.1|1335240_1335954_+	acidic protein MsyB	NA	NA	NA	NA	NA
WP_000528538.1|1336102_1336669_+	acetate uptake transporter	NA	NA	NA	NA	NA
WP_001420535.1|1336703_1337291_-	molybdopterin adenylyltransferase	NA	NA	NA	NA	NA
WP_000130182.1|1337405_1338359_-	transaldolase	NA	A0A127KNC6	Cyanophage	32.7	7.4e-11
>prophage 96
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	1351406	1353520	4978613		Ectocarpus_siliculosus_virus(50.0%)	2	NA	NA
WP_001219604.1|1351406_1352831_-	two-component system sensor histidine kinase CreC	NA	Q8QKV7	Ectocarpus_siliculosus_virus	21.7	1.2e-09
WP_001188659.1|1352830_1353520_-	two-component system response regulator CreB	NA	W8CYM9	Bacillus_phage	35.3	8.8e-30
>prophage 97
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	1356751	1362106	4978613		Bacillus_phage(33.33%)	3	NA	NA
WP_000409451.1|1356751_1358689_-	murein transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	34.8	4.0e-11
WP_000046749.1|1358899_1360567_+	energy-dependent translational throttle protein EttA	NA	A0A1V0SKJ1	Klosneuvirus	26.4	3.7e-42
WP_000093810.1|1360873_1362106_-	multifunctional transcriptional regulator/nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase NadR	NA	A0A0C5K935	Enterococcus_phage	42.6	1.6e-82
>prophage 98
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	1368826	1370149	4978613		Geobacillus_virus(100.0%)	1	NA	NA
WP_000477811.1|1368826_1370149_-	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	39.8	2.3e-79
>prophage 99
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	1376286	1379162	4978613		Salmonella_phage(50.0%)	3	NA	NA
WP_000490275.1|1376286_1376448_-	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	64.2	1.8e-10
WP_001295748.1|1376574_1377180_-	molecular chaperone OsmY	NA	NA	NA	NA	NA
WP_000175940.1|1377572_1379162_-	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	25.2	2.4e-30
>prophage 100
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	1387169	1388449	4978613		Salmonella_phage(50.0%)	2	NA	NA
WP_000098815.1|1387169_1387709_+	primosomal protein DnaT	NA	T1SA92	Salmonella_phage	62.8	2.9e-28
WP_000799911.1|1387711_1388449_+	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	50.8	7.6e-64
>prophage 101
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	1391673	1397038	4978613		Tupanvirus(50.0%)	4	NA	NA
WP_000106020.1|1391673_1392696_-	zinc-binding alcohol dehydrogenase family protein	NA	A0A2K9L7I1	Tupanvirus	26.3	3.6e-11
WP_000091572.1|1392834_1393749_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000410144.1|1393963_1395325_+	MFS transporter	NA	NA	NA	NA	NA
WP_000919540.1|1395373_1397038_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	39.6	6.2e-13
>prophage 102
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	1402821	1412641	4978613	transposase	Bodo_saltans_virus(25.0%)	7	NA	NA
WP_001029745.1|1402821_1404441_+	type I restriction-modification system subunit M	NA	A0A2H4UVW8	Bodo_saltans_virus	21.8	1.1e-06
WP_000535012.1|1404430_1405735_+	restriction endonuclease subunit S	NA	B3GAM1	uncultured_virus	24.7	8.3e-05
WP_000058884.1|1405829_1409093_+	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	25.4	2.8e-49
WP_000132599.1|1409307_1409646_+	endoribonuclease SymE	NA	NA	NA	NA	NA
WP_000397910.1|1409688_1409853_-	DUF1127 domain-containing protein	NA	NA	NA	NA	NA
WP_000199304.1|1410029_1411442_+	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_000181180.1|1411684_1412641_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	51.2	1.0e-60
>prophage 103
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	1420141	1420696	4978613		Clostridioides_phage(100.0%)	1	NA	NA
WP_001151855.1|1420141_1420696_-	RNA 2'-phosphotransferase	NA	A0A2R2ZGT8	Clostridioides_phage	45.6	2.7e-37
>prophage 104
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	1427219	1428680	4978613		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_000208224.1|1427219_1428680_-	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	32.4	1.4e-48
>prophage 105
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	1435407	1439752	4978613	transposase	Stx2-converting_phage(75.0%)	5	NA	NA
WP_001333468.1|1435407_1435788_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
WP_000612591.1|1435784_1436132_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998013.1|1436181_1437567_+|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	89.1	1.9e-257
WP_000823241.1|1437805_1439164_-	esterase-like activity of phytase family protein	NA	NA	NA	NA	NA
WP_000937727.1|1439542_1439752_+	hypothetical protein	NA	A0A0N7BTS3	Escherichia_phage	96.0	5.9e-06
>prophage 106
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	1446910	1451609	4978613		uncultured_Caudovirales_phage(33.33%)	4	NA	NA
WP_000684856.1|1446910_1447867_+	Fe(3+) dicitrate ABC transporter permease subunit FecD	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.1	1.1e-17
WP_000175457.1|1447867_1448635_+	Fe(3+) dicitrate ABC transporter ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	24.8	6.4e-13
WP_000177057.1|1449192_1449450_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001189123.1|1450100_1451609_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	3.6e-44
>prophage 107
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	1457262	1460553	4978613	transposase	Acinetobacter_phage(50.0%)	2	NA	NA
WP_016245226.1|1457262_1458402_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.5e-68
WP_157774451.1|1458555_1460553_+	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	25.9	7.4e-21
>prophage 108
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	1471387	1475647	4978613		Nostoc_phage(50.0%)	2	NA	NA
WP_000643690.1|1471387_1472584_+	DNA cytosine methyltransferase	NA	A0A191SAU1	Nostoc_phage	30.8	2.2e-36
WP_000236931.1|1472677_1475647_+	histidine kinase	NA	A0A1B5FPD5	Escherichia_phage	32.9	7.3e-81
>prophage 109
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	1483506	1484526	4978613		Acanthamoeba_polyphaga_mimivirus(100.0%)	1	NA	NA
WP_000061766.1|1483506_1484526_+	NADPH-dependent aldehyde reductase Ahr	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	30.4	1.4e-44
>prophage 110
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	1489655	1498697	4978613	tRNA	Klebsiella_phage(33.33%)	6	NA	NA
WP_001422764.1|1489655_1491158_+	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	44.3	1.5e-82
WP_001422763.1|1491276_1492359_-	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_000584114.1|1492358_1493459_-	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_001422762.1|1493725_1495237_+	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.4	1.2e-47
WP_000786399.1|1495398_1495842_+	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_001422761.1|1495841_1498697_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.7	7.9e-141
>prophage 111
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	1507749	1514206	4978613	transposase	Paramecium_bursaria_Chlorella_virus(66.67%)	7	NA	NA
WP_000013047.1|1507749_1508685_+	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	39.9	3.2e-51
WP_000148581.1|1508697_1509159_+	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_000047539.1|1509231_1509618_+	2-iminobutanoate/2-iminopropanoate deaminase	NA	NA	NA	NA	NA
WP_001118337.1|1509683_1510139_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_000471866.1|1510183_1512880_-	magnesium-translocating P-type ATPase	NA	M1HLC0	Paramecium_bursaria_Chlorella_virus	27.4	9.0e-46
WP_001387276.1|1513020_1513074_-	mgtA regulatory leader peptide MgtL	NA	NA	NA	NA	NA
WP_001181332.1|1513258_1514206_+	HTH-type transcriptional regulator TreR	NA	C6ZCU4	Enterobacteria_phage	21.8	6.0e-13
>prophage 112
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	1517844	1520605	4978613		Vibrio_phage(100.0%)	2	NA	NA
WP_000187778.1|1517844_1519983_+	anaerobic ribonucleoside-triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	64.5	1.5e-266
WP_001106222.1|1520140_1520605_+	anaerobic ribonucleoside-triphosphate reductase-activating protein	NA	H6WXC9	Vibrio_phage	59.7	1.1e-52
>prophage 113
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	1524847	1531505	4978613		Klosneuvirus(33.33%)	6	NA	NA
WP_000853753.1|1524847_1525846_+	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.7	5.7e-70
WP_000595986.1|1525878_1526874_-	sugar ABC transporter permease YjfF	NA	NA	NA	NA	NA
WP_001339490.1|1526860_1527883_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000205793.1|1527896_1529399_-	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.3	1.1e-11
WP_000265933.1|1529708_1530665_-	galactofuranose ABC transporter substrate-binding protein YtfQ	NA	NA	NA	NA	NA
WP_000055072.1|1530974_1531505_+	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.9	9.4e-56
>prophage 114
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	1573539	1574703	4978613		Ralstonia_phage(100.0%)	1	NA	NA
WP_000943996.1|1573539_1574703_-	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.8	8.3e-81
>prophage 115
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	1578635	1591666	4978613	protease,tRNA	Lactococcus_phage(20.0%)	11	NA	NA
WP_000076316.1|1578635_1581077_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.1	6.4e-67
WP_001177639.1|1581115_1581541_-	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_000527955.1|1581745_1583044_-	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.9	2.2e-66
WP_001089295.1|1583147_1583345_-	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_001232412.1|1583426_1584431_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_000312488.1|1584433_1585693_-|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
WP_000460360.1|1585778_1587059_-	GTPase HflX	NA	NA	NA	NA	NA
WP_001051883.1|1587134_1587443_-	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_001280345.1|1587528_1588479_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_001122499.1|1588471_1590319_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	41.3	4.4e-60
WP_000990321.1|1590328_1591666_-	N-acetylmuramoyl-L-alanine amidase AmiB	NA	A0A067ZJB6	Vibrio_phage	31.0	8.8e-18
>prophage 116
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	1595581	1596127	4978613		Diachasmimorpha_longicaudata_entomopoxvirus(100.0%)	1	NA	NA
WP_001295188.1|1595581_1596127_-	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	40.4	2.2e-28
>prophage 117
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	1603555	1604533	4978613		Tupanvirus(100.0%)	1	NA	NA
WP_000004771.1|1603555_1604533_-	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9KZX5	Tupanvirus	28.2	6.8e-28
>prophage 118
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	1609453	1609987	4978613		Morganella_phage(100.0%)	1	NA	NA
WP_001238378.1|1609453_1609987_+	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	55.0	2.7e-47
>prophage 119
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	1615777	1617761	4978613		Vibrio_phage(50.0%)	2	NA	NA
WP_000729117.1|1615777_1617424_-	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	68.9	5.3e-190
WP_001026276.1|1617467_1617761_-	co-chaperone GroES	NA	K4F9I2	Cronobacter_phage	45.4	9.2e-13
>prophage 120
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	1626074	1627265	4978613	integrase	Enterobacteria_phage(100.0%)	1	1621043:1621056	1631747:1631760
1621043:1621056	attL	GGCCTGAACGAGAT	NA	NA	NA	NA
WP_099588360.1|1626074_1627265_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	52.6	4.9e-121
WP_099588360.1|1626074_1627265_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	52.6	4.9e-121
1631747:1631760	attR	GGCCTGAACGAGAT	NA	NA	NA	NA
>prophage 121
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	1638214	1638996	4978613		Stx2-converting_phage(50.0%)	2	NA	NA
WP_074502645.1|1638214_1638565_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	63.8	2.4e-39
WP_001309734.1|1638561_1638996_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	60.3	1.5e-19
>prophage 122
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	1658247	1658724	4978613		Sodalis_phage(100.0%)	1	NA	NA
WP_074502628.1|1658247_1658724_+	ProQ/FinO family protein	NA	Q2A0A1	Sodalis_phage	41.1	1.0e-08
>prophage 123
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	1667052	1672926	4978613	transposase	Yersinia_phage(25.0%)	9	NA	NA
WP_074503010.1|1667052_1667871_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	39.0	1.6e-46
WP_000206660.1|1667962_1668448_+	antirestriction protein	NA	A9J566	Pseudomonas_phage	32.4	1.2e-12
WP_074503008.1|1668463_1668940_+	RadC family protein	NA	NA	NA	NA	NA
WP_000692295.1|1669008_1669230_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.1e-10
WP_024183700.1|1669309_1669678_+	type IV toxin-antitoxin system YeeU family antitoxin	NA	NA	NA	NA	NA
WP_074503007.1|1669766_1670144_+	toxin	NA	NA	NA	NA	NA
WP_000777667.1|1670140_1670629_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000839291.1|1670640_1670838_+	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_134743730.1|1671697_1672926_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	94.4	1.6e-167
>prophage 124
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	1680189	1683401	4978613	tRNA	Acinetobacter_phage(50.0%)	2	NA	NA
WP_000856829.1|1680189_1681647_+	dipeptide/tripeptide permease DtpC	NA	A0A0P0IY73	Acinetobacter_phage	29.4	6.8e-48
WP_001295074.1|1681883_1683401_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	38.0	2.7e-87
>prophage 125
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	1704598	1706101	4978613		Burkholderia_virus(100.0%)	1	NA	NA
WP_001296882.1|1704598_1706101_-	glycine betaine/L-proline transporter ProP	NA	Q6JIH2	Burkholderia_virus	31.0	7.0e-56
>prophage 126
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	1710940	1711729	4978613		Cedratvirus(100.0%)	1	NA	NA
WP_001193391.1|1710940_1711729_+	phosphonate ABC transporter ATP-binding protein	NA	A0A285PWH2	Cedratvirus	30.1	8.5e-13
>prophage 127
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	1717352	1718902	4978613		Bacillus_virus(50.0%)	2	NA	NA
WP_001075526.1|1717352_1718111_+	phosphonate C-P lyase system protein PhnK	NA	G3M9Y6	Bacillus_virus	27.8	1.0e-15
WP_000611404.1|1718221_1718902_+	phosphonate C-P lyase system protein PhnL	NA	F2Y2R6	Organic_Lake_phycodnavirus	29.5	7.1e-08
>prophage 128
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	1722887	1724873	4978613		Tetraselmis_virus(100.0%)	1	NA	NA
WP_001315959.1|1722887_1724873_+	alkyl sulfatase YjcS	NA	A0A2P0VMX1	Tetraselmis_virus	44.3	1.6e-148
>prophage 129
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	1730118	1732266	4978613		Escherichia_phage(100.0%)	1	NA	NA
WP_001300547.1|1730118_1732266_+	formate dehydrogenase subunit alpha	NA	A0A077SK27	Escherichia_phage	23.9	7.0e-33
>prophage 130
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	1741548	1743507	4978613		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000078239.1|1741548_1743507_+	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	40.4	1.9e-90
>prophage 131
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	1749090	1750440	4978613		Moraxella_phage(100.0%)	1	NA	NA
WP_000106882.1|1749090_1750440_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	71.6	1.8e-159
>prophage 132
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	1754257	1757870	4978613		Enterobacteria_phage(50.0%)	2	NA	NA
WP_000168305.1|1754257_1754794_-	single-stranded DNA-binding protein SSB1	NA	A0A0A0P1Q9	Enterobacteria_phage	78.7	1.1e-56
WP_000357740.1|1755047_1757870_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	56.1	0.0e+00
>prophage 133
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	1762077	1764625	4978613		Yellowstone_lake_mimivirus(50.0%)	2	NA	NA
WP_001147328.1|1762077_1763157_-	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	27.9	5.2e-29
WP_000918363.1|1763209_1764625_-	replicative DNA helicase	NA	O80281	Escherichia_phage	78.3	4.8e-200
>prophage 134
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	1771221	1771830	4978613		Lactococcus_phage(100.0%)	1	NA	NA
WP_000646078.1|1771221_1771830_-	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
>prophage 135
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	1781045	1782161	4978613		Mycoplasma_phage(100.0%)	1	NA	NA
WP_000179165.1|1781045_1782161_-	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	31.7	4.3e-18
>prophage 136
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	1797968	1798760	4978613		Pseudomonas_phage(100.0%)	1	NA	NA
WP_001130548.1|1797968_1798760_-	nucleotidyltransferase domain-containing protein	NA	A0A2D1GQQ2	Pseudomonas_phage	45.5	2.4e-47
>prophage 137
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	1804410	1808094	4978613		Dickeya_phage(100.0%)	1	NA	NA
WP_000096011.1|1804410_1808094_-	methionine synthase	NA	A0A140XBC7	Dickeya_phage	90.2	1.3e-26
>prophage 138
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	1823472	1825062	4978613		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_001187562.1|1823472_1825062_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	47.7	1.3e-68
>prophage 139
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	1830430	1832194	4978613		Bacillus_phage(50.0%)	3	NA	NA
WP_001044513.1|1830430_1830703_-	DNA-binding protein HU-alpha	NA	A7KV42	Bacillus_phage	58.9	3.2e-20
WP_000940106.1|1830889_1831480_-	YjaG family protein	NA	NA	NA	NA	NA
WP_000362392.1|1831522_1832194_-	deoxyribonuclease V	NA	A0A1V0SJW5	Klosneuvirus	28.7	6.1e-20
>prophage 140
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	1841409	1849738	4978613		Vibrio_phage(50.0%)	2	NA	NA
WP_000653944.1|1841409_1845633_-	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	26.5	2.5e-66
WP_000263098.1|1845709_1849738_-	DNA-directed RNA polymerase subunit beta	NA	A0A0N9R0J7	Chrysochromulina_ericina_virus	29.0	9.4e-23
>prophage 141
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	1853854	1856907	4978613		Tupanvirus(50.0%)	2	NA	NA
WP_000031784.1|1853854_1855039_-	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.1	4.4e-13
WP_000023081.1|1855956_1856907_+	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	32.0	8.7e-28
>prophage 142
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	1865413	1867258	4978613		Acinetobacter_phage(100.0%)	1	NA	NA
WP_000591355.1|1865413_1867258_-	TonB-dependent vitamin B12 receptor BtuB	NA	A0A0P0I887	Acinetobacter_phage	32.0	7.1e-10
>prophage 143
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	1874008	1875223	4978613		Oenococcus_phage(100.0%)	1	NA	NA
WP_000690946.1|1874008_1875223_-	D-galactonate dehydratase family protein	NA	Q6A202	Oenococcus_phage	28.6	4.5e-45
>prophage 144
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	1887340	1894587	4978613		Serratia_phage(33.33%)	5	NA	NA
WP_000184827.1|1887340_1889638_-	formate C-acetyltransferase	NA	A0A1S6UAD4	Serratia_phage	48.1	4.6e-06
WP_000161265.1|1889688_1890009_-	PTS fructose-like transporter subunit IIB	NA	NA	NA	NA	NA
WP_001004446.1|1890023_1891103_-	PTS fructose transporter subunit EIIC	NA	NA	NA	NA	NA
WP_001174083.1|1891411_1893913_+	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	26.9	1.0e-11
WP_000424845.1|1893924_1894587_+	fructose-6-phosphate aldolase	NA	A0A0E3F0E2	Synechococcus_phage	34.6	5.5e-29
>prophage 145
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	1907579	1911764	4978613		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_053285920.1|1907579_1911764_-	RHS repeat protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	32.0	1.0e-24
>prophage 146
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	1917401	1921905	4978613		Erwinia_phage(50.0%)	5	NA	NA
WP_001293343.1|1917401_1918733_+	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	29.9	1.7e-45
WP_001307494.1|1918799_1919726_+	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_000872908.1|1919818_1920304_+	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_001296623.1|1920388_1920634_-	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
WP_000084268.1|1921059_1921905_+	glycerol uptake facilitator protein GlpF	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.0	4.4e-15
>prophage 147
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	1933480	1938341	4978613		Feldmannia_irregularis_virus(33.33%)	5	NA	NA
WP_001033722.1|1933480_1934179_+	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
WP_000580417.1|1934175_1935549_+	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.9	3.8e-16
WP_001270260.1|1935654_1936329_-	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_001166063.1|1936477_1937461_-	2-keto-3-deoxygluconate transporter	NA	NA	NA	NA	NA
WP_001297064.1|1937720_1938341_-	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	59.8	4.9e-64
>prophage 148
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	1953049	1956100	4978613		Escherichia_phage(100.0%)	1	NA	NA
WP_011310337.1|1953049_1956100_+	formate dehydrogenase-N subunit alpha	NA	A0A077SK27	Escherichia_phage	23.8	1.1e-07
>prophage 149
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	1964974	1967754	4978613		Escherichia_phage(50.0%)	3	NA	NA
WP_000059678.1|1964974_1965760_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.9	8.2e-24
WP_000621656.1|1965793_1966690_-	sulfofructose kinase	NA	NA	NA	NA	NA
WP_000718896.1|1966857_1967754_+	sulfolactaldehyde 3-reductase	NA	D2K0C8	Staphylococcus_phage	90.7	9.6e-61
>prophage 150
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	1984122	1986593	4978613		Ectocarpus_siliculosus_virus(50.0%)	2	NA	NA
WP_000190577.1|1984122_1985172_+	nitrogen regulation protein NR(II)	NA	Q8QKV7	Ectocarpus_siliculosus_virus	26.1	2.5e-07
WP_001188777.1|1985183_1986593_+	nitrogen regulation protein NR(I)	NA	Q56AR1	Bacillus_thuringiensis_phage	28.7	2.4e-05
>prophage 151
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	1990671	1993458	4978613		uncultured_virus(100.0%)	1	NA	NA
WP_000250006.1|1990671_1993458_-	DNA polymerase I	NA	A0A218MKQ4	uncultured_virus	32.1	1.7e-71
>prophage 152
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	2007145	2007760	4978613		Streptococcus_phage(100.0%)	1	NA	NA
WP_001296979.1|2007145_2007760_-	IMPACT family protein	NA	A0A1X9I5T8	Streptococcus_phage	33.0	1.6e-19
>prophage 153
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	2016550	2019837	4978613		uncultured_Mediterranean_phage(50.0%)	4	NA	NA
WP_000109943.1|2016550_2017327_-	Sec-independent protein translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	32.6	5.1e-26
WP_000459594.1|2017329_2017845_-	Sec-independent protein translocase subunit TatB	NA	NA	NA	NA	NA
WP_001315927.1|2017848_2018118_-	Sec-independent protein translocase subunit TatA	NA	NA	NA	NA	NA
WP_000187530.1|2018196_2019837_-	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	M4R0M8	Ostreococcus_lucimarinus_virus	29.0	8.2e-42
>prophage 154
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	2032248	2034078	4978613		Catovirus(100.0%)	1	NA	NA
WP_001346040.1|2032248_2034078_-	ATP-dependent DNA helicase RecQ	NA	A0A1V0SBK0	Catovirus	37.8	9.7e-84
>prophage 155
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	2041562	2045421	4978613		Bacillus_phage(100.0%)	3	NA	NA
WP_000383406.1|2041562_2043725_-	DNA helicase II	NA	A7KV33	Bacillus_phage	37.2	4.6e-117
WP_001213584.1|2043808_2044525_-	5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase YigB	NA	NA	NA	NA	NA
WP_000130691.1|2044524_2045421_-	tyrosine recombinase XerC	NA	A0A142F1N9	Bacillus_phage	29.6	3.8e-25
>prophage 156
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	2048457	2051245	4978613		Salmonella_phage(100.0%)	2	NA	NA
WP_001315924.1|2048457_2049936_+	hypothetical protein	NA	A0A0U2C3T4	Salmonella_phage	54.7	1.8e-43
WP_001349386.1|2049919_2051245_+	hypothetical protein	NA	A0A0U2C3T4	Salmonella_phage	33.6	4.8e-08
>prophage 157
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	2067548	2073692	4978613		Enterobacteria_phage(40.0%)	6	NA	NA
WP_000612044.1|2067548_2068679_-	dTDP-4-amino-4,6-dideoxygalactose transaminase	NA	A0A0F7LAY0	uncultured_marine_virus	41.7	2.0e-18
WP_001145196.1|2068683_2069358_-	dTDP-4-amino-4,6-dideoxy-D-galactose acyltransferase	NA	NA	NA	NA	NA
WP_000676056.1|2069335_2070217_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	66.3	8.7e-107
WP_001474796.1|2070235_2071303_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.4	1.0e-101
WP_000006621.1|2071302_2072565_-	UDP-N-acetyl-D-mannosamine dehydrogenase	NA	M1HNJ7	Paramecium_bursaria_Chlorella_virus	27.0	1.0e-23
WP_000866670.1|2072561_2073692_-	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	32.8	3.0e-27
>prophage 158
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	2077734	2083146	4978613		Indivirus(33.33%)	4	NA	NA
WP_001280776.1|2077734_2078064_-	thioredoxin TrxA	NA	A0A1V0SD63	Indivirus	38.5	4.2e-14
WP_000047499.1|2078194_2079460_+	ATP-dependent RNA helicase RhlB	NA	E3T5E1	Cafeteria_roenbergensis_virus	31.2	3.1e-41
WP_001299253.1|2079593_2081078_+	guanosine-5'-triphosphate,3'-diphosphate diphosphatase	NA	NA	NA	NA	NA
WP_001238869.1|2081124_2083146_-	DNA helicase Rep	NA	A7KV33	Bacillus_phage	37.6	2.9e-113
>prophage 159
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	2092898	2094545	4978613		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_001012633.1|2092898_2094545_-	acetolactate synthase 2 catalytic subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	31.8	3.9e-68
>prophage 160
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	2107938	2113791	4978613		Enterobacteria_phage(33.33%)	5	NA	NA
WP_001056273.1|2107938_2108829_-	ribose ABC transporter substrate-binding protein RbsB	NA	C6ZCU4	Enterobacteria_phage	23.4	4.3e-05
WP_000211858.1|2108853_2109819_-	ribose ABC transporter permease	NA	NA	NA	NA	NA
WP_000387753.1|2109823_2111329_-	ribose ABC transporter ATP-binding protein RbsA	NA	A0A2H4PQG7	Staphylococcus_phage	28.6	4.6e-15
WP_000715936.1|2111336_2111756_-	D-ribose pyranase	NA	NA	NA	NA	NA
WP_000102319.1|2111922_2113791_-	low affinity potassium transporter Kup	NA	M1I6H8	Paramecium_bursaria_Chlorella_virus	30.6	6.0e-65
>prophage 161
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	2116959	2117952	4978613		Heterosigma_akashiwo_virus(100.0%)	1	NA	NA
WP_000845103.1|2116959_2117952_-	aspartate--ammonia ligase	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	37.7	1.7e-50
>prophage 162
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	2129904	2133266	4978613		Chrysochromulina_ericina_virus(50.0%)	2	NA	NA
WP_000933736.1|2129904_2131275_+	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A0N7G7I9	Chrysochromulina_ericina_virus	36.7	3.1e-34
WP_001422574.1|2131436_2133266_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	43.2	1.9e-132
>prophage 163
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	2138797	2142638	4978613		Cyanophage(50.0%)	4	NA	NA
WP_000867146.1|2138797_2139838_+	phosphate ABC transporter substrate-binding protein PstS	NA	A0A1D7SRJ6	Cyanophage	38.3	2.7e-51
WP_000741620.1|2139924_2140884_+	phosphate ABC transporter permease PstC	NA	NA	NA	NA	NA
WP_001251991.1|2140883_2141774_+	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_000063125.1|2141864_2142638_+	phosphate ABC transporter ATP-binding protein PstB	NA	W8CYL7	Bacillus_phage	31.7	4.0e-15
>prophage 164
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	2153627	2154965	4978613		Moraxella_phage(100.0%)	1	NA	NA
WP_001299598.1|2153627_2154965_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	35.7	2.6e-62
>prophage 165
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	2165164	2172533	4978613		Staphylococcus_phage(33.33%)	8	NA	NA
WP_001307474.1|2165164_2165422_-	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	56.7	5.4e-17
WP_000239730.1|2165385_2165745_-	ribonuclease P protein component	NA	NA	NA	NA	NA
WP_000831330.1|2165761_2165902_-	50S ribosomal protein L34	NA	NA	NA	NA	NA
WP_120795392.1|2166131_2166212_-	protein YsdD	NA	NA	NA	NA	NA
WP_000059111.1|2166508_2167912_+	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
WP_000673464.1|2167916_2169017_+	DNA polymerase III subunit beta	NA	B4UTW9	Rhizobium_phage	35.0	4.1e-53
WP_000060116.1|2169016_2170090_+	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_000072071.1|2170118_2172533_+	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	34.1	1.8e-114
>prophage 166
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	2177239	2178388	4978613		Oenococcus_phage(100.0%)	1	NA	NA
WP_000705001.1|2177239_2178388_+	galactonate dehydratase	NA	Q6A202	Oenococcus_phage	32.8	3.6e-52
>prophage 167
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	2182815	2183769	4978613		Cyanophage(50.0%)	2	NA	NA
WP_001243437.1|2182815_2183229_+	heat shock chaperone IbpA	NA	A0A1D7SU06	Cyanophage	36.2	1.0e-17
WP_001243431.1|2183340_2183769_+	heat shock chaperone IbpB	NA	A0A1D8KPX5	Synechococcus_phage	36.4	2.1e-13
>prophage 168
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	2190122	2199284	4978613		Aeromonas_phage(25.0%)	10	NA	NA
WP_001087147.1|2190122_2191838_+	solute:sodium symporter family transporter	NA	A0A240F3J2	Aeromonas_phage	29.6	5.6e-41
WP_000828483.1|2191834_2193328_+	sulfatase-like hydrolase/transferase	NA	A0A2K9L1A5	Tupanvirus	25.4	1.1e-29
WP_000511287.1|2193374_2193824_-	membrane protein	NA	NA	NA	NA	NA
WP_000703959.1|2193933_2194281_+	YidH family protein	NA	NA	NA	NA	NA
WP_001113432.1|2194270_2194633_+	DUF202 domain-containing protein	NA	NA	NA	NA	NA
WP_000148039.1|2194629_2195127_+	radical SAM protein	NA	NA	NA	NA	NA
WP_000828746.1|2195134_2196319_-	multidrug efflux MFS transporter EmrD	NA	S4TR35	Salmonella_phage	23.5	8.9e-14
WP_000060506.1|2196737_2196827_-	type I toxin-antitoxin system toxin TisB	NA	NA	NA	NA	NA
WP_001315912.1|2197391_2197490_+	ilvB operon leader peptide IvbL	NA	NA	NA	NA	NA
WP_000168480.1|2197595_2199284_+	acetolactate synthase large subunit	NA	E5EQ70	Micromonas_sp._RCC1109_virus	29.7	4.2e-57
>prophage 169
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	2206588	2207923	4978613		Moraxella_phage(100.0%)	1	NA	NA
WP_001349999.1|2206588_2207923_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	37.2	6.6e-66
>prophage 170
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	2221185	2222577	4978613		environmental_Halophage(100.0%)	1	NA	NA
WP_001295238.1|2221185_2222577_-	xanthine/proton symporter XanP	NA	H9YQ34	environmental_Halophage	100.0	1.4e-71
>prophage 171
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	2227698	2234449	4978613		Bordetella_phage(25.0%)	6	NA	NA
WP_000280488.1|2227698_2229807_-	bifunctional GTP diphosphokinase/guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase	NA	A0A291L9W9	Bordetella_phage	34.5	4.8e-10
WP_000135058.1|2229825_2230101_-	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_001295237.1|2230155_2230779_-	guanylate kinase	NA	K4JYM5	Abalone_herpesvirus	34.5	4.1e-18
WP_000870053.1|2231036_2232719_+	NAD-dependent DNA ligase LigB	NA	F8SJM3	Pseudomonas_phage	22.3	1.9e-22
WP_000924289.1|2232715_2233333_-	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
WP_001297374.1|2233624_2234449_-	DNA damage-inducible protein D	NA	A0A1W6JPJ7	Morganella_phage	77.0	6.3e-91
>prophage 172
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	2237821	2242384	4978613		Xanthomonas_phage(25.0%)	7	NA	NA
WP_001298007.1|2237821_2238277_-	dUTP diphosphatase	NA	Q2NP83	Xanthomonas_phage	59.5	7.3e-49
WP_000050139.1|2238257_2239478_-	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	33.9	6.5e-44
WP_001298959.1|2239649_2240318_+	JAB domain-containing protein	NA	NA	NA	NA	NA
WP_000091955.1|2240534_2240771_+	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_001051798.1|2240791_2240959_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_001114533.1|2241056_2241866_+	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	F8WPX6	Bacillus_phage	32.2	2.6e-25
WP_001171866.1|2241904_2242384_-	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	42.0	4.8e-27
>prophage 173
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	2249822	2251916	4978613		Archaeal_BJ1_virus(50.0%)	2	NA	NA
WP_000364782.1|2249822_2250848_+	UDP-galactose--(galactosyl) LPS alpha1,2-galactosyltransferase	NA	A0ZYL4	Archaeal_BJ1_virus	25.5	1.4e-10
WP_000064012.1|2250932_2251916_+	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	38.5	2.4e-12
>prophage 174
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	2255315	2264821	4978613		Synechococcus_phage(16.67%)	9	NA	NA
WP_000587750.1|2255315_2256248_-	ADP-glyceromanno-heptose 6-epimerase	NA	E3SL51	Synechococcus_phage	39.3	8.5e-36
WP_001213834.1|2256461_2257658_+	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	29.4	4.9e-36
WP_000646014.1|2257667_2258693_+	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	84.6	2.1e-19
WP_000982091.1|2258931_2259966_+	UDP-glucuronate:LPS(HepIII) glycosyltransferase	NA	A0A1V0SAH6	Catovirus	28.7	5.8e-09
WP_000483856.1|2259952_2260912_-	divergent polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_001214147.1|2260915_2262199_-	murein hydrolase activator EnvC	NA	G9BW84	Planktothrix_phage	34.3	1.0e-07
WP_000116566.1|2262208_2263753_-	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_001315904.1|2263997_2264429_+	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_000024392.1|2264569_2264821_+	glutaredoxin 3	NA	V9QKN6	Rhizobium_phage	54.8	2.0e-16
>prophage 175
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	2286917	2297608	4978613	tRNA	uncultured_Caudovirales_phage(66.67%)	7	NA	NA
WP_001346013.1|2286917_2287751_-	RHS repeat protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	47.0	3.3e-23
WP_000072855.1|2287903_2288746_-	lyase	NA	NA	NA	NA	NA
WP_001271686.1|2288850_2289234_-	protein YhhH	NA	NA	NA	NA	NA
WP_000015317.1|2289205_2293441_-	RHS repeat protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	32.3	7.3e-26
WP_000779792.1|2293669_2294278_+	glutathione S-transferase	NA	NA	NA	NA	NA
WP_000206275.1|2294375_2295767_+|tRNA	L-seryl-tRNA(Sec) selenium transferase	tRNA	NA	NA	NA	NA
WP_000582482.1|2295763_2297608_+	selenocysteine-specific translation elongation factor	NA	A0A2K9KZ60	Tupanvirus	27.2	1.5e-15
>prophage 176
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	2326032	2327574	4978613		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001146482.1|2326032_2327574_-	D-xylose ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.3	2.5e-16
>prophage 177
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	2332892	2333888	4978613		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
WP_001182653.1|2332892_2333888_-	acyltransferase	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	26.7	9.1e-12
>prophage 178
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	2338112	2338325	4978613		Morganella_phage(100.0%)	1	NA	NA
WP_000014594.1|2338112_2338325_-	RNA chaperone/antiterminator CspA	NA	A0A1W6JNX5	Morganella_phage	72.9	2.7e-22
>prophage 179
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	2341979	2344313	4978613		Escherichia_phage(100.0%)	1	NA	NA
WP_000013909.1|2341979_2344313_+	biotin sulfoxide reductase	NA	A0A077SK27	Escherichia_phage	29.4	4.9e-72
>prophage 180
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	2354527	2356512	4978613		Planktothrix_phage(50.0%)	2	NA	NA
WP_001196486.1|2354527_2355511_+	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.8	3.9e-15
WP_000107018.1|2355507_2356512_+	dipeptide ABC transporter ATP binding subunit DppF	NA	G3M9Y6	Bacillus_virus	29.9	8.6e-18
>prophage 181
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	2403492	2404140	4978613		Bacillus_virus(100.0%)	1	NA	NA
WP_001296814.1|2403492_2404140_+	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	38.5	6.1e-17
>prophage 182
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	2409020	2411155	4978613		uncultured_Caudovirales_phage(100.0%)	3	NA	NA
WP_000065786.1|2409020_2409446_-	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.7	2.5e-51
WP_000922639.1|2409458_2410748_-	arsenite/antimonite:H(+) antiporter ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	73.5	4.6e-173
WP_000008957.1|2410801_2411155_-	arsenical resistance operon transcriptional regulator ArsR	NA	A0A2H4J145	uncultured_Caudovirales_phage	50.9	9.7e-25
>prophage 183
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	2414500	2416543	4978613		Indivirus(100.0%)	1	NA	NA
WP_001295214.1|2414500_2416543_+	oligopeptidase A	NA	A0A1V0SD92	Indivirus	22.9	3.4e-45
>prophage 184
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	2433591	2436920	4978613		Bacillus_phage(66.67%)	4	NA	NA
WP_000647571.1|2433591_2433942_-	DUF305 domain-containing protein	NA	A0A218MND9	uncultured_virus	61.4	8.1e-16
WP_000790485.1|2434089_2434521_-	silver-binding protein SilE	NA	NA	NA	NA	NA
WP_001475870.1|2434765_2436247_-	copper/silver sensor histidine kinase SilS	NA	W8CYF6	Bacillus_phage	30.1	1.8e-27
WP_000697968.1|2436239_2436920_-	copper/silver response regulator transcription factor SilR	NA	W8CYM9	Bacillus_phage	36.0	2.7e-31
>prophage 185
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	2444092	2449703	4978613	transposase	Stx2-converting_phage(75.0%)	5	NA	NA
WP_001353604.1|2444092_2446540_+	Ag(+)-translocating P-type ATPase SilP	NA	A0A218MNH6	uncultured_virus	35.3	1.3e-83
WP_000843494.1|2446580_2446778_+	DUF2933 domain-containing protein	NA	NA	NA	NA	NA
WP_000381379.1|2447087_2448659_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	7.6e-170
WP_000624622.1|2448678_2449026_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_001339397.1|2449025_2449703_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
>prophage 186
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	2455350	2457428	4978613		Bacillus_phage(100.0%)	2	NA	NA
WP_001188930.1|2455350_2456031_+	copper response regulator transcription factor PcoR	NA	W8CYM9	Bacillus_phage	34.4	8.7e-30
WP_001211180.1|2456027_2457428_+	copper resistance membrane spanning protein PcoS	NA	W8CYF6	Bacillus_phage	26.6	3.2e-18
>prophage 187
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	2465112	2470995	4978613		Staphylococcus_phage(50.0%)	5	NA	NA
WP_000149165.1|2465112_2467848_+	ribosome-associated ATPase/putative transporter RbbA	NA	A0A2H4PQG7	Staphylococcus_phage	30.6	5.4e-22
WP_001314210.1|2467847_2468972_+	ABC-2 transporter permease	NA	NA	NA	NA	NA
WP_000593555.1|2469302_2469662_+	type II toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_001190062.1|2469781_2470183_-	nickel-responsive transcriptional regulator NikR	NA	NA	NA	NA	NA
WP_000173666.1|2470188_2470995_-	nickel import ATP-binding protein NikE	NA	G3M9Y6	Bacillus_virus	29.1	4.5e-17
>prophage 188
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	2478888	2483020	4978613		Dickeya_phage(50.0%)	4	NA	NA
WP_001100467.1|2478888_2479554_-	7-cyano-7-deazaguanine/7-aminomethyl-7- deazaguanine transporter	NA	A0A2I7SAW6	Vibrio_phage	53.6	5.6e-58
WP_000130621.1|2479774_2480020_+	sulfurtransferase TusA	NA	A0A140XB86	Dickeya_phage	83.3	8.0e-10
WP_000106510.1|2480121_2482320_-	Zn(II)/Cd(II)/Pb(II) translocating P-type ATPase ZntA	NA	E4ZFI9	Streptococcus_phage	38.3	1.1e-118
WP_000964718.1|2482393_2483020_-	lysoplasmalogenase	NA	A0A140XAH6	Dickeya_phage	61.9	1.2e-30
>prophage 189
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	2486026	2488845	4978613		Staphylococcus_phage(50.0%)	3	NA	NA
WP_000617723.1|2486026_2486695_+	cell division ATP-binding protein FtsE	NA	A0A2H4PQG7	Staphylococcus_phage	25.1	5.0e-14
WP_001042003.1|2486687_2487746_+	cell division protein FtsX	NA	NA	NA	NA	NA
WP_000130217.1|2487990_2488845_+	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	41.9	3.5e-44
>prophage 190
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	2495326	2496809	4978613		Anomala_cuprea_entomopoxvirus(50.0%)	2	NA	NA
WP_000082101.1|2495326_2496094_+	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivG	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.6	4.9e-13
WP_000416895.1|2496095_2496809_+	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivF	NA	G9BWD6	Planktothrix_phage	31.1	9.1e-14
>prophage 191
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	2500349	2502160	4978613		Planktothrix_phage(50.0%)	2	NA	NA
WP_000907790.1|2500349_2501420_+	sn-glycerol-3-phosphate import ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	33.7	1.7e-19
WP_000073609.1|2501416_2502160_+	glycerophosphodiester phosphodiesterase	NA	A0A0S2MYI4	Enterococcus_phage	25.0	8.3e-10
>prophage 192
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	2522168	2524616	4978613		Dickeya_phage(100.0%)	1	NA	NA
WP_000993449.1|2522168_2524616_+	glycogen phosphorylase	NA	A0A140XAG6	Dickeya_phage	81.0	2.1e-33
>prophage 193
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	2534797	2535847	4978613		Ralstonia_phage(100.0%)	1	NA	NA
WP_099588390.1|2534797_2535847_+	RtcB family protein	NA	A0A1L7N133	Ralstonia_phage	58.5	9.7e-113
>prophage 194
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	2540226	2542620	4978613		Iris_mild_mosaic_virus(100.0%)	1	NA	NA
WP_000081909.1|2540226_2542620_+	maltodextrin phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	42.5	4.3e-15
>prophage 195
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	2548589	2549468	4978613		Sodalis_phage(100.0%)	1	NA	NA
WP_000039057.1|2548589_2549468_-	recombination-promoting nuclease RpnA	NA	Q2A0A7	Sodalis_phage	52.4	4.7e-68
>prophage 196
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	2556031	2560543	4978613		Bacillus_phage(66.67%)	5	NA	NA
WP_001157751.1|2556031_2556751_+	two-component system response regulator OmpR	NA	W8CYM9	Bacillus_phage	34.7	3.5e-29
WP_001253696.1|2556747_2558100_+	two-component system sensor histidine kinase EnvZ	NA	W8CYF6	Bacillus_phage	23.8	3.6e-11
WP_000650976.1|2558131_2558428_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000493756.1|2558486_2558804_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001265681.1|2558920_2560543_-	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	52.5	5.3e-142
>prophage 197
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	2577521	2578358	4978613		Vibrio_phage(100.0%)	1	NA	NA
WP_000742143.1|2577521_2578358_+	adenine-specific DNA-methyltransferase	NA	A0A1S6L1V5	Vibrio_phage	49.1	4.9e-67
>prophage 198
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	2602593	2612134	4978613		Acinetobacter_phage(25.0%)	9	NA	NA
WP_000601847.1|2602593_2603157_+	aminodeoxychorismate synthase component 2	NA	A0A0P0IKJ1	Acinetobacter_phage	55.8	1.2e-61
WP_000963784.1|2603242_2604463_+	bifunctional acetylornithine/succinyldiaminopimelate transaminase	NA	NA	NA	NA	NA
WP_001295162.1|2604529_2606620_-	membrane protein	NA	H9YQA8	environmental_Halophage	100.0	1.7e-76
WP_000242755.1|2606670_2607303_-	cAMP-activated global transcriptional regulator CRP	NA	NA	NA	NA	NA
WP_001148908.1|2607604_2608009_+	OsmC family protein	NA	NA	NA	NA	NA
WP_001274680.1|2608063_2608933_-	phosphoribulokinase	NA	NA	NA	NA	NA
WP_000907085.1|2608986_2609205_-	YheU family protein	NA	A0A2H4J8A7	uncultured_Caudovirales_phage	40.3	3.1e-05
WP_000057405.1|2609198_2610221_-	hydrolase	NA	NA	NA	NA	NA
WP_000634798.1|2610220_2612134_-	ABC transporter ATP-binding protein	NA	A0A2K9L0W2	Tupanvirus	33.5	4.3e-74
>prophage 199
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	2617704	2623278	4978613		uncultured_Caudovirales_phage(33.33%)	7	NA	NA
WP_001209689.1|2617704_2618091_+	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	39.1	3.3e-18
WP_000820720.1|2618090_2618450_+	sulfurtransferase complex subunit TusC	NA	NA	NA	NA	NA
WP_000903377.1|2618457_2618745_+	sulfurtransferase complex subunit TusB	NA	NA	NA	NA	NA
WP_000246815.1|2618870_2619245_+	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_001138043.1|2619341_2619812_+	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_000124700.1|2619908_2622023_+	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	27.5	5.2e-57
WP_000031783.1|2622093_2623278_+	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.1	4.4e-13
>prophage 200
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	2643155	2644627	4978613	tRNA	Prochlorococcus_phage(50.0%)	2	NA	NA
WP_000004454.1|2643155_2644103_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	35.7	1.4e-06
WP_000114984.1|2644117_2644627_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	41.9	3.9e-19
>prophage 201
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	2655130	2659284	4978613		Bacillus_virus(50.0%)	4	NA	NA
WP_000078338.1|2655130_2655889_-	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.8	1.2e-19
WP_001299298.1|2655896_2657000_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_000019655.1|2657009_2658191_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_000738575.1|2658258_2659284_-	amino acid ABC transporter substrate-binding protein	NA	A0A1B1IT51	uncultured_Mediterranean_phage	39.5	6.9e-71
>prophage 202
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	2665788	2666673	4978613		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_001258900.1|2665788_2666673_-	adenine-specific DNA-methyltransferase	NA	M4QNN5	Ostreococcus_lucimarinus_virus	30.2	1.1e-24
>prophage 203
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	2677238	2678282	4978613		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_000913396.1|2677238_2678282_+	rod shape-determining protein	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
>prophage 204
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	2694777	2697302	4978613	protease	uncultured_archaeal_virus(50.0%)	2	NA	NA
WP_000497724.1|2694777_2695845_-	outer membrane-stress sensor serine endopeptidase DegS	NA	A0A1S5Y2X3	uncultured_archaeal_virus	24.2	6.8e-05
WP_001295271.1|2695934_2697302_-|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	25.6	2.3e-21
>prophage 205
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	2701268	2701766	4978613	protease	Pseudomonas_phage(100.0%)	1	NA	NA
WP_000366129.1|2701268_2701766_+|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	42.9	3.3e-26
>prophage 206
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	2705470	2710218	4978613		Burkholderia_virus(50.0%)	5	NA	NA
WP_000108460.1|2705470_2706961_+	sialic acid transporter NanT	NA	Q6JIH2	Burkholderia_virus	23.6	4.9e-09
WP_000054239.1|2707008_2707698_+	N-acetylmannosamine-6-phosphate 2-epimerase	NA	NA	NA	NA	NA
WP_000209027.1|2707694_2708570_+	N-acetylmannosamine kinase	NA	NA	NA	NA	NA
WP_000979880.1|2708566_2709031_+	YhcH/YjgK/YiaL family protein	NA	NA	NA	NA	NA
WP_000445142.1|2709090_2710218_-	DUF1016 domain-containing protein	NA	A0A0U2BZN7	Salmonella_phage	88.5	4.7e-73
>prophage 207
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	2716967	2731761	4978613		Staphylococcus_phage(25.0%)	17	NA	NA
WP_001176896.1|2716967_2717897_+	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	35.0	8.8e-17
WP_000809774.1|2717992_2720329_+	aerobic respiration two-component sensor histidine kinase ArcB	NA	A0A1V0SGX0	Hokovirus	31.2	1.7e-40
WP_001299134.1|2720558_2721212_+	isoprenoid biosynthesis glyoxalase ElbB	NA	NA	NA	NA	NA
WP_000047091.1|2721208_2721937_+	monofunctional biosynthetic peptidoglycan transglycosylase	NA	NA	NA	NA	NA
WP_000620387.1|2721933_2722566_-	PhoP regulatory network protein YrbL	NA	NA	NA	NA	NA
WP_000216791.1|2722778_2723051_-	PTS phosphocarrier protein NPr	NA	NA	NA	NA	NA
WP_000243741.1|2723047_2723902_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	28.4	1.1e-05
WP_000183676.1|2723947_2724439_-	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
WP_001176599.1|2724556_2724844_-	ribosome hibernation promoting factor	NA	A0A0M7QCF2	Escherichia_phage	44.3	2.5e-10
WP_000809051.1|2724866_2726300_-	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_000224099.1|2726347_2727073_-	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	3.2e-22
WP_000669785.1|2727079_2727637_-	lipopolysaccharide ABC transporter substrate-binding protein LptA	NA	NA	NA	NA	NA
WP_000030537.1|2727605_2728181_-	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_000030005.1|2728177_2728744_-	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	75.7	1.4e-54
WP_001295557.1|2728764_2729751_-	arabinose-5-phosphate isomerase KdsD	NA	A0A2P0VNK5	Tetraselmis_virus	31.5	1.9e-38
WP_000922872.1|2729764_2730742_-	calcium/sodium antiporter	NA	NA	NA	NA	NA
WP_000438245.1|2730951_2731761_+	phospholipid ABC transporter ATP-binding protein MlaF	NA	G3M9Y6	Bacillus_virus	29.3	2.2e-19
>prophage 208
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	2735829	2737307	4978613		Vibrio_phage(50.0%)	2	NA	NA
WP_000445413.1|2735829_2736108_-	DNA-binding transcriptional regulator SfsB	NA	A0A2I7S995	Vibrio_phage	71.4	2.6e-17
WP_001047336.1|2736335_2737307_-	octaprenyl diphosphate synthase	NA	A0A1V0SE37	Indivirus	25.8	6.0e-08
>prophage 209
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	2743935	2746808	4978613	protease	Micromonas_pusilla_virus(50.0%)	2	NA	NA
WP_001107467.1|2743935_2745870_+|protease	ATP-dependent zinc metalloprotease FtsH	protease	G8DDJ2	Micromonas_pusilla_virus	43.6	6.3e-118
WP_000764731.1|2745959_2746808_+	dihydropteroate synthase	NA	S4W084	Pandoravirus	29.9	3.4e-23
>prophage 210
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	2750890	2757529	4978613		Dickeya_phage(50.0%)	4	NA	NA
WP_000207685.1|2750890_2752234_-	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	92.9	1.1e-63
WP_001300397.1|2752864_2753317_+	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_001031057.1|2753344_2754832_+	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_000133043.1|2754856_2757529_+	translation initiation factor IF-2	NA	E3T4N3	Cafeteria_roenbergensis_virus	26.3	1.5e-24
>prophage 211
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	2763010	2764900	4978613		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_001295553.1|2763010_2764900_+	DEAD/DEAH family ATP-dependent RNA helicase	NA	A0A0N9Q9J4	Chrysochromulina_ericina_virus	30.8	2.0e-52
>prophage 212
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	2772006	2779799	4978613		Diadromus_pulchellus_ascovirus(25.0%)	10	NA	NA
WP_001345969.1|2772006_2772309_-	DNA damage response exodeoxyribonuclease YhbQ	NA	F2NZ06	Diadromus_pulchellus_ascovirus	52.5	1.7e-14
WP_000449451.1|2772359_2772803_+	YhbP family protein	NA	NA	NA	NA	NA
WP_000037608.1|2772782_2773301_-	protein/nucleic acid deglycase	NA	A0A0N7KVR4	Yellowstone_lake_phycodnavirus	27.0	4.4e-10
WP_001315854.1|2773428_2774064_+	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_000147619.1|2774136_2775177_+	permease	NA	NA	NA	NA	NA
WP_000646033.1|2775290_2775866_-	divisome-associated lipoprotein YraP	NA	NA	NA	NA	NA
WP_001158035.1|2775875_2776466_-	DnaA initiator-associating protein DiaA	NA	A0A067XQR2	Caulobacter_phage	31.1	5.4e-12
WP_000246855.1|2776485_2776881_-	YraN family protein	NA	NA	NA	NA	NA
WP_000249144.1|2776838_2778875_-	penicillin-binding protein activator	NA	NA	NA	NA	NA
WP_000809253.1|2778938_2779799_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	43.3	2.1e-49
>prophage 213
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	2802807	2803953	4978613		Streptococcus_phage(100.0%)	1	NA	NA
WP_001299416.1|2802807_2803953_+	glycerate 2-kinase	NA	W6LM47	Streptococcus_phage	41.3	1.7e-49
>prophage 214
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	2812272	2814567	4978613		Tetraselmis_virus(100.0%)	1	NA	NA
WP_000861734.1|2812272_2814567_+	2-ketobutyrate formate-lyase/pyruvate formate-lyase	NA	A0A2P0VNR5	Tetraselmis_virus	41.0	7.4e-158
>prophage 215
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	2840800	2841766	4978613		Escherichia_phage(100.0%)	1	NA	NA
WP_001098805.1|2840800_2841766_-	TerC family membrane protein Alx	NA	A0A291LBC5	Escherichia_phage	33.8	5.2e-36
>prophage 216
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	2854187	2870382	4978613	tRNA	Herpes_simplex_virus(16.67%)	12	NA	NA
WP_001082883.1|2854187_2857280_-	beta-galactosidase subunit alpha	NA	L0N6M2	Herpes_simplex_virus	34.2	2.0e-158
WP_000212465.1|2857463_2858447_-	transcriptional regulator EbgR	NA	NA	NA	NA	NA
WP_000450589.1|2858665_2858998_+|tRNA	tRNA-binding protein	tRNA	NA	NA	NA	NA
WP_000627213.1|2859039_2860530_-	putrescine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	28.6	4.8e-33
WP_000094682.1|2860836_2862357_+	aerotaxis sensor receptor Aer	NA	A0A1B0V854	Salmonella_phage	52.2	1.4e-35
WP_000018003.1|2862510_2863134_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001065909.1|2863421_2864186_+	NADPH-dependent ferric chelate reductase	NA	NA	NA	NA	NA
WP_000228937.1|2864439_2864946_+	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
WP_000437371.1|2865024_2866866_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.3e-35
WP_000918827.1|2867060_2868806_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.4	1.1e-76
WP_001144069.1|2868916_2869132_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_001264365.1|2869368_2870382_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.2	4.8e-109
>prophage 217
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	2876764	2878003	4978613	tRNA	Sinorhizobium_phage(100.0%)	1	NA	NA
WP_000708500.1|2876764_2878003_-|tRNA	fused tRNA nucleotidyltransferase/2',3'-cyclic phosphodiesterase/2' nucleotidase/phosphatase Cca	tRNA	A0A0F6YPT7	Sinorhizobium_phage	51.6	5.9e-93
>prophage 218
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	2883140	2884574	4978613		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_000869178.1|2883140_2884574_+	bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE	NA	A0A1B1IUK5	uncultured_Mediterranean_phage	29.4	3.0e-40
>prophage 219
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	2894089	2905051	4978613		Staphylococcus_phage(20.0%)	12	NA	NA
WP_001076997.1|2894089_2894743_+	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	44.3	4.9e-46
WP_000469266.1|2895003_2895174_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001295627.1|2895231_2896005_-	zinc transporter ZupT	NA	NA	NA	NA	NA
WP_000188373.1|2896120_2896936_+	4,5-DOPA dioxygenase extradiol	NA	NA	NA	NA	NA
WP_000442860.1|2896973_2898134_-	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.1	3.5e-87
WP_000831543.1|2898139_2898811_-	DUF1190 family protein	NA	A0A173GEW8	Erwinia_phage	44.3	4.8e-33
WP_000735278.1|2898958_2900440_-	outer membrane channel protein TolC	NA	NA	NA	NA	NA
WP_000917117.1|2900644_2901274_+	ADP-ribose diphosphatase	NA	A0A1S6L1P8	Vibrio_phage	32.5	9.2e-18
WP_000833393.1|2901274_2901697_+	DUF1249 family protein	NA	NA	NA	NA	NA
WP_000444747.1|2901721_2902549_+	3',5'-cyclic-AMP phosphodiesterase	NA	NA	NA	NA	NA
WP_000105733.1|2902548_2903130_+	esterase YqiA	NA	NA	NA	NA	NA
WP_000195296.1|2903158_2905051_+	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	35.1	3.4e-92
>prophage 220
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	2917163	2927986	4978613		Stx_converting_phage(25.0%)	9	NA	NA
WP_000712658.1|2917163_2917556_+	OB fold stress tolerance protein YgiW	NA	A0A1I9LJU6	Stx_converting_phage	49.1	9.4e-21
WP_000183494.1|2917608_2918091_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_001281881.1|2918636_2920895_+	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	35.1	1.4e-84
WP_000965712.1|2921127_2921865_+	1-acylglycerol-3-phosphate O-acyltransferase	NA	NA	NA	NA	NA
WP_000059395.1|2921939_2923352_+	cell division protein FtsP	NA	NA	NA	NA	NA
WP_000095187.1|2923462_2925682_+	YgiQ family radical SAM protein	NA	M1QSD9	Pseudomonas_phage	70.4	7.8e-104
WP_000848528.1|2925724_2925982_-	lipoprotein YqhH	NA	NA	NA	NA	NA
WP_001422257.1|2926032_2926959_-	YbjP/YqhG family protein	NA	NA	NA	NA	NA
WP_000013149.1|2927158_2927986_-	2,5-didehydrogluconate reductase DkgA	NA	A0A2H4PQR8	Staphylococcus_phage	45.2	7.2e-63
>prophage 221
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	2935348	2936233	4978613		Diadromus_pulchellus_ascovirus(100.0%)	1	NA	NA
WP_000018760.1|2935348_2936233_-	NADP(+)-dependent aldehyde reductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	47.1	1.7e-65
>prophage 222
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	2959731	2960904	4978613		Emiliania_huxleyi_virus(100.0%)	1	NA	NA
WP_000524972.1|2959731_2960904_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	D2TEZ5	Emiliania_huxleyi_virus	30.7	4.2e-40
>prophage 223
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	3015744	3016899	4978613		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001062128.1|3015744_3016899_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	63.2	4.0e-128
>prophage 224
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	3030613	3031153	4978613		Bacillus_virus(100.0%)	1	NA	NA
WP_001422014.1|3030613_3031153_-	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	26.0	5.7e-08
>prophage 225
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	3049089	3050322	4978613		Catovirus(100.0%)	1	NA	NA
WP_001151604.1|3049089_3050322_+	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	48.4	1.9e-104
>prophage 226
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	3058849	3064217	4978613		Prochlorococcus_phage(50.0%)	3	NA	NA
WP_099588400.1|3058849_3061723_+	aminomethyl-transferring glycine dehydrogenase	NA	E3SN07	Prochlorococcus_phage	52.0	2.4e-262
WP_000951964.1|3061983_3062727_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_001363803.1|3062783_3064217_-	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	26.1	2.6e-31
>prophage 227
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	3068022	3083414	4978613	tRNA	Brevibacillus_phage(14.29%)	14	NA	NA
WP_000806638.1|3068022_3068919_+	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	28.6	6.7e-30
WP_000715214.1|3068943_3069654_+	bifunctional protein-disulfide isomerase/oxidoreductase DsbC	NA	NA	NA	NA	NA
WP_000813215.1|3069659_3071393_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	28.5	3.2e-60
WP_001701073.1|3071483_3072581_+	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	39.0	1.8e-05
WP_000003068.1|3072591_3074109_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.7	5.9e-87
WP_001192804.1|3074151_3074700_-	isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_120795390.1|3074754_3074826_+	protein YqfH	NA	NA	NA	NA	NA
WP_001010156.1|3074822_3074948_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001295374.1|3074949_3076398_-	purine permease	NA	Q9KX94	Enterobacteria_phage	26.8	7.3e-26
WP_001367088.1|3076833_3078753_+	formate-dependent uric acid utilization protein YgfT	NA	NA	NA	NA	NA
WP_000838428.1|3078752_3079241_+	4Fe-4S dicluster domain-containing protein	NA	NA	NA	NA	NA
WP_000012163.1|3079276_3080644_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	73.1	2.1e-160
WP_001295158.1|3080679_3081996_-	guanine deaminase	NA	NA	NA	NA	NA
WP_001280215.1|3082013_3083414_-	xanthine/proton symporter XanQ	NA	H9YQ34	environmental_Halophage	46.1	1.7e-19
>prophage 228
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	3107693	3108449	4978613		Clostridium_phage(100.0%)	1	NA	NA
WP_001272558.1|3107693_3108449_+	peptidoglycan DD-metalloendopeptidase family protein	NA	I2E8W3	Clostridium_phage	36.8	1.1e-12
>prophage 229
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	3131276	3133764	4978613		Trichoplusia_ni_ascovirus(50.0%)	2	NA	NA
WP_000603518.1|3131276_3132038_+	2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.7	7.7e-19
WP_000256438.1|3132345_3133764_+	sugar porter family MFS transporter	NA	O13311	Aichi_virus	26.9	1.8e-24
>prophage 230
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	3143395	3150168	4978613		Moraxella_phage(33.33%)	6	NA	NA
WP_000895624.1|3143395_3144109_-	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	47.3	2.6e-45
WP_000082188.1|3144177_3144867_-	DNA mismatch repair endonuclease MutH	NA	NA	NA	NA	NA
WP_000564489.1|3145551_3146082_+	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_000957914.1|3146094_3148341_+	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	26.2	2.7e-11
WP_000204658.1|3148491_3149367_+	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_000816232.1|3149373_3150168_+	thymidylate synthase	NA	A6M9A2	Geobacillus_virus	70.8	7.6e-118
>prophage 231
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	3155645	3171032	4978613	tRNA	Klosneuvirus(16.67%)	9	NA	NA
WP_001138163.1|3155645_3158534_+	pitrilysin	NA	A0A1V0SJA4	Klosneuvirus	25.6	1.2e-67
WP_001285985.1|3158526_3162069_+	exodeoxyribonuclease V subunit beta	NA	G3MA40	Bacillus_virus	21.8	1.5e-08
WP_000775946.1|3162068_3163895_+	exodeoxyribonuclease V subunit alpha	NA	A0A1P8DII4	Virus_Rctr197k	26.6	7.8e-25
WP_000237948.1|3163956_3165288_-	amino-acid N-acetyltransferase	NA	NA	NA	NA	NA
WP_000016907.1|3165519_3166773_+	N-acetylmuramoyl-L-alanine amidase	NA	Q5YA51	Bacillus_phage	28.6	2.2e-15
WP_000678646.1|3167352_3168450_+	murein transglycosylase A	NA	NA	NA	NA	NA
WP_000117728.1|3168526_3169333_+|tRNA	tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA	tRNA	S4VW33	Pandoravirus	33.3	2.2e-16
WP_000184253.1|3169383_3169827_-	cysteine desulfurase sulfur acceptor subunit CsdE	NA	NA	NA	NA	NA
WP_001300698.1|3169826_3171032_-	cysteine desulfurase CsdA	NA	Q2XUY6	environmental_halophage	36.8	3.0e-73
>prophage 232
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	3182558	3183314	4978613		Bacillus_phage(100.0%)	1	NA	NA
WP_000268232.1|3182558_3183314_-	flap endonuclease Xni	NA	F8WQ40	Bacillus_phage	33.5	5.0e-10
>prophage 233
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	3188172	3189021	4978613		Vibrio_phage(100.0%)	1	NA	NA
WP_000100394.1|3188172_3189021_-	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A2I7SAX1	Vibrio_phage	37.1	1.0e-40
>prophage 234
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	3200145	3201447	4978613		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_000046790.1|3200145_3201447_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	27.7	2.0e-38
>prophage 235
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	3205479	3211322	4978613		Only_Syngen_Nebraska_virus(33.33%)	6	NA	NA
WP_000210878.1|3205479_3207117_+	CTP synthase (glutamine hydrolyzing)	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	50.4	1.8e-153
WP_000036723.1|3207204_3208503_+	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	58.8	2.0e-131
WP_000034929.1|3208558_3208921_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000793004.1|3208956_3209862_-	YgcG family protein	NA	NA	NA	NA	NA
WP_001379137.1|3209875_3210478_-	LemA family protein	NA	NA	NA	NA	NA
WP_001199982.1|3210650_3211322_+	7-carboxy-7-deazaguanine synthase QueE	NA	A0A2I7S8X1	Vibrio_phage	25.0	1.7e-14
>prophage 236
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	3232003	3234036	4978613		Hokovirus(50.0%)	2	NA	NA
WP_001090346.1|3232003_3233431_+	sulfate adenylyltransferase subunit CysN	NA	A0A1V0SGC3	Hokovirus	27.6	2.8e-30
WP_001173673.1|3233430_3234036_+	adenylyl-sulfate kinase	NA	A0A2K9L4R9	Tupanvirus	38.1	4.2e-28
>prophage 237
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	3237148	3240864	4978613		uncultured_Mediterranean_phage(50.0%)	4	NA	NA
WP_001295182.1|3237148_3237910_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	3.4e-59
WP_000254708.1|3237903_3238530_+	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
WP_001272592.1|3238669_3239809_+	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
WP_000081550.1|3239871_3240864_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
>prophage 238
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	3246078	3253218	4978613		Escherichia_phage(83.33%)	6	NA	NA
WP_001278994.1|3246078_3246717_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_000590392.1|3246713_3247976_-	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	1.3e-135
WP_000847985.1|3247972_3248881_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_001297141.1|3249076_3249844_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	3.3e-70
WP_001141330.1|3249894_3250551_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.7	4.3e-50
WP_001272898.1|3250656_3253218_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.3e-30
>prophage 239
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	3271043	3272057	4978613		Enterobacteria_phage(100.0%)	1	NA	NA
WP_001300105.1|3271043_3272057_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	28.3	1.0e-26
>prophage 240
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	3279630	3280596	4978613		Tetraselmis_virus(100.0%)	1	NA	NA
WP_001287415.1|3279630_3280596_-	arabinose-5-phosphate isomerase GutQ	NA	A0A2P0VNK5	Tetraselmis_virus	33.9	1.8e-36
>prophage 241
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	3286062	3291622	4978613	tRNA	Pseudomonas_phage(25.0%)	5	NA	NA
WP_000132231.1|3286062_3286560_+	nicotinamide-nucleotide amidase	NA	B5TK85	Pseudomonas_phage	49.7	4.4e-31
WP_000963143.1|3286639_3287701_+	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	63.4	1.2e-113
WP_000140506.1|3287943_3288444_+	recombination regulator RecX	NA	NA	NA	NA	NA
WP_000047176.1|3288571_3291202_+|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L1X7	Tupanvirus	38.6	5.5e-80
WP_000906486.1|3291436_3291622_+	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	4.9e-12
>prophage 242
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	3304805	3310101	4978613		Bacillus_virus(20.0%)	5	NA	NA
WP_000985494.1|3304805_3306008_-	glycine betaine/L-proline ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	39.4	4.9e-28
WP_000777969.1|3306362_3307322_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	71.8	3.5e-133
WP_000246542.1|3307331_3309476_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	48.4	3.8e-196
WP_000080944.1|3309448_3309859_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	44.4	2.7e-18
WP_001223235.1|3309855_3310101_-	glutaredoxin-like protein NrdH	NA	Q5K5J3	Oenococcus_phage	35.3	2.4e-06
>prophage 243
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	3314036	3318087	4978613		Clostridium_phage(50.0%)	4	NA	NA
WP_000522424.1|3314036_3314486_+	potassium binding protein Kbp	NA	A0A090DBR9	Clostridium_phage	39.5	2.0e-06
WP_000156811.1|3314486_3315149_-	DNA-binding transcriptional regulator CsiR	NA	NA	NA	NA	NA
WP_001295173.1|3315169_3316570_-	GABA permease	NA	NA	NA	NA	NA
WP_000097674.1|3316806_3318087_-	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	30.3	1.1e-33
>prophage 244
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	3327568	3341033	4978613	transposase,integrase	Acinetobacter_phage(28.57%)	13	3314580:3314593	3341343:3341356
3314580:3314593	attL	TACCGCCGCAGTCA	NA	NA	NA	NA
WP_000340076.1|3327568_3327757_+	hypothetical protein	NA	A0A1S6L009	Salmonella_phage	69.2	9.1e-06
WP_001120794.1|3327911_3328031_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085950812.1|3328535_3329749_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	56.8	2.4e-99
WP_001283984.1|3329769_3330069_-	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_001367084.1|3330234_3330474_-	AlpA family phage regulatory protein	NA	A0A1V0E8E5	Vibrio_phage	49.2	2.5e-08
WP_000655916.1|3330587_3331469_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000925811.1|3331736_3331916_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085947771.1|3332380_3333542_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
WP_000532680.1|3333560_3334859_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085951104.1|3334872_3336035_-|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.2	2.6e-50
WP_001378315.1|3336648_3338388_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000113815.1|3338526_3339768_-|integrase	integrase	integrase	A0A1B5FPC6	Escherichia_phage	47.3	4.5e-101
WP_000162574.1|3340550_3341033_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
3341343:3341356	attR	TGACTGCGGCGGTA	NA	NA	NA	NA
>prophage 245
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	3354667	3355738	4978613		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
WP_001168044.1|3354667_3355738_+	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	4.0e-90
>prophage 246
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	3361644	3364218	4978613		Enterobacteria_phage(100.0%)	1	NA	NA
WP_001235102.1|3361644_3364218_+	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	2.6e-127
>prophage 247
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	3370085	3371384	4978613		Burkholderia_virus(100.0%)	1	NA	NA
WP_000841103.1|3370085_3371384_+	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	32.2	1.3e-45
>prophage 248
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	3376677	3382935	4978613	tRNA	Achromobacter_phage(25.0%)	7	NA	NA
WP_001098726.1|3376677_3377097_-	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
WP_000997411.1|3377303_3378341_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001262723.1|3378388_3379078_-	uracil-DNA glycosylase	NA	A0A077BCN4	Equid_alphaherpesvirus	52.1	2.1e-55
WP_000627807.1|3379382_3379766_+	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	72.0	1.4e-32
WP_000189206.1|3379820_3380408_-	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_000365855.1|3380510_3381392_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000219193.1|3381600_3382935_-	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.8	2.9e-45
>prophage 249
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	3388706	3392449	4978613		Tupanvirus(50.0%)	3	NA	NA
WP_000790168.1|3388706_3390506_+	elongation factor 4	NA	A0A2K9L6L3	Tupanvirus	41.9	4.2e-23
WP_000002542.1|3390521_3391496_+	signal peptidase I	NA	NA	NA	NA	NA
WP_001068343.1|3391768_3392449_+	ribonuclease III	NA	A0A2P0VNZ5	Tetraselmis_virus	39.6	5.6e-21
>prophage 250
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	3395907	3396168	4978613		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_001196283.1|3395907_3396168_-	4Fe-4S dicluster ferredoxin YfhL	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	52.3	1.1e-17
>prophage 251
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	3400288	3411596	4978613		Bacillus_phage(50.0%)	7	NA	NA
WP_000970122.1|3400288_3404176_+	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	58.9	7.7e-131
WP_001297612.1|3404751_3406179_+	two component system sensor histidine kinase QseE/GlrK	NA	W8CYF6	Bacillus_phage	24.9	3.0e-16
WP_001215888.1|3406343_3407057_+	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
WP_001298983.1|3407046_3408381_+	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	37.3	3.9e-10
WP_000717694.1|3408441_3408780_+	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
WP_000883122.1|3408824_3410015_-	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_000919159.1|3410342_3411596_+	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	52.7	7.8e-101
>prophage 252
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	3417354	3418866	4978613		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000493473.1|3417354_3418866_+	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.3	3.3e-13
>prophage 253
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	3434030	3440487	4978613		Faustovirus(20.0%)	8	NA	NA
WP_001295373.1|3434030_3435245_+	cysteine desulfurase	NA	A0A1X7C038	Faustovirus	31.8	8.8e-33
WP_000331707.1|3435272_3435659_+	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	78.9	1.4e-53
WP_000028953.1|3435675_3435999_+	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	48.6	5.4e-22
WP_000384411.1|3436094_3436610_+	co-chaperone HscB	NA	NA	NA	NA	NA
WP_001196613.1|3436626_3438477_+	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	41.6	5.5e-103
WP_001124469.1|3438478_3438814_+	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_000523616.1|3438825_3439026_+	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_000133582.1|3439203_3440487_+	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	37.8	2.2e-34
>prophage 254
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	3450372	3450804	4978613		Powai_lake_megavirus(100.0%)	1	NA	NA
WP_000963837.1|3450372_3450804_+	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	37.9	3.7e-18
>prophage 255
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	3459633	3465928	4978613		Escherichia_phage(60.0%)	6	NA	NA
WP_000937933.1|3459633_3461004_-	exodeoxyribonuclease VII large subunit	NA	A0A2H4UVM9	Bodo_saltans_virus	35.3	4.0e-42
WP_001299507.1|3461165_3462632_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	39.1	2.3e-88
WP_000138282.1|3462700_3464278_+	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_000755179.1|3464370_3464910_-	DUF5384 family protein	NA	G9L6F0	Escherichia_phage	98.3	4.1e-43
WP_000669403.1|3464925_3465441_-	glycine zipper 2TM domain-containing protein	NA	G9L6F1	Escherichia_phage	99.4	6.5e-62
WP_001344399.1|3465754_3465928_-	DUF2633 family protein	NA	G9L6F2	Escherichia_phage	100.0	6.8e-24
>prophage 256
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	3472362	3476364	4978613		Prochlorococcus_phage(33.33%)	4	NA	NA
WP_001028614.1|3472362_3473001_-	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	42.9	2.4e-29
WP_001295474.1|3473000_3474038_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SE90	Cyanophage	43.3	1.1e-71
WP_001295473.1|3474362_3474989_+	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000198328.1|3475074_3476364_+	uracil permease	NA	Q9KX94	Enterobacteria_phage	37.4	5.1e-63
>prophage 257
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	3497406	3498120	4978613		Synechococcus_phage(100.0%)	1	NA	NA
WP_001295467.1|3497406_3498120_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3FGF0	Synechococcus_phage	36.1	6.9e-38
>prophage 258
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	3516167	3517118	4978613		Cyanophage(100.0%)	1	NA	NA
WP_001003709.1|3516167_3517118_-	transaldolase	NA	A0A127KNC6	Cyanophage	31.3	5.7e-11
>prophage 259
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	3535672	3540610	4978613		Deep-sea_thermophilic_phage(33.33%)	6	NA	NA
WP_000102886.1|3535672_3536542_-	N-acetylmuramoyl-L-alanine amidase AmiA	NA	E5DV68	Deep-sea_thermophilic_phage	27.4	4.2e-13
WP_000406000.1|3536755_3537181_+	GNAT family acetyltransferase	NA	NA	NA	NA	NA
WP_001300381.1|3537167_3537617_+	DUF2919 domain-containing protein	NA	NA	NA	NA	NA
WP_000838945.1|3537677_3538253_+	RpoE-regulated lipoprotein	NA	NA	NA	NA	NA
WP_000084590.1|3538348_3539248_+	porphyrinogen peroxidase	NA	S4VVJ7	Pandoravirus	32.6	4.5e-26
WP_001315775.1|3539305_3540610_-	penicillin binding protein PBP4B	NA	A0A0B5A438	Mycobacterium_phage	26.2	1.6e-08
>prophage 260
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	3544088	3559458	4978613		Streptococcus_phage(33.33%)	15	NA	NA
WP_000517431.1|3544088_3544880_+	SDR family oxidoreductase UcpA	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.0	8.9e-18
WP_000290223.1|3545050_3546067_+	sulfate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000458405.1|3546066_3546900_+	sulfate/thiosulfate ABC transporter permease CysT	NA	NA	NA	NA	NA
WP_000852686.1|3546899_3547775_+	sulfate/thiosulfate ABC transporter permease CysW	NA	NA	NA	NA	NA
WP_000021040.1|3547764_3548862_+	sulfate/thiosulfate ABC transporter ATP-binding protein CysA	NA	G3M9Y6	Bacillus_virus	34.1	4.2e-26
WP_001297645.1|3548995_3549907_+	cysteine synthase B	NA	A0A1X9I5F1	Streptococcus_phage	41.9	3.5e-58
WP_000719943.1|3549909_3550278_-	YfeK family protein	NA	NA	NA	NA	NA
WP_000096660.1|3550382_3551234_+	pyridoxine/pyridoxal/pyridoxamine kinase	NA	NA	NA	NA	NA
WP_000522247.1|3551275_3551785_-	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_000623136.1|3551825_3553553_-	phosphoenolpyruvate-protein phosphotransferase PtsI	NA	A0A1V0SGR7	Hokovirus	31.1	9.6e-17
WP_000487600.1|3553597_3553855_-	phosphocarrier protein Hpr	NA	NA	NA	NA	NA
WP_000034402.1|3554238_3555210_-	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	51.0	2.8e-74
WP_000254843.1|3555394_3556156_-	sulfate transporter CysZ	NA	NA	NA	NA	NA
WP_001297862.1|3556385_3557372_+	cell division protein ZipA	NA	NA	NA	NA	NA
WP_000443665.1|3557442_3559458_+	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	43.4	6.5e-150
>prophage 261
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	3585307	3586042	4978613		Clostridioides_phage(100.0%)	1	NA	NA
WP_099588406.1|3585307_3586042_-	response regulator transcription factor	NA	A0A2R2ZGH8	Clostridioides_phage	25.3	1.2e-13
>prophage 262
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	3589860	3590781	4978613		Morganella_phage(100.0%)	1	NA	NA
WP_000484404.1|3589860_3590781_-	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	54.8	4.9e-76
>prophage 263
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	3594510	3602087	4978613		Ostreococcus_lucimarinus_virus(50.0%)	4	NA	NA
WP_001283499.1|3594510_3596205_+	oxalyl-CoA decarboxylase	NA	E5ERI2	Ostreococcus_lucimarinus_virus	23.6	1.0e-23
WP_000955028.1|3596274_3597219_+	transporter YfdV	NA	NA	NA	NA	NA
WP_001296867.1|3597292_3598438_+	CoA:oxalate CoA-transferase	NA	NA	NA	NA	NA
WP_001317243.1|3598493_3602087_-	acid-sensing system histidine kinase EvgS	NA	A0A1V0SGX0	Hokovirus	32.1	1.7e-36
>prophage 264
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	3608728	3654191	4978613	lysis,integrase,terminase,coat,protease,holin	Enterobacteria_phage(55.0%)	63	3606260:3606276	3656201:3656217
3606260:3606276	attL	GGTTGTCGATACCAATA	NA	NA	NA	NA
WP_000194515.1|3608728_3610162_-	glycoside hydrolase family 32 protein	NA	F8WPR5	Bacillus_phage	25.4	7.0e-29
WP_001274887.1|3610377_3611292_+	aminoimidazole riboside kinase	NA	NA	NA	NA	NA
WP_001197023.1|3611363_3612611_+	oligosaccharide MFS transporter	NA	NA	NA	NA	NA
WP_001163428.1|3613140_3613341_-	response regulator inhibitor TorI	NA	K7P7V0	Enterobacteria_phage	100.0	2.4e-33
WP_000545737.1|3613398_3613566_-	hypothetical protein	NA	A5VWB7	Enterobacteria_phage	100.0	9.8e-28
WP_099588407.1|3613665_3614625_-	DUF550 domain-containing protein	NA	K7PGV7	Enterobacterial_phage	55.1	3.9e-68
WP_099588408.1|3614635_3614899_-	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	71.3	2.6e-30
WP_099588409.1|3614900_3615653_-	ead/Ea22-like family protein	NA	A0A0K2FJF6	Enterobacteria_phage	56.8	4.0e-60
WP_099588410.1|3615649_3616081_-	hypothetical protein	NA	K7PMI0	Enterobacteria_phage	87.0	7.6e-64
WP_001214446.1|3616077_3616242_-	DUF2737 family protein	NA	K7P716	Enterobacteria_phage	100.0	6.5e-24
WP_072256487.1|3616238_3616529_-	hypothetical protein	NA	K7P7M4	Enterobacteria_phage	99.0	2.4e-45
WP_001111275.1|3616539_3616836_-	DUF2856 family protein	NA	A0A220NRR0	Escherichia_phage	99.0	8.6e-51
WP_016063998.1|3616859_3617243_-	hypothetical protein	NA	K7P6P8	Enterobacteria_phage	100.0	2.9e-67
WP_047662504.1|3617242_3617848_-	ERF family protein	NA	Q9MCQ9	Enterobacteria_phage	99.5	1.2e-107
WP_001243355.1|3618104_3618257_-	host cell division inhibitory peptide Kil	NA	A5VWA5	Enterobacteria_phage	100.0	4.7e-21
WP_000638547.1|3618241_3618373_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	A5VWA4	Enterobacteria_phage	100.0	1.4e-16
WP_099588456.1|3618397_3619366_-	cell envelope biogenesis protein TolA	NA	K7P7J7	Enterobacteria_phage	99.7	7.7e-56
WP_000865176.1|3619500_3619689_-	hypothetical protein	NA	A0A0B7MKW0	Enterobacteria_phage	59.3	3.8e-12
WP_053881393.1|3619688_3619985_-	hypothetical protein	NA	K7PH98	Enterobacteria_phage	95.9	1.4e-48
WP_000167595.1|3620031_3620502_-	hypothetical protein	NA	A0A1I9LJN4	Stx_converting_phage	100.0	3.7e-88
WP_099588411.1|3620510_3620837_-	antitermination protein	NA	A4KWR0	Enterobacteria_phage	99.1	5.9e-53
WP_021526961.1|3621297_3621702_-	hypothetical protein	NA	A0A088CQ79	Enterobacteria_phage	99.3	1.9e-69
WP_000028393.1|3621698_3622331_-	LexA family transcriptional regulator	NA	K7P850	Enterobacteria_phage	100.0	5.4e-119
WP_001194218.1|3622434_3622650_+	helix-turn-helix transcriptional regulator	NA	Q716D6	Shigella_phage	100.0	1.4e-31
WP_001177653.1|3622769_3623048_+	transcriptional regulator	NA	Q8VNP9	Enterobacteria_phage	100.0	3.6e-43
WP_099588412.1|3623230_3624052_+	replication protein	NA	K7PJZ3	Enterobacterial_phage	99.3	1.7e-152
WP_099588413.1|3624048_3625425_+	AAA family ATPase	NA	A0A0P0ZC27	Stx2-converting_phage	99.3	1.4e-252
WP_000736903.1|3625498_3625939_+	recombination protein NinB	NA	A0A220NRM1	Escherichia_phage	100.0	7.0e-81
WP_000153280.1|3625935_3626463_+	phage N-6-adenine-methyltransferase	NA	A0A1I9LJP9	Stx_converting_phage	100.0	9.5e-101
WP_099588414.1|3626459_3626642_+	NinE family protein	NA	A0A0P0ZDL7	Stx2-converting_phage	96.7	1.3e-28
WP_000566866.1|3626638_3626809_+	protein ninF	NA	K7PLU6	Enterobacteria_phage	100.0	2.5e-26
WP_016242496.1|3626801_3627071_+	hypothetical protein	NA	K7PHK7	Enterobacteria_phage	98.9	9.3e-44
WP_000002229.1|3627070_3627361_+	DUF1364 domain-containing protein	NA	A0A192Y6R9	Salmonella_phage	99.0	1.0e-51
WP_089656476.1|3627357_3627720_+	RusA family crossover junction endodeoxyribonuclease	NA	A5VW85	Enterobacteria_phage	99.2	2.0e-62
WP_000994515.1|3627716_3627905_+	protein ninH	NA	K7PH29	Enterobacteria_phage	100.0	1.9e-27
WP_001235461.1|3627901_3628525_+	antitermination protein	NA	K7PM87	Enterobacteria_phage	100.0	3.0e-114
WP_000783734.1|3628958_3629282_+|holin	phage holin, lambda family	holin	G5DA93	Enterobacteria_phage	100.0	1.3e-52
WP_099588415.1|3629265_3629742_+	glycoside hydrolase family protein	NA	A5VW81	Enterobacteria_phage	98.1	1.1e-87
WP_099588416.1|3629738_3630206_+|lysis	lysis protein	lysis	A0A291AWW3	Escherichia_phage	95.5	1.5e-73
WP_099588417.1|3630193_3630346_+	hypothetical protein	NA	Q716B2	Shigella_phage	88.0	1.7e-18
WP_000191869.1|3630428_3630908_+	DUF2829 domain-containing protein	NA	A0A1Y0T2L3	Pseudomonas_phage	60.4	1.1e-55
WP_000999674.1|3631142_3631523_+	hypothetical protein	NA	Q716B1	Shigella_phage	99.2	1.4e-66
WP_000807788.1|3631626_3631869_+	DUF2560 family protein	NA	A5VW77	Enterobacteria_phage	100.0	1.3e-36
WP_000091986.1|3631870_3632050_+	hypothetical protein	NA	Q9AZ02	Salmonella_phage	98.3	1.1e-24
WP_000729920.1|3632073_3632562_+	hypothetical protein	NA	G8EYI7	Enterobacteria_phage	100.0	1.4e-90
WP_000417850.1|3632539_3634039_+|terminase	terminase	terminase	A0A2D1GLW6	Escherichia_phage	99.4	1.2e-305
WP_023486193.1|3634039_3636205_+	packaging glycoprotein	NA	A0A2D1GLJ6	Escherichia_phage	99.7	0.0e+00
WP_099588418.1|3636218_3637130_+	scaffolding protein	NA	A0A2D1GLN7	Escherichia_phage	99.7	1.7e-161
WP_001196944.1|3637129_3638425_+|coat	coat protein	coat	A0A2D1GLV2	Escherichia_phage	99.1	2.1e-242
WP_042837736.1|3638469_3638706_+	hypothetical protein	NA	A0A2D1GLK1	Escherichia_phage	83.0	2.9e-25
WP_099588419.1|3638683_3639184_+	recombinase RmuC	NA	G8EYJ2	Enterobacteria_phage	98.2	1.6e-89
WP_001576812.1|3639184_3640603_+	DNA stabilization protein	NA	A0A088CQ70	Enterobacteria_phage	99.6	5.4e-276
WP_099588420.1|3640602_3641451_+	hypothetical protein	NA	Q716G6	Shigella_phage	92.9	2.2e-99
WP_000614031.1|3641450_3641906_+	DUF2824 family protein	NA	A5VW67	Enterobacteria_phage	98.7	1.5e-86
WP_000964882.1|3641908_3642601_+	DNA transfer protein	NA	G5DA80	Enterobacteria_phage	100.0	9.2e-112
WP_099588421.1|3642610_3643942_+	acyltransferase	NA	A0A2D1GLX5	Escherichia_phage	96.8	4.9e-210
WP_099588422.1|3643942_3646336_+	lytic transglycosylase domain-containing protein	NA	Q716G2	Shigella_phage	97.3	0.0e+00
WP_099588423.1|3646425_3646686_-	Arc family DNA-binding protein	NA	A0A088CPT2	Enterobacteria_phage	95.3	5.8e-35
WP_099588424.1|3648929_3650360_-	glucosyl transferase GtrII family protein	NA	NA	NA	NA	NA
WP_099588425.1|3650356_3651277_-	glycosyltransferase family 2 protein	NA	U5P087	Shigella_phage	91.8	4.2e-160
WP_024168963.1|3651273_3651636_-	GtrA family protein	NA	U5P0S6	Shigella_phage	90.0	3.5e-54
WP_099588426.1|3651789_3652947_-|integrase	prophage integrase IntS	integrase	A5VW56	Enterobacteria_phage	98.4	2.6e-220
WP_000368131.1|3653258_3654191_-	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
3656201:3656217	attR	GGTTGTCGATACCAATA	NA	NA	NA	NA
>prophage 265
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	3672054	3673140	4978613		Pandoravirus(100.0%)	1	NA	NA
WP_000918470.1|3672054_3673140_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	48.4	9.1e-90
>prophage 266
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	3681722	3682859	4978613		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_000699122.1|3681722_3682859_+	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.1	5.9e-23
>prophage 267
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	3689335	3690853	4978613		Mollivirus(100.0%)	1	NA	NA
WP_000334220.1|3689335_3690853_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	44.0	5.9e-87
>prophage 268
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	3695064	3696937	4978613		Acanthocystis_turfacea_Chlorella_virus(50.0%)	2	NA	NA
WP_001293612.1|3695064_3695838_+	histidine ABC transporter ATP-binding protein HisP	NA	M1I0T9	Acanthocystis_turfacea_Chlorella_virus	28.2	2.1e-08
WP_000156113.1|3696034_3696937_+	recombination-promoting nuclease RpnB	NA	Q2A0A7	Sodalis_phage	44.5	8.2e-68
>prophage 269
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	3707496	3710724	4978613		Acanthocystis_turfacea_Chlorella_virus(50.0%)	3	NA	NA
WP_001203410.1|3707496_3708147_+	hexitol phosphatase HpxA	NA	M1IMD4	Acanthocystis_turfacea_Chlorella_virus	34.3	5.2e-08
WP_001012899.1|3708233_3710066_+	SLC13 family permease	NA	NA	NA	NA	NA
WP_000813848.1|3710124_3710724_-	5'-deoxynucleotidase	NA	A0A2L0V156	Salmonella_phage	37.3	5.9e-06
>prophage 270
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	3745138	3750142	4978613		Tupanvirus(50.0%)	4	NA	NA
WP_000860259.1|3745138_3747121_-	bifunctional UDP-4-amino-4-deoxy-L-arabinose formyltransferase/UDP-glucuronic acid oxidase ArnA	NA	A0A2K9KZK0	Tupanvirus	25.8	1.8e-19
WP_000461661.1|3747120_3748089_-	undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase	NA	F1C5B0	Cronobacter_phage	31.2	2.0e-35
WP_001342601.1|3748092_3749232_-	UDP-4-amino-4-deoxy-L-arabinose aminotransferase	NA	A0A2K9L470	Tupanvirus	29.8	1.9e-29
WP_001297077.1|3749539_3750142_+	histidine phosphatase family protein	NA	A0A2L1IV13	Escherichia_phage	42.9	3.4e-09
>prophage 271
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	3753294	3754197	4978613	transposase	Sodalis_phage(100.0%)	1	NA	NA
WP_000140553.1|3753294_3754197_-|transposase	ISNCY family transposase	transposase	Q2A0A7	Sodalis_phage	54.4	9.6e-69
>prophage 272
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	3760090	3766092	4978613		Pseudomonas_phage(50.0%)	5	NA	NA
WP_000779084.1|3760090_3761167_+	glycerophosphodiester phosphodiesterase	NA	A0A220BYK6	Staphylococcus_phage	46.0	5.1e-08
WP_000301050.1|3761629_3762280_+	lipopolysaccharide kinase InaA	NA	NA	NA	NA	NA
WP_000135040.1|3762333_3762588_-	ferredoxin-like diferric-tyrosyl radical cofactor maintenance protein YfaE	NA	G9IAA2	Pseudomonas_phage	73.1	2.6e-24
WP_000332036.1|3762587_3763718_-	ribonucleotide-diphosphate reductase subunit beta	NA	G9IAA3	Pseudomonas_phage	78.9	2.5e-175
WP_001075170.1|3763806_3766092_-	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2D1GNB1	Pseudoalteromonas_phage	63.6	1.9e-283
>prophage 273
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	3771518	3774146	4978613		Bacillus_virus(100.0%)	1	NA	NA
WP_001281242.1|3771518_3774146_+	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	G3M9Z5	Bacillus_virus	30.4	8.1e-92
>prophage 274
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	3783845	3786695	4978613		Hokovirus(100.0%)	1	NA	NA
WP_000876014.1|3783845_3786695_+	two-component system sensor histidine kinase RcsC	NA	A0A1V0SGX0	Hokovirus	27.2	1.4e-41
>prophage 275
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	3790972	3796771	4978613		Enterobacteria_phage(25.0%)	5	NA	NA
WP_000865609.1|3790972_3792097_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	58.8	2.4e-117
WP_000406098.1|3792208_3793264_+	FAD:protein FMN transferase ApbE	NA	NA	NA	NA	NA
WP_000710368.1|3793337_3794402_+	bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	50.5	1.8e-18
WP_000884922.1|3794401_3795052_+	DNA oxidative demethylase AlkB	NA	A0A2K9L3R7	Tupanvirus	31.7	1.4e-05
WP_000422188.1|3795127_3796771_+	microcin J25 efflux ABC transporter YojI	NA	W8CYL7	Bacillus_phage	24.0	9.5e-14
>prophage 276
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	3805538	3806156	4978613		Bacillus_virus(100.0%)	1	NA	NA
WP_000888560.1|3805538_3806156_+	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	G3M9Y6	Bacillus_virus	25.5	1.9e-12
>prophage 277
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	3817855	3825503	4978613		Vibrio_phage(50.0%)	7	NA	NA
WP_000050789.1|3817855_3818863_+	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	48.3	1.5e-83
WP_000494183.1|3819001_3819286_-	50S ribosomal protein L25	NA	NA	NA	NA	NA
WP_000578076.1|3819410_3821171_-	DEAD/DEAH box helicase	NA	M4Q3N1	Vibrio_phage	41.8	3.2e-100
WP_001474458.1|3821319_3822015_+	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
WP_000213360.1|3822042_3823233_+	multidrug efflux MFS transporter Bcr	NA	S4TR35	Salmonella_phage	23.7	2.2e-20
WP_000202798.1|3823565_3823910_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000194928.1|3823913_3825503_-	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	34.0	1.1e-19
>prophage 278
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	3831257	3835558	4978613		Clostridioides_phage(50.0%)	4	NA	NA
WP_000241012.1|3831257_3831824_-	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	A0A1V0DZX6	Clostridioides_phage	40.7	4.2e-14
WP_000594599.1|3832235_3832949_-	Kdo(2)-lipid A phosphotransferase	NA	NA	NA	NA	NA
WP_000198822.1|3832987_3833974_-	GTP-binding protein	NA	NA	NA	NA	NA
WP_024232246.1|3834091_3835558_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.3	1.9e-42
>prophage 279
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	3850056	3850914	4978613		Catovirus(100.0%)	1	NA	NA
WP_000873890.1|3850056_3850914_-	deoxyribonuclease IV	NA	A0A1V0SBL9	Catovirus	34.0	1.4e-24
>prophage 280
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	3854983	3858769	4978613		Acinetobacter_phage(50.0%)	3	NA	NA
WP_000489233.1|3854983_3856975_+	catecholate siderophore receptor CirA	NA	A0A0P0I887	Acinetobacter_phage	36.6	2.0e-13
WP_000425462.1|3857006_3857843_-	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_001139613.1|3858100_3858769_+	GTP cyclohydrolase I FolE	NA	M1Q6X8	Cellulophaga_phage	56.3	9.0e-56
>prophage 281
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	3862463	3863984	4978613		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_000255039.1|3862463_3863984_+	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	33.0	2.6e-10
>prophage 282
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	3884296	3893738	4978613		Enterobacteria_phage(85.71%)	10	NA	NA
WP_000569325.1|3884296_3885223_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	2.8e-23
WP_000783120.1|3885227_3885959_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|3885939_3886047_-	protein YohO	NA	NA	NA	NA	NA
WP_001240401.1|3886106_3886838_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001295431.1|3887059_3888745_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_000598641.1|3888741_3889461_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295430.1|3889507_3889978_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_001295429.1|3890018_3890480_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001317947.1|3890604_3892605_-	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	96.1	0.0e+00
WP_001292774.1|3892601_3893738_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.7	1.1e-162
>prophage 283
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	3906303	4002112	4978613	lysis,transposase,integrase,tRNA,plate,portal,terminase,holin,capsid,head,tail	Escherichia_phage(41.51%)	92	3933543:3933569	3967261:3967287
WP_001295427.1|3906303_3908337_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.8e-54
WP_001005448.1|3908468_3909578_+	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_001324851.1|3909840_3910122_+	YehE family protein	NA	NA	NA	NA	NA
WP_000830468.1|3910414_3910957_+	fimbrial protein	NA	NA	NA	NA	NA
WP_000677395.1|3911037_3911712_+	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_000945406.1|3911727_3914208_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_001026154.1|3914221_3915256_+	putative fimbrial-like adhesin protein	NA	NA	NA	NA	NA
WP_000153067.1|3915337_3915676_-	Ni(II)/Co(II) efflux transporter accessory subunit RcnB	NA	NA	NA	NA	NA
WP_000134576.1|3915894_3916719_-	nickel/cobalt efflux protein RcnA	NA	NA	NA	NA	NA
WP_000019938.1|3916839_3917112_+	Ni(II)/Co(II)-binding transcriptional repressor RcnR	NA	NA	NA	NA	NA
WP_001195590.1|3917334_3918123_+	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
WP_000822274.1|3918119_3918920_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_001474430.1|3918984_3919803_+	glycoside hydrolase family 25 protein	NA	D0R7H8	Paenibacillus_phage	38.0	3.3e-23
WP_000434038.1|3919854_3920601_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000011950.1|3920574_3921540_-	sugar kinase	NA	NA	NA	NA	NA
WP_000846217.1|3921536_3922541_-	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	29.4	7.5e-14
WP_000858498.1|3922537_3923815_-	MFS transporter	NA	NA	NA	NA	NA
WP_000129551.1|3924071_3925124_+	class I fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_000289788.1|3925432_3926287_+	tagatose-bisphosphate aldolase subunit GatY	NA	NA	NA	NA	NA
WP_000853898.1|3926315_3927578_+	tagatose-bisphosphate aldolase subunit GatZ	NA	NA	NA	NA	NA
WP_000182914.1|3927587_3928040_+	PTS galactitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_000823272.1|3928070_3928355_+	PTS galactitol transporter subunit IIB	NA	NA	NA	NA	NA
WP_024243419.1|3928358_3929714_+	PTS galactitol transporter subunit IIC	NA	NA	NA	NA	NA
WP_000178552.1|3930900_3931680_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_000807361.1|3931761_3932661_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	1.3e-12
WP_001318299.1|3933065_3933383_+	hypothetical protein	NA	NA	NA	NA	NA
3933543:3933569	attL	AAAAAATAAGCCCGTGTAAGGGAGATT	NA	NA	NA	NA
WP_000985264.1|3933648_3934662_-|integrase	site-specific integrase	integrase	Q83VS6	Escherichia_phage	98.8	2.4e-193
WP_001306384.1|3934777_3935077_-	helix-turn-helix transcriptional regulator	NA	Q1JS63	Enterobacteria_phage	100.0	2.5e-50
WP_000043869.1|3935191_3935467_+	hypothetical protein	NA	Q1JS62	Enterobacteria_phage	100.0	1.3e-48
WP_000217670.1|3935644_3936145_+	hypothetical protein	NA	M1SV55	Escherichia_phage	100.0	2.6e-92
WP_000557703.1|3936208_3936433_+	DUF2732 family protein	NA	S4TP68	Salmonella_phage	100.0	4.7e-33
WP_001277897.1|3936432_3936735_+	DUF5405 family protein	NA	A0A0F7LCL4	Escherichia_phage	98.0	8.5e-46
WP_001113270.1|3936734_3936959_+	TraR/DksA family transcriptional regulator	NA	A0A0F7LDI3	Escherichia_phage	98.6	3.8e-35
WP_000027664.1|3936955_3937231_+	DUF5405 family protein	NA	U5N3W1	Enterobacteria_phage	100.0	3.8e-45
WP_099483588.1|3937220_3939506_+	replication endonuclease	NA	Q858T4	Yersinia_virus	97.4	0.0e+00
WP_032185297.1|3939505_3939958_+	DUF3850 domain-containing protein	NA	Q2P9X4	Enterobacteria_phage	96.0	2.3e-79
WP_032185251.1|3939957_3940164_+	hypothetical protein	NA	Q2P9X3	Enterobacteria_phage	86.6	4.6e-27
WP_000981007.1|3940472_3940709_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000457799.1|3940711_3941473_+	hypothetical protein	NA	I6PD67	Cronobacter_phage	46.5	3.0e-55
WP_000066157.1|3941506_3943771_-	S8 family peptidase	NA	NA	NA	NA	NA
WP_099483586.1|3943767_3944913_-	ATP-binding protein	NA	A0A1B2RW50	Lymphocystis_disease_virus	29.8	1.9e-13
WP_000038181.1|3945360_3946395_-|portal	phage portal protein	portal	Q858W8	Yersinia_virus	99.7	1.2e-200
WP_000156872.1|3946394_3948167_-|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCK3	Escherichia_phage	100.0	0.0e+00
WP_099483583.1|3948340_3949195_+|capsid	GPO family capsid scaffolding protein	capsid	A0A0F7LA11	Escherichia_phage	97.5	1.9e-135
WP_001248583.1|3949253_3950327_+|capsid	phage major capsid protein, P2 family	capsid	Q94MK2	Enterobacteria_phage	100.0	6.7e-202
WP_024249459.1|3950330_3951074_+|terminase	terminase endonuclease subunit	terminase	U5N091	Enterobacteria_phage	99.2	9.2e-126
WP_000988642.1|3951173_3951683_+|head	head completion/stabilization protein	head	A0A0F7L9Y3	Escherichia_phage	100.0	1.9e-90
WP_000846399.1|3951682_3951886_+|tail	tail protein X	tail	U5N3E7	Enterobacteria_phage	100.0	4.0e-31
WP_000123124.1|3951889_3952171_+|holin	holin	holin	A0A0F7LDF8	Escherichia_phage	100.0	3.7e-43
WP_001144101.1|3952170_3952668_+	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	100.0	3.1e-93
WP_001593488.1|3952682_3953108_+	hypothetical protein	NA	A0A0F7LBP4	Escherichia_phage	96.4	1.9e-59
WP_099483581.1|3953095_3953521_+|lysis	LysB family phage lysis regulatory protein	lysis	U5N3W5	Enterobacteria_phage	95.0	4.0e-65
WP_001300730.1|3953492_3953666_+	hypothetical protein	NA	Q7Y4E1	Escherichia_virus	94.7	5.2e-24
WP_000917189.1|3953628_3954096_+|tail	phage tail protein	tail	U5N0S7	Enterobacteria_phage	98.1	2.5e-81
WP_099483579.1|3954088_3954541_+	phage virion morphogenesis protein	NA	A0A0F7LBV9	Escherichia_phage	98.7	1.5e-75
WP_053920544.1|3954607_3955243_+|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	99.1	4.5e-113
WP_000127164.1|3955239_3955587_+|plate	baseplate assembly protein	plate	A0A0F7LDQ1	Escherichia_phage	100.0	1.3e-58
WP_089615958.1|3955591_3956500_+|plate	baseplate assembly protein	plate	A0A0F7LCQ9	Escherichia_phage	99.3	2.8e-161
WP_001285352.1|3956492_3957104_+|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	99.5	3.8e-117
WP_000905108.1|3959903_3960497_+	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	96.4	8.7e-103
WP_001286727.1|3960556_3961747_+|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	99.7	4.8e-225
WP_001251408.1|3961759_3962278_+|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_001031303.1|3962334_3962610_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
WP_000785970.1|3962642_3962762_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_099483576.1|3962754_3965202_+|tail	phage tail tape measure protein	tail	A0A0F7LA40	Escherichia_phage	99.8	0.0e+00
WP_000978878.1|3965216_3965696_+|tail	phage tail protein	tail	A0A0F7LBX3	Escherichia_phage	98.7	9.6e-84
WP_000882969.1|3965695_3966859_+	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	100.0	2.8e-206
WP_000468308.1|3966940_3967159_+	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_000476014.1|3967431_3968793_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	99.7	1.9e-217
3967261:3967287	attR	AAAAAATAAGCCCGTGTAAGGGAGATT	NA	NA	NA	NA
WP_000929408.1|3968939_3969272_-	YegP family protein	NA	NA	NA	NA	NA
WP_000137877.1|3969462_3970185_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.6	3.7e-31
WP_000675150.1|3970181_3971585_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.0	3.0e-32
WP_000130837.1|3971581_3972997_-	MFS transporter	NA	NA	NA	NA	NA
WP_000667585.1|3972997_3976075_-	multidrug efflux RND transporter permease subunit MdtC	NA	NA	NA	NA	NA
WP_001197875.1|3976075_3979198_-	multidrug efflux RND transporter permease subunit MdtB	NA	NA	NA	NA	NA
WP_001475455.1|3979197_3980439_-	multidrug efflux RND transporter subunit MdtA	NA	NA	NA	NA	NA
WP_010723109.1|3980718_3980778_+	type I toxin-antitoxin system toxin IbsA	NA	NA	NA	NA	NA
WP_000003202.1|3980998_3981658_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_000119067.1|3981654_3982416_+	protein-serine/threonine phosphatase PphC	NA	NA	NA	NA	NA
WP_001386896.1|3982412_3984353_+	protein kinase YegI	NA	NA	NA	NA	NA
WP_087603184.1|3984364_3985717_-	molecular chaperone	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	20.9	1.6e-06
WP_000288408.1|3985850_3986699_+	DNA-3-methyladenine glycosylase 2	NA	NA	NA	NA	NA
WP_000043757.1|3986807_3990125_-	diguanylate cyclase	NA	NA	NA	NA	NA
WP_001295424.1|3990442_3991084_+	uridine kinase	NA	A0A1V0SAA3	Catovirus	36.9	3.2e-34
WP_001234767.1|3991175_3991757_+	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	42.1	1.3e-31
WP_099588432.1|3991778_3993632_+	outer membrane assembly protein AsmA	NA	NA	NA	NA	NA
WP_000399648.1|3993761_3994742_-|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
WP_001300971.1|3995184_3996768_-	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	42.6	7.2e-35
WP_000978094.1|3997426_3998566_+	polysaccharide export protein	NA	NA	NA	NA	NA
WP_099588433.1|3998571_3999015_+	low molecular weight protein-tyrosine-phosphatase Wzb	NA	NA	NA	NA	NA
WP_000137163.1|3999017_4001180_+	tyrosine-protein kinase Wzc	NA	A0A1X9I5D6	Streptococcus_phage	30.3	2.4e-17
WP_000654487.1|4001272_4002112_+	colanic acid biosynthesis glycosyltransferase WcaA	NA	A0A1V0S9B9	Catovirus	28.3	4.1e-05
>prophage 284
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	4006355	4013149	4978613		Synechococcus_phage(25.0%)	6	NA	NA
WP_000048190.1|4006355_4007477_+	GDP-mannose 4,6-dehydratase	NA	M4QRT5	Synechococcus_phage	64.9	1.5e-132
WP_000043623.1|4007479_4008445_+	GDP-L-fucose synthase	NA	D1LW79	Prochlorococcus_phage	50.8	9.9e-88
WP_000479836.1|4008447_4008927_+	GDP-mannose mannosyl hydrolase	NA	NA	NA	NA	NA
WP_000699706.1|4008923_4010147_+	colanic acid biosynthesis fucosyltransferase WcaI	NA	NA	NA	NA	NA
WP_000079309.1|4010149_4011586_+	mannose-1-phosphate guanyltransferase	NA	A0A1V0SH58	Hokovirus	29.2	1.7e-46
WP_016247331.1|4011778_4013149_+	phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	27.6	9.9e-33
>prophage 285
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	4018657	4040187	4978613		Bacillus_phage(15.38%)	19	NA	NA
WP_001115992.1|4018657_4020052_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	31.9	1.7e-19
WP_000999466.1|4020209_4021205_+	SDR family oxidoreductase	NA	A0A1V0QG29	Shearwaterpox_virus	26.3	1.9e-09
WP_000183075.1|4021447_4022341_+	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	1.0e-46
WP_000234387.1|4022650_4023670_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	47.7	2.9e-85
WP_000799971.1|4023688_4024705_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_001140913.1|4024731_4025853_+	GDP-mannose 4,6-dehydratase	NA	M4QRT5	Synechococcus_phage	65.5	6.9e-133
WP_000043612.1|4025855_4026821_+	GDP-L-fucose synthase	NA	D1LW79	Prochlorococcus_phage	51.4	1.3e-87
WP_001414910.1|4026823_4027324_+	GDP-mannose mannosyl hydrolase	NA	NA	NA	NA	NA
WP_001286269.1|4027316_4028765_+	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	31.6	1.8e-56
WP_000736843.1|4028768_4030148_+	phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	27.6	3.8e-32
WP_000499109.1|4030390_4030702_+	transferase	NA	NA	NA	NA	NA
WP_001034330.1|4030698_4032141_+	O128 family O-antigen flippase	NA	NA	NA	NA	NA
WP_000453202.1|4032130_4032982_+	alpha-1,2-fucosyltransferase	NA	A0A2H4UUT1	Bodo_saltans_virus	31.6	2.6e-31
WP_000969630.1|4032978_4033845_+	glycosyltransferase	NA	A0A0F7L2F7	uncultured_marine_virus	39.3	1.8e-08
WP_000247459.1|4033829_4034729_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_001737305.1|4034725_4035769_+	O128 family O-antigen polymerase	NA	NA	NA	NA	NA
WP_099588434.1|4036239_4037259_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	47.2	8.3e-85
WP_000043450.1|4037365_4038772_+	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.0	6.8e-37
WP_000704839.1|4039020_4040187_+	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	52.4	5.0e-110
>prophage 286
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	4047541	4048441	4978613		Cellulophaga_phage(100.0%)	1	NA	NA
WP_000131774.1|4047541_4048441_-	ATP phosphoribosyltransferase	NA	A0A0F7Q4B0	Cellulophaga_phage	94.7	1.8e-11
>prophage 287
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	4056086	4057253	4978613		Stx2-converting_phage(100.0%)	1	NA	NA
WP_001356285.1|4056086_4057253_+	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	99.5	1.0e-227
>prophage 288
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	4061570	4068443	4978613	transposase	Stx2-converting_phage(71.43%)	7	NA	NA
WP_074501617.1|4061570_4062353_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	98.8	3.8e-138
WP_001696684.1|4062346_4063321_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	98.1	2.5e-187
WP_001339397.1|4063610_4064288_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000624622.1|4064287_4064635_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_099588435.1|4064654_4066226_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.5	1.3e-169
WP_000612591.1|4066507_4066855_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_099588436.1|4066904_4068443_+|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	97.1	4.5e-292
>prophage 289
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	4079628	4082038	4978613		Klebsiella_phage(33.33%)	4	NA	NA
WP_000692341.1|4079628_4079850_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	44.4	4.2e-10
WP_001186774.1|4079912_4080389_-	RadC family protein	NA	NA	NA	NA	NA
WP_000855059.1|4080404_4080878_-	antirestriction protein	NA	A9J566	Pseudomonas_phage	30.3	1.5e-12
WP_001234719.1|4081219_4082038_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	39.3	4.7e-46
>prophage 290
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	4104410	4104629	4978613		Stenotrophomonas_phage(100.0%)	1	NA	NA
WP_000250490.1|4104410_4104629_+	AlpA family transcriptional regulator	NA	B7SYF9	Stenotrophomonas_phage	50.0	1.9e-07
>prophage 291
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	4112025	4112445	4978613		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000208713.1|4112025_4112445_-	TIR domain-containing protein	NA	A0A2H4J496	uncultured_Caudovirales_phage	33.3	9.2e-06
>prophage 292
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	4121453	4127772	4978613	integrase	Erysipelothrix_phage(66.67%)	3	4124498:4124512	4129992:4130006
WP_000766119.1|4121453_4124414_-	DEAD/DEAH box helicase family protein	NA	A0A2K5B2C2	Erysipelothrix_phage	38.7	2.2e-162
WP_001400541.1|4124423_4126322_-	site-specific DNA-methyltransferase	NA	A0A2K5B2C1	Erysipelothrix_phage	43.3	2.9e-139
4124498:4124512	attL	CAAATGCGTCATCAA	NA	NA	NA	NA
WP_001400540.1|4126473_4127772_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	38.9	1.5e-70
WP_001400540.1|4126473_4127772_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	38.9	1.5e-70
4129992:4130006	attR	TTGATGACGCATTTG	NA	NA	NA	NA
>prophage 293
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	4164263	4173701	4978613	integrase	Bacillus_phage(50.0%)	7	4169534:4169548	4177333:4177347
WP_087603173.1|4164263_4166066_+	yersiniabactin ABC transporter ATP-binding/permease protein YbtP	NA	W8CYL7	Bacillus_phage	27.0	6.5e-32
WP_001304269.1|4166052_4167855_+	yersiniabactin ABC transporter ATP-binding/permease protein YbtQ	NA	W8CYL7	Bacillus_phage	26.5	6.1e-22
WP_032181119.1|4167847_4169128_+	yersiniabactin-associated zinc MFS transporter YbtX	NA	NA	NA	NA	NA
WP_032181117.1|4169155_4170460_+	yersiniabactin biosynthesis salicylate synthase YbtS	NA	NA	NA	NA	NA
4169534:4169548	attL	GAACTTATTTTTGAA	NA	NA	NA	NA
WP_032181116.1|4170653_4171916_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	38.8	2.6e-72
WP_032181113.1|4172456_4173332_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023155944.1|4173482_4173701_+	AlpA family transcriptional regulator	NA	B7SYF9	Stenotrophomonas_phage	52.8	3.0e-08
4177333:4177347	attR	TTCAAAAATAAGTTC	NA	NA	NA	NA
>prophage 294
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	4178129	4178867	4978613		Cellulophaga_phage(100.0%)	1	NA	NA
WP_032181100.1|4178129_4178867_-	DNA-binding protein	NA	M1Q742	Cellulophaga_phage	39.6	8.2e-26
>prophage 295
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	4192380	4195249	4978613	integrase	Leptospira_phage(50.0%)	3	4189169:4189182	4200310:4200323
4189169:4189182	attL	TGTTAAAGCGTTAT	NA	NA	NA	NA
WP_032181085.1|4192380_4193301_-	hypothetical protein	NA	S5VKI3	Leptospira_phage	31.7	4.0e-30
WP_000042269.1|4193652_4193904_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038349147.1|4193974_4195249_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	40.1	1.5e-75
4200310:4200323	attR	ATAACGCTTTAACA	NA	NA	NA	NA
>prophage 296
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	4200456	4208855	4978613		Burkholderia_phage(40.0%)	8	NA	NA
WP_001339045.1|4200456_4201128_+	response regulator transcription factor HprR	NA	W8CYM9	Bacillus_phage	35.2	5.4e-32
WP_000826748.1|4201127_4202486_+	two-component system sensor histidine kinase HprS	NA	NA	NA	NA	NA
WP_000218212.1|4202593_4203445_-	protein deglycase HchA	NA	NA	NA	NA	NA
WP_000824347.1|4204037_4205252_-	porin	NA	Q1MVN1	Enterobacteria_phage	53.7	4.0e-102
WP_001313057.1|4205818_4206184_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001471696.1|4206223_4206919_+	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	28.0	3.6e-07
WP_001157238.1|4206985_4208404_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	55.3	1.8e-101
WP_000786005.1|4208384_4208855_+	very short patch repair endonuclease	NA	E5E3X5	Burkholderia_phage	47.6	2.0e-33
>prophage 297
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	4227062	4227731	4978613		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000334598.1|4227062_4227731_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	60.4	2.8e-81
>prophage 298
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	4239528	4240281	4978613		Bacillus_virus(100.0%)	1	NA	NA
WP_001272994.1|4239528_4240281_+	L-cystine ABC transporter ATP-binding protein YecC	NA	G3M9Y6	Bacillus_virus	34.9	3.8e-26
>prophage 299
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	4252272	4253787	4978613		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001187819.1|4252272_4253787_+	L-arabinose ABC transporter ATP-binding protein AraG	NA	A0A2H4PQG7	Staphylococcus_phage	27.1	4.3e-13
>prophage 300
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	4263873	4269517	4978613		uncultured_Caudovirales_phage(50.0%)	5	NA	NA
WP_001370571.1|4263873_4265535_+	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	38.4	7.6e-11
WP_000483221.1|4265580_4267182_+	methyl-accepting chemotaxis protein IV	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.7	8.3e-15
WP_001421499.1|4267200_4268061_+	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_001421497.1|4268063_4269113_+	chemotaxis response regulator protein-glutamate methylesterase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	1.3e-05
WP_000763867.1|4269127_4269517_+	chemotaxis protein CheY	NA	A0A2K9L4R0	Tupanvirus	32.0	1.3e-06
>prophage 301
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	4274769	4276503	4978613	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_001025326.1|4274769_4276503_-|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.7	8.8e-87
>prophage 302
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	4284398	4286449	4978613		Synechococcus_phage(50.0%)	3	NA	NA
WP_000019590.1|4284398_4285142_-	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	3.5e-24
WP_000252979.1|4285182_4285578_-	membrane protein	NA	NA	NA	NA	NA
WP_000639285.1|4285630_4286449_-	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	98.4	2.5e-71
>prophage 303
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	4290467	4297531	4978613		Bacillus_virus(50.0%)	9	NA	NA
WP_001295503.1|4290467_4290989_+	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.0e-10
WP_001024930.1|4290990_4291593_-	YebB family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_001386853.1|4291663_4291729_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000580323.1|4291867_4292479_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_000568519.1|4292487_4293498_+	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.5	5.6e-09
WP_000571465.1|4293644_4294430_-	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_000202996.1|4294426_4295182_-	zinc ABC transporter ATP-binding protein ZnuC	NA	G3M9Y6	Bacillus_virus	28.3	1.3e-18
WP_001342995.1|4295260_4296193_+	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_001184045.1|4296208_4297531_+	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	40.9	1.2e-14
>prophage 304
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	4301529	4303005	4978613		Cyanophage(100.0%)	1	NA	NA
WP_000301727.1|4301529_4303005_+	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	37.5	4.4e-79
>prophage 305
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	4311061	4315531	4978613		Klebsiella_phage(33.33%)	7	NA	NA
WP_000944256.1|4311061_4311724_-	exodeoxyribonuclease X	NA	Q6UAU3	Klebsiella_phage	41.6	2.0e-07
WP_000011652.1|4311747_4312404_-	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_000916763.1|4312505_4312736_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	1.3e-14
WP_000204699.1|4312874_4313249_+	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000879282.1|4313252_4314125_+	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000976472.1|4314137_4314479_+	YebY family protein	NA	NA	NA	NA	NA
WP_000812724.1|4314874_4315531_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	50.2	3.1e-56
>prophage 306
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	4323027	4325076	4978613		Moraxella_phage(100.0%)	1	NA	NA
WP_001315679.1|4323027_4325076_+	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.5	6.8e-86
>prophage 307
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	4330407	4330617	4978613		Morganella_phage(100.0%)	1	NA	NA
WP_001062678.1|4330407_4330617_+	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	1.6e-22
>prophage 308
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	4336257	4337814	4978613		Moraxella_phage(100.0%)	1	NA	NA
WP_000394983.1|4336257_4337814_+	CNNM family cation transport protein YoaE	NA	A0A0R6PEZ3	Moraxella_phage	45.4	1.7e-41
>prophage 309
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	4341676	4349783	4978613	tRNA	Pandoravirus(33.33%)	8	NA	NA
WP_000854972.1|4341676_4343038_-	aminodeoxychorismate synthase component 1	NA	S4VT78	Pandoravirus	33.4	3.4e-41
WP_000457334.1|4343111_4343291_+	YoaH family protein	NA	NA	NA	NA	NA
WP_001300615.1|4343410_4343770_-	DUF1889 family protein	NA	NA	NA	NA	NA
WP_001295493.1|4344132_4344477_-	RidA family protein	NA	NA	NA	NA	NA
WP_000128847.1|4344608_4346519_+	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	31.9	4.5e-92
WP_001221000.1|4346576_4347272_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_000290564.1|4347311_4347893_+	Slp family lipoprotein YeaY	NA	NA	NA	NA	NA
WP_001475393.1|4348097_4349783_+	long-chain-fatty-acid--CoA ligase FadD	NA	A0A2H4PQM9	Staphylococcus_phage	26.2	4.0e-36
>prophage 310
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	4359126	4360335	4978613	transposase	Salmonella_phage(100.0%)	1	NA	NA
WP_071531852.1|4359126_4360335_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A1B0VCD8	Salmonella_phage	91.3	1.4e-208
>prophage 311
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	4366286	4370863	4978613		Bacillus_phage(100.0%)	3	NA	NA
WP_001295489.1|4366286_4367777_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	30.6	1.1e-08
WP_000616433.1|4367957_4369433_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_000219686.1|4369579_4370863_-	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	36.3	7.6e-11
>prophage 312
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	4374181	4375036	4978613		Indivirus(100.0%)	1	NA	NA
WP_001186343.1|4374181_4375036_+	methylglyoxal reductase YeaE	NA	A0A1V0SDE7	Indivirus	24.6	1.5e-10
>prophage 313
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	4378279	4378921	4978613		Tupanvirus(100.0%)	1	NA	NA
WP_001135062.1|4378279_4378921_-	bifunctional nicotinamidase/pyrazinamidase	NA	A0A2K9L2K0	Tupanvirus	34.9	2.9e-19
>prophage 314
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	4383847	4385809	4978613		Streptococcus_phage(100.0%)	1	NA	NA
WP_001235800.1|4383847_4385809_+	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	29.2	3.2e-40
>prophage 315
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	4391407	4392061	4978613		Bacillus_phage(100.0%)	1	NA	NA
WP_001315662.1|4391407_4392061_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	31.7	3.3e-10
>prophage 316
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	4398825	4400046	4978613		Klosneuvirus(100.0%)	1	NA	NA
WP_000081983.1|4398825_4400046_+	succinylornithine/acetylornithine transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.1	5.5e-27
>prophage 317
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	4407522	4408350	4978613		Bacillus_virus(100.0%)	1	NA	NA
WP_000175053.1|4407522_4408350_-	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	54.9	1.2e-73
>prophage 318
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	4414477	4416739	4978613		Tupanvirus(100.0%)	1	NA	NA
WP_000077844.1|4414477_4416739_-	catalase HPII	NA	A0A2K9L572	Tupanvirus	48.5	3.0e-143
>prophage 319
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	4428040	4447634	4978613	tRNA	Tupanvirus(22.22%)	19	NA	NA
WP_001144192.1|4428040_4429969_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.4	3.2e-130
WP_001700733.1|4429972_4430515_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.9	6.3e-15
WP_001124225.1|4430611_4430809_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_000124850.1|4430861_4431218_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_001386830.1|4431340_4431385_+	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_000018596.1|4431668_4432652_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	1.4e-33
WP_000672359.1|4432666_4435054_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_001229265.1|4435058_4435358_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
WP_000956519.1|4435458_4436439_+	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
WP_001154187.1|4436501_4437053_+	bifunctional thioredoxin/glutathione peroxidase	NA	NA	NA	NA	NA
WP_000029466.1|4437052_4437802_+	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	28.2	9.3e-09
WP_001209780.1|4437879_4438344_+	lipoprotein	NA	S5MM68	Bacillus_phage	37.7	9.5e-12
WP_001315654.1|4438590_4439304_+	anti-FlhDC factor	NA	NA	NA	NA	NA
WP_000175615.1|4439366_4440803_+	YdiU family protein	NA	NA	NA	NA	NA
WP_001270809.1|4440806_4440998_-	hemin uptake protein HemP	NA	NA	NA	NA	NA
WP_001082204.1|4441129_4442176_-	3-deoxy-7-phosphoheptulonate synthase AroH	NA	S4W5F1	Pandoravirus	47.7	3.2e-84
WP_000368046.1|4442332_4443166_-	posphoenolpyruvate synthetase regulatory kinase/phosphorylase PpsR	NA	NA	NA	NA	NA
WP_000069375.1|4443498_4445877_+	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	36.7	9.4e-172
WP_000553696.1|4445933_4447634_-	medium-chain fatty-acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	25.8	1.6e-32
>prophage 320
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	4466226	4471310	4978613		Lake_Baikal_phage(33.33%)	5	NA	NA
WP_000367160.1|4466226_4466595_+	Fe-S cluster assembly scaffold SufA	NA	A0A2H4N7N5	Lake_Baikal_phage	39.4	4.3e-15
WP_000089364.1|4466603_4468091_+	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_099588446.1|4468100_4468847_+	Fe-S cluster assembly ATPase SufC	NA	A0A285PWH2	Cedratvirus	32.0	2.2e-10
WP_000908012.1|4468821_4470093_+	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_000144565.1|4470089_4471310_+	cysteine desulfurase SufS	NA	Q2XUY6	environmental_halophage	41.4	4.4e-93
>prophage 321
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	4479600	4481867	4978613		Escherichia_phage(50.0%)	3	NA	NA
WP_001310861.1|4479600_4480269_+	4Fe-4S dicluster domain-containing protein	NA	A0A077SL61	Escherichia_phage	37.2	1.0e-22
WP_001069997.1|4480265_4481051_+	thiosulfate reductase cytochrome B subunit	NA	NA	NA	NA	NA
WP_000587560.1|4481054_4481867_+	hypothetical protein	NA	A0A077K9W7	Edwardsiella_phage	35.9	5.0e-08
>prophage 322
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	4487371	4496163	4978613		Orpheovirus(20.0%)	9	NA	NA
WP_000493947.1|4487371_4488013_+	riboflavin synthase	NA	A0A2I2L4R9	Orpheovirus	35.2	7.4e-23
WP_000098911.1|4488052_4489201_-	cyclopropane fatty acyl phospholipid synthase	NA	A0A2K9L4K8	Tupanvirus	45.7	4.2e-85
WP_001182362.1|4489491_4490703_-	Bcr/CflA family multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_000269501.1|4490815_4491748_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000190982.1|4491744_4492770_-	HTH-type transcriptional repressor PurR	NA	C6ZCU4	Enterobacteria_phage	31.6	3.7e-32
WP_000102278.1|4493068_4493158_+	stress response protein YnhF	NA	NA	NA	NA	NA
WP_096884985.1|4493323_4494493_+	MFS transporter	NA	NA	NA	NA	NA
WP_000007283.1|4494638_4495220_-	superoxide dismutase [Fe]	NA	Q56AR7	Bacillus_thuringiensis_phage	46.0	2.6e-43
WP_000101193.1|4495347_4496163_-	C40 family peptidase	NA	A0A2H5BM69	Streptomyces_phage	42.7	1.7e-19
>prophage 323
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	4504966	4506465	4978613		Indivirus(50.0%)	2	NA	NA
WP_000250661.1|4504966_4505863_+	aldo/keto reductase family oxidoreductase	NA	A0A1V0SDE7	Indivirus	30.8	3.6e-07
WP_001296937.1|4505943_4506465_+	superoxide dismutase [Cu-Zn] SodC2	NA	Q9MC02	Salmonella_phage	55.7	7.8e-47
>prophage 324
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	4513376	4514651	4978613	tRNA	Cronobacter_phage(100.0%)	1	NA	NA
WP_099588448.1|4513376_4514651_+|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	41.4	5.1e-84
>prophage 325
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	4534438	4536250	4978613		Vaccinia_virus(100.0%)	1	NA	NA
WP_000945878.1|4534438_4536250_+	beta-glucuronidase	NA	B9U1V4	Vaccinia_virus	100.0	0.0e+00
>prophage 326
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	4546326	4547628	4978613		Bacillus_phage(100.0%)	1	NA	NA
WP_000732487.1|4546326_4547628_-	two-component system sensor histidine kinase RstB	NA	W8CYF6	Bacillus_phage	23.9	7.2e-17
>prophage 327
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	4557728	4622784	4978613	transposase,lysis,integrase,portal,terminase,protease,tail	Enterobacteria_phage(46.94%)	74	4565304:4565320	4595820:4595836
WP_001260855.1|4557728_4558550_-|protease	serine protease	protease	NA	NA	NA	NA
WP_000233090.1|4558649_4558733_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000743951.1|4558825_4559161_-	acid shock protein	NA	NA	NA	NA	NA
WP_000091840.1|4559557_4560811_-	MFS transporter	NA	NA	NA	NA	NA
WP_001019530.1|4560917_4561811_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000225276.1|4561945_4563166_+	DNA-binding transcriptional repressor Mlc	NA	NA	NA	NA	NA
WP_000919226.1|4563290_4563986_+	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_001315626.1|4563938_4565231_-	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
4565304:4565320	attL	CTTTAAGAGATAAAAAA	NA	NA	NA	NA
WP_000148710.1|4565389_4566004_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
WP_000526492.1|4566046_4566901_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000213028.1|4566902_4567520_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_001340362.1|4567530_4569954_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	1.7e-208
WP_000041535.1|4570014_4572441_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.1	2.9e-213
WP_001295396.1|4572639_4572945_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_001321287.1|4573052_4573763_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001138584.1|4573765_4574326_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_000705197.1|4574360_4574702_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_000598292.1|4574836_4575163_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_001295394.1|4575368_4576583_+	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_000836057.1|4576594_4577614_+	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	26.2	7.4e-17
WP_001389342.1|4577671_4577800_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000876976.1|4577801_4579082_-|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	62.6	1.0e-156
WP_001296941.1|4579116_4579353_-	excisionase family protein	NA	S4TND0	Salmonella_phage	50.7	6.1e-15
WP_099588449.1|4579440_4581912_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	57.5	8.5e-59
WP_001090200.1|4582004_4582196_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449192.1|4582192_4582381_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001474216.1|4582868_4583444_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001421419.1|4583445_4583601_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	55.3	1.0e-07
WP_000362155.1|4583866_4584286_-	hypothetical protein	NA	K7PK07	Enterobacteria_phage	65.1	8.8e-25
WP_000391950.1|4584386_4584668_+	hypothetical protein	NA	K7PHA1	Enterobacteria_phage	72.6	6.5e-24
WP_001478187.1|4584651_4585077_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001475341.1|4585148_4586219_+	hypothetical protein	NA	A0A088CD36	Shigella_phage	65.7	6.5e-64
WP_001474220.1|4586259_4586685_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	89.6	1.7e-60
WP_000379313.1|4586912_4587938_+	hypothetical protein	NA	NA	NA	NA	NA
WP_122083109.1|4588315_4588423_-	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	100.0	3.8e-09
WP_001013636.1|4588467_4588680_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	96.9	8.9e-26
WP_001332495.1|4589138_4589417_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	46.9	1.3e-11
WP_001483581.1|4589418_4590468_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	2.2e-109
WP_000904112.1|4590480_4590855_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	8.4e-35
WP_000762866.1|4590851_4591673_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	59.0	1.2e-78
WP_029380182.1|4592571_4592700_+	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	96.4	4.7e-06
WP_000506936.1|4593066_4593495_+	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
WP_001348108.1|4593666_4594041_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000839561.1|4594292_4594508_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	95.8	5.9e-33
WP_001421378.1|4594512_4594824_+	DUF1327 domain-containing protein	NA	K7PGU6	Enterobacteria_phage	66.7	5.9e-26
WP_001092966.1|4594820_4595354_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.2	8.4e-97
WP_001071776.1|4595350_4595848_+	DUF2514 domain-containing protein	NA	NA	NA	NA	NA
4595820:4595836	attR	CTTTAAGAGATAAAAAA	NA	NA	NA	NA
WP_001356335.1|4596211_4596424_+	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.6e-22
WP_071526745.1|4596434_4596623_+	cold-shock protein	NA	NA	NA	NA	NA
WP_001443523.1|4596770_4596926_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001019207.1|4597098_4597272_+	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_085948316.1|4597645_4598919_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	95.7	2.8e-170
WP_099588450.1|4598927_4599110_+	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	91.5	2.5e-16
WP_000421825.1|4599659_4600199_+	DUF1441 family protein	NA	A5LH26	Enterobacteria_phage	100.0	1.8e-94
WP_001546839.1|4600207_4602307_+|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	96.9	0.0e+00
WP_001072975.1|4602303_4602516_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_072745589.1|4602443_4603991_+|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	99.6	3.2e-282
WP_001546838.1|4603968_4605996_+|protease	Clp protease ClpP	protease	A5LH30	Enterobacteria_phage	99.7	0.0e+00
WP_001097050.1|4606082_4606406_+	DUF2190 family protein	NA	A0A291AWX2	Escherichia_phage	100.0	8.5e-52
WP_001474292.1|4606398_4606674_+	ATP-binding sugar transporter from pro-phage family protein	NA	K7PH43	Enterobacteria_phage	97.8	3.3e-44
WP_000677108.1|4606685_4607264_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	99.5	7.2e-102
WP_001421116.1|4607260_4607662_+|tail	phage tail protein	tail	A0A291AWY2	Escherichia_phage	99.2	4.1e-72
WP_001475283.1|4607673_4608417_+	cell motility protein	NA	A5LH35	Enterobacteria_phage	99.2	5.0e-132
WP_001421118.1|4608477_4608864_+|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	98.4	3.0e-64
WP_001161009.1|4608872_4609202_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_001421119.1|4609173_4612239_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	98.7	0.0e+00
WP_000447253.1|4612238_4612568_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	100.0	1.7e-60
WP_001152379.1|4612577_4613276_+|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	99.6	1.3e-134
WP_032228194.1|4613281_4614025_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	98.8	6.3e-151
WP_000741576.1|4613922_4614570_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	98.6	2.7e-113
WP_074484540.1|4614630_4618113_+	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	90.4	0.0e+00
WP_001230364.1|4618179_4618779_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	98.0	8.2e-109
WP_024198169.1|4618843_4622203_+	hypothetical protein	NA	X2KTY7	Enterobacteria_phage	36.4	8.1e-12
WP_001421130.1|4622202_4622784_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	92.7	2.1e-101
>prophage 328
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	4625889	4627589	4978613		Micromonas_pusilla_virus(50.0%)	2	NA	NA
WP_000527751.1|4625889_4627350_+	mannitol dehydrogenase family protein	NA	G8DCZ3	Micromonas_pusilla_virus	29.8	1.1e-42
WP_000214712.1|4627385_4627589_-	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
>prophage 329
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	4632955	4633846	4978613		Bacillus_phage(100.0%)	1	NA	NA
WP_000592814.1|4632955_4633846_+	diguanylate cyclase DgcZ	NA	A0A127AWB9	Bacillus_phage	37.7	8.2e-20
>prophage 330
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	4643096	4643480	4978613		Streptococcus_phage(100.0%)	1	NA	NA
WP_000091199.1|4643096_4643480_-	MDR efflux pump AcrAB transcriptional activator MarA	NA	D0R0F8	Streptococcus_phage	32.3	4.7e-09
>prophage 331
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	4651224	4652643	4978613		Bacillus_phage(100.0%)	1	NA	NA
WP_157774453.1|4651224_4652643_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	36.1	1.4e-18
>prophage 332
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	4660524	4662060	4978613		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001194881.1|4660524_4662060_-	autoinducer 2 ABC transporter ATP-binding protein LsrA	NA	A0A2H4PQG7	Staphylococcus_phage	30.4	9.8e-21
>prophage 333
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	4665463	4670884	4978613		Escherichia_phage(100.0%)	1	NA	NA
WP_001315515.1|4665463_4670884_+	autotransporter barrel domain-containing lipoprotein	NA	A0A2L1IV18	Escherichia_phage	38.3	1.6e-142
>prophage 334
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	4687473	4694409	4978613		Bacillus_phage(50.0%)	3	NA	NA
WP_000628544.1|4687473_4689159_+	ABC transporter ATP-binding protein/permease	NA	W8CYL7	Bacillus_phage	24.1	1.0e-10
WP_000832498.1|4689196_4691569_+	TonB-dependent receptor plug domain-containing protein	NA	NA	NA	NA	NA
WP_001317088.1|4691613_4694409_+	insulinase family protein	NA	A0A167R9K4	Powai_lake_megavirus	23.8	4.4e-19
>prophage 335
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	4699683	4703490	4978613		Bacillus_virus(50.0%)	2	NA	NA
WP_000426265.1|4699683_4701066_+	diguanylate cyclase DosC	NA	G3MA91	Bacillus_virus	31.5	2.0e-17
WP_001307211.1|4701090_4703490_+	oxygen-sensing cyclic-di-GMP phosphodiesterase	NA	A0A1V0SL97	Klosneuvirus	22.0	1.6e-09
>prophage 336
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	4707806	4709712	4978613		Planktothrix_phage(100.0%)	2	NA	NA
WP_000193551.1|4707806_4708793_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.1	2.2e-18
WP_001285553.1|4708785_4709712_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.6	1.2e-13
>prophage 337
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	4712986	4714428	4978613		Tupanvirus(50.0%)	2	NA	NA
WP_000642407.1|4712986_4713997_+	alcohol dehydrogenase AdhP	NA	A0A2K9L339	Tupanvirus	25.3	9.6e-25
WP_000781370.1|4714143_4714428_+	HigA family addiction module antidote protein	NA	A0A2L1IV52	Escherichia_phage	51.1	1.2e-20
>prophage 338
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	4720440	4720731	4978613		Enterobacteria_phage(100.0%)	1	NA	NA
WP_000768384.1|4720440_4720731_+	lipoprotein	NA	Q1MVN1	Enterobacteria_phage	65.1	2.1e-25
>prophage 339
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	4727616	4729161	4978613		Escherichia_phage(100.0%)	1	NA	NA
WP_000702560.1|4727616_4729161_+	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	39.2	6.4e-20
>prophage 340
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	4736365	4741319	4978613	transposase	Stx2-converting_phage(100.0%)	5	NA	NA
WP_000381379.1|4736365_4737937_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	7.6e-170
WP_000624622.1|4737956_4738304_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_000381379.1|4738703_4740275_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	7.6e-170
WP_000624622.1|4740294_4740642_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_099588451.1|4740641_4741319_-|transposase	transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	46.0	4.3e-21
>prophage 341
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	4747487	4751696	4978613		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000014879.1|4747487_4751696_-	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	43.3	4.1e-21
>prophage 342
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	4758778	4760881	4978613		Salmonella_phage(100.0%)	1	NA	NA
WP_001474232.1|4758778_4760881_+	TonB-dependent receptor	NA	A0A1B0VCF0	Salmonella_phage	65.3	4.0e-134
>prophage 343
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	4768013	4769027	4978613		Mycoplasma_phage(100.0%)	1	NA	NA
WP_000220396.1|4768013_4769027_-	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	37.9	2.1e-27
>prophage 344
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	4772696	4778964	4978613	transposase	Cronobacter_phage(25.0%)	7	NA	NA
WP_001270286.1|4772696_4773113_-	type II toxin-antitoxin system antitoxin HicB	NA	F1C593	Cronobacter_phage	57.8	6.3e-31
WP_000813794.1|4773158_4773335_-	type II toxin-antitoxin system mRNA interferase toxin HicA	NA	A0A0M3LQ86	Mannheimia_phage	57.9	3.6e-12
WP_000494244.1|4773556_4773787_+	YncJ family protein	NA	NA	NA	NA	NA
WP_001307191.1|4773878_4775840_-	23S rRNA 5-hydroxycytidine C2501 synthase	NA	Q6DW11	Phage_TP	28.9	7.1e-24
WP_000429141.1|4775912_4776449_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001349372.1|4776501_4777716_+	BenE family transporter YdcO	NA	NA	NA	NA	NA
WP_001373192.1|4777755_4778964_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.8	2.9e-209
>prophage 345
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	4790770	4791719	4978613		Moraxella_phage(50.0%)	2	NA	NA
WP_000731833.1|4790770_4790944_-	periplasmic protein	NA	A0A0R6PKG1	Moraxella_phage	67.4	4.4e-07
WP_001307188.1|4791188_4791719_-	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	44.9	3.1e-19
>prophage 346
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	4795658	4799561	4978613		Klosneuvirus(100.0%)	1	NA	NA
WP_000139614.1|4795658_4799561_-	ATP-dependent RNA helicase HrpA	NA	A0A1V0SIV3	Klosneuvirus	29.5	2.2e-53
>prophage 347
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	4830846	4831836	4978613		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_000762218.1|4830846_4831836_+	D-lactate dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	44.0	3.3e-70
>prophage 348
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	4836795	4844065	4978613	tRNA	Enterobacteria_phage(20.0%)	6	NA	NA
WP_000837924.1|4836795_4837929_+	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	58.8	8.3e-118
WP_001082294.1|4838069_4838504_+	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.0e-28
WP_000081418.1|4838679_4839615_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	97.7	1.1e-144
WP_000123745.1|4839743_4841117_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_000387388.1|4841594_4842578_-	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_001307164.1|4842832_4844065_+	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
>prophage 349
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	4850391	4850907	4978613		Streptococcus_phage(100.0%)	1	NA	NA
WP_000945005.1|4850391_4850907_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	42.8	2.4e-24
>prophage 350
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	4867524	4868607	4978613		Planktothrix_phage(100.0%)	1	NA	NA
WP_000057977.1|4867524_4868607_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.7	5.6e-23
>prophage 351
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	4882610	4883876	4978613		Klosneuvirus(100.0%)	1	NA	NA
WP_000069226.1|4882610_4883876_-	4-aminobutyrate transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.0	3.5e-24
>prophage 352
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	4896791	4902451	4978613		Bacillus_virus(50.0%)	5	NA	NA
WP_000573407.1|4896791_4897598_+	peptide ABC transporter ATP-binding protein SapF	NA	G3M9Y6	Bacillus_virus	28.6	7.2e-15
WP_000968857.1|4897665_4898019_+	DUF559 domain-containing protein	NA	NA	NA	NA	NA
WP_000506490.1|4898388_4899177_+	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
WP_000437858.1|4899321_4900449_+	CMD domain-containing protein	NA	NA	NA	NA	NA
WP_000484984.1|4900516_4902451_+	exoribonuclease II	NA	Q0GXV6	Lactococcus_phage	27.9	3.1e-32
>prophage 353
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	4910266	4910857	4978613		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001176295.1|4910266_4910857_+	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	48.9	7.7e-43
>prophage 354
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	4915781	4921073	4978613	protease	Tupanvirus(33.33%)	4	NA	NA
WP_001297122.1|4915781_4918379_-	type I DNA topoisomerase	NA	A0A2K9L1Q2	Tupanvirus	34.7	1.7e-86
WP_001031530.1|4918758_4919010_+	YciN family protein	NA	NA	NA	NA	NA
WP_000422045.1|4919045_4920095_-|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
WP_000559280.1|4920314_4921073_+	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	25.0	1.5e-06
>prophage 355
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	4926006	4928964	4978613		Acinetobacter_phage(100.0%)	2	NA	NA
WP_000763511.1|4926006_4927602_+	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	3.8e-52
WP_099588458.1|4927605_4928964_+	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.3	7.3e-36
>prophage 356
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	4940621	4942636	4978613		Bacillus_virus(50.0%)	2	NA	NA
WP_000994905.1|4940621_4941626_-	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppF	NA	G3M9Y6	Bacillus_virus	30.7	2.3e-15
WP_000110945.1|4941622_4942636_-	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppD	NA	G9BWD6	Planktothrix_phage	31.7	2.0e-14
>prophage 357
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	4951045	4961055	4978613		Citrobacter_phage(25.0%)	10	NA	NA
WP_000068079.1|4951045_4951663_-	thymidine kinase	NA	A0A0A0YP64	Citrobacter_phage	53.6	1.3e-53
WP_001287378.1|4952267_4952681_+	DNA-binding transcriptional regulator H-NS	NA	NA	NA	NA	NA
WP_000718995.1|4952824_4953733_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	46.8	1.4e-59
WP_000193437.1|4953934_4954948_-	two-component system response regulator RssB	NA	NA	NA	NA	NA
WP_001226476.1|4955039_4955945_-	patatin-like phospholipase RssA	NA	NA	NA	NA	NA
WP_001307143.1|4956057_4956516_+	YchJ family protein	NA	NA	NA	NA	NA
WP_000555849.1|4956565_4957408_+	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	47.6	1.1e-13
WP_001160110.1|4958132_4958810_-	respiratory nitrate reductase subunit gamma	NA	NA	NA	NA	NA
WP_000571699.1|4958809_4959520_-	nitrate reductase molybdenum cofactor assembly chaperone	NA	NA	NA	NA	NA
WP_000702660.1|4959516_4961055_-	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	40.8	6.3e-20
>prophage 358
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	4972186	4972417	4978613		Spodoptera_litura_granulovirus(100.0%)	1	NA	NA
WP_001146442.1|4972186_4972417_-	putative cation transport regulator ChaB	NA	A5IZT6	Spodoptera_litura_granulovirus	40.0	6.5e-06
>prophage 359
NZ_CP024243	Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome	4978613	4975518	4976373	4978613		Cafeteria_roenbergensis_virus(100.0%)	1	NA	NA
WP_000811065.1|4975518_4976373_-	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	39.0	8.3e-46
>prophage 1
NZ_CP024244	Escherichia coli O128:H27 strain 90-9281 plasmid unnamed, complete sequence	152012	2150	26042	152012	transposase	Stx2-converting_phage(33.33%)	24	NA	NA
WP_000381379.1|2150_3722_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	7.6e-170
WP_000624622.1|3741_4089_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_099588451.1|4088_4766_-|transposase	transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	46.0	4.3e-21
WP_001143613.1|6123_7539_+|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	47.2	1.8e-117
WP_099588459.1|7544_8757_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.0	5.5e-168
WP_001494857.1|9593_9947_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001464003.1|10167_10419_-|transposase	transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	55.3	1.7e-07
WP_001356264.1|10739_11099_-|transposase	transposase	transposase	A0A1B0V7H9	Salmonella_phage	53.4	1.7e-13
WP_077635016.1|11098_11266_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	78.3	8.9e-13
WP_001498835.1|11503_12718_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000593532.1|12729_13359_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.8	3.7e-19
WP_032181798.1|13351_14173_-	membrane protein	NA	NA	NA	NA	NA
WP_001269347.1|14069_15296_-	TolC family protein	NA	NA	NA	NA	NA
WP_000258161.1|15292_16423_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_013188501.1|18929_19148_+	heat-stable enterotoxin ST-I group b	NA	NA	NA	NA	NA
WP_001016257.1|19353_20100_-	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	48.5	5.0e-55
WP_099588459.1|20335_21549_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.0	5.5e-168
WP_001464039.1|21554_21737_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000624722.1|21767_22118_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
WP_001464040.1|22114_22435_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	100.0	1.5e-16
WP_001310555.1|22414_23431_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.7	9.8e-187
WP_000217718.1|23788_24019_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099588460.1|24070_25432_+	DUF3560 domain-containing protein	NA	NA	NA	NA	NA
WP_001460283.1|25478_26042_+	class I SAM-dependent methyltransferase	NA	A0A2I7RQ20	Vibrio_phage	36.9	3.0e-20
>prophage 2
NZ_CP024244	Escherichia coli O128:H27 strain 90-9281 plasmid unnamed, complete sequence	152012	72656	110458	152012	integrase,transposase	Stx2-converting_phage(21.43%)	35	91663:91722	110464:111723
WP_000381379.1|72656_74228_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	7.6e-170
WP_000624622.1|74247_74595_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_099588451.1|74594_75272_-|transposase	transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	46.0	4.3e-21
WP_000649995.1|76381_76831_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000455854.1|76940_77150_+	hypothetical protein	NA	I3WFA4	Macacine_betaherpesvirus	93.0	3.5e-14
WP_085951105.1|77336_78550_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.0	5.5e-168
WP_085947598.1|79428_80591_-|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	4.0e-51
WP_001460290.1|81212_81929_+	CFA/I pilus chaperone CfaA	NA	NA	NA	NA	NA
WP_000768758.1|81957_82467_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000768759.1|82476_83004_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077635032.1|83119_85687_+	CS4 pilus usher protein CsaC	NA	NA	NA	NA	NA
WP_001033659.1|85690_86776_+	CS4 pilus tip adhesin CsaE	NA	NA	NA	NA	NA
WP_001009833.1|86936_87734_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_024168605.1|87930_88125_+	ANR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001460292.1|89444_90308_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001309734.1|91031_91466_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	60.3	1.5e-19
91663:91722	attL	TGATCTTACCCAGCAATAGTGGACACGCGGCTAAGTGAGTAAACTCTCAGTCAGAGGTGA	NA	NA	NA	NA
WP_085947598.1|91727_92889_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	4.0e-51
WP_157774455.1|92886_93033_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000433597.1|93402_95340_+	NACHT domain-containing protein	NA	NA	NA	NA	NA
WP_001356324.1|95619_95886_+	type II toxin-antitoxin system ParD family antitoxin	NA	NA	NA	NA	NA
WP_001356323.1|95954_96122_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085951106.1|96143_96365_+	serine/threonine protein kinase	NA	NA	NA	NA	NA
WP_001066942.1|96485_97226_+|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	2.0e-24
WP_000361612.1|97510_98488_-	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	59.2	3.9e-100
WP_001356322.1|99274_99940_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000933099.1|100098_100839_-	abortive infection family protein	NA	NA	NA	NA	NA
WP_000708302.1|100874_101663_-	DUF2971 domain-containing protein	NA	NA	NA	NA	NA
WP_001248529.1|101659_102280_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010891291.1|102276_102960_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_000465050.1|103400_103814_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085948316.1|104309_105583_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	95.7	2.8e-170
WP_000239529.1|106071_106347_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000633914.1|106340_106985_-	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	43.5	8.8e-40
WP_099588461.1|107181_108395_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.0	5.5e-168
WP_085947598.1|109295_110458_-|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	4.0e-51
110464:111723	attR	TCACCTCTGACTGAGAGTTTACTCACTTAGCCGCGTGTCCACTATTGCTGGGTAAGATCAGTCAGAAGCTGTCCAGAATTTGATTCCATTCGGCCTTACAGTCCAGCAGGTACCGGAGGCCGTTGTCGACCCCGTCAAGTAAATCGGAAGCCTCTCCCATTTTTTCCCCAAAGCGGCGGGTGTTGACGTAATGAATTCCTTCAAGGCTCCGGGTGCCGTCATTTCTCTTGGCATATCGGAAATCTGTCGCCCGTTCATCCGCTTGGTGAAGAGCTTTAACCACCTCTTTGACGATTTTAAAATCGGAAGGCCGGTAGCTGTCATCAACTTCCAGGATCAGCTTTTGTGCCAGCGGCCATAGATTATTCAGGTTATGGTCATCTTTTTTGTACTGGTGTTTATCCGGGTCTTCTGCCAGTGCAAGGGCCAGTCCGATAATTTGTTTGATAAGGAGCTCCAAGTGATGTCGGTAGAGAAACAACACCGGATAAACCAGAAAATCCTGGTCCCGCCCGGATTCATCAATGTGGTTAATCAGAATATCAGCAGCTCGCCTGTAACCTTCAGTGTAAGCTGTACCATGATCCGGCATGTAATTCAGGCAGGCATTATTGTGCCAGTCGCTGTCGCTGGCCAGCAGCCCCGGTTCTAACGTTTTTCCCTTTTTCATTTCAGCTCCAGAATCTTTTAACAGCCCCGGTTCGGTACCTTATCCGGAAATCCCGCCTACTGTATGTATTCAGCGGTCAGCAGCCAGTTCTTCAGCCAGCTTCACAAACCCTTTGTGCTCAGTCTGCAGGTAATGACTGTAAATCCGGGCATCACGTTCTGTCAGTCCGGATGGATTACCGGTGAAGTAACGTTGTAGCACCGCAATACAGTGATTGTAGTTATCGAGATCATATTCCCAGTTTCCCAGCTCACCGGCCGCATCCAGCTCCCGGCGAAACTGCTCGTATTTACGGAGCAGAATGCCAAGACCTAATTCTGTTGCAGCATAAACATTATTTTCTCCTGGCGCGGAAATCGCATTACGGATTTTTTCAAAAGCATAACTGAAATCATTTCTCTCATTGAATGCAGTAAACATGTCATTTCCTCAGTTGAATAGTTAGCCGTGCAATTTTACCACACCTCAATCATCGCCAGATGAGTGCTACTCTGTTGAGAAAGTGACTTTCACAAAAATGAATTTCACATATTGAAATAATAATCAGGCATATAACCACTCCATTAAATTACCGAACAGTGGTTTTCAGA	NA	NA	NA	NA
>prophage 3
NZ_CP024244	Escherichia coli O128:H27 strain 90-9281 plasmid unnamed, complete sequence	152012	122213	128561	152012	transposase	Stx2-converting_phage(50.0%)	8	NA	NA
WP_001339397.1|122213_122891_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000624622.1|122890_123238_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_000381379.1|123257_124829_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	7.6e-170
WP_099588463.1|124831_125302_+	ClbS/DfsB family four-helix bundle protein	NA	NA	NA	NA	NA
WP_000343765.1|125320_126541_+|transposase	ISL3-like element ISEc53 family transposase	transposase	NA	NA	NA	NA
WP_000618110.1|126604_126853_+	DinI-like family protein	NA	Q2A098	Sodalis_phage	48.0	1.9e-14
WP_000109071.1|126849_127287_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	48.4	8.3e-26
WP_000457490.1|127286_128561_+	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	60.0	1.7e-143
