The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	0	18003	4943397		Streptomyces_phage(20.0%)	15	NA	NA
WP_000840481.1|443_683_-	DUF1289 domain-containing protein	NA	NA	NA	NA	NA
WP_000093589.1|1422_2520_+	N-ethylmaleimide reductase	NA	NA	NA	NA	NA
WP_001237796.1|2600_3008_+	lactoylglutathione lyase	NA	NA	NA	NA	NA
WP_001718347.1|3110_3758_+	ribonuclease T	NA	NA	NA	NA	NA
WP_032201041.1|3850_8467_+	ATP-dependent helicase	NA	NA	NA	NA	NA
WP_000108172.1|8517_8865_-	monothiol glutaredoxin 4	NA	NA	NA	NA	NA
WP_001718349.1|9199_10027_+	C40 family peptidase	NA	A0A2H5BM69	Streptomyces_phage	42.7	1.7e-19
WP_000007283.1|10154_10736_+	superoxide dismutase [Fe]	NA	Q56AR7	Bacillus_thuringiensis_phage	46.0	2.6e-43
WP_000701040.1|10881_12051_-	MFS transporter	NA	NA	NA	NA	NA
WP_000102278.1|12216_12306_-	stress response protein YnhF	NA	NA	NA	NA	NA
WP_000190982.1|12604_13630_+	HTH-type transcriptional repressor PurR	NA	C6ZCU4	Enterobacteria_phage	31.6	3.7e-32
WP_000269493.1|13626_14559_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001718351.1|14671_15883_+	Bcr/CflA family multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_000098896.1|16173_17322_+	cyclopropane fatty acyl phospholipid synthase	NA	A0A2K9L4K8	Tupanvirus	45.4	9.3e-85
WP_000493947.1|17361_18003_-	riboflavin synthase	NA	A0A2I2L4R9	Orpheovirus	35.2	7.4e-23
>prophage 2
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	23507	25774	4943397		Edwardsiella_phage(50.0%)	3	NA	NA
WP_001718353.1|23507_24320_-	hypothetical protein	NA	A0A077K9W7	Edwardsiella_phage	35.9	1.7e-08
WP_001613177.1|24323_25109_-	thiosulfate reductase cytochrome B subunit	NA	NA	NA	NA	NA
WP_001349911.1|25105_25774_-	4Fe-4S dicluster domain-containing protein	NA	A0A077SL61	Escherichia_phage	37.2	1.0e-22
>prophage 3
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	36525	39146	4943397		Cedratvirus(50.0%)	3	NA	NA
WP_000948855.1|36525_37272_-	Fe-S cluster assembly ATPase SufC	NA	A0A285PWH2	Cedratvirus	32.0	3.8e-10
WP_000089364.1|37281_38769_-	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_000367160.1|38777_39146_-	Fe-S cluster assembly scaffold SufA	NA	A0A2H4N7N5	Lake_Baikal_phage	39.4	4.3e-15
>prophage 4
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	57740	115214	4943397	terminase,holin,capsid,head,integrase,tail,plate,tRNA,portal	Enterobacteria_phage(73.47%)	66	69975:69999	107856:107880
WP_072148437.1|57740_59441_+	medium-chain fatty-acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	25.8	2.1e-32
WP_001613191.1|59497_61876_-	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	36.7	7.2e-172
WP_000368046.1|62208_63042_+	posphoenolpyruvate synthetase regulatory kinase/phosphorylase PpsR	NA	NA	NA	NA	NA
WP_001082229.1|63198_64245_+	3-deoxy-7-phosphoheptulonate synthase AroH	NA	S4W5F1	Pandoravirus	47.7	3.2e-84
WP_001270809.1|64376_64568_+	hemin uptake protein HemP	NA	NA	NA	NA	NA
WP_001613192.1|64571_66008_-	YdiU family protein	NA	NA	NA	NA	NA
WP_001613194.1|66070_66784_-	anti-FlhDC factor	NA	NA	NA	NA	NA
WP_001209780.1|67030_67495_-	lipoprotein	NA	S5MM68	Bacillus_phage	37.7	9.5e-12
WP_001613196.1|67572_68322_-	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	28.7	3.2e-09
WP_001154167.1|68321_68873_-	bifunctional thioredoxin/glutathione peroxidase	NA	NA	NA	NA	NA
WP_000956527.1|68935_69916_-	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
69975:69999	attL	AAAGAAAAAAGGCCGCAGAGCGGCC	NA	NA	NA	NA
WP_000997174.1|70124_70454_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000668483.1|70561_70924_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099490828.1|70926_71865_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M4RTQ0	Salmonella_phage	51.5	3.9e-81
WP_000904671.1|71953_72262_-	helix-turn-helix transcriptional regulator	NA	A0A0M5M1I9	Salmonella_phage	53.1	1.3e-22
WP_001151410.1|72358_72637_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000917808.1|72651_72990_+	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	85.3	2.2e-50
WP_099490829.1|73000_73234_+	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	74.0	8.3e-25
WP_000514277.1|73290_73533_+	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	100.0	2.3e-38
WP_000021663.1|73529_73643_+	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	94.6	3.6e-10
WP_000985153.1|73730_73934_+	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	82.1	3.3e-25
WP_042096084.1|74257_74647_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099490830.1|74643_77277_+	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	79.7	0.0e+00
WP_000686521.1|77817_78777_+	recombinase	NA	A0A0A7NPX4	Enterobacteria_phage	99.7	2.9e-180
WP_000211255.1|78781_79093_+	chromosome partitioning protein	NA	A0A0A7NPT5	Enterobacteria_phage	96.1	1.9e-48
WP_001163782.1|79156_79489_+	carboxylate--amine ligase	NA	A0A0A7NV51	Enterobacteria_phage	96.4	5.5e-54
WP_001519213.1|79485_79893_+	hypothetical protein	NA	A0A0A7NRY2	Enterobacteria_phage	90.0	3.4e-21
WP_099490831.1|80377_81424_-|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	99.7	1.7e-205
WP_099490832.1|81423_83175_-	oxidoreductase	NA	A0A0A7NV54	Enterobacteria_phage	97.4	0.0e+00
WP_001262676.1|83329_84166_+|capsid	phage capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	99.3	1.0e-149
WP_001055119.1|84189_85242_+|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	99.7	1.5e-198
WP_099490833.1|85287_86088_+|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	91.0	4.3e-129
WP_000063082.1|86190_86685_+|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	99.4	2.7e-89
WP_000864901.1|86684_86885_+|tail	tail protein	tail	A0A0A7NV57	Enterobacteria_phage	100.0	3.5e-32
WP_000104350.1|86887_87211_+|holin	holin	holin	A0A0A7NRY9	Enterobacteria_phage	99.1	1.6e-50
WP_000072335.1|87207_87600_+	M15 family metallopeptidase	NA	A0A0A7NQ86	Enterobacteria_phage	99.2	9.9e-71
WP_000780548.1|87596_88004_+	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	95.6	5.5e-64
WP_096221949.1|88141_88609_+|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	98.7	8.4e-85
WP_096978766.1|88601_89237_+	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	99.1	1.2e-113
WP_021564414.1|89233_89815_+|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	97.4	2.8e-101
WP_000213447.1|89811_90162_+|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	100.0	9.2e-60
WP_099490834.1|90165_91062_+|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	98.7	3.5e-156
WP_000071721.1|91054_91585_+|tail	phage tail protein I	tail	A0A0A7NPV1	Enterobacteria_phage	100.0	1.3e-94
WP_099490835.1|91587_93822_+|tail	phage tail protein	tail	Q1MVL8	Enterobacteria_phage	62.5	6.7e-212
WP_000972173.1|93824_94358_+|tail	tail fiber assembly protein	tail	A0A077SL44	Escherichia_phage	99.4	5.5e-96
WP_021578959.1|94386_94914_-|tail	tail fiber assembly protein	tail	A0A0C4UR05	Shigella_phage	96.0	1.1e-91
WP_000905055.1|95997_96597_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	97.8	1.2e-96
WP_000979954.1|96623_97112_-|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	100.0	1.6e-86
WP_099490836.1|97124_99932_-|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	96.9	0.0e+00
WP_000333503.1|99918_100074_-|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	96.1	9.7e-22
WP_000651572.1|100082_100457_-|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	73.2	9.0e-37
WP_000290462.1|100512_101025_-|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	97.1	1.5e-90
WP_096854704.1|101024_102209_-|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	98.2	1.7e-222
WP_001756444.1|102366_103476_+	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	94.3	6.3e-195
WP_099490837.1|103686_106479_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001756446.1|106484_106805_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001781539.1|106999_107260_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_001416438.1|107450_107591_+	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	95.7	4.5e-18
WP_001229265.1|107897_108197_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
107856:107880	attR	AAAGAAAAAAGGCCGCAGAGCGGCC	NA	NA	NA	NA
WP_032201046.1|108201_110589_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_000018588.1|110603_111587_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	1.1e-33
WP_001386830.1|111869_111914_-	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_000124850.1|112036_112393_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_001124225.1|112445_112643_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_001700733.1|112739_113282_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.9	6.3e-15
WP_001144202.1|113285_115214_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.3	9.4e-130
>prophage 5
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	126512	128774	4943397		Tupanvirus(100.0%)	1	NA	NA
WP_032201048.1|126512_128774_+	catalase HPII	NA	A0A2K9L572	Tupanvirus	48.5	1.0e-143
>prophage 6
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	134901	135729	4943397		Bacillus_virus(100.0%)	1	NA	NA
WP_000175050.1|134901_135729_+	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	54.9	1.2e-73
>prophage 7
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	143205	144426	4943397		Klosneuvirus(100.0%)	1	NA	NA
WP_032201053.1|143205_144426_-	succinylornithine/acetylornithine transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.3	2.5e-27
>prophage 8
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	151190	151844	4943397		Planktothrix_phage(100.0%)	1	NA	NA
WP_001718379.1|151190_151844_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	30.2	7.6e-15
>prophage 9
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	157443	159405	4943397		Streptococcus_phage(100.0%)	1	NA	NA
WP_032201055.1|157443_159405_-	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	29.2	3.2e-40
>prophage 10
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	164318	168404	4943397		Tupanvirus(50.0%)	4	NA	NA
WP_001135075.1|164318_164960_+	bifunctional nicotinamidase/pyrazinamidase	NA	A0A2K9L2K0	Tupanvirus	34.9	2.9e-19
WP_001718388.1|165052_166411_-	MFS transporter	NA	NA	NA	NA	NA
WP_000719088.1|166528_167287_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_000723724.1|167423_168404_-	NADH-dependent methylglyoxal reductase	NA	A0A2H4PQR8	Staphylococcus_phage	22.0	7.9e-08
>prophage 11
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	177217	178072	4943397		Indivirus(100.0%)	1	NA	NA
WP_001186347.1|177217_178072_-	methylglyoxal reductase YeaE	NA	A0A1V0SDE7	Indivirus	24.6	1.1e-10
>prophage 12
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	181390	185967	4943397		Bacillus_phage(100.0%)	3	NA	NA
WP_000219686.1|181390_182674_+	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	36.3	7.6e-11
WP_000616417.1|182820_184296_+	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_000766132.1|184476_185967_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	30.6	6.4e-09
>prophage 13
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	202069	210175	4943397	tRNA	Staphylococcus_phage(33.33%)	8	NA	NA
WP_000758422.1|202069_203755_-	long-chain-fatty-acid--CoA ligase FadD	NA	A0A2H4PQM9	Staphylococcus_phage	26.0	1.5e-35
WP_000290576.1|203959_204541_-	Slp family lipoprotein YeaY	NA	NA	NA	NA	NA
WP_001220997.1|204580_205276_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_000128847.1|205333_207244_-	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	31.9	4.5e-92
WP_001295493.1|207375_207720_+	RidA family protein	NA	NA	NA	NA	NA
WP_001307845.1|208081_208441_+	DUF1889 family protein	NA	NA	NA	NA	NA
WP_000457334.1|208560_208740_-	YoaH family protein	NA	NA	NA	NA	NA
WP_001613238.1|208813_210175_+	aminodeoxychorismate synthase component 1	NA	S4VT78	Pandoravirus	33.4	3.4e-41
>prophage 14
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	214037	215594	4943397		Moraxella_phage(100.0%)	1	NA	NA
WP_000394983.1|214037_215594_-	CNNM family cation transport protein YoaE	NA	A0A0R6PEZ3	Moraxella_phage	45.4	1.7e-41
>prophage 15
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	221235	221445	4943397		Morganella_phage(100.0%)	1	NA	NA
WP_001062678.1|221235_221445_-	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	1.6e-22
>prophage 16
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	226776	228825	4943397		Moraxella_phage(100.0%)	1	NA	NA
WP_001055778.1|226776_228825_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.5	1.2e-85
>prophage 17
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	236321	240791	4943397		Escherichia_phage(33.33%)	7	NA	NA
WP_001718411.1|236321_236978_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	50.2	1.8e-56
WP_000976472.1|237373_237715_-	YebY family protein	NA	NA	NA	NA	NA
WP_001718412.1|237727_238600_-	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000168747.1|238603_238978_-	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000916763.1|239116_239347_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	1.3e-14
WP_001718413.1|239448_240105_+	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_000944256.1|240128_240791_+	exodeoxyribonuclease X	NA	Q6UAU3	Klebsiella_phage	41.6	2.0e-07
>prophage 18
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	248847	250323	4943397		Cyanophage(100.0%)	1	NA	NA
WP_001718415.1|248847_250323_-	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	37.3	1.7e-78
>prophage 19
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	254321	261583	4943397		Bacillus_virus(50.0%)	9	NA	NA
WP_001613254.1|254321_255644_-	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	40.9	1.2e-14
WP_001342995.1|255659_256592_-	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_001718418.1|256670_257423_+	zinc ABC transporter ATP-binding protein ZnuC	NA	G3M9Y6	Bacillus_virus	28.3	1.3e-18
WP_001613256.1|257422_258208_+	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_000568519.1|258552_259563_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.5	5.6e-09
WP_000580323.1|259571_260183_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_072094247.1|260321_260387_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001718419.1|260457_261060_+	YebB family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_001295503.1|261061_261583_-	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.0e-10
>prophage 20
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	265601	270707	4943397		Escherichia_coli_phage(33.33%)	4	NA	NA
WP_074557447.1|265601_266096_+	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	99.2	3.0e-72
WP_099490838.1|266164_267688_+	recombinase family protein	NA	NA	NA	NA	NA
WP_000460604.1|267702_268467_-	hypothetical protein	NA	A0A291AY96	Shigella_phage	67.4	1.9e-86
WP_099490839.1|268640_270707_-	tape measure protein	NA	A0A0D4DAK9	Salmonella_phage	27.0	9.0e-54
>prophage 21
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	275446	279517	4943397		Mycobacterium_phage(50.0%)	6	NA	NA
WP_074558467.1|275446_275998_-	recombinase family protein	NA	G8I4U3	Mycobacterium_phage	40.3	5.6e-27
WP_074558465.1|276474_277011_-	hypothetical protein	NA	NA	NA	NA	NA
WP_074558463.1|276991_277843_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000599617.1|277937_278285_+	DUF72 domain-containing protein	NA	NA	NA	NA	NA
WP_000252980.1|278337_278733_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000019588.1|278773_279517_+	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	4.6e-24
>prophage 22
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	286133	287867	4943397	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_001613267.1|286133_287867_+|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.5	4.4e-86
>prophage 23
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	293121	298765	4943397		uncultured_Caudovirales_phage(50.0%)	5	NA	NA
WP_000763867.1|293121_293511_-	chemotaxis protein CheY	NA	A0A2K9L4R0	Tupanvirus	32.0	1.3e-06
WP_000036378.1|293525_294575_-	chemotaxis response regulator protein-glutamate methylesterase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	1.0e-05
WP_000204335.1|294577_295438_-	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_001613272.1|295456_297058_-	methyl-accepting chemotaxis protein IV	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.7	2.9e-15
WP_001297437.1|297103_298765_-	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.3	1.7e-10
>prophage 24
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	308852	310367	4943397		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001537115.1|308852_310367_-	L-arabinose ABC transporter ATP-binding protein AraG	NA	A0A2H4PQG7	Staphylococcus_phage	27.1	4.3e-13
>prophage 25
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	322360	323113	4943397		Bacillus_virus(100.0%)	1	NA	NA
WP_001272992.1|322360_323113_-	L-cystine ABC transporter ATP-binding protein YecC	NA	G3M9Y6	Bacillus_virus	34.9	3.8e-26
>prophage 26
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	335301	335970	4943397		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_001718434.1|335301_335970_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	61.7	6.6e-83
>prophage 27
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	351136	363622	4943397		Bacillus_phage(33.33%)	12	NA	NA
WP_077823181.1|351136_352831_-	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	35.1	8.5e-18
WP_000009307.1|353001_353184_-	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_000922682.1|353262_354180_-	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_001718442.1|354352_355273_+	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_000786004.1|355261_355732_-	very short patch repair endonuclease	NA	E5E3X5	Burkholderia_phage	47.6	1.5e-33
WP_001157247.1|355712_357131_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	55.6	1.4e-101
WP_000365562.1|357197_357893_-	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	28.0	2.8e-07
WP_001313057.1|357932_358298_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001718446.1|358863_360042_+	porin	NA	Q1MVN1	Enterobacteria_phage	55.4	2.9e-105
WP_000218214.1|360634_361486_+	protein deglycase HchA	NA	NA	NA	NA	NA
WP_001718447.1|361592_362951_-	two-component system sensor histidine kinase HprS	NA	NA	NA	NA	NA
WP_001339045.1|362950_363622_-	response regulator transcription factor HprR	NA	W8CYM9	Bacillus_phage	35.2	5.4e-32
>prophage 28
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	367166	367697	4943397		Escherichia_phage(100.0%)	1	NA	NA
WP_001079074.1|367166_367697_+	cytochrome b	NA	A0A0U2QLA7	Escherichia_phage	100.0	1.9e-56
>prophage 29
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	394277	395444	4943397		Stx2-converting_phage(100.0%)	1	NA	NA
WP_001296209.1|394277_395444_-	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	99.5	5.9e-228
>prophage 30
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	402637	403537	4943397		Cellulophaga_phage(100.0%)	1	NA	NA
WP_000131782.1|402637_403537_+	ATP phosphoribosyltransferase	NA	A0A0F7Q4B0	Cellulophaga_phage	94.7	1.8e-11
>prophage 31
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	410891	413713	4943397		Paramecium_bursaria_Chlorella_virus(50.0%)	2	NA	NA
WP_000704798.1|410891_412058_-	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	54.2	3.3e-114
WP_001718466.1|412306_413713_-	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.3	1.8e-37
>prophage 32
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	419330	422254	4943397		Bacillus_phage(50.0%)	2	NA	NA
WP_001718482.1|419330_420704_-	phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	27.4	3.8e-32
WP_001718483.1|420817_422254_-	mannose-1-phosphate guanyltransferase	NA	A0A1V0SH58	Hokovirus	30.7	1.1e-55
>prophage 33
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	427993	431677	4943397		Bacillus_phage(33.33%)	3	NA	NA
WP_099490842.1|427993_428887_-	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	41.7	1.0e-46
WP_001718491.1|429129_430125_-	SDR family oxidoreductase	NA	A0A1V0QG29	Shearwaterpox_virus	26.3	1.9e-09
WP_001718492.1|430282_431677_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	31.8	3.7e-19
>prophage 34
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	437485	444367	4943397		Bacillus_phage(25.0%)	6	NA	NA
WP_001313977.1|437485_438856_-	phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	27.7	2.2e-32
WP_000079285.1|439136_440573_-	mannose-1-phosphate guanyltransferase	NA	A0A1V0SH58	Hokovirus	29.2	1.3e-46
WP_001718496.1|440575_441799_-	colanic acid biosynthesis fucosyltransferase WcaI	NA	NA	NA	NA	NA
WP_000479836.1|441795_442275_-	GDP-mannose mannosyl hydrolase	NA	NA	NA	NA	NA
WP_000043606.1|442277_443243_-	GDP-L-fucose synthase	NA	D1LW79	Prochlorococcus_phage	50.8	1.7e-87
WP_000048190.1|443245_444367_-	GDP-mannose 4,6-dehydratase	NA	M4QRT5	Synechococcus_phage	64.9	1.5e-132
>prophage 35
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	448610	459178	4943397		uncultured_marine_virus(20.0%)	8	NA	NA
WP_000654503.1|448610_449450_-	colanic acid biosynthesis glycosyltransferase WcaA	NA	A0A0F7L2F7	uncultured_marine_virus	34.8	9.7e-07
WP_032201074.1|449542_451705_-	tyrosine-protein kinase Wzc	NA	A0A1X9I5D6	Streptococcus_phage	30.3	2.4e-17
WP_001718499.1|451707_452151_-	low molecular weight protein-tyrosine-phosphatase Wzb	NA	NA	NA	NA	NA
WP_000978094.1|452156_453296_-	polysaccharide export protein	NA	NA	NA	NA	NA
WP_000454701.1|453954_455538_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	42.6	7.2e-35
WP_032201077.1|455988_457842_-	outer membrane assembly protein AsmA	NA	NA	NA	NA	NA
WP_001234767.1|457863_458445_-	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	42.1	1.3e-31
WP_001295424.1|458536_459178_-	uridine kinase	NA	A0A1V0SAA3	Catovirus	36.9	3.2e-34
>prophage 36
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	463903	465256	4943397		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_000469692.1|463903_465256_+	molecular chaperone	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	20.9	1.6e-06
>prophage 37
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	478697	485560	4943397	tRNA	Bacillus_phage(50.0%)	8	NA	NA
WP_000675144.1|478697_480101_+	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.4	1.2e-33
WP_000137877.1|480097_480820_+	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.6	3.7e-31
WP_001718511.1|481010_481343_+	YegP family protein	NA	NA	NA	NA	NA
WP_000124651.1|481586_481838_+	type II toxin-antitoxin system ParD family antitoxin	NA	NA	NA	NA	NA
WP_001220181.1|481839_482136_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001718513.1|482238_483600_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	99.5	4.2e-217
WP_000716757.1|483929_484247_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000807361.1|484660_485560_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	1.3e-12
>prophage 38
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	494782	498339	4943397		Serratia_phage(50.0%)	4	NA	NA
WP_099490843.1|494782_495787_+	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	29.7	1.3e-13
WP_001613398.1|495783_496749_+	kinase	NA	NA	NA	NA	NA
WP_000434038.1|496722_497469_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001400611.1|497520_498339_-	glycoside hydrolase family 25 protein	NA	D0R7H8	Paenibacillus_phage	38.5	1.7e-24
>prophage 39
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	508987	511021	4943397	tRNA	Indivirus(100.0%)	1	NA	NA
WP_001613409.1|508987_511021_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.8e-54
>prophage 40
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	523533	532978	4943397		Enterobacteria_phage(85.71%)	10	NA	NA
WP_001292770.1|523533_524670_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.7	8.5e-163
WP_001613415.1|524666_526670_+	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	96.7	0.0e+00
WP_001295429.1|526794_527256_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001295430.1|527296_527767_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_000598641.1|527813_528533_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295431.1|528529_530215_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_001240399.1|530436_531168_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.0	2.8e-111
WP_001216963.1|531227_531335_+	protein YohO	NA	NA	NA	NA	NA
WP_000783120.1|531315_532047_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001718529.1|532051_532978_-	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	31.2	9.7e-24
>prophage 41
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	553398	554919	4943397		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_000255032.1|553398_554919_-	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	33.0	2.6e-10
>prophage 42
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	558613	562387	4943397		Cellulophaga_phage(50.0%)	3	NA	NA
WP_001139613.1|558613_559282_-	GTP cyclohydrolase I FolE	NA	M1Q6X8	Cellulophaga_phage	56.3	9.0e-56
WP_000425434.1|559539_560376_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000489252.1|560407_562387_-	catecholate siderophore receptor CirA	NA	A0A0P0I887	Acinetobacter_phage	36.6	1.9e-13
>prophage 43
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	566455	567313	4943397		Catovirus(100.0%)	1	NA	NA
WP_000873899.1|566455_567313_+	deoxyribonuclease IV	NA	A0A1V0SBL9	Catovirus	34.0	1.4e-24
>prophage 44
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	581807	586108	4943397		Ostreococcus_tauri_virus(50.0%)	4	NA	NA
WP_001613458.1|581807_583274_+	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	30.2	1.0e-43
WP_001613459.1|583391_584378_+	GTP-binding protein	NA	NA	NA	NA	NA
WP_001613460.1|584416_585130_+	Kdo(2)-lipid A phosphotransferase	NA	NA	NA	NA	NA
WP_000241011.1|585541_586108_+	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	A0A1V0DZX6	Clostridioides_phage	40.7	4.2e-14
>prophage 45
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	591862	599510	4943397		Vibrio_phage(50.0%)	7	NA	NA
WP_001613465.1|591862_593452_+	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	34.0	1.1e-19
WP_000202798.1|593455_593800_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000213385.1|594132_595323_-	multidrug efflux MFS transporter Bcr	NA	S4TR35	Salmonella_phage	23.7	2.9e-20
WP_001234850.1|595350_596046_-	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
WP_000578040.1|596194_597955_+	DEAD/DEAH box helicase	NA	M4Q3N1	Vibrio_phage	42.0	1.9e-100
WP_000494183.1|598079_598364_+	50S ribosomal protein L25	NA	NA	NA	NA	NA
WP_000050789.1|598502_599510_-	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	48.3	1.5e-83
>prophage 46
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	611383	612001	4943397		Bacillus_virus(100.0%)	1	NA	NA
WP_001613471.1|611383_612001_-	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	G3M9Y6	Bacillus_virus	25.5	2.5e-12
>prophage 47
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	620994	626781	4943397		Bacillus_phage(25.0%)	5	NA	NA
WP_001613473.1|620994_622638_-	microcin J25 efflux ABC transporter YojI	NA	W8CYL7	Bacillus_phage	24.0	1.2e-13
WP_000884972.1|622713_623364_-	DNA oxidative demethylase AlkB	NA	A0A2K9L3R7	Tupanvirus	31.7	1.4e-05
WP_001718541.1|623363_624428_-	bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	48.5	1.6e-17
WP_001613476.1|624501_625557_-	FAD:protein FMN transferase ApbE	NA	NA	NA	NA	NA
WP_000865563.1|625668_626781_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	59.4	7.6e-116
>prophage 48
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	631040	633890	4943397		Hokovirus(100.0%)	1	NA	NA
WP_001613477.1|631040_633890_-	two-component system sensor histidine kinase RcsC	NA	A0A1V0SGX0	Hokovirus	27.2	1.1e-41
>prophage 49
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	643590	646218	4943397		Bacillus_virus(100.0%)	1	NA	NA
WP_001718550.1|643590_646218_-	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	G3M9Z5	Bacillus_virus	31.4	1.9e-88
>prophage 50
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	651662	655565	4943397		Pseudomonas_phage(66.67%)	3	NA	NA
WP_001075170.1|651662_653948_+	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2D1GNB1	Pseudoalteromonas_phage	63.6	1.9e-283
WP_000332036.1|654180_655311_+	ribonucleotide-diphosphate reductase subunit beta	NA	G9IAA3	Pseudomonas_phage	78.9	2.5e-175
WP_001613486.1|655310_655565_+	ferredoxin-like diferric-tyrosyl radical cofactor maintenance protein YfaE	NA	G9IAA2	Pseudomonas_phage	61.9	1.5e-24
>prophage 51
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	658627	659707	4943397		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001613489.1|658627_659707_-	glycerophosphodiester phosphodiesterase	NA	A0A220BYK6	Staphylococcus_phage	46.0	5.1e-08
>prophage 52
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	665599	669987	4943397	transposase	Sodalis_phage(50.0%)	4	NA	NA
WP_001718555.1|665599_666574_+|transposase	ISNCY family transposase	transposase	Q2A0A7	Sodalis_phage	55.2	7.2e-70
WP_001613493.1|666614_667418_-	2-keto-3-deoxy-L-rhamnonate aldolase	NA	NA	NA	NA	NA
WP_001613495.1|667435_668725_-	MFS transporter	NA	NA	NA	NA	NA
WP_001613496.1|668781_669987_-	L-rhamnonate dehydratase	NA	Q6A202	Oenococcus_phage	28.5	3.2e-27
>prophage 53
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	673590	678594	4943397		Tupanvirus(50.0%)	4	NA	NA
WP_001306469.1|673590_674193_-	histidine phosphatase family protein	NA	A0A2L1IV13	Escherichia_phage	42.9	4.4e-09
WP_001718556.1|674500_675640_+	UDP-4-amino-4-deoxy-L-arabinose aminotransferase	NA	A0A2K9L470	Tupanvirus	29.8	1.5e-29
WP_000461658.1|675643_676612_+	undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase	NA	F1C5B0	Cronobacter_phage	31.5	1.2e-35
WP_001613499.1|676611_678594_+	bifunctional UDP-4-amino-4-deoxy-L-arabinose formyltransferase/UDP-glucuronic acid oxidase ArnA	NA	A0A2K9KZK0	Tupanvirus	25.8	3.1e-19
>prophage 54
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	713017	716245	4943397		Salmonella_phage(50.0%)	3	NA	NA
WP_000813854.1|713017_713617_+	5'-deoxynucleotidase	NA	A0A2L0V156	Salmonella_phage	38.6	7.0e-07
WP_001012892.1|713675_715508_-	SLC13 family permease	NA	NA	NA	NA	NA
WP_001613513.1|715594_716245_-	hexitol phosphatase HpxA	NA	M1IMD4	Acanthocystis_turfacea_Chlorella_virus	27.5	2.8e-09
>prophage 55
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	726804	728665	4943397		Sodalis_phage(50.0%)	2	NA	NA
WP_001613519.1|726804_727695_-	recombination-promoting nuclease RpnB	NA	Q2A0A7	Sodalis_phage	52.3	5.8e-66
WP_001293612.1|727891_728665_-	histidine ABC transporter ATP-binding protein HisP	NA	M1I0T9	Acanthocystis_turfacea_Chlorella_virus	28.2	2.1e-08
>prophage 56
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	732876	734394	4943397		Mollivirus(100.0%)	1	NA	NA
WP_001613521.1|732876_734394_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	44.0	2.0e-87
>prophage 57
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	740926	742063	4943397		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_001613522.1|740926_742063_-	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.4	4.5e-23
>prophage 58
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	750618	751704	4943397		Pandoravirus(100.0%)	1	NA	NA
WP_001297933.1|750618_751704_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	47.8	7.0e-90
>prophage 59
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	769772	777022	4943397	transposase	Enterobacteria_phage(25.0%)	6	NA	NA
WP_000368131.1|769772_770705_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
WP_000064874.1|771368_771794_-|transposase	IS200/IS605-like element ISEc46 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	50.4	1.1e-25
WP_001613545.1|771850_773020_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SLN2	Escherichia_phage	99.5	9.2e-205
WP_001613546.1|773139_774387_-	MFS transporter	NA	NA	NA	NA	NA
WP_001274878.1|774458_775373_-	aminoimidazole riboside kinase	NA	NA	NA	NA	NA
WP_001613547.1|775588_777022_+	glycoside hydrolase family 32 protein	NA	F8WPR5	Bacillus_phage	25.2	4.1e-29
>prophage 60
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	783675	791252	4943397		Bacillus_phage(50.0%)	4	NA	NA
WP_001613552.1|783675_787269_+	acid-sensing system histidine kinase EvgS	NA	W8CYM9	Bacillus_phage	40.0	6.2e-10
WP_001433504.1|787324_788470_-	CoA:oxalate CoA-transferase	NA	NA	NA	NA	NA
WP_000955028.1|788543_789488_-	transporter YfdV	NA	NA	NA	NA	NA
WP_001283479.1|789557_791252_-	oxalyl-CoA decarboxylase	NA	E5ERI2	Ostreococcus_lucimarinus_virus	23.8	1.0e-23
>prophage 61
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	794942	795863	4943397		Morganella_phage(100.0%)	1	NA	NA
WP_000484404.1|794942_795863_+	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	54.8	4.9e-76
>prophage 62
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	799681	800416	4943397		Clostridioides_phage(100.0%)	1	NA	NA
WP_001295458.1|799681_800416_+	response regulator transcription factor	NA	A0A2R2ZGH8	Clostridioides_phage	25.4	3.6e-13
>prophage 63
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	827302	842685	4943397		Streptococcus_phage(33.33%)	15	NA	NA
WP_001718634.1|827302_829318_-	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	43.4	1.7e-150
WP_001299866.1|829388_830387_-	cell division protein ZipA	NA	NA	NA	NA	NA
WP_000254839.1|830616_831378_+	sulfate transporter CysZ	NA	NA	NA	NA	NA
WP_000034402.1|831562_832534_+	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	51.0	2.8e-74
WP_000487600.1|832917_833175_+	phosphocarrier protein Hpr	NA	NA	NA	NA	NA
WP_000623136.1|833219_834947_+	phosphoenolpyruvate-protein phosphotransferase PtsI	NA	A0A1V0SGR7	Hokovirus	31.1	9.6e-17
WP_000522247.1|834987_835497_+	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_000096660.1|835538_836390_-	pyridoxine/pyridoxal/pyridoxamine kinase	NA	NA	NA	NA	NA
WP_000719943.1|836494_836863_+	YfeK family protein	NA	NA	NA	NA	NA
WP_001295461.1|836865_837777_-	cysteine synthase B	NA	A0A1X9I5F1	Streptococcus_phage	41.9	7.7e-58
WP_099490845.1|837911_839009_-	sulfate/thiosulfate ABC transporter ATP-binding protein CysA	NA	G9BWD6	Planktothrix_phage	38.9	2.4e-29
WP_000852686.1|838998_839874_-	sulfate/thiosulfate ABC transporter permease CysW	NA	NA	NA	NA	NA
WP_000458406.1|839873_840707_-	sulfate/thiosulfate ABC transporter permease CysT	NA	NA	NA	NA	NA
WP_000290231.1|840706_841723_-	sulfate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000517431.1|841893_842685_-	SDR family oxidoreductase UcpA	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.0	8.9e-18
>prophage 64
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	846163	851247	4943397		Mycobacterium_phage(33.33%)	6	NA	NA
WP_001315775.1|846163_847468_+	penicillin binding protein PBP4B	NA	A0A0B5A438	Mycobacterium_phage	26.2	1.6e-08
WP_000084590.1|847525_848425_-	porphyrinogen peroxidase	NA	S4VVJ7	Pandoravirus	32.6	4.5e-26
WP_000838945.1|848520_849096_-	RpoE-regulated lipoprotein	NA	NA	NA	NA	NA
WP_001613566.1|849302_849752_-	DUF2919 domain-containing protein	NA	NA	NA	NA	NA
WP_000406000.1|849738_850164_-	GNAT family acetyltransferase	NA	NA	NA	NA	NA
WP_000102891.1|850377_851247_+	N-acetylmuramoyl-L-alanine amidase AmiA	NA	E5DV68	Deep-sea_thermophilic_phage	27.4	4.2e-13
>prophage 65
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	870001	870952	4943397		Cyanophage(100.0%)	1	NA	NA
WP_001003709.1|870001_870952_+	transaldolase	NA	A0A127KNC6	Cyanophage	31.3	5.7e-11
>prophage 66
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	888255	888969	4943397		Synechococcus_phage(100.0%)	1	NA	NA
WP_001295467.1|888255_888969_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3FGF0	Synechococcus_phage	36.1	6.9e-38
>prophage 67
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	910269	914271	4943397		Enterobacteria_phage(33.33%)	4	NA	NA
WP_000198328.1|910269_911559_-	uracil permease	NA	Q9KX94	Enterobacteria_phage	37.4	5.1e-63
WP_001295473.1|911644_912271_-	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001295474.1|912595_913633_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SE90	Cyanophage	43.3	1.1e-71
WP_001028618.1|913632_914271_+	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	42.9	4.0e-29
>prophage 68
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	920706	922264	4943397		Escherichia_phage(100.0%)	3	NA	NA
WP_001344399.1|920706_920880_+	DUF2633 family protein	NA	G9L6F2	Escherichia_phage	100.0	6.8e-24
WP_000669412.1|921193_921709_+	glycine zipper 2TM domain-containing protein	NA	G9L6F1	Escherichia_phage	99.4	2.9e-62
WP_001718659.1|921724_922264_+	DUF5384 family protein	NA	G9L6F0	Escherichia_phage	97.8	2.2e-44
>prophage 69
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	927876	930875	4943397		Klosneuvirus(50.0%)	2	NA	NA
WP_001299507.1|927876_929343_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	39.1	2.3e-88
WP_001718663.1|929504_930875_+	exodeoxyribonuclease VII large subunit	NA	A0A2H4UVM9	Bodo_saltans_virus	35.3	6.8e-42
>prophage 70
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	939704	940136	4943397		Powai_lake_megavirus(100.0%)	1	NA	NA
WP_099490847.1|939704_940136_-	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	37.1	5.3e-17
>prophage 71
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	950346	956684	4943397		Mycoplasma_phage(20.0%)	8	NA	NA
WP_001718669.1|950346_951630_-	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	37.8	2.2e-34
WP_000523616.1|951688_951889_-	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_001124474.1|951900_952236_-	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_099490848.1|952237_954088_-	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	41.7	3.2e-103
WP_000384413.1|954104_954620_-	co-chaperone HscB	NA	NA	NA	NA	NA
WP_000028953.1|954715_955039_-	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	48.6	5.4e-22
WP_000331707.1|955055_955442_-	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	78.9	1.4e-53
WP_001295373.1|955469_956684_-	cysteine desulfurase	NA	A0A1X7C038	Faustovirus	31.8	8.8e-33
>prophage 72
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	971910	973422	4943397		Staphylococcus_phage(100.0%)	1	NA	NA
WP_032201231.1|971910_973422_-	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.7	1.5e-13
>prophage 73
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	979314	990622	4943397		Bacillus_phage(50.0%)	7	NA	NA
WP_000919159.1|979314_980568_-	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	52.7	7.8e-101
WP_000883122.1|980895_982086_+	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_000717694.1|982130_982469_-	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
WP_001295369.1|982529_983864_-	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	37.3	3.9e-10
WP_001215860.1|983853_984567_-	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
WP_001301750.1|984731_986159_-	two component system sensor histidine kinase QseE/GlrK	NA	W8CYF6	Bacillus_phage	25.6	1.8e-16
WP_001718683.1|986734_990622_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	59.2	5.9e-131
>prophage 74
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	994741	995002	4943397		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_001196285.1|994741_995002_+	4Fe-4S dicluster ferredoxin YfhL	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	52.3	8.4e-18
>prophage 75
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	998462	1002205	4943397		Tetraselmis_virus(50.0%)	3	NA	NA
WP_001068343.1|998462_999143_-	ribonuclease III	NA	A0A2P0VNZ5	Tetraselmis_virus	39.6	5.6e-21
WP_000002542.1|999415_1000390_-	signal peptidase I	NA	NA	NA	NA	NA
WP_000790168.1|1000405_1002205_-	elongation factor 4	NA	A0A2K9L6L3	Tupanvirus	41.9	4.2e-23
>prophage 76
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	1007976	1014059	4943397	tRNA	Cafeteria_roenbergensis_virus(25.0%)	7	NA	NA
WP_001613621.1|1007976_1009311_+	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.8	2.9e-45
WP_001383425.1|1009343_1010225_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001613622.1|1010327_1010915_+	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_000627807.1|1010970_1011354_-	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	72.0	1.4e-32
WP_001262720.1|1011658_1012348_+	uracil-DNA glycosylase	NA	A0A077BCN4	Equid_alphaherpesvirus	52.1	3.5e-55
WP_000997403.1|1012395_1013433_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001098726.1|1013639_1014059_+	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
>prophage 77
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	1019352	1020651	4943397		Burkholderia_virus(100.0%)	1	NA	NA
WP_000841103.1|1019352_1020651_-	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	32.2	1.3e-45
>prophage 78
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	1026426	1029000	4943397		Enterobacteria_phage(100.0%)	1	NA	NA
WP_001235102.1|1026426_1029000_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	2.6e-127
>prophage 79
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	1034912	1035983	4943397		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
WP_001168032.1|1034912_1035983_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	6.9e-90
>prophage 80
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	1049617	1052531	4943397	integrase	Escherichia_phage(66.67%)	3	1046451:1046466	1052455:1052470
1046451:1046466	attL	CTGTATATAAAACCAG	NA	NA	NA	NA
WP_000162574.1|1049617_1050100_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
WP_001718710.1|1050841_1052071_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	98.3	1.0e-230
WP_024171535.1|1052114_1052531_+	hypothetical protein	NA	A0A1B5FPM5	Escherichia_phage	95.7	7.6e-69
1052455:1052470	attR	CTGGTTTTATATACAG	NA	NA	NA	NA
>prophage 81
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	1056136	1057525	4943397		Leptospira_phage(100.0%)	1	NA	NA
WP_001718714.1|1056136_1057525_-	His-Xaa-Ser system radical SAM maturase HxsB	NA	S5VT21	Leptospira_phage	28.7	2.8e-51
>prophage 82
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	1070218	1070425	4943397		Vibrio_phage(100.0%)	1	NA	NA
WP_001071599.1|1070218_1070425_-	AlpA family transcriptional regulator	NA	A0A1V0E8E5	Vibrio_phage	43.3	1.8e-07
>prophage 83
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	1076727	1076946	4943397		Salmonella_phage(100.0%)	1	NA	NA
WP_071589635.1|1076727_1076946_-	recombinase family protein	NA	A0A1S6L009	Salmonella_phage	72.0	4.1e-10
>prophage 84
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	1086398	1090450	4943397		Klosneuvirus(50.0%)	4	NA	NA
WP_001613645.1|1086398_1087679_+	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	29.9	1.6e-32
WP_001301367.1|1087916_1089317_+	GABA permease	NA	NA	NA	NA	NA
WP_000156811.1|1089337_1090000_+	DNA-binding transcriptional regulator CsiR	NA	NA	NA	NA	NA
WP_000522424.1|1090000_1090450_-	potassium binding protein Kbp	NA	A0A090DBR9	Clostridium_phage	39.5	2.0e-06
>prophage 85
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	1094385	1099681	4943397		Oenococcus_phage(20.0%)	5	NA	NA
WP_001223227.1|1094385_1094631_+	glutaredoxin-like protein NrdH	NA	Q5K5J3	Oenococcus_phage	35.3	1.8e-06
WP_000080944.1|1094627_1095038_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	44.4	2.7e-18
WP_001718731.1|1095010_1097155_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	48.4	2.4e-195
WP_000777969.1|1097164_1098124_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	71.8	3.5e-133
WP_000985494.1|1098478_1099681_+	glycine betaine/L-proline ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	39.4	4.9e-28
>prophage 86
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	1114422	1119982	4943397	tRNA	Vibrio_phage(25.0%)	5	NA	NA
WP_000906486.1|1114422_1114608_-	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	4.9e-12
WP_000047196.1|1114842_1117473_-|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L1X7	Tupanvirus	38.6	5.5e-80
WP_000140506.1|1117600_1118101_-	recombination regulator RecX	NA	NA	NA	NA	NA
WP_000963143.1|1118343_1119405_-	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	63.4	1.2e-113
WP_000132231.1|1119484_1119982_-	nicotinamide-nucleotide amidase	NA	B5TK85	Pseudomonas_phage	49.7	4.4e-31
>prophage 87
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	1125449	1126415	4943397		Tetraselmis_virus(100.0%)	1	NA	NA
WP_001718738.1|1125449_1126415_+	arabinose-5-phosphate isomerase GutQ	NA	A0A2P0VNK5	Tetraselmis_virus	34.3	1.0e-36
>prophage 88
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	1154169	1161309	4943397		Escherichia_phage(83.33%)	6	NA	NA
WP_001272907.1|1154169_1156731_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	2.3e-30
WP_001141330.1|1156836_1157493_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.7	4.3e-50
WP_001297141.1|1157543_1158311_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	3.3e-70
WP_000847985.1|1158506_1159415_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_001613685.1|1159411_1160674_+	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	1.7e-135
WP_001278994.1|1160670_1161309_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
>prophage 89
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	1166523	1170239	4943397		uncultured_Mediterranean_phage(50.0%)	4	NA	NA
WP_000081550.1|1166523_1167516_-	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
WP_001272592.1|1167578_1168718_-	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
WP_001718755.1|1168857_1169484_-	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	4.4e-36
WP_001295182.1|1169477_1170239_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	3.4e-59
>prophage 90
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	1173351	1175384	4943397		Tupanvirus(50.0%)	2	NA	NA
WP_001718759.1|1173351_1173957_-	adenylyl-sulfate kinase	NA	A0A2K9L4R9	Tupanvirus	38.1	5.5e-28
WP_001090338.1|1173956_1175384_-	sulfate adenylyltransferase subunit CysN	NA	A0A1V0SGC3	Hokovirus	31.8	1.6e-30
>prophage 91
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	1193907	1194693	4943397		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
WP_001718778.1|1193907_1194693_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.5	3.8e-21
>prophage 92
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	1199531	1204451	4943397		Dinoroseobacter_phage(33.33%)	4	NA	NA
WP_001718782.1|1199531_1200203_-	7-carboxy-7-deazaguanine synthase QueE	NA	A0A1V0DYC7	Dinoroseobacter_phage	27.4	1.1e-08
WP_001718785.1|1200495_1201368_+	YgcG family protein	NA	NA	NA	NA	NA
WP_000036723.1|1201427_1202726_-	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	58.8	2.0e-131
WP_000210878.1|1202813_1204451_-	CTP synthase (glutamine hydrolyzing)	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	50.4	1.8e-153
>prophage 93
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	1207847	1211962	4943397		Erysipelothrix_phage(50.0%)	2	NA	NA
WP_001718787.1|1207847_1209149_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	27.7	2.0e-38
WP_000186450.1|1209205_1211962_+	two-component sensor histidine kinase BarA	NA	A0A1V0SGX0	Hokovirus	30.6	6.4e-55
>prophage 94
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	1219497	1220346	4943397		Vibrio_phage(100.0%)	1	NA	NA
WP_000100422.1|1219497_1220346_+	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A2I7SAX1	Vibrio_phage	37.1	4.7e-41
>prophage 95
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	1225204	1225960	4943397		Bacillus_phage(100.0%)	1	NA	NA
WP_099490854.1|1225204_1225960_+	flap endonuclease Xni	NA	F8WQ40	Bacillus_phage	33.5	5.0e-10
>prophage 96
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	1237493	1253040	4943397	tRNA	environmental_halophage(16.67%)	9	NA	NA
WP_001299106.1|1237493_1238699_+	cysteine desulfurase CsdA	NA	Q2XUY6	environmental_halophage	37.0	1.7e-73
WP_000184261.1|1238698_1239142_+	cysteine desulfurase sulfur acceptor subunit CsdE	NA	NA	NA	NA	NA
WP_001613718.1|1239192_1239999_-|tRNA	tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA	tRNA	S4VW33	Pandoravirus	33.3	1.0e-16
WP_000678646.1|1240237_1241335_-	murein transglycosylase A	NA	NA	NA	NA	NA
WP_001613719.1|1241912_1243166_-	N-acetylmuramoyl-L-alanine amidase	NA	Q5YA51	Bacillus_phage	28.6	2.2e-15
WP_000237969.1|1243397_1244729_+	amino-acid N-acetyltransferase	NA	NA	NA	NA	NA
WP_001718798.1|1244790_1246617_-	exodeoxyribonuclease V subunit alpha	NA	A0A1P8DII4	Virus_Rctr197k	26.7	7.8e-25
WP_032200763.1|1246616_1250159_-	exodeoxyribonuclease V subunit beta	NA	G3MA40	Bacillus_virus	21.6	1.5e-08
WP_001613722.1|1250151_1253040_-	pitrilysin	NA	A0A1V0SJA4	Klosneuvirus	25.8	1.4e-68
>prophage 97
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	1258516	1265289	4943397		Geobacillus_virus(33.33%)	6	NA	NA
WP_000816232.1|1258516_1259311_-	thymidylate synthase	NA	A6M9A2	Geobacillus_virus	70.8	7.6e-118
WP_000204658.1|1259317_1260193_-	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_000957912.1|1260343_1262590_-	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	26.2	2.7e-11
WP_000564489.1|1262602_1263133_-	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_000082188.1|1263817_1264507_+	DNA mismatch repair endonuclease MutH	NA	NA	NA	NA	NA
WP_000895624.1|1264575_1265289_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	47.3	2.6e-45
>prophage 98
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	1274920	1277415	4943397		Aichi_virus(50.0%)	2	NA	NA
WP_000256438.1|1274920_1276339_-	sugar porter family MFS transporter	NA	O13311	Aichi_virus	26.9	1.8e-24
WP_000603529.1|1276653_1277415_-	2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.3	2.9e-18
>prophage 99
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	1309226	1309982	4943397		Clostridium_phage(100.0%)	1	NA	NA
WP_001272558.1|1309226_1309982_-	peptidoglycan DD-metalloendopeptidase family protein	NA	I2E8W3	Clostridium_phage	36.8	1.1e-12
>prophage 100
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	1334442	1349834	4943397	tRNA	environmental_Halophage(14.29%)	14	NA	NA
WP_001280192.1|1334442_1335843_+	xanthine/proton symporter XanQ	NA	H9YQ34	environmental_Halophage	46.1	1.7e-19
WP_001613756.1|1335860_1337177_+	guanine deaminase	NA	NA	NA	NA	NA
WP_000012163.1|1337212_1338580_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	73.1	2.1e-160
WP_001718830.1|1338615_1339104_-	4Fe-4S dicluster domain-containing protein	NA	NA	NA	NA	NA
WP_024171560.1|1339103_1341023_-	formate-dependent uric acid utilization protein YgfT	NA	NA	NA	NA	NA
WP_001718832.1|1341458_1342907_+	purine permease	NA	Q9KX94	Enterobacteria_phage	26.8	1.2e-25
WP_001010156.1|1342908_1343034_+	hypothetical protein	NA	NA	NA	NA	NA
WP_120795390.1|1343030_1343102_-	protein YqfH	NA	NA	NA	NA	NA
WP_001192818.1|1343156_1343705_+	isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_001613759.1|1343747_1345265_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.7	5.9e-87
WP_001701073.1|1345274_1346373_-	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	39.0	1.8e-05
WP_000813202.1|1346463_1348197_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	28.7	1.4e-60
WP_000715214.1|1348202_1348913_-	bifunctional protein-disulfide isomerase/oxidoreductase DsbC	NA	NA	NA	NA	NA
WP_000806638.1|1348937_1349834_-	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	28.6	6.7e-30
>prophage 101
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	1353639	1358112	4943397		Pandoravirus(50.0%)	2	NA	NA
WP_032200731.1|1353639_1355073_+	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	26.1	1.5e-31
WP_000195016.1|1355238_1358112_-	aminomethyl-transferring glycine dehydrogenase	NA	E3SN07	Prochlorococcus_phage	52.1	3.7e-263
>prophage 102
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	1366248	1367481	4943397		Catovirus(100.0%)	1	NA	NA
WP_001718839.1|1366248_1367481_-	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	48.4	4.3e-104
>prophage 103
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	1385534	1386212	4943397		Bacillus_virus(100.0%)	1	NA	NA
WP_001613781.1|1385534_1386212_+	sulfate/molybdate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	25.6	6.4e-09
>prophage 104
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	1399901	1401056	4943397		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001718854.1|1399901_1401056_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	63.2	3.1e-128
>prophage 105
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	1457834	1459007	4943397		Emiliania_huxleyi_virus(100.0%)	1	NA	NA
WP_001613831.1|1457834_1459007_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	D2TEZ5	Emiliania_huxleyi_virus	31.0	5.5e-40
>prophage 106
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	1481219	1482104	4943397		Diadromus_pulchellus_ascovirus(100.0%)	1	NA	NA
WP_032200702.1|1481219_1482104_+	NADP(+)-dependent aldehyde reductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	47.1	1.7e-65
>prophage 107
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	1488180	1499002	4943397		Staphylococcus_phage(25.0%)	9	NA	NA
WP_001613848.1|1488180_1489008_+	2,5-didehydrogluconate reductase DkgA	NA	A0A2H4PQR8	Staphylococcus_phage	45.2	4.2e-63
WP_001613849.1|1489207_1490134_+	YbjP/YqhG family protein	NA	NA	NA	NA	NA
WP_001613850.1|1490182_1490440_+	lipoprotein YqhH	NA	NA	NA	NA	NA
WP_000095187.1|1490482_1492702_-	YgiQ family radical SAM protein	NA	M1QSD9	Pseudomonas_phage	70.4	7.8e-104
WP_000059395.1|1492812_1494225_-	cell division protein FtsP	NA	NA	NA	NA	NA
WP_000965712.1|1494299_1495037_-	1-acylglycerol-3-phosphate O-acyltransferase	NA	NA	NA	NA	NA
WP_001281881.1|1495270_1497529_-	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	35.1	1.4e-84
WP_001718874.1|1498074_1498557_-	gyrI-like small molecule-binding domain protein	NA	NA	NA	NA	NA
WP_000712658.1|1498609_1499002_-	OB fold stress tolerance protein YgiW	NA	A0A1I9LJU6	Stx_converting_phage	49.1	9.4e-21
>prophage 108
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	1505758	1521089	4943397		uncultured_Caudovirales_phage(14.29%)	15	NA	NA
WP_001613857.1|1505758_1506742_-	iron ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.6	5.0e-10
WP_001613858.1|1506738_1507548_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	29.9	2.1e-14
WP_001613859.1|1507921_1510063_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_001613860.1|1510126_1512019_-	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	34.9	5.8e-92
WP_000105733.1|1512047_1512629_-	esterase YqiA	NA	NA	NA	NA	NA
WP_001718877.1|1512628_1513456_-	3',5'-cyclic-AMP phosphodiesterase	NA	NA	NA	NA	NA
WP_000833393.1|1513480_1513903_-	DUF1249 family protein	NA	NA	NA	NA	NA
WP_000917117.1|1513903_1514533_-	ADP-ribose diphosphatase	NA	A0A1S6L1P8	Vibrio_phage	32.5	9.2e-18
WP_000735278.1|1514737_1516219_+	outer membrane channel protein TolC	NA	NA	NA	NA	NA
WP_001718878.1|1516366_1517038_+	DUF1190 family protein	NA	A0A173GEW8	Erwinia_phage	44.3	4.8e-33
WP_000442860.1|1517043_1518204_+	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.1	3.5e-87
WP_001613863.1|1518241_1519057_-	4,5-DOPA dioxygenase extradiol	NA	NA	NA	NA	NA
WP_001613864.1|1519172_1519946_+	zinc transporter ZupT	NA	NA	NA	NA	NA
WP_000469266.1|1520003_1520174_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001076997.1|1520435_1521089_-	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	44.3	4.9e-46
>prophage 109
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	1525377	1526811	4943397		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_001613866.1|1525377_1526811_-	bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE	NA	A0A1B1IUK5	uncultured_Mediterranean_phage	29.4	3.0e-40
>prophage 110
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	1531948	1533187	4943397	tRNA	Sinorhizobium_phage(100.0%)	1	NA	NA
WP_001613869.1|1531948_1533187_+|tRNA	fused tRNA nucleotidyltransferase/2',3'-cyclic phosphodiesterase/2' nucleotidase/phosphatase Cca	tRNA	A0A0F6YPT7	Sinorhizobium_phage	51.9	2.6e-93
>prophage 111
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	1539588	1555783	4943397	tRNA	Moraxella_phage(16.67%)	12	NA	NA
WP_001264352.1|1539588_1540602_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.2	6.3e-109
WP_001144069.1|1540839_1541055_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_000918827.1|1541165_1542911_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.4	1.1e-76
WP_000437371.1|1543105_1544947_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.3e-35
WP_000228930.1|1545025_1545532_-	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
WP_001066498.1|1545784_1546549_-	NADPH-dependent ferric chelate reductase	NA	NA	NA	NA	NA
WP_000018005.1|1546836_1547460_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000094712.1|1547613_1549134_-	aerotaxis sensor receptor Aer	NA	A0A1B0V854	Salmonella_phage	51.5	4.0e-35
WP_000633381.1|1549440_1550931_+	putrescine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	28.6	4.8e-33
WP_001718888.1|1550972_1551305_-|tRNA	tRNA-binding protein	tRNA	NA	NA	NA	NA
WP_001613871.1|1551523_1552507_+	transcriptional regulator EbgR	NA	NA	NA	NA	NA
WP_001613872.1|1552690_1555783_+	beta-galactosidase subunit alpha	NA	L0N6M2	Herpes_simplex_virus	34.2	4.5e-158
>prophage 112
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	1567790	1568756	4943397		Escherichia_phage(100.0%)	1	NA	NA
WP_001098809.1|1567790_1568756_+	TerC family membrane protein Alx	NA	A0A291LBC5	Escherichia_phage	33.8	6.7e-36
>prophage 113
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	1589402	1593325	4943397	transposase	Tetraselmis_virus(50.0%)	2	NA	NA
WP_032200717.1|1589402_1591697_-	2-ketobutyrate formate-lyase/pyruvate formate-lyase	NA	A0A2P0VNR5	Tetraselmis_virus	40.8	2.2e-157
WP_001352368.1|1592116_1593325_+|transposase	IS4-like element ISVsa5 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	100.0	1.8e-235
>prophage 114
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	1601011	1602157	4943397		Streptococcus_phage(100.0%)	1	NA	NA
WP_001718909.1|1601011_1602157_-	glycerate 2-kinase	NA	W6LM47	Streptococcus_phage	41.6	5.7e-50
>prophage 115
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	1622149	1629946	4943397		Streptococcus_phage(25.0%)	10	NA	NA
WP_001613902.1|1622149_1623013_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	43.6	7.3e-50
WP_001613903.1|1623077_1625114_+	penicillin-binding protein activator	NA	NA	NA	NA	NA
WP_000246855.1|1625071_1625467_+	YraN family protein	NA	NA	NA	NA	NA
WP_001613904.1|1625486_1626077_+	DnaA initiator-associating protein DiaA	NA	A0A067XQR2	Caulobacter_phage	31.1	9.2e-12
WP_000646033.1|1626086_1626662_+	divisome-associated lipoprotein YraP	NA	NA	NA	NA	NA
WP_000147606.1|1626775_1627816_-	permease	NA	NA	NA	NA	NA
WP_000084526.1|1627888_1628524_-	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_000037608.1|1628651_1629170_+	protein/nucleic acid deglycase	NA	A0A0N7KVR4	Yellowstone_lake_phycodnavirus	27.0	4.4e-10
WP_001613905.1|1629149_1629593_-	YhbP family protein	NA	NA	NA	NA	NA
WP_000189315.1|1629643_1629946_+	DNA damage response exodeoxyribonuclease YhbQ	NA	F2NZ06	Diadromus_pulchellus_ascovirus	52.5	3.9e-14
>prophage 116
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	1635772	1637662	4943397		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_001301504.1|1635772_1637662_-	DEAD/DEAH family ATP-dependent RNA helicase	NA	A0A0N9Q9J4	Chrysochromulina_ericina_virus	30.8	2.0e-52
>prophage 117
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	1643143	1649782	4943397		Cafeteria_roenbergensis_virus(50.0%)	4	NA	NA
WP_000133044.1|1643143_1645816_-	translation initiation factor IF-2	NA	E3T4N3	Cafeteria_roenbergensis_virus	26.3	2.5e-24
WP_001031057.1|1645840_1647328_-	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_001300397.1|1647355_1647808_-	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_000207683.1|1648438_1649782_+	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	92.9	1.1e-63
>prophage 118
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	1653864	1656737	4943397	protease	Pandoravirus(50.0%)	2	NA	NA
WP_000764731.1|1653864_1654713_-	dihydropteroate synthase	NA	S4W084	Pandoravirus	29.9	3.4e-23
WP_001107467.1|1654802_1656737_-|protease	ATP-dependent zinc metalloprotease FtsH	protease	G8DDJ2	Micromonas_pusilla_virus	43.6	6.3e-118
>prophage 119
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	1663365	1664843	4943397		Indivirus(50.0%)	2	NA	NA
WP_001047336.1|1663365_1664337_+	octaprenyl diphosphate synthase	NA	A0A1V0SE37	Indivirus	25.8	6.0e-08
WP_000445413.1|1664564_1664843_+	DNA-binding transcriptional regulator SfsB	NA	A0A2I7S995	Vibrio_phage	71.4	2.6e-17
>prophage 120
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	1668911	1683705	4943397		Staphylococcus_phage(25.0%)	17	NA	NA
WP_000438245.1|1668911_1669721_-	phospholipid ABC transporter ATP-binding protein MlaF	NA	G3M9Y6	Bacillus_virus	29.3	2.2e-19
WP_001613911.1|1669930_1670908_+	calcium/sodium antiporter	NA	NA	NA	NA	NA
WP_001295557.1|1670921_1671908_+	arabinose-5-phosphate isomerase KdsD	NA	A0A2P0VNK5	Tetraselmis_virus	31.5	1.9e-38
WP_000030005.1|1671928_1672495_+	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	75.7	1.4e-54
WP_000030537.1|1672491_1673067_+	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_000669785.1|1673035_1673593_+	lipopolysaccharide ABC transporter substrate-binding protein LptA	NA	NA	NA	NA	NA
WP_000224099.1|1673599_1674325_+	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	3.2e-22
WP_000809051.1|1674372_1675806_+	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_001176599.1|1675828_1676116_+	ribosome hibernation promoting factor	NA	A0A0M7QCF2	Escherichia_phage	44.3	2.5e-10
WP_000183676.1|1676233_1676725_+	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
WP_000243741.1|1676770_1677625_+	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	28.4	1.1e-05
WP_000216791.1|1677621_1677894_+	PTS phosphocarrier protein NPr	NA	NA	NA	NA	NA
WP_000620409.1|1678106_1678739_+	PhoP regulatory network protein YrbL	NA	NA	NA	NA	NA
WP_001613914.1|1678735_1679464_-	monofunctional biosynthetic peptidoglycan transglycosylase	NA	NA	NA	NA	NA
WP_001613915.1|1679460_1680114_-	isoprenoid biosynthesis glyoxalase ElbB	NA	NA	NA	NA	NA
WP_000809774.1|1680343_1682680_-	aerobic respiration two-component sensor histidine kinase ArcB	NA	A0A1V0SGX0	Hokovirus	31.2	1.7e-40
WP_001613917.1|1682775_1683705_-	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	35.0	8.8e-17
>prophage 121
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	1693401	1694892	4943397		Burkholderia_virus(100.0%)	1	NA	NA
WP_000108459.1|1693401_1694892_-	sialic acid transporter NanT	NA	Q6JIH2	Burkholderia_virus	23.6	4.9e-09
>prophage 122
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	1698595	1699093	4943397	protease	Pseudomonas_phage(100.0%)	1	NA	NA
WP_000366126.1|1698595_1699093_-|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	54.8	2.5e-26
>prophage 123
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	1703059	1705584	4943397	protease	uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_001718928.1|1703059_1704427_+|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	25.6	7.9e-22
WP_000497723.1|1704516_1705584_+	outer membrane-stress sensor serine endopeptidase DegS	NA	A0A1S5Y2X3	uncultured_archaeal_virus	24.2	6.8e-05
>prophage 124
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	1722263	1723307	4943397		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_000913396.1|1722263_1723307_-	rod shape-determining protein	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
>prophage 125
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	1733872	1734757	4943397		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_001718937.1|1733872_1734757_+	adenine-specific DNA-methyltransferase	NA	M4QNN5	Ostreococcus_lucimarinus_virus	30.2	1.4e-24
>prophage 126
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	1741262	1745416	4943397		uncultured_Mediterranean_phage(50.0%)	4	NA	NA
WP_000738579.1|1741262_1742288_+	amino acid ABC transporter substrate-binding protein	NA	A0A1B1IT51	uncultured_Mediterranean_phage	39.8	2.4e-71
WP_001613932.1|1742355_1743537_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_001613934.1|1743546_1744650_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_000078349.1|1744657_1745416_+	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.8	9.1e-20
>prophage 127
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	1755753	1757225	4943397	tRNA	Synechococcus_phage(50.0%)	2	NA	NA
WP_000114984.1|1755753_1756263_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	41.9	3.9e-19
WP_001613940.1|1756277_1757225_+|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	35.7	1.4e-06
>prophage 128
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	1777102	1782676	4943397		uncultured_Caudovirales_phage(50.0%)	7	NA	NA
WP_000031783.1|1777102_1778287_-	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.1	4.4e-13
WP_000124700.1|1778357_1780472_-	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	27.5	5.2e-57
WP_001138043.1|1780568_1781039_-	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_000246815.1|1781135_1781510_-	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_000903375.1|1781635_1781923_-	sulfurtransferase complex subunit TusB	NA	NA	NA	NA	NA
WP_001613947.1|1781930_1782290_-	sulfurtransferase complex subunit TusC	NA	A0A2H4J8C0	uncultured_Caudovirales_phage	29.3	9.0e-10
WP_001209707.1|1782289_1782676_-	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	39.1	7.4e-18
>prophage 129
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	1788246	1797787	4943397		Tupanvirus(25.0%)	9	NA	NA
WP_001613950.1|1788246_1790160_+	ABC transporter ATP-binding protein	NA	A0A2K9L0W2	Tupanvirus	33.7	1.5e-74
WP_000057392.1|1790159_1791182_+	hydrolase	NA	NA	NA	NA	NA
WP_000907085.1|1791175_1791394_+	YheU family protein	NA	A0A2H4J8A7	uncultured_Caudovirales_phage	40.3	3.1e-05
WP_001274680.1|1791447_1792317_+	phosphoribulokinase	NA	NA	NA	NA	NA
WP_001148908.1|1792371_1792776_-	OsmC family protein	NA	NA	NA	NA	NA
WP_000242755.1|1793077_1793710_+	cAMP-activated global transcriptional regulator CRP	NA	NA	NA	NA	NA
WP_001295162.1|1793760_1795851_+	membrane protein	NA	H9YQA8	environmental_Halophage	100.0	1.7e-76
WP_001718947.1|1795917_1797138_-	bifunctional acetylornithine/succinyldiaminopimelate transaminase	NA	NA	NA	NA	NA
WP_001718948.1|1797223_1797787_-	aminodeoxychorismate synthase component 2	NA	A0A0P0IKJ1	Acinetobacter_phage	55.8	7.1e-62
>prophage 130
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	1821905	1822742	4943397		Vibrio_phage(100.0%)	1	NA	NA
WP_000742141.1|1821905_1822742_-	adenine-specific DNA-methyltransferase	NA	A0A1S6L1V5	Vibrio_phage	49.1	2.9e-67
>prophage 131
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	1839645	1843412	4943397		Bacillus_phage(66.67%)	3	NA	NA
WP_099490861.1|1839645_1841268_+	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	51.5	1.0e-140
WP_001253696.1|1841343_1842696_-	two-component system sensor histidine kinase EnvZ	NA	W8CYF6	Bacillus_phage	23.8	3.6e-11
WP_001157751.1|1842692_1843412_-	two-component system response regulator OmpR	NA	W8CYM9	Bacillus_phage	34.7	3.5e-29
>prophage 132
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	1849976	1850855	4943397		Sodalis_phage(100.0%)	1	NA	NA
WP_001613984.1|1849976_1850855_+	recombination-promoting nuclease RpnA	NA	Q2A0A7	Sodalis_phage	53.3	2.5e-69
>prophage 133
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	1856822	1859216	4943397		Iris_mild_mosaic_virus(100.0%)	1	NA	NA
WP_000081909.1|1856822_1859216_-	maltodextrin phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	42.5	4.3e-15
>prophage 134
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	1863595	1864822	4943397		Ralstonia_phage(100.0%)	1	NA	NA
WP_001105504.1|1863595_1864822_-	RtcB family protein	NA	A0A1L7N133	Ralstonia_phage	60.0	4.0e-134
>prophage 135
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	1872632	1875080	4943397		Dickeya_phage(100.0%)	1	NA	NA
WP_000993449.1|1872632_1875080_-	glycogen phosphorylase	NA	A0A140XAG6	Dickeya_phage	81.0	2.1e-33
>prophage 136
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	1885409	1887506	4943397		Diadromus_pulchellus_ascovirus(100.0%)	1	NA	NA
WP_001613995.1|1885409_1887506_-	RecQ family ATP-dependent DNA helicase	NA	F2NZ48	Diadromus_pulchellus_ascovirus	34.1	1.6e-42
>prophage 137
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	1898433	1900244	4943397		Enterococcus_phage(50.0%)	2	NA	NA
WP_001614000.1|1898433_1899177_-	glycerophosphodiester phosphodiesterase	NA	A0A0S2MYI4	Enterococcus_phage	24.5	8.3e-10
WP_000907798.1|1899173_1900244_-	sn-glycerol-3-phosphate import ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	33.7	1.7e-19
>prophage 138
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	1903785	1905268	4943397		Planktothrix_phage(50.0%)	2	NA	NA
WP_000416895.1|1903785_1904499_-	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivF	NA	G9BWD6	Planktothrix_phage	31.1	9.1e-14
WP_000082101.1|1904500_1905268_-	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivG	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.6	4.9e-13
>prophage 139
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	1911749	1914568	4943397		Salicola_phage(50.0%)	3	NA	NA
WP_000130217.1|1911749_1912604_-	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	41.9	3.5e-44
WP_001042003.1|1912848_1913907_-	cell division protein FtsX	NA	NA	NA	NA	NA
WP_001718990.1|1913899_1914568_-	cell division ATP-binding protein FtsE	NA	A0A2H4PQG7	Staphylococcus_phage	25.1	5.0e-14
>prophage 140
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	1917574	1921706	4943397		Dickeya_phage(50.0%)	4	NA	NA
WP_000964718.1|1917574_1918201_+	lysoplasmalogenase	NA	A0A140XAH6	Dickeya_phage	61.9	1.2e-30
WP_001614011.1|1918274_1920473_+	Zn(II)/Cd(II)/Pb(II) translocating P-type ATPase ZntA	NA	E4ZFI9	Streptococcus_phage	38.3	2.5e-118
WP_000130621.1|1920574_1920820_-	sulfurtransferase TusA	NA	A0A140XB86	Dickeya_phage	83.3	8.0e-10
WP_001100467.1|1921040_1921706_+	7-cyano-7-deazaguanine/7-aminomethyl-7- deazaguanine transporter	NA	A0A2I7SAW6	Vibrio_phage	53.6	5.6e-58
>prophage 141
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	1929599	1935496	4943397		Bacillus_virus(33.33%)	6	NA	NA
WP_001614017.1|1929599_1930406_+	nickel import ATP-binding protein NikE	NA	G3M9Y6	Bacillus_virus	27.8	1.0e-16
WP_001190062.1|1930411_1930813_+	nickel-responsive transcriptional regulator NikR	NA	NA	NA	NA	NA
WP_000593555.1|1930932_1931292_-	type II toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_001259385.1|1931288_1931564_-	type II toxin-antitoxin system HicA family toxin	NA	R4JMD3	Burkholderia_phage	50.0	3.7e-16
WP_001314210.1|1931636_1932761_-	ABC-2 transporter permease	NA	NA	NA	NA	NA
WP_001614021.1|1932760_1935496_-	ribosome-associated ATPase/putative transporter RbbA	NA	A0A2H4PQG7	Staphylococcus_phage	30.6	4.1e-22
>prophage 142
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	1948947	1950990	4943397		Indivirus(100.0%)	1	NA	NA
WP_001614027.1|1948947_1950990_-	oligopeptidase A	NA	A0A1V0SD92	Indivirus	23.1	1.5e-45
>prophage 143
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	1954085	1958055	4943397	transposase	uncultured_Caudovirales_phage(75.0%)	4	NA	NA
WP_099490865.1|1954085_1955294_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.8	3.7e-209
WP_000008965.1|1955919_1956273_+	arsenical resistance operon transcriptional regulator ArsR	NA	A0A2H4J145	uncultured_Caudovirales_phage	50.0	1.3e-24
WP_099490866.1|1956327_1957617_+	arsenite/antimonite:H(+) antiporter ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	73.3	2.3e-172
WP_001719018.1|1957629_1958055_+	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.7	4.3e-51
>prophage 144
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	1969642	1971112	4943397		Pithovirus(50.0%)	2	NA	NA
WP_001614044.1|1969642_1970413_+	heme ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	30.0	1.7e-18
WP_032201192.1|1970464_1971112_-	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	38.5	6.1e-17
>prophage 145
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	2017590	2019575	4943397		Bacillus_virus(50.0%)	2	NA	NA
WP_099490869.1|2017590_2018595_-	dipeptide ABC transporter ATP binding subunit DppF	NA	G3M9Y6	Bacillus_virus	29.9	3.9e-18
WP_001196496.1|2018591_2019575_-	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.8	8.7e-15
>prophage 146
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	2030430	2031212	4943397		Stx2-converting_phage(50.0%)	2	NA	NA
WP_024171399.1|2030430_2030781_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	62.1	1.5e-38
WP_001309734.1|2030777_2031212_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	60.3	1.5e-19
>prophage 147
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	2039114	2041448	4943397		Escherichia_phage(100.0%)	1	NA	NA
WP_071607555.1|2039114_2041448_-	biotin sulfoxide reductase	NA	A0A077SK27	Escherichia_phage	29.4	1.8e-71
>prophage 148
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	2045102	2045315	4943397		Morganella_phage(100.0%)	1	NA	NA
WP_001719061.1|2045102_2045315_+	RNA chaperone/antiterminator CspA	NA	A0A1W6JNX5	Morganella_phage	74.3	7.1e-23
>prophage 149
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	2049535	2050531	4943397		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
WP_001614068.1|2049535_2050531_+	acyltransferase	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	27.1	9.1e-12
>prophage 150
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	2055849	2057391	4943397		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001614070.1|2055849_2057391_+	D-xylose ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.3	1.1e-16
>prophage 151
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	2075429	2083781	4943397	tRNA	Clostridioides_phage(33.33%)	6	NA	NA
WP_001614077.1|2075429_2076725_-	Fic family protein	NA	A0A1V0E025	Clostridioides_phage	30.9	2.8e-21
WP_000741518.1|2076854_2078006_-	L-threonine dehydrogenase	NA	NA	NA	NA	NA
WP_001614078.1|2078195_2080040_-	selenocysteine-specific translation elongation factor	NA	A0A2K9KZ60	Tupanvirus	27.2	1.9e-15
WP_001719071.1|2080036_2081428_-|tRNA	L-seryl-tRNA(Sec) selenium transferase	tRNA	NA	NA	NA	NA
WP_001719072.1|2081525_2082134_-	glutathione S-transferase	NA	NA	NA	NA	NA
WP_137461403.1|2082656_2083781_+	RHS repeat protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	32.5	3.3e-26
>prophage 152
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	2087043	2087922	4943397		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_001719078.1|2087043_2087922_+	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	40.4	1.3e-22
>prophage 153
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	2109267	2118774	4943397		Rhizobium_phage(16.67%)	9	NA	NA
WP_000024392.1|2109267_2109519_-	glutaredoxin 3	NA	V9QKN6	Rhizobium_phage	54.8	2.0e-16
WP_001156181.1|2109660_2110092_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_000116565.1|2110336_2111881_+	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_001214147.1|2111890_2113174_+	murein hydrolase activator EnvC	NA	G9BW84	Planktothrix_phage	34.3	1.0e-07
WP_001614097.1|2113177_2114137_+	divergent polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_000982091.1|2114123_2115158_-	UDP-glucuronate:LPS(HepIII) glycosyltransferase	NA	A0A1V0SAH6	Catovirus	28.7	5.8e-09
WP_000646014.1|2115396_2116422_-	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	84.6	2.1e-19
WP_001719089.1|2116431_2117628_-	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	29.4	4.9e-36
WP_000587750.1|2117841_2118774_+	ADP-glyceromanno-heptose 6-epimerase	NA	E3SL51	Synechococcus_phage	39.3	8.5e-36
>prophage 154
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	2122933	2123962	4943397		Archaeal_BJ1_virus(100.0%)	1	NA	NA
WP_001719092.1|2122933_2123962_-	glycosyl transferase 8 family protein	NA	A0ZYL4	Archaeal_BJ1_virus	25.9	4.2e-12
>prophage 155
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	2131400	2135963	4943397		uncultured_Mediterranean_phage(25.0%)	7	NA	NA
WP_099490870.1|2131400_2131880_+	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	42.0	2.4e-26
WP_001114533.1|2131918_2132728_-	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	F8WPX6	Bacillus_phage	32.2	2.6e-25
WP_001051798.1|2132825_2132993_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_000091955.1|2133013_2133250_-	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_001297375.1|2133466_2134135_-	JAB domain-containing protein	NA	NA	NA	NA	NA
WP_001614110.1|2134306_2135527_+	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	34.2	2.9e-44
WP_001298007.1|2135507_2135963_+	dUTP diphosphatase	NA	Q2NP83	Xanthomonas_phage	59.5	7.3e-49
>prophage 156
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	2139926	2146086	4943397		Morganella_phage(25.0%)	6	NA	NA
WP_001614115.1|2139926_2140160_+	hypothetical protein	NA	A0A1W6JPJ7	Morganella_phage	72.7	3.0e-22
WP_000924289.1|2140451_2141069_+	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
WP_001719101.1|2141065_2142748_-	NAD-dependent DNA ligase LigB	NA	A0A1Q2U2Q6	Vibrio_phage	23.9	5.7e-22
WP_001295237.1|2143005_2143629_+	guanylate kinase	NA	K4JYM5	Abalone_herpesvirus	34.5	4.1e-18
WP_000135058.1|2143683_2143959_+	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_000280488.1|2143977_2146086_+	bifunctional GTP diphosphokinase/guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase	NA	A0A291L9W9	Bordetella_phage	34.5	4.8e-10
>prophage 157
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	2150522	2151914	4943397		environmental_Halophage(100.0%)	1	NA	NA
WP_001295238.1|2150522_2151914_+	xanthine/proton symporter XanP	NA	H9YQ34	environmental_Halophage	100.0	1.4e-71
>prophage 158
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	2158192	2159383	4943397	integrase	Enterobacteria_phage(100.0%)	1	2143493:2143506	2161157:2161170
2143493:2143506	attL	ATGATTATCTGATT	NA	NA	NA	NA
WP_001218920.1|2158192_2159383_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	69.9	8.9e-163
WP_001218920.1|2158192_2159383_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	69.9	8.9e-163
2161157:2161170	attR	AATCAGATAATCAT	NA	NA	NA	NA
>prophage 159
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	2172769	2182526	4943397		Organic_Lake_phycodnavirus(25.0%)	6	NA	NA
WP_001277856.1|2172769_2173960_-	restriction endonuclease subunit S	NA	F2Y1N5	Organic_Lake_phycodnavirus	32.7	3.3e-08
WP_000627733.1|2173956_2175591_-	N-6 DNA methylase	NA	J7I0U9	Acinetobacter_phage	29.0	6.9e-33
WP_000438164.1|2175654_2179068_-	DEAD/DEAH box helicase family protein	NA	Q6NDX2	Leptospira_phage	26.2	8.5e-17
WP_000658303.1|2180342_2180966_+	MmcB family DNA repair protein	NA	NA	NA	NA	NA
WP_000714421.1|2180951_2181980_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000875105.1|2181983_2182526_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A142KB62	Gordonia_phage	29.3	3.6e-10
>prophage 160
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	2187622	2188099	4943397		Sodalis_phage(100.0%)	1	NA	NA
WP_000258199.1|2187622_2188099_+	ProQ/FinO family protein	NA	Q2A0A1	Sodalis_phage	42.5	3.1e-10
>prophage 161
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	2196863	2199041	4943397		Yersinia_phage(33.33%)	4	NA	NA
WP_001175173.1|2196863_2197682_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	39.7	9.4e-47
WP_000213721.1|2197773_2198259_+	antirestriction protein	NA	A9J566	Pseudomonas_phage	31.7	9.0e-13
WP_001186201.1|2198274_2198751_+	RadC family protein	NA	NA	NA	NA	NA
WP_000692303.1|2198819_2199041_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	8.5e-11
>prophage 162
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	2228207	2229542	4943397		Moraxella_phage(100.0%)	1	NA	NA
WP_072148461.1|2228207_2229542_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	36.7	1.1e-65
>prophage 163
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	2240185	2249346	4943397		Micromonas_sp._RCC1109_virus(25.0%)	10	NA	NA
WP_032223176.1|2240185_2241874_-	acetolactate synthase large subunit	NA	E5EQ70	Micromonas_sp._RCC1109_virus	29.4	3.5e-56
WP_001312198.1|2241979_2242078_-	ilvB operon leader peptide IvbL	NA	NA	NA	NA	NA
WP_000060506.1|2242642_2242732_+	type I toxin-antitoxin system toxin TisB	NA	NA	NA	NA	NA
WP_001614150.1|2243150_2244335_+	multidrug efflux MFS transporter EmrD	NA	S4TR35	Salmonella_phage	23.5	1.2e-13
WP_000148074.1|2244342_2244840_-	radical SAM protein	NA	NA	NA	NA	NA
WP_001113432.1|2244836_2245199_-	DUF202 domain-containing protein	NA	NA	NA	NA	NA
WP_000703959.1|2245188_2245536_-	YidH family protein	NA	NA	NA	NA	NA
WP_001614152.1|2245644_2246094_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001614153.1|2246140_2247634_-	sulfatase-like hydrolase/transferase	NA	A0A2K9L1A5	Tupanvirus	25.6	2.9e-30
WP_001614154.1|2247630_2249346_-	solute:sodium symporter family transporter	NA	A0A240F3J2	Aeromonas_phage	29.4	2.5e-41
>prophage 164
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	2256206	2257160	4943397		Synechococcus_phage(50.0%)	2	NA	NA
WP_001243431.1|2256206_2256635_-	heat shock chaperone IbpB	NA	A0A1D8KPX5	Synechococcus_phage	36.4	2.1e-13
WP_001243437.1|2256746_2257160_-	heat shock chaperone IbpA	NA	A0A1D7SU06	Cyanophage	36.2	1.0e-17
>prophage 165
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	2262691	2357754	4943397	terminase,capsid,head,integrase,protease,tail,tRNA,portal	uncultured_Caudovirales_phage(37.5%)	82	2319230:2319245	2357501:2357516
WP_000072067.1|2262691_2265106_-	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	34.6	3.7e-115
WP_000060112.1|2265134_2266208_-	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_000673464.1|2266207_2267308_-	DNA polymerase III subunit beta	NA	B4UTW9	Rhizobium_phage	35.0	4.1e-53
WP_000059111.1|2267312_2268716_-	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
WP_122134670.1|2269012_2269093_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000831330.1|2269322_2269463_+	50S ribosomal protein L34	NA	NA	NA	NA	NA
WP_000239730.1|2269479_2269839_+	ribonuclease P protein component	NA	NA	NA	NA	NA
WP_001307474.1|2269802_2270060_+	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	56.7	5.4e-17
WP_001719136.1|2270062_2271709_+	membrane protein insertase YidC	NA	NA	NA	NA	NA
WP_001282344.1|2271810_2273175_+|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE	tRNA	NA	NA	NA	NA
WP_001614164.1|2273322_2275494_-	ShET2/EspL2 family type III secretion system effector toxin	NA	NA	NA	NA	NA
WP_001364348.1|2275893_2275968_+	tryptophanase leader peptide	NA	NA	NA	NA	NA
WP_001295247.1|2276188_2277604_+	tryptophanase	NA	NA	NA	NA	NA
WP_001614165.1|2277694_2278942_+	low affinity tryptophan permease TnaB	NA	NA	NA	NA	NA
WP_001614168.1|2280123_2281083_+	HTH-type transcriptional regulator YidZ	NA	NA	NA	NA	NA
WP_001491398.1|2281239_2281989_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001614171.1|2282010_2282577_+	NAD(P)H-dependent chromate oxidoreductase YieF	NA	NA	NA	NA	NA
WP_000082693.1|2282630_2283968_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	35.7	2.6e-62
WP_001614172.1|2284134_2284800_+	6-phosphogluconate phosphatase	NA	NA	NA	NA	NA
WP_001614173.1|2284936_2287345_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001614174.1|2287646_2288834_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077633199.1|2289306_2291691_-	type III effector protein	NA	NA	NA	NA	NA
WP_000377785.1|2292217_2292943_-	phosphate signaling complex protein PhoU	NA	NA	NA	NA	NA
WP_000063125.1|2292957_2293731_-	phosphate ABC transporter ATP-binding protein PstB	NA	W8CYL7	Bacillus_phage	31.7	4.0e-15
WP_001614176.1|2293821_2294712_-	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_000741620.1|2294711_2295671_-	phosphate ABC transporter permease PstC	NA	NA	NA	NA	NA
WP_000867146.1|2295757_2296798_-	phosphate ABC transporter substrate-binding protein PstS	NA	A0A1D7SRJ6	Cyanophage	38.3	2.7e-51
WP_001719150.1|2297046_2298120_-	fimbrial protein	NA	NA	NA	NA	NA
WP_001614180.1|2298130_2300653_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_001614181.1|2300677_2301409_-	fimbrial chaperone	NA	NA	NA	NA	NA
WP_001614182.1|2301456_2302029_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000334086.1|2302336_2304166_-	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	43.2	5.6e-132
WP_000933736.1|2304327_2305698_-	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A0N7G7I9	Chrysochromulina_ericina_virus	36.7	3.1e-34
WP_001251965.1|2306050_2306470_-	F0F1 ATP synthase subunit epsilon	NA	NA	NA	NA	NA
WP_000190506.1|2306490_2307873_-	F0F1 ATP synthase subunit beta	NA	NA	NA	NA	NA
WP_000896498.1|2307899_2308763_-	F0F1 ATP synthase subunit gamma	NA	NA	NA	NA	NA
WP_001176745.1|2308813_2310355_-	F0F1 ATP synthase subunit alpha	NA	NA	NA	NA	NA
WP_001288587.1|2310367_2310901_-	F0F1 ATP synthase subunit delta	NA	NA	NA	NA	NA
WP_001052219.1|2310915_2311386_-	F0F1 ATP synthase subunit B	NA	NA	NA	NA	NA
WP_000429386.1|2311447_2311687_-	F0F1 ATP synthase subunit C	NA	NA	NA	NA	NA
WP_000135625.1|2311733_2312549_-	F0F1 ATP synthase subunit A	NA	NA	NA	NA	NA
WP_000116695.1|2312557_2312938_-	F0F1 ATP synthase subunit I	NA	NA	NA	NA	NA
WP_000932839.1|2313554_2314178_-	16S rRNA (guanine(527)-N(7))-methyltransferase RsmG	NA	NA	NA	NA	NA
WP_000499788.1|2314241_2316131_-|tRNA	tRNA uridine(34) 5-carboxymethylaminomethyl synthesis enzyme MnmG	tRNA	NA	NA	NA	NA
WP_000763742.1|2316509_2316953_-	FMN-binding protein MioC	NA	NA	NA	NA	NA
WP_000432970.1|2317042_2317501_-	transcriptional regulator AsnC	NA	NA	NA	NA	NA
WP_000845104.1|2317652_2318645_+	aspartate--ammonia ligase	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	37.7	2.2e-50
WP_001614187.1|2318649_2320101_-	ATPase RavA stimulator ViaA	NA	NA	NA	NA	NA
2319230:2319245	attL	AGCAACTGTTTTTCCA	NA	NA	NA	NA
WP_001299914.1|2320094_2321591_-	ATPase RavA	NA	NA	NA	NA	NA
WP_000102319.1|2321813_2323682_+	low affinity potassium transporter Kup	NA	M1I6H8	Paramecium_bursaria_Chlorella_virus	30.6	6.0e-65
WP_000715936.1|2323848_2324268_+	D-ribose pyranase	NA	NA	NA	NA	NA
WP_000387770.1|2324275_2325781_+	ribose ABC transporter ATP-binding protein RbsA	NA	A0A2H4PQG7	Staphylococcus_phage	27.1	6.0e-15
WP_000211858.1|2325785_2326751_+	ribose ABC transporter permease	NA	NA	NA	NA	NA
WP_001056273.1|2326775_2327666_+	ribose ABC transporter substrate-binding protein RbsB	NA	C6ZCU4	Enterobacteria_phage	23.4	4.3e-05
WP_001300603.1|2327791_2328721_+	ribokinase	NA	NA	NA	NA	NA
WP_000224470.1|2328724_2329717_+	ribose operon transcriptional repressor RbsR	NA	NA	NA	NA	NA
WP_001280852.1|2329682_2331110_-	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_001614192.1|2331132_2331825_-	FadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000379246.1|2337627_2338467_-	HTH-type transcriptional regulator HdfR	NA	NA	NA	NA	NA
WP_000841001.1|2338585_2338924_+	macrodomain Ori organization protein MaoP	NA	NA	NA	NA	NA
WP_001735905.1|2341075_2341360_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033813546.1|2341365_2343027_-|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	82.5	3.4e-277
WP_001353110.1|2343010_2343367_-|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	83.8	6.1e-51
WP_001145900.1|2343655_2344096_-	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	75.3	1.6e-64
WP_001287547.1|2344095_2344398_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4JD08	uncultured_Caudovirales_phage	61.1	1.0e-27
WP_122986556.1|2344390_2345563_-|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	88.3	5.1e-203
WP_000798766.1|2345606_2346167_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	84.9	2.0e-88
WP_099490876.1|2346216_2347362_-|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	66.9	5.4e-141
WP_001145410.1|2347635_2347884_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033813547.1|2347874_2348405_-	ProQ/FinO family protein	NA	Q2A0A1	Sodalis_phage	37.1	4.3e-08
WP_000126639.1|2348441_2348867_-	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_033813548.1|2349077_2351201_-	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	53.3	2.6e-173
WP_033813549.1|2351197_2351512_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_001307906.1|2351518_2351752_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032252948.1|2351726_2351972_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033813550.1|2351961_2352174_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077775460.1|2352166_2353312_-	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_001409403.1|2353364_2353553_-	AlpA family transcriptional regulator	NA	A0A2H4JB58	uncultured_Caudovirales_phage	66.7	4.1e-14
WP_032345684.1|2353929_2355159_-|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	54.4	4.9e-132
WP_001311244.1|2355869_2355968_+	ilv operon leader peptide	NA	NA	NA	NA	NA
WP_001387183.1|2356054_2356105_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032201130.1|2356107_2357754_+	acetolactate synthase 2 catalytic subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	31.8	2.2e-66
2357501:2357516	attR	AGCAACTGTTTTTCCA	NA	NA	NA	NA
>prophage 166
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	2366186	2371598	4943397		Bacillus_phage(33.33%)	4	NA	NA
WP_032201127.1|2366186_2368208_+	DNA helicase Rep	NA	A7KV33	Bacillus_phage	37.5	1.1e-112
WP_001612063.1|2368254_2369739_-	guanosine-5'-triphosphate,3'-diphosphate diphosphatase	NA	NA	NA	NA	NA
WP_000047499.1|2369872_2371138_-	ATP-dependent RNA helicase RhlB	NA	E3T5E1	Cafeteria_roenbergensis_virus	31.2	3.1e-41
WP_001280776.1|2371268_2371598_+	thioredoxin TrxA	NA	A0A1V0SD63	Indivirus	38.5	4.2e-14
>prophage 167
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	2375640	2381784	4943397		Enterobacteria_phage(40.0%)	6	NA	NA
WP_000866672.1|2375640_2376771_+	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	31.3	3.9e-27
WP_000006621.1|2376767_2378030_+	UDP-N-acetyl-D-mannosamine dehydrogenase	NA	M1HNJ7	Paramecium_bursaria_Chlorella_virus	27.0	1.0e-23
WP_001226601.1|2378029_2379097_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.4	2.3e-101
WP_000676056.1|2379115_2379997_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	66.3	8.7e-107
WP_001719163.1|2379974_2380649_+	dTDP-4-amino-4,6-dideoxy-D-galactose acyltransferase	NA	NA	NA	NA	NA
WP_000612044.1|2380653_2381784_+	dTDP-4-amino-4,6-dideoxygalactose transaminase	NA	A0A0F7LAY0	uncultured_marine_virus	41.7	2.0e-18
>prophage 168
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	2389868	2391524	4943397		Tetraselmis_virus(100.0%)	1	NA	NA
WP_000395856.1|2389868_2391524_-	arylsulfatase	NA	A0A2P0VMN7	Tetraselmis_virus	29.7	1.0e-44
>prophage 169
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	2401815	2405674	4943397		Bacillus_phage(100.0%)	3	NA	NA
WP_000130691.1|2401815_2402712_+	tyrosine recombinase XerC	NA	A0A142F1N9	Bacillus_phage	29.6	3.8e-25
WP_001213584.1|2402711_2403428_+	5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase YigB	NA	NA	NA	NA	NA
WP_000383407.1|2403511_2405674_+	DNA helicase II	NA	A7KV33	Bacillus_phage	37.2	4.6e-117
>prophage 170
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	2411391	2413221	4943397		Catovirus(100.0%)	1	NA	NA
WP_000035581.1|2411391_2413221_+	ATP-dependent DNA helicase RecQ	NA	A0A1V0SBK0	Catovirus	37.8	7.4e-84
>prophage 171
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	2427770	2431057	4943397		Ostreococcus_lucimarinus_virus(50.0%)	4	NA	NA
WP_000187530.1|2427770_2429411_+	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	M4R0M8	Ostreococcus_lucimarinus_virus	29.0	8.2e-42
WP_001295260.1|2429489_2429759_+	Sec-independent protein translocase subunit TatA	NA	NA	NA	NA	NA
WP_000459594.1|2429762_2430278_+	Sec-independent protein translocase subunit TatB	NA	NA	NA	NA	NA
WP_001719177.1|2430280_2431057_+	Sec-independent protein translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	32.6	5.1e-26
>prophage 172
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	2439847	2440462	4943397		Streptococcus_phage(100.0%)	1	NA	NA
WP_001719182.1|2439847_2440462_+	IMPACT family protein	NA	A0A1X9I5T8	Streptococcus_phage	32.4	2.4e-18
>prophage 173
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	2454137	2456924	4943397		uncultured_virus(100.0%)	1	NA	NA
WP_032201343.1|2454137_2456924_+	DNA polymerase I	NA	A0A218MKQ4	uncultured_virus	32.1	4.9e-71
>prophage 174
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	2460999	2463470	4943397		Bacillus_thuringiensis_phage(50.0%)	2	NA	NA
WP_001188777.1|2460999_2462409_-	nitrogen regulation protein NR(I)	NA	Q56AR1	Bacillus_thuringiensis_phage	28.7	2.4e-05
WP_000190577.1|2462420_2463470_-	nitrogen regulation protein NR(II)	NA	Q8QKV7	Ectocarpus_siliculosus_virus	26.1	2.5e-07
>prophage 175
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	2472712	2566784	4943397	terminase,holin,capsid,head,integrase,protease,transposase,lysis,tail,plate,tRNA,portal	Escherichia_phage(42.86%)	99	2518387:2518433	2550745:2550791
WP_099490879.1|2472712_2473921_-|transposase	IS4 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	99.8	8.8e-235
WP_000018367.1|2474161_2475547_-	MFS transporter	NA	NA	NA	NA	NA
WP_001719190.1|2475592_2477629_-	sulfoquinovosidase	NA	NA	NA	NA	NA
WP_000052656.1|2477827_2478754_-	aldose-1-epimerase	NA	NA	NA	NA	NA
WP_032201344.1|2478867_2480109_-	sulfoquinovose isomerase	NA	NA	NA	NA	NA
WP_001401400.1|2480124_2481003_-	sulfofructosephosphate aldolase	NA	NA	NA	NA	NA
WP_000718901.1|2481026_2481923_-	sulfolactaldehyde 3-reductase	NA	D2K0C8	Staphylococcus_phage	90.7	1.3e-60
WP_000621647.1|2482090_2482987_+	sulfofructose kinase	NA	NA	NA	NA	NA
WP_000059678.1|2483020_2483806_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.9	8.2e-24
WP_001315111.1|2483904_2484504_+	glucose-1-phosphatase	NA	NA	NA	NA	NA
WP_000920762.1|2484497_2485370_+	virulence factor BrkB family protein	NA	NA	NA	NA	NA
WP_001719194.1|2485366_2485804_+|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_001297068.1|2485848_2486790_+	fatty acid biosynthesis protein FabY	NA	NA	NA	NA	NA
WP_001719195.1|2487204_2489019_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001313440.1|2489695_2489914_+	CopG family transcriptional regulator	NA	NA	NA	NA	NA
WP_001719196.1|2490153_2490342_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000027705.1|2490684_2491614_-	formate dehydrogenase accessory protein FdhE	NA	NA	NA	NA	NA
WP_000829013.1|2491610_2492246_-	formate dehydrogenase cytochrome b556 subunit	NA	NA	NA	NA	NA
WP_000331377.1|2492242_2493145_-	formate dehydrogenase O subunit beta	NA	NA	NA	NA	NA
WP_077841582.1|2493157_2496208_-	formate dehydrogenase-N subunit alpha	NA	A0A077SK27	Escherichia_phage	24.1	1.9e-07
WP_099490880.1|2496426_2497236_+	formate dehydrogenase accessory sulfurtransferase FdhD	NA	NA	NA	NA	NA
WP_032201345.1|2497388_2498444_+	YiiG family protein	NA	NA	NA	NA	NA
WP_099490881.1|2498539_2500288_-	PTS transporter subunit EIIA	NA	NA	NA	NA	NA
WP_032201346.1|2500287_2501358_-	aminopeptidase	NA	NA	NA	NA	NA
WP_000446023.1|2501347_2502799_-	PTS fructose-like transporter subunit IIBC	NA	NA	NA	NA	NA
WP_001612103.1|2502809_2503256_-	PTS fructose transporter subunit IIA	NA	NA	NA	NA	NA
WP_001719203.1|2503732_2505127_+	maltoporin	NA	NA	NA	NA	NA
WP_001719204.1|2505167_2505482_-	L-rhamnose mutarotase	NA	NA	NA	NA	NA
WP_001719205.1|2505491_2506316_-	rhamnulose-1-phosphate aldolase	NA	NA	NA	NA	NA
WP_001612105.1|2506766_2508026_-	L-rhamnose isomerase	NA	NA	NA	NA	NA
WP_001719206.1|2508022_2509492_-	rhamnulokinase	NA	NA	NA	NA	NA
WP_001465744.1|2509779_2510616_+	HTH-type transcriptional activator RhaS	NA	NA	NA	NA	NA
WP_072148427.1|2510599_2511538_+	HTH-type transcriptional activator RhaR	NA	NA	NA	NA	NA
WP_001719210.1|2511534_2512569_-	L-rhamnose/proton symporter RhaT	NA	NA	NA	NA	NA
WP_001297064.1|2512853_2513474_+	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	59.8	4.9e-64
WP_099490882.1|2513771_2514716_+	2-keto-3-deoxygluconate transporter	NA	NA	NA	NA	NA
WP_001270260.1|2514864_2515539_+	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_000580417.1|2515644_2517018_-	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.9	3.8e-16
WP_001033722.1|2517014_2517713_-	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
WP_001223800.1|2517862_2518363_+	cell-envelope stress modulator CpxP	NA	NA	NA	NA	NA
2518387:2518433	attL	GACACCATCCCTGTCTTCCCCCACATGATGTGGGGGTTTTTTTTATC	NA	NA	NA	NA
WP_000023384.1|2518548_2519529_-|integrase	tyrosine-type recombinase/integrase	integrase	U5N0A8	Enterobacteria_phage	100.0	4.7e-186
WP_001192857.1|2519598_2519892_-	helix-turn-helix domain-containing protein	NA	Q1JS45	Enterobacteria_phage	100.0	1.0e-48
WP_000453534.1|2520044_2520317_+	hypothetical protein	NA	Q1JS44	Enterobacteria_phage	100.0	1.5e-46
WP_000217677.1|2520486_2520987_+	hypothetical protein	NA	A0A0F7LBQ6	Escherichia_phage	100.0	4.5e-92
WP_000557703.1|2521050_2521275_+	DUF2732 family protein	NA	S4TP68	Salmonella_phage	100.0	4.7e-33
WP_001277898.1|2521274_2521574_+	DUF5405 family protein	NA	S4TUD1	Salmonella_phage	99.0	3.2e-45
WP_001113264.1|2521576_2521801_+	TraR/DksA family transcriptional regulator	NA	S4TRY6	Salmonella_phage	100.0	2.9e-35
WP_000027676.1|2521797_2522073_+	DUF5405 family protein	NA	U5N3W1	Enterobacteria_phage	98.9	8.6e-45
WP_001719213.1|2522062_2524357_+	replication endonuclease	NA	Q858T4	Yersinia_virus	98.0	0.0e+00
WP_001697730.1|2524443_2525466_+	DNA cytosine methyltransferase	NA	A0A0R6PG08	Moraxella_phage	59.0	5.5e-113
WP_000373633.1|2525495_2526176_-	hypothetical protein	NA	A0A0R6PER3	Moraxella_phage	31.7	9.9e-18
WP_000351260.1|2526177_2527320_-	DUF262 domain-containing protein	NA	A0A0R6PKN1	Moraxella_phage	42.9	1.6e-73
WP_097325385.1|2527693_2528728_-|portal	phage portal protein	portal	A0A0F7LDI7	Escherichia_phage	99.7	4.2e-201
WP_001719216.1|2528727_2530500_-|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCK3	Escherichia_phage	99.5	0.0e+00
WP_001697727.1|2530673_2531528_+|capsid	GPO family capsid scaffolding protein	capsid	Q94MF5	Enterobacteria_phage	96.1	1.5e-132
WP_001719219.1|2531586_2532660_+|capsid	phage major capsid protein, P2 family	capsid	Q94MK7	Enterobacteria_phage	99.4	2.5e-201
WP_024171590.1|2532663_2533407_+|terminase	terminase endonuclease subunit	terminase	A0A0F7LBP7	Escherichia_phage	98.4	3.0e-124
WP_000988633.1|2533506_2534016_+|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	100.0	1.1e-90
WP_000846409.1|2534015_2534219_+|tail	tail protein X	tail	A0A0F7LCN2	Escherichia_phage	100.0	3.0e-31
WP_000123123.1|2534222_2534504_+|holin	holin	holin	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
WP_001144111.1|2534503_2535001_+	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	98.8	4.5e-92
WP_000736604.1|2535015_2535441_+	hypothetical protein	NA	M1SV74	Escherichia_phage	94.3	5.7e-56
WP_001719221.1|2535428_2535854_+|lysis	LysB family phage lysis regulatory protein	lysis	A0A0F7LDJ6	Escherichia_phage	95.0	4.0e-65
WP_001440152.1|2535825_2535999_+	hypothetical protein	NA	Q7Y4E1	Escherichia_virus	96.5	2.3e-24
WP_001719223.1|2535961_2536429_+|tail	phage tail protein	tail	U5N0S7	Enterobacteria_phage	98.7	1.1e-81
WP_001001786.1|2536421_2536874_+	phage virion morphogenesis protein	NA	A0A0F7LDR6	Escherichia_phage	100.0	8.2e-77
WP_001719225.1|2536940_2537576_+|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	96.7	2.1e-110
WP_000127163.1|2537572_2537920_+|plate	baseplate assembly protein	plate	A0A0F7L9X3	Escherichia_phage	100.0	1.7e-58
WP_001121481.1|2537924_2538833_+|plate	baseplate assembly protein	plate	A0A0F7LCJ3	Escherichia_phage	99.3	3.4e-162
WP_001719226.1|2538825_2539356_+|tail	phage tail protein I	tail	A0A0F7LDF3	Escherichia_phage	98.9	7.3e-101
WP_099490883.1|2539366_2541616_+|tail	phage tail protein	tail	U5N099	Enterobacteria_phage	56.3	2.9e-138
WP_001719228.1|2541619_2542147_+|tail	tail fiber assembly protein	tail	U5N0T1	Enterobacteria_phage	94.9	2.0e-90
WP_000257039.1|2542428_2543772_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001719229.1|2544030_2545221_+|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	99.7	4.8e-225
WP_001251408.1|2545233_2545752_+|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_001719230.1|2545808_2546084_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	98.9	1.3e-40
WP_000785970.1|2546116_2546236_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_099490884.1|2546228_2548676_+|tail	phage tail tape measure protein	tail	M1T2S3	Escherichia_phage	95.8	0.0e+00
WP_001471798.1|2548690_2549170_+|tail	phage tail protein	tail	Q7Y4C7	Escherichia_virus	99.4	1.1e-84
WP_001719232.1|2549169_2550333_+	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	99.5	1.1e-205
WP_000468308.1|2550414_2550633_+	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_001076742.1|2550869_2551772_+	CDF family cation-efflux transporter FieF	NA	NA	NA	NA	NA
2550745:2550791	attR	GACACCATCCCTGTCTTCCCCCACATGATGTGGGGGTTTTTTTTATC	NA	NA	NA	NA
WP_000591795.1|2551952_2552915_+	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_001045689.1|2553234_2554224_+	sulfate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001719233.1|2554330_2555086_+	CDP-diacylglycerol diphosphatase	NA	NA	NA	NA	NA
WP_001216325.1|2555140_2555908_-	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_000802226.1|2556015_2556615_-	YiiQ family protein	NA	NA	NA	NA	NA
WP_000155257.1|2556715_2557156_+	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_000655986.1|2557367_2557667_+	DUF406 domain-containing protein	NA	NA	NA	NA	NA
WP_000323556.1|2557693_2558122_+	universal stress protein UspD	NA	NA	NA	NA	NA
WP_001719234.1|2558126_2558873_-	ferredoxin--NADP(+) reductase	NA	NA	NA	NA	NA
WP_001719235.1|2558969_2559980_-	class II fructose-bisphosphatase	NA	NA	NA	NA	NA
WP_000136788.1|2560209_2561718_-	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_000084268.1|2561740_2562586_-	glycerol uptake facilitator protein GlpF	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.0	4.4e-15
WP_001296623.1|2563011_2563257_+	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
WP_000872908.1|2563341_2563827_-	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_000139496.1|2563919_2564846_-	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_001293341.1|2564912_2566244_-	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	29.9	1.7e-45
WP_000208242.1|2566253_2566784_-|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
>prophage 176
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	2571881	2576066	4943397		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_099490885.1|2571881_2576066_+	RHS repeat protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	32.0	2.3e-24
>prophage 177
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	2589058	2596305	4943397		Synechococcus_phage(33.33%)	5	NA	NA
WP_000424845.1|2589058_2589721_-	fructose-6-phosphate aldolase	NA	A0A0E3F0E2	Synechococcus_phage	34.6	5.5e-29
WP_001612129.1|2589732_2592234_-	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	26.4	1.3e-11
WP_001004442.1|2592542_2593622_+	PTS fructose transporter subunit EIIC	NA	NA	NA	NA	NA
WP_000161265.1|2593636_2593957_+	PTS fructose-like transporter subunit IIB	NA	NA	NA	NA	NA
WP_032201177.1|2594007_2596305_+	formate C-acetyltransferase	NA	A0A1S6UAD4	Serratia_phage	48.1	4.6e-06
>prophage 178
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	2612342	2618164	4943397	tRNA	Burkholderia_virus(50.0%)	5	NA	NA
WP_032201179.1|2612342_2613659_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	35.4	7.0e-60
WP_001309117.1|2613762_2614413_+	HTH-type transcriptional repressor FabR	NA	NA	NA	NA	NA
WP_000806411.1|2614412_2614772_+	YijD family membrane protein	NA	NA	NA	NA	NA
WP_000187008.1|2614811_2615912_-|tRNA	tRNA (uridine(54)-C5)-methyltransferase TrmA	tRNA	NA	NA	NA	NA
WP_001612139.1|2616280_2618164_+	TonB-dependent vitamin B12 receptor BtuB	NA	A0A0P0I887	Acinetobacter_phage	27.5	4.0e-08
>prophage 179
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	2626593	2629646	4943397		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_000023081.1|2626593_2627544_-	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	32.0	8.7e-28
WP_000031784.1|2628461_2629646_+	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.1	4.4e-13
>prophage 180
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	2633641	2641970	4943397		Chrysochromulina_ericina_virus(50.0%)	2	NA	NA
WP_000263098.1|2633641_2637670_+	DNA-directed RNA polymerase subunit beta	NA	A0A0N9R0J7	Chrysochromulina_ericina_virus	29.0	9.4e-23
WP_001719259.1|2637746_2641970_+	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	26.5	1.9e-66
>prophage 181
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	2651187	2652951	4943397		Klosneuvirus(50.0%)	3	NA	NA
WP_000362395.1|2651187_2651859_+	deoxyribonuclease V	NA	A0A1V0SJW5	Klosneuvirus	29.2	2.8e-20
WP_000940106.1|2651901_2652492_+	YjaG family protein	NA	NA	NA	NA	NA
WP_001044513.1|2652678_2652951_+	DNA-binding protein HU-alpha	NA	A7KV42	Bacillus_phage	58.9	3.2e-20
>prophage 182
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	2658319	2659909	4943397		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_001612147.1|2658319_2659909_-	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	47.7	7.6e-69
>prophage 183
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	2675898	2679582	4943397		Dickeya_phage(100.0%)	1	NA	NA
WP_001612152.1|2675898_2679582_+	methionine synthase	NA	A0A140XBC7	Dickeya_phage	90.2	1.3e-26
>prophage 184
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	2704952	2706068	4943397		Mycoplasma_phage(100.0%)	1	NA	NA
WP_000179165.1|2704952_2706068_+	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	31.7	4.3e-18
>prophage 185
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	2715283	2715892	4943397		Lactococcus_phage(100.0%)	1	NA	NA
WP_000646078.1|2715283_2715892_+	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
>prophage 186
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	2722521	2725069	4943397		Escherichia_phage(50.0%)	2	NA	NA
WP_000918363.1|2722521_2723937_+	replicative DNA helicase	NA	O80281	Escherichia_phage	78.3	4.8e-200
WP_001147332.1|2723989_2725069_+	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	28.2	4.0e-29
>prophage 187
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	2729278	2732892	4943397		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_000357740.1|2729278_2732101_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	56.1	0.0e+00
WP_000168305.1|2732355_2732892_+	single-stranded DNA-binding protein SSB1	NA	A0A0A0P1Q9	Enterobacteria_phage	78.7	1.1e-56
>prophage 188
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	2736709	2738059	4943397		Moraxella_phage(100.0%)	1	NA	NA
WP_000106882.1|2736709_2738059_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	71.6	1.8e-159
>prophage 189
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	2743644	2745603	4943397		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000078209.1|2743644_2745603_-	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	40.4	1.9e-90
>prophage 190
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	2754998	2757146	4943397		Escherichia_phage(100.0%)	1	NA	NA
WP_001300547.1|2754998_2757146_-	formate dehydrogenase subunit alpha	NA	A0A077SK27	Escherichia_phage	23.9	7.0e-33
>prophage 191
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	2762391	2764377	4943397		Tetraselmis_virus(100.0%)	1	NA	NA
WP_032201355.1|2762391_2764377_-	alkyl sulfatase YjcS	NA	A0A2P0VMX1	Tetraselmis_virus	44.3	4.2e-149
>prophage 192
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	2769913	2771434	4943397		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001089390.1|2769913_2771434_-	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.6	7.7e-18
>prophage 193
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	2777120	2778670	4943397		Organic_Lake_phycodnavirus(50.0%)	2	NA	NA
WP_000611426.1|2777120_2777801_-	phosphonate C-P lyase system protein PhnL	NA	F2Y1V6	Organic_Lake_phycodnavirus	25.0	8.7e-06
WP_001075518.1|2777911_2778670_-	phosphonate C-P lyase system protein PhnK	NA	G3M9Y6	Bacillus_virus	28.2	4.7e-16
>prophage 194
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	2784274	2785063	4943397		Cedratvirus(100.0%)	1	NA	NA
WP_001612206.1|2784274_2785063_-	phosphonate ABC transporter ATP-binding protein	NA	A0A285PWH2	Cedratvirus	29.6	1.6e-11
>prophage 195
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	2790107	2791610	4943397		Burkholderia_virus(100.0%)	1	NA	NA
WP_001313516.1|2790107_2791610_+	glycine betaine/L-proline transporter ProP	NA	Q6JIH2	Burkholderia_virus	31.0	3.1e-56
>prophage 196
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	2812806	2816018	4943397	tRNA	Catovirus(50.0%)	2	NA	NA
WP_001295087.1|2812806_2814324_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	38.0	2.0e-87
WP_000856835.1|2814560_2816018_-	dipeptide/tripeptide permease DtpC	NA	A0A0P0IY73	Acinetobacter_phage	29.6	1.8e-48
>prophage 197
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	2830295	2832279	4943397		Cronobacter_phage(50.0%)	2	NA	NA
WP_001026276.1|2830295_2830589_+	co-chaperone GroES	NA	K4F9I2	Cronobacter_phage	45.4	9.2e-13
WP_000729117.1|2830632_2832279_+	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	68.9	5.3e-190
>prophage 198
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	2836785	2837319	4943397		Morganella_phage(100.0%)	1	NA	NA
WP_001238369.1|2836785_2837319_-	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	55.0	2.7e-47
>prophage 199
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	2842239	2843217	4943397		Tupanvirus(100.0%)	1	NA	NA
WP_001612227.1|2842239_2843217_+	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9KZX5	Tupanvirus	28.2	1.5e-27
>prophage 200
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	2850645	2851191	4943397		Diachasmimorpha_longicaudata_entomopoxvirus(100.0%)	1	NA	NA
WP_001295188.1|2850645_2851191_+	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	40.4	2.2e-28
>prophage 201
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	2855106	2922922	4943397	protease,tRNA,transposase	Vibrio_phage(15.38%)	66	NA	NA
WP_000990296.1|2855106_2856444_+	N-acetylmuramoyl-L-alanine amidase AmiB	NA	A0A067ZJB6	Vibrio_phage	31.0	8.8e-18
WP_001122499.1|2856453_2858301_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	41.3	4.4e-60
WP_001280339.1|2858293_2859244_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_001051883.1|2859329_2859638_+	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_000460360.1|2859714_2860995_+	GTPase HflX	NA	NA	NA	NA	NA
WP_000312488.1|2861080_2862340_+|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
WP_001232412.1|2862342_2863347_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_001089295.1|2863428_2863626_+	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_000527955.1|2863729_2865028_+	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.9	2.2e-66
WP_001177644.1|2865232_2865658_+	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_000076316.1|2865696_2868138_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.1	6.4e-67
WP_001293282.1|2868318_2869050_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_000220137.1|2869176_2869578_+	DUF2170 family protein	NA	NA	NA	NA	NA
WP_000511955.1|2869596_2870295_+	PspA/IM30 family protein	NA	NA	NA	NA	NA
WP_000012553.1|2870345_2871005_+	YjfK family protein	NA	NA	NA	NA	NA
WP_000547760.1|2871022_2871421_+	DUF350 domain-containing protein	NA	NA	NA	NA	NA
WP_000101670.1|2871430_2872069_+	DUF1190 domain-containing protein	NA	NA	NA	NA	NA
WP_000943991.1|2872071_2873235_+	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.8	4.9e-81
WP_001719326.1|2873318_2874944_+	isovaleryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000811566.1|2875060_2875336_-|protease	protease activator YjfN	protease	NA	NA	NA	NA
WP_000254636.1|2875484_2875814_-	biofilm peroxide resistance protein BsmA	NA	NA	NA	NA	NA
WP_001719327.1|2875995_2876745_+	esterase	NA	NA	NA	NA	NA
WP_000133631.1|2876741_2877497_-	HTH-type transcriptional regulator UlaR	NA	NA	NA	NA	NA
WP_001295191.1|2877604_2878669_-	L-ascorbate 6-phosphate lactonase	NA	NA	NA	NA	NA
WP_032201196.1|2879023_2880421_+	PTS ascorbate transporter subunit IIC	NA	NA	NA	NA	NA
WP_000218362.1|2880436_2880742_+	PTS ascorbate transporter subunit IIB	NA	NA	NA	NA	NA
WP_000776543.1|2880751_2881216_+	PTS ascorbate transporter subunit IIA	NA	NA	NA	NA	NA
WP_001719329.1|2881229_2881880_+	3-keto-L-gulonate-6-phosphate decarboxylase UlaD	NA	NA	NA	NA	NA
WP_000949511.1|2881889_2882744_+	L-ribulose-5-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_001601324.1|2882743_2883430_+	L-ribulose-5-phosphate 4-epimerase	NA	NA	NA	NA	NA
WP_000492914.1|2883558_2883834_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001216676.1|2884160_2884556_+	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_001296681.1|2884562_2884877_+	primosomal replication protein N	NA	NA	NA	NA	NA
WP_000135199.1|2884881_2885109_+	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_001196062.1|2885150_2885600_+	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_001308220.1|2885670_2886465_-	DUF2686 family protein	NA	NA	NA	NA	NA
WP_000604912.1|2887088_2887520_-|transposase	IS200/IS605-like element IS609 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	60.6	1.9e-43
WP_069903738.1|2887527_2888736_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A1W6JP07	Morganella_phage	97.6	6.0e-207
WP_001119478.1|2888870_2889509_-	cell division protein YtfB	NA	NA	NA	NA	NA
WP_000211225.1|2889726_2890347_+	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_000228346.1|2890655_2892068_+	D-serine/D-alanine/glycine transporter	NA	NA	NA	NA	NA
WP_001719334.1|2892112_2892775_-	iron-sulfur cluster repair protein YtfE	NA	NA	NA	NA	NA
WP_032201334.1|2892882_2893848_-	DMT family transporter	NA	NA	NA	NA	NA
WP_001719336.1|2893955_2894816_-	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_001317588.1|2894904_2895285_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001719337.1|2895413_2897357_-	2',3'-cyclic-nucleotide 2'-phosphodiesterase	NA	NA	NA	NA	NA
WP_000886909.1|2897546_2898287_+	3'(2'),5'-bisphosphate nucleotidase CysQ	NA	NA	NA	NA	NA
WP_001719338.1|2898498_2899410_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000175287.1|2899499_2900054_-	YtfJ family protein	NA	NA	NA	NA	NA
WP_000689228.1|2900378_2900585_+	DUF1107 domain-containing protein	NA	NA	NA	NA	NA
WP_000935036.1|2900646_2901990_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001269327.1|2903155_2904889_+	autotransporter assembly complex protein TamA	NA	NA	NA	NA	NA
WP_001719340.1|2904885_2908665_+	autotransporter assembly complex protein TamB	NA	NA	NA	NA	NA
WP_001219160.1|2908667_2909009_+	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_000055075.1|2909388_2909919_-	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.3	1.2e-55
WP_032301153.1|2910228_2911194_+	galactofuranose ABC transporter substrate-binding protein YtfQ	NA	NA	NA	NA	NA
WP_001719343.1|2911293_2912796_+	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.4	1.4e-19
WP_001719344.1|2912809_2913832_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000596014.1|2913818_2914814_+	sugar ABC transporter permease YjfF	NA	NA	NA	NA	NA
WP_000853753.1|2914846_2915845_-	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.7	5.7e-70
WP_001219792.1|2916020_2917394_+	UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl- meso-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_001719346.1|2917549_2918101_-	ribosome-associated protein	NA	NA	NA	NA	NA
WP_001162171.1|2918194_2919547_+|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
WP_001232246.1|2919730_2920117_+	cytochrome b562	NA	NA	NA	NA	NA
WP_001106233.1|2920161_2920626_-	anaerobic ribonucleoside-triphosphate reductase-activating protein	NA	K4F9T1	Cronobacter_phage	57.7	3.8e-53
WP_000187778.1|2920783_2922922_-	anaerobic ribonucleoside-triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	64.5	1.5e-266
>prophage 202
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	2926560	2932657	4943397		Paramecium_bursaria_Chlorella_virus(66.67%)	6	NA	NA
WP_001181324.1|2926560_2927508_-	HTH-type transcriptional regulator TreR	NA	C6ZCU4	Enterobacteria_phage	21.8	7.9e-13
WP_001387276.1|2927692_2927746_+	mgtA regulatory leader peptide MgtL	NA	NA	NA	NA	NA
WP_000471889.1|2927886_2930583_+	magnesium-translocating P-type ATPase	NA	M1HLC0	Paramecium_bursaria_Chlorella_virus	27.4	9.0e-46
WP_000047539.1|2930788_2931175_-	2-iminobutanoate/2-iminopropanoate deaminase	NA	NA	NA	NA	NA
WP_000148581.1|2931247_2931709_-	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_000013046.1|2931721_2932657_-	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	40.2	2.9e-52
>prophage 203
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	2941121	2951546	4943397	tRNA	Klosneuvirus(25.0%)	7	NA	NA
WP_001719355.1|2941121_2943977_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.6	3.0e-140
WP_000786399.1|2943976_2944420_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_000397144.1|2944773_2946285_-	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.0	6.0e-47
WP_000584114.1|2946551_2947652_+	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_001295681.1|2947651_2948734_+	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_032301160.1|2948894_2950397_-	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	44.8	1.0e-83
WP_001719357.1|2950526_2951546_-	NADPH-dependent aldehyde reductase Ahr	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	30.4	3.2e-44
>prophage 204
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	2956264	2957245	4943397		Stx2-converting_phage(100.0%)	1	NA	NA
WP_032301170.1|2956264_2957245_-	9-O-acetyl-N-acetylneuraminic acid deacetylase	NA	Q08JA2	Stx2-converting_phage	55.9	1.2e-101
>prophage 205
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	2960605	2962282	4943397		Escherichia_phage(100.0%)	2	NA	NA
WP_001719414.1|2960605_2961208_+	type 1 fimbria regulatory protein FimB	NA	A0A2L1IV36	Escherichia_phage	52.3	4.0e-55
WP_000044700.1|2961685_2962282_+	type 1 fimbria regulatory protein FimE	NA	A0A2L1IV36	Escherichia_phage	53.4	5.1e-50
>prophage 206
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	2972480	2973941	4943397		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_001719422.1|2972480_2973941_+	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	32.2	7.3e-50
>prophage 207
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	2980506	2981058	4943397		Clostridioides_phage(100.0%)	1	NA	NA
WP_001719427.1|2980506_2981058_+	RNA 2'-phosphotransferase	NA	A0A2R2ZGT8	Clostridioides_phage	43.3	2.7e-37
>prophage 208
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	2997486	2999882	4943397	transposase	Stx2-converting_phage(66.67%)	3	NA	NA
WP_099490891.1|2997486_2999079_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	61.2	3.0e-174
WP_000624718.1|2999109_2999460_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	2.1e-40
WP_000422741.1|2999456_2999882_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
>prophage 209
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	3005018	3006347	4943397		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001719439.1|3005018_3006347_-	type-1 restriction enzyme EcoKI specificity protein	NA	A0A2H4PQP5	Staphylococcus_phage	31.1	2.9e-13
>prophage 210
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	3027728	3033093	4943397		uncultured_Caudovirales_phage(50.0%)	4	NA	NA
WP_000919571.1|3027728_3029393_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	39.6	6.2e-13
WP_000410140.1|3029441_3030803_-	MFS transporter	NA	NA	NA	NA	NA
WP_000091572.1|3031017_3031932_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001612288.1|3032070_3033093_+	zinc-binding alcohol dehydrogenase family protein	NA	A0A2K9L7I1	Tupanvirus	26.3	2.7e-11
>prophage 211
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	3036320	3037600	4943397		Shigella_phage(50.0%)	2	NA	NA
WP_000799911.1|3036320_3037058_-	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	50.8	7.6e-64
WP_000098818.1|3037060_3037600_-	primosomal protein DnaT	NA	T1SA92	Salmonella_phage	62.8	2.9e-28
>prophage 212
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	3045492	3048368	4943397		Streptococcus_phage(50.0%)	3	NA	NA
WP_000175940.1|3045492_3047082_+	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	25.2	2.4e-30
WP_001295410.1|3047474_3048080_+	molecular chaperone OsmY	NA	NA	NA	NA	NA
WP_000490275.1|3048206_3048368_+	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	64.2	1.8e-10
>prophage 213
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	3054404	3055727	4943397		Geobacillus_virus(100.0%)	1	NA	NA
WP_000477811.1|3054404_3055727_+	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	39.8	2.3e-79
>prophage 214
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	3062447	3067803	4943397		Enterococcus_phage(33.33%)	3	NA	NA
WP_000093814.1|3062447_3063680_+	multifunctional transcriptional regulator/nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase NadR	NA	A0A0C5K935	Enterococcus_phage	42.6	3.6e-82
WP_000046749.1|3063987_3065655_-	energy-dependent translational throttle protein EttA	NA	A0A1V0SKJ1	Klosneuvirus	26.4	3.7e-42
WP_000409457.1|3065865_3067803_+	murein transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	34.8	4.0e-11
>prophage 215
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	3071139	3071829	4943397		Bacillus_phage(100.0%)	1	NA	NA
WP_001188659.1|3071139_3071829_+	two-component system response regulator CreB	NA	W8CYM9	Bacillus_phage	35.3	8.8e-30
>prophage 216
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	3085022	3095439	4943397	transposase	Cyanophage(20.0%)	10	NA	NA
WP_000130185.1|3085022_3085976_+	transaldolase	NA	A0A127KNC6	Cyanophage	31.5	1.7e-10
WP_001094685.1|3086090_3086678_+	molybdopterin adenylyltransferase	NA	NA	NA	NA	NA
WP_000528538.1|3086711_3087278_-	acetate uptake transporter	NA	NA	NA	NA	NA
WP_001102367.1|3087426_3088140_-	acidic protein MsyB	NA	NA	NA	NA	NA
WP_001612303.1|3088165_3088570_-	DUF2541 family protein	NA	NA	NA	NA	NA
WP_000516135.1|3088946_3090863_+	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	51.1	6.9e-149
WP_001118464.1|3090951_3092082_+	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	34.6	4.6e-28
WP_001300563.1|3092228_3093341_+|transposase	IS4-like element IS421 family transposase	transposase	NA	NA	NA	NA
WP_001181672.1|3093534_3093744_-	type I toxin-antitoxin system toxin MokC	NA	A0A0P0ZAX5	Stx2-converting_phage	72.5	5.2e-18
WP_000681360.1|3094272_3095439_+	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	50.3	7.5e-90
>prophage 217
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	3104912	3107729	4943397	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_001286887.1|3104912_3107729_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A2K9L260	Tupanvirus	26.1	2.1e-77
>prophage 218
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	3112135	3113284	4943397		Halovirus(100.0%)	1	NA	NA
WP_000597260.1|3112135_3113284_+	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	32.6	1.7e-49
>prophage 219
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	3118787	3124448	4943397		Hepacivirus(50.0%)	4	NA	NA
WP_000351348.1|3118787_3120341_-	crotonobetaine/carnitine-CoA ligase	NA	Q75ZG1	Hepacivirus	25.4	2.1e-31
WP_000349932.1|3120414_3121632_-	L-carnitine CoA-transferase	NA	NA	NA	NA	NA
WP_000347117.1|3121760_3122903_-	crotonobetainyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000787111.1|3122933_3124448_-	L-carnitine/gamma-butyrobetaine antiport BCCT transporter	NA	A0A2I7QNT1	Vibrio_phage	21.1	3.5e-07
>prophage 220
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	3132344	3133744	4943397		Bacillus_phage(50.0%)	2	NA	NA
WP_000624375.1|3132344_3132824_+	type 3 dihydrofolate reductase	NA	A0A219UQN5	Bacillus_phage	46.4	1.0e-29
WP_000257194.1|3132901_3133744_-	bis(5'-nucleosyl)-tetraphosphatase (symmetrical)	NA	A0A075BTY6	Microcystis_phage	42.0	1.0e-08
>prophage 221
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	3141488	3146910	4943397		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_001717640.1|3141488_3144395_-	RNA polymerase-associated protein RapA	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	37.9	5.7e-22
WP_001717641.1|3144558_3146910_-	DNA polymerase II	NA	A0A0P0YM26	Yellowstone_lake_phycodnavirus	25.4	3.0e-37
>prophage 222
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	3153273	3153972	4943397		Planktothrix_phage(100.0%)	1	NA	NA
WP_001717645.1|3153273_3153972_-	thiamine ABC transporter ATP-binding protein ThiQ	NA	G9BWD6	Planktothrix_phage	36.7	3.1e-22
>prophage 223
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	3167682	3169407	4943397		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_000425668.1|3167682_3169407_+	acetolactate synthase 3 large subunit	NA	E5ERI2	Ostreococcus_lucimarinus_virus	26.9	1.9e-36
>prophage 224
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	3195380	3196424	4943397		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_001217337.1|3195380_3196424_+	GMP reductase	NA	A0A0N9Q9A5	Chrysochromulina_ericina_virus	56.3	6.3e-104
>prophage 225
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	3200669	3201221	4943397		Sphingobium_phage(100.0%)	1	NA	NA
WP_000923722.1|3200669_3201221_+	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	A0A1W6DX33	Sphingobium_phage	31.6	1.1e-11
>prophage 226
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	3209731	3211156	4943397		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_000102485.1|3209731_3211156_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.8	4.2e-42
>prophage 227
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	3218806	3225429	4943397		Mamastrovirus(33.33%)	5	NA	NA
WP_001717663.1|3218806_3220357_+	multicopper oxidase CueO	NA	A0A0C6DWA2	Mamastrovirus	55.4	2.7e-18
WP_001717665.1|3220558_3222949_-	pyrroloquinoline quinone-dependent dehydrogenase	NA	NA	NA	NA	NA
WP_000683335.1|3223154_3223691_+	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	33.1	5.1e-17
WP_000651599.1|3223731_3224394_-	carbonate dehydratase	NA	NA	NA	NA	NA
WP_000150637.1|3224502_3225429_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	34.0	1.2e-21
>prophage 228
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	3228691	3229564	4943397		Sodalis_phage(100.0%)	1	NA	NA
WP_001717668.1|3228691_3229564_+	recombination-promoting nuclease RpnC	NA	Q2A0A7	Sodalis_phage	50.2	3.5e-60
>prophage 229
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	3239463	3246269	4943397	tRNA	unidentified_phage(50.0%)	6	NA	NA
WP_071607517.1|3239463_3240882_-	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	37.9	5.5e-26
WP_024171430.1|3240920_3241847_-|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
WP_001155227.1|3241883_3242339_-	RNA polymerase-binding protein DksA	NA	NA	NA	NA	NA
WP_000396036.1|3242516_3243221_-	DNA/RNA nuclease SfsA	NA	NA	NA	NA	NA
WP_001612365.1|3243235_3243766_-	RNA 2',3'-cyclic phosphodiesterase	NA	NA	NA	NA	NA
WP_001612367.1|3243839_3246269_+	ATP-dependent helicase HrpB	NA	A0A0G2Y9F4	Acanthamoeba_polyphaga_mimivirus	30.3	3.0e-40
>prophage 230
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	3251457	3252255	4943397		Planktothrix_phage(100.0%)	1	NA	NA
WP_001158929.1|3251457_3252255_+	Fe3+-hydroxamate ABC transporter ATP-binding protein FhuC	NA	G9BWD6	Planktothrix_phage	26.9	6.0e-14
>prophage 231
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	3258289	3258634	4943397		Lake_Baikal_phage(100.0%)	1	NA	NA
WP_001295564.1|3258289_3258634_+	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	51.4	4.5e-27
>prophage 232
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	3262563	3263988	4943397	protease	uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_000753946.1|3262563_3263988_+|protease	serine endoprotease DegP	protease	A0A1B1IT49	uncultured_Mediterranean_phage	28.8	1.9e-26
>prophage 233
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	3275748	3276507	4943397		Flavobacterium_phage(100.0%)	1	NA	NA
WP_001295562.1|3275748_3276507_+	(2E,6E)-farnesyl-diphosphate-specific ditrans,polycis-undecaprenyl-diphosphate synthase	NA	R9W0U9	Flavobacterium_phage	44.4	7.7e-27
>prophage 234
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	3285335	3289451	4943397		Emiliania_huxleyi_virus(50.0%)	2	NA	NA
WP_000569431.1|3285335_3285932_+	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.0	1.8e-26
WP_001612380.1|3285968_3289451_+	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.9	2.8e-209
>prophage 235
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	3302453	3303485	4943397		Planktothrix_phage(100.0%)	1	NA	NA
WP_000593994.1|3302453_3303485_-	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	7.2e-36
>prophage 236
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	3309994	3317847	4943397		Indivirus(25.0%)	9	NA	NA
WP_000997018.1|3309994_3310798_+	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.6	5.4e-39
WP_001612387.1|3310794_3311709_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001230983.1|3311949_3312750_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_001612389.1|3312827_3313598_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000644685.1|3313645_3315004_-	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_001612392.1|3315075_3315831_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_001612393.1|3315864_3316587_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000917883.1|3316583_3317051_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001301976.1|3317115_3317847_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.5	9.9e-40
>prophage 237
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	3331643	3335562	4943397		Caulobacter_phage(50.0%)	6	NA	NA
WP_000284050.1|3331643_3332222_+	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
WP_000333380.1|3332427_3333195_+	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_001225679.1|3333165_3333906_-	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_024171431.1|3334061_3334340_-	type II toxin-antitoxin system mRNA interferase toxin YafQ	NA	NA	NA	NA	NA
WP_000729704.1|3334342_3334603_-	type II toxin-antitoxin system antitoxin DinJ	NA	NA	NA	NA	NA
WP_000056850.1|3334812_3335562_+	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	37.7	1.2e-19
>prophage 238
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	3345573	3350808	4943397	integrase	Enterobacteria_phage(50.0%)	4	3337989:3338004	3358495:3358510
3337989:3338004	attL	GCCTGCGCCTGGTTGA	NA	NA	NA	NA
WP_000749879.1|3345573_3346629_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.9	4.5e-118
WP_001285288.1|3346916_3348020_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000893266.1|3348031_3349285_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	5.8e-96
WP_099490898.1|3349638_3350808_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	62.6	1.5e-146
3358495:3358510	attR	GCCTGCGCCTGGTTGA	NA	NA	NA	NA
>prophage 239
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	3354930	3361109	4943397		Enterobacteria_phage(75.0%)	8	NA	NA
WP_001711518.1|3354930_3355203_-	ogr/Delta-like zinc finger family protein	NA	A0A2I8TV89	Erwinia_phage	46.9	8.3e-08
WP_001711519.1|3355204_3355759_-	phage polarity suppression family protein	NA	NA	NA	NA	NA
WP_001711511.1|3355755_3356508_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001711481.1|3357411_3357672_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	67.5	3.5e-24
WP_024172233.1|3357668_3358217_+	ash family protein	NA	Q7M2A7	Enterobacteria_phage	55.3	3.4e-24
WP_001711517.1|3358216_3358441_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000842357.1|3358437_3358761_+	DUF5375 family protein	NA	NA	NA	NA	NA
WP_024172234.1|3358775_3361109_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	72.8	0.0e+00
>prophage 240
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	3369024	3371223	4943397		Acinetobacter_phage(100.0%)	1	NA	NA
WP_001612429.1|3369024_3371223_-	xanthine dehydrogenase family protein molybdopterin-binding subunit	NA	A0A0P0I429	Acinetobacter_phage	25.8	3.3e-38
>prophage 241
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	3381009	3382218	4943397	transposase	uncultured_marine_virus(100.0%)	1	NA	NA
WP_001352368.1|3381009_3382218_-|transposase	IS4-like element ISVsa5 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	100.0	1.8e-235
>prophage 242
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	3390861	3391713	4943397		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001717723.1|3390861_3391713_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	40.3	2.0e-47
>prophage 243
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	3397757	3401062	4943397		Staphylococcus_phage(50.0%)	4	NA	NA
WP_001612446.1|3397757_3398627_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	42.1	3.2e-53
WP_001306921.1|3398786_3399380_-	reactive chlorine species resistance protein RclC	NA	NA	NA	NA	NA
WP_000474084.1|3399391_3399628_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001612447.1|3399736_3401062_-	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	47.6	2.5e-113
>prophage 244
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	3410989	3418547	4943397	integrase,holin	Escherichia_phage(33.33%)	6	3409948:3409961	3425021:3425034
3409948:3409961	attL	TTCACCAACGGCAA	NA	NA	NA	NA
WP_001362381.1|3410989_3411553_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	52.7	1.8e-52
WP_001612454.1|3411796_3411931_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001612455.1|3412609_3414298_-|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.1	1.8e-60
WP_001612456.1|3414311_3415784_-	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001301903.1|3415797_3416385_-	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_000131044.1|3416513_3418547_+|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	27.4	3.4e-21
3425021:3425034	attR	TTCACCAACGGCAA	NA	NA	NA	NA
>prophage 245
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	3429936	3430986	4943397		Tupanvirus(100.0%)	1	NA	NA
WP_000692746.1|3429936_3430986_+	NADPH-dependent aldehyde reductase YahK	NA	A0A2K9L339	Tupanvirus	45.0	1.1e-71
>prophage 246
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	3439666	3441553	4943397		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000010270.1|3439666_3441553_+	propionate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	29.4	3.1e-53
>prophage 247
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	3444829	3445729	4943397		Lactobacillus_phage(100.0%)	1	NA	NA
WP_032200772.1|3444829_3445729_-	transcriptional regulator CynR	NA	A0A2P0ZL89	Lactobacillus_phage	27.3	2.5e-16
>prophage 248
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	3450270	3454550	4943397		Herpes_simplex_virus(50.0%)	2	NA	NA
WP_001612474.1|3450270_3453345_-	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	97.4	0.0e+00
WP_000805900.1|3453467_3454550_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	99.7	9.8e-193
>prophage 249
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	3459960	3461921	4943397		Ostreococcus_lucimarinus_virus(50.0%)	2	NA	NA
WP_000044314.1|3459960_3460911_+	acetaldehyde dehydrogenase	NA	G9E526	Ostreococcus_lucimarinus_virus	35.2	8.7e-36
WP_001013510.1|3460907_3461921_+	4-hydroxy-2-oxovalerate aldolase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	31.1	3.2e-44
>prophage 250
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	3465403	3468029	4943397		Prochlorococcus_phage(50.0%)	3	NA	NA
WP_000842102.1|3465403_3466513_-	S-(hydroxymethyl)glutathione dehydrogenase	NA	A0A0K0KVL7	Prochlorococcus_phage	28.6	1.2e-31
WP_001141271.1|3466547_3466823_-	formaldehyde-responsive transcriptional repressor FrmR	NA	NA	NA	NA	NA
WP_001717740.1|3466982_3468029_-	ferric ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.7	8.1e-35
>prophage 251
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	3476052	3476820	4943397		Planktothrix_phage(100.0%)	1	NA	NA
WP_000939373.1|3476052_3476820_+	taurine ABC transporter ATP-binding subunit	NA	G9BWD6	Planktothrix_phage	40.3	8.6e-26
>prophage 252
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	3483719	3484877	4943397		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_001612488.1|3483719_3484877_-	D-alanyl-D-alanine- carboxypeptidase/endopeptidase AmpH	NA	A0A2H4JAN9	uncultured_Caudovirales_phage	22.1	5.1e-06
>prophage 253
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	3492292	3493408	4943397		Bacillus_phage(100.0%)	1	NA	NA
WP_000484044.1|3492292_3493408_+	diguanylate cyclase AdrA	NA	A0A127AWB9	Bacillus_phage	34.5	1.1e-18
>prophage 254
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	3498070	3508042	4943397		Bacillus_phage(60.0%)	7	NA	NA
WP_001298537.1|3498070_3498982_-	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	63.6	2.7e-103
WP_001612495.1|3499106_3500015_+	fructokinase	NA	NA	NA	NA	NA
WP_001306939.1|3500157_3501342_-	MFS transporter AraJ	NA	NA	NA	NA	NA
WP_001612498.1|3501467_3504611_-	exonuclease subunit SbcC	NA	G3MAB6	Bacillus_virus	27.4	5.3e-13
WP_001612499.1|3504607_3505810_-	exonuclease subunit SbcD	NA	R4JGS2	Bacillus_phage	31.5	3.1e-06
WP_000113933.1|3505999_3506689_+	phosphate response regulator transcription factor PhoB	NA	W8CYM9	Bacillus_phage	38.0	4.4e-37
WP_000893611.1|3506746_3508042_+	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	30.8	1.7e-26
>prophage 255
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	3516640	3525482	4943397	tRNA	uncultured_Mediterranean_phage(60.0%)	10	NA	NA
WP_000667319.1|3516640_3517768_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	46.1	2.1e-89
WP_000007629.1|3517790_3518123_+	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	33.0	2.8e-10
WP_000934822.1|3518150_3519998_+	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_000046637.1|3520008_3520980_+	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	37.9	1.0e-44
WP_000974813.1|3521108_3521456_+	HNH nuclease family protein	NA	NA	NA	NA	NA
WP_001295328.1|3521493_3522378_-	nucleoside-specific channel-forming protein Tsx	NA	NA	NA	NA	NA
WP_001314529.1|3522676_3523216_-	DUF3251 domain-containing protein	NA	NA	NA	NA	NA
WP_000543535.1|3523366_3523816_+	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_001717759.1|3523819_3524923_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	35.8	1.4e-53
WP_001021161.1|3525011_3525482_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	47.4	1.3e-29
>prophage 256
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	3548840	3553887	4943397	protease	Agrobacterium_phage(25.0%)	4	NA	NA
WP_000122253.1|3548840_3549464_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	63.9	2.9e-64
WP_000130305.1|3549589_3550864_+|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	56.4	8.7e-132
WP_001295325.1|3551051_3553406_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.4	1.6e-224
WP_001043542.1|3553614_3553887_+	DNA-binding protein HU-beta	NA	A7KV42	Bacillus_phage	58.4	1.1e-20
>prophage 257
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	3557027	3557723	4943397		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000817227.1|3557027_3557723_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	68.0	1.9e-88
>prophage 258
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	3561046	3564593	4943397		Bacillus_phage(100.0%)	2	NA	NA
WP_032200872.1|3561046_3562819_+	SmdA family multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.1	2.6e-49
WP_001256174.1|3562811_3564593_+	SmdB family multidrug efflux ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.1	1.4e-42
>prophage 259
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	3573428	3576578	4943397		Leptospira_phage(100.0%)	1	NA	NA
WP_001132469.1|3573428_3576578_-	multidrug efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	23.9	6.2e-54
>prophage 260
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	3583586	3592044	4943397		Klosneuvirus(25.0%)	8	NA	NA
WP_000127356.1|3583586_3584138_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	47.3	3.7e-31
WP_024171443.1|3584266_3586198_+	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	41.5	5.1e-43
WP_000467098.1|3586250_3586580_+	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_001195025.1|3586579_3587185_+	recombination protein RecR	NA	NA	NA	NA	NA
WP_000678201.1|3587294_3589169_+	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	38.0	1.0e-117
WP_000261613.1|3589289_3589994_+	adenylate kinase	NA	NA	NA	NA	NA
WP_001250105.1|3590125_3591088_+	ferrochelatase	NA	NA	NA	NA	NA
WP_001717778.1|3591084_3592044_-	acetyl esterase	NA	L7RDF8	Acanthamoeba_polyphaga_moumouvirus	24.7	1.3e-15
>prophage 261
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	3600288	3603450	4943397		Escherichia_phage(50.0%)	2	NA	NA
WP_001717781.1|3600288_3600630_+	HigA family addiction module antidote protein	NA	A0A222YWD7	Escherichia_phage	70.9	7.4e-38
WP_001717782.1|3600945_3603450_-	copper-exporting P-type ATPase CopA	NA	A0A218MNH6	uncultured_virus	38.2	8.5e-115
>prophage 262
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	3628521	3630684	4943397		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_001612541.1|3628521_3630684_+	type I secretion system permease/ATPase	NA	F2Y302	Organic_Lake_phycodnavirus	31.9	4.1e-17
>prophage 263
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	3636413	3637091	4943397		Bacillus_virus(100.0%)	1	NA	NA
WP_001157535.1|3636413_3637091_+	iron ABC transporter ATP-binding protein FetA	NA	G3M9Y6	Bacillus_virus	34.3	2.4e-27
>prophage 264
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	3640227	3647956	4943397		Planktothrix_phage(50.0%)	3	NA	NA
WP_001110573.1|3640227_3640914_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.6	2.9e-33
WP_001717789.1|3640910_3643325_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_099490903.1|3643753_3647956_+	RHS repeat protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	44.6	1.3e-22
>prophage 265
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	3653213	3654995	4943397		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_001612552.1|3653213_3654995_+	glyoxylate carboligase	NA	E4WLQ6	Ostreococcus_tauri_virus	27.0	6.0e-38
>prophage 266
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	3661186	3662332	4943397		Streptococcus_phage(100.0%)	1	NA	NA
WP_001717805.1|3661186_3662332_+	glycerate 3-kinase	NA	W6LM47	Streptococcus_phage	41.4	1.2e-47
>prophage 267
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	3673764	3676895	4943397	tRNA	Moumouvirus(50.0%)	4	NA	NA
WP_001402080.1|3673764_3675150_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.9e-45
WP_001612564.1|3675185_3675707_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000190288.1|3675814_3676027_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_000729155.1|3676028_3676895_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
>prophage 268
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	3698657	3703274	4943397		Ralstonia_phage(33.33%)	3	NA	NA
WP_001612575.1|3698657_3700559_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	26.1	3.5e-28
WP_032201420.1|3701152_3702601_-	Cu(+)/Ag(+) sensor histidine kinase CusS	NA	A0A1V0SGX0	Hokovirus	26.1	3.0e-11
WP_000770953.1|3702590_3703274_-	copper response regulator transcription factor CusR	NA	W8CYM9	Bacillus_phage	35.1	1.0e-30
>prophage 269
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	3706419	3709563	4943397		Leptospira_phage(100.0%)	1	NA	NA
WP_001717826.1|3706419_3709563_+	Cu(+)/Ag(+) efflux RND transporter permease subunit CusA	NA	S5VTK5	Leptospira_phage	22.5	1.7e-59
>prophage 270
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	3721837	3727880	4943397		Tupanvirus(50.0%)	3	NA	NA
WP_001612585.1|3721837_3725719_+	enterobactin non-ribosomal peptide synthetase EntF	NA	A0A2K9KZV5	Tupanvirus	29.4	6.4e-61
WP_000096698.1|3725934_3727068_+	LPS O-antigen length regulator	NA	NA	NA	NA	NA
WP_000140647.1|3727064_3727880_-	iron-enterobactin ABC transporter ATP-binding protein	NA	A0A1V0SJ29	Klosneuvirus	22.0	7.3e-07
>prophage 271
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	3742200	3744023	4943397		uncultured_marine_virus(50.0%)	2	NA	NA
WP_000502952.1|3742200_3742830_-	ParB-like nuclease domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	52.8	2.9e-56
WP_000029824.1|3742802_3744023_-	phosphoadenosine phosphosulfate reductase	NA	A0A220GKF8	Streptococcus_phage	32.8	2.7e-58
>prophage 272
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	3747207	3749322	4943397		Bacillus_virus(50.0%)	2	NA	NA
WP_000887629.1|3747207_3748773_+	alkyl hydroperoxide reductase subunit F	NA	G3MA85	Bacillus_virus	34.3	2.2e-44
WP_000278505.1|3748893_3749322_-	universal stress protein UspG	NA	A0A1W6JNV4	Morganella_phage	39.2	1.1e-19
>prophage 273
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	3764745	3765391	4943397		Morganella_phage(50.0%)	2	NA	NA
WP_000034825.1|3764745_3764955_+	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	2.7e-22
WP_000939738.1|3765007_3765391_-	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	53.6	6.8e-24
>prophage 274
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	3770206	3772646	4943397		Stx2-converting_phage(50.0%)	2	NA	NA
WP_001092082.1|3770206_3771418_-	D-alanyl-D-alanine carboxypeptidase DacA	NA	B6DZZ7	Stx2-converting_phage	47.4	1.2e-101
WP_032200858.1|3771557_3772646_-	endolytic peptidoglycan transglycosylase RlpA	NA	F5B3X9	Synechococcus_phage	53.2	3.6e-09
>prophage 275
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	3779656	3782239	4943397	tRNA	Staphylococcus_phage(100.0%)	1	NA	NA
WP_001612599.1|3779656_3782239_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	42.2	6.8e-184
>prophage 276
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	3785287	3786013	4943397		Planktothrix_phage(100.0%)	1	NA	NA
WP_000631384.1|3785287_3786013_-	glutamate/aspartate ABC transporter ATP binding protein GltL	NA	G9BWD6	Planktothrix_phage	38.6	7.6e-32
>prophage 277
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	3791896	3792976	4943397		Pseudomonas_phage(100.0%)	1	NA	NA
WP_000490838.1|3791896_3792976_-	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	46.6	4.3e-47
>prophage 278
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	3797071	3798736	4943397		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_000337063.1|3797071_3798736_-	asparagine synthase B	NA	A9YVS6	Ostreococcus_tauri_virus	39.3	6.1e-85
>prophage 279
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	3803502	3807372	4943397	tRNA	Vibrio_phage(50.0%)	2	NA	NA
WP_001717856.1|3803502_3805449_+	PTS N-acetyl glucosamine transporter subunit IIABC	NA	A0A2I7SAJ6	Vibrio_phage	47.3	1.6e-07
WP_001287164.1|3805707_3807372_+|tRNA	glutamine--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	98.9	0.0e+00
>prophage 280
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	3811654	3827716	4943397		Mycobacterium_phage(20.0%)	11	NA	NA
WP_001612611.1|3811654_3812419_-	esterase	NA	A0A1J0GNR5	Mycobacterium_phage	32.4	5.8e-06
WP_000848387.1|3812603_3813149_+	replication initiation negative regulator SeqA	NA	NA	NA	NA	NA
WP_001297249.1|3813174_3814815_+	alpha-D-glucose phosphate-specific phosphoglucomutase	NA	NA	NA	NA	NA
WP_000186102.1|3814989_3815667_-	two-component system response regulator KdpE	NA	W8CYM9	Bacillus_phage	31.1	8.9e-27
WP_001717860.1|3815663_3818348_-	two-component system sensor histidine kinase KdbD	NA	A0A1V0SGX0	Hokovirus	27.1	5.0e-12
WP_001717861.1|3818340_3818913_-	K(+)-transporting ATPase subunit C	NA	NA	NA	NA	NA
WP_001717862.1|3818921_3820970_-	potassium-transporting ATPase subunit KdpB	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	22.8	5.5e-27
WP_089628145.1|3820992_3822666_-	potassium-transporting ATPase subunit KdpA	NA	NA	NA	NA	NA
WP_001272653.1|3822665_3822755_-	K(+)-transporting ATPase subunit F	NA	NA	NA	NA	NA
WP_000424924.1|3823067_3823274_+	YbfA family protein	NA	NA	NA	NA	NA
WP_099490906.1|3823516_3827716_+	RHS repeat protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	32.6	7.3e-26
>prophage 281
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	3831474	3840032	4943397	transposase	Hokovirus(25.0%)	8	NA	NA
WP_001717891.1|3831474_3832893_+	deoxyribodipyrimidine photo-lyase	NA	A0A1V0SGL1	Hokovirus	32.2	8.9e-61
WP_001032694.1|3833042_3834524_-	dipeptide permease DtpD	NA	A0A0P0IY73	Acinetobacter_phage	28.2	2.5e-45
WP_000798871.1|3834794_3835538_+	radiation resistance protein YbgI	NA	NA	NA	NA	NA
WP_001188343.1|3835560_3836217_+	5-oxoprolinase subunit PxpB	NA	NA	NA	NA	NA
WP_001352368.1|3836693_3837902_-|transposase	IS4-like element ISVsa5 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	100.0	1.8e-235
WP_099490907.1|3838025_3838481_+	allophanate hydrolase	NA	NA	NA	NA	NA
WP_001612620.1|3838470_3839205_+	5-oxoprolinase subunit PxpA	NA	NA	NA	NA	NA
WP_001717892.1|3839240_3840032_+	endonuclease VIII	NA	A0A1V0CNR6	Kaumoebavirus	31.5	2.2e-08
>prophage 282
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	3864070	3865468	4943397		Bordetella_phage(100.0%)	1	NA	NA
WP_024171454.1|3864070_3865468_-	RtcB family protein	NA	A0A291L9X2	Bordetella_phage	31.8	1.8e-34
>prophage 283
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	3891254	3894774	4943397		Vibrio_phage(33.33%)	4	NA	NA
WP_000345410.1|3891254_3891974_+	nicotinamide riboside transporter PnuC	NA	A0A126HGA3	Vibrio_phage	32.7	9.2e-22
WP_001612652.1|3891970_3892912_-	CDF family zinc transporter ZitB	NA	A0A1V0SED0	Indivirus	27.6	4.9e-23
WP_000784348.1|3893025_3893406_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099490910.1|3893721_3894774_+	3-deoxy-7-phosphoheptulonate synthase AroG	NA	A0A2I6UFP9	Klebsiella_phage	49.4	2.6e-81
>prophage 284
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	3899135	3905710	4943397		Tupanvirus(33.33%)	7	NA	NA
WP_001265443.1|3899135_3900152_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	46.0	1.0e-79
WP_001612654.1|3900413_3901886_-	molybdate ABC transporter ATP-binding protein ModF	NA	A0A1M7XV31	Cedratvirus	27.9	2.7e-12
WP_001147439.1|3901953_3902742_-	molybdenum-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_000891515.1|3902870_3903020_+	multidrug efflux pump accessory protein AcrZ	NA	NA	NA	NA	NA
WP_001612655.1|3903186_3903960_+	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000604034.1|3903959_3904649_+	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_000891692.1|3904651_3905710_+	molybdenum ABC transporter ATP-binding protein ModC	NA	G9BWD6	Planktothrix_phage	35.9	1.5e-20
>prophage 285
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	3915420	3941739	4943397	integrase,lysis,tail	Enterobacteria_phage(45.71%)	42	3915333:3915347	3939810:3939824
3915333:3915347	attL	GCTTTTTTATACTAA	NA	NA	NA	NA
WP_000533642.1|3915420_3916491_-|integrase	tyrosine-type recombinase/integrase	integrase	Q9MCR4	Enterobacteria_phage	100.0	5.1e-202
WP_001303849.1|3916468_3916687_-	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_000545745.1|3916726_3916894_-	hypothetical protein	NA	A5VWB7	Enterobacteria_phage	98.2	2.9e-27
WP_001348592.1|3917136_3917739_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000763367.1|3917949_3918171_-	TraR/DksA family transcriptional regulator	NA	A0A0K2FI84	Escherichia_phage	100.0	2.9e-35
WP_001386642.1|3918269_3918551_-	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	98.9	5.5e-47
WP_024171457.1|3918561_3918753_-	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	98.4	2.8e-26
WP_000682318.1|3918725_3918908_-	DUF1317 domain-containing protein	NA	A0A0N7CHV0	Escherichia_phage	98.3	1.3e-28
WP_000186792.1|3918904_3919585_-	YqaJ viral recombinase family protein	NA	A0A0P0ZCQ7	Stx2-converting_phage	99.6	4.6e-132
WP_000100847.1|3919581_3920367_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000995441.1|3920372_3920669_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	99.0	1.1e-48
WP_000233576.1|3920745_3920952_-	phage encoded cell division inhibitor protein	NA	K7P6H3	Enterobacteria_phage	85.3	3.2e-28
WP_064716911.1|3921547_3922237_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	74.6	1.1e-91
WP_001067458.1|3922341_3922572_+	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	68.0	1.5e-21
WP_001182903.1|3922641_3923181_+	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	66.1	1.2e-61
WP_001471439.1|3923267_3924197_+	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	62.8	4.9e-108
WP_001717909.1|3924193_3924895_+	replication P family protein	NA	M1FJ72	Enterobacteria_phage	96.6	4.3e-125
WP_099490911.1|3924891_3925194_+	protein ren	NA	M1FPD5	Enterobacteria_phage	96.7	1.0e-43
WP_001070442.1|3925261_3925594_+	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_001348591.1|3925642_3925792_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001717910.1|3925849_3927376_+	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	27.5	1.3e-30
WP_000338662.1|3927487_3927811_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001348590.1|3927985_3928768_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072097297.1|3928862_3928964_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001053027.1|3928960_3929416_+	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	67.5	2.2e-61
WP_000224914.1|3929415_3929586_+	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	69.8	2.4e-13
WP_000774504.1|3929578_3929869_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	92.7	2.8e-46
WP_001099713.1|3929865_3930228_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	95.7	4.3e-60
WP_000971071.1|3930224_3930365_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	2.5e-08
WP_001204791.1|3930450_3930834_+	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	83.3	4.4e-55
WP_000737275.1|3931022_3932105_-	porin OmpD	NA	Q1MVN1	Enterobacteria_phage	76.3	8.9e-154
WP_000839596.1|3932692_3932908_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_001717912.1|3932907_3933405_+	lysozyme	NA	A0A1B5FP97	Escherichia_phage	97.0	6.0e-89
WP_001228702.1|3933621_3933828_+	hypothetical protein	NA	H6WRZ6	Salmonella_phage	98.5	5.3e-31
WP_001139678.1|3933856_3934009_+	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	96.0	3.1e-20
WP_000079508.1|3934360_3934771_-	DUF1398 family protein	NA	C6ZCX4	Enterobacteria_phage	76.3	1.3e-52
WP_000105084.1|3934827_3935061_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	94.4	7.3e-21
WP_001717915.1|3936802_3937180_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	91.3	1.8e-40
WP_001717916.1|3937179_3937764_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.3	3.9e-103
WP_001717917.1|3937837_3939169_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	37.1	1.4e-20
WP_000767391.1|3939914_3940391_-	kinase inhibitor	NA	NA	NA	NA	NA
3939810:3939824	attR	GCTTTTTTATACTAA	NA	NA	NA	NA
WP_001612659.1|3940449_3941739_-	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	29.0	1.0e-18
>prophage 286
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	3948219	3949128	4943397		Streptococcus_phage(100.0%)	1	NA	NA
WP_001400532.1|3948219_3949128_-	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	31.1	1.4e-27
>prophage 287
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	3960098	3965090	4943397		Anomala_cuprea_entomopoxvirus(50.0%)	4	NA	NA
WP_000996092.1|3960098_3961835_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	29.8	2.3e-18
WP_000743444.1|3961827_3962823_-	secretion protein HlyD	NA	NA	NA	NA	NA
WP_001296991.1|3962825_3963497_-	DNA-binding transcriptional regulator CecR	NA	NA	NA	NA	NA
WP_001717923.1|3963725_3965090_+	ATP-dependent RNA helicase RhlE	NA	A0A1V0SBR7	Catovirus	31.8	1.5e-52
>prophage 288
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	3969480	3978467	4943397		Bacillus_phage(25.0%)	8	NA	NA
WP_001612679.1|3969480_3971631_+	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	26.0	1.8e-41
WP_001612685.1|3971658_3972621_+	DNA-binding protein YbiB	NA	NA	NA	NA	NA
WP_001612686.1|3972761_3973847_+	malate/lactate/ureidoglycolate dehydrogenase	NA	NA	NA	NA	NA
WP_000849301.1|3974075_3974336_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_000146357.1|3974600_3974867_-	C4-type zinc finger protein YbiI	NA	E5G6L7	Salmonella_phage	45.6	3.1e-07
WP_000990176.1|3974940_3975618_-	PKHD-type hydroxylase YbiX	NA	Q5GQB0	Synechococcus_phage	30.1	1.2e-18
WP_000430039.1|3975659_3977942_-	catecholate siderophore receptor Fiu	NA	NA	NA	NA	NA
WP_000710619.1|3978206_3978467_-	DUF1471 domain-containing protein	NA	A0A1B2ICL8	Erwinia_phage	51.0	1.6e-05
>prophage 289
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	3982007	3987232	4943397		Planktothrix_phage(33.33%)	7	NA	NA
WP_000569080.1|3982007_3982730_-	glutamine ABC transporter ATP-binding protein GlnQ	NA	G9BWD6	Planktothrix_phage	41.8	2.5e-35
WP_001159065.1|3982726_3983386_-	glutamine ABC transporter permease GlnP	NA	NA	NA	NA	NA
WP_001717928.1|3983524_3984271_-	glutamine ABC transporter substrate-binding protein GlnH	NA	NA	NA	NA	NA
WP_000100800.1|3984674_3985178_-	DNA starvation/stationary phase protection protein Dps	NA	A0A222YYG6	Streptomyces_phage	29.0	4.9e-06
WP_001295297.1|3985476_3986364_-	threonine/homoserine exporter RhtA	NA	NA	NA	NA	NA
WP_120795379.1|3986598_3986664_+	protein YliM	NA	NA	NA	NA	NA
WP_001295296.1|3986716_3987232_+	outer membrane protein OmpX	NA	H6WZM8	Escherichia_phage	33.8	1.1e-16
>prophage 290
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	3992229	4000565	4943397		Tupanvirus(33.33%)	6	NA	NA
WP_000961458.1|3992229_3993822_+	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.7	6.9e-62
WP_001612693.1|3994062_3995322_-	DUF1479 domain-containing protein	NA	NA	NA	NA	NA
WP_001612694.1|3995473_3996289_-	sugar-phosphatase YbiV	NA	NA	NA	NA	NA
WP_000209318.1|3996434_3998867_-	glycyl radical protein	NA	A0A076YHZ7	Citrobacter_phage	43.5	6.1e-09
WP_001612696.1|3998872_3999772_-	glycyl-radical enzyme activating protein	NA	NA	NA	NA	NA
WP_001612697.1|3999902_4000565_+	fructose-6-phosphate aldolase	NA	A0A0E3HJ81	Synechococcus_phage	33.6	5.7e-26
>prophage 291
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	4003883	4005755	4943397		Planktothrix_phage(100.0%)	1	NA	NA
WP_001400536.1|4003883_4005755_+	glutathione ABC transporter ATP-binding protein GsiA	NA	G9BWD6	Planktothrix_phage	29.7	4.0e-16
>prophage 292
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	4017090	4018293	4943397		Stx2-converting_phage(100.0%)	1	NA	NA
WP_000195961.1|4017090_4018293_+	serine-type D-Ala-D-Ala carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	48.0	8.2e-100
>prophage 293
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	4026859	4036009	4943397		Vibrio_phage(25.0%)	11	NA	NA
WP_001195231.1|4026859_4027117_-	glutaredoxin 1	NA	A0A2I7SAE2	Vibrio_phage	63.1	7.8e-24
WP_001612709.1|4027276_4027564_+	DUF1418 family protein	NA	NA	NA	NA	NA
WP_001612710.1|4027547_4028270_+	nitroreductase NfsA	NA	NA	NA	NA	NA
WP_065226457.1|4028330_4029233_+	30S ribosomal protein S6--L-glutamate ligase	NA	I3ULC9	Synechococcus_phage	34.0	4.8e-36
WP_000203025.1|4029320_4029797_+	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_001612712.1|4030147_4031260_+	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_000996010.1|4031354_4032488_+	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.0	1.4e-29
WP_032200979.1|4032497_4033451_+	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_001061658.1|4033447_4034293_+	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_001612714.1|4034352_4034841_+	YbjO family protein	NA	NA	NA	NA	NA
WP_001612715.1|4034881_4036009_+	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	28.0	1.8e-27
>prophage 294
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	4039345	4040074	4943397		Planktothrix_phage(100.0%)	1	NA	NA
WP_000027205.1|4039345_4040074_-	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.7	6.0e-29
>prophage 295
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	4043763	4044594	4943397		Roseobacter_phage(100.0%)	1	NA	NA
WP_001255167.1|4043763_4044594_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	30.0	5.7e-07
>prophage 296
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	4048181	4049900	4943397		Yellowstone_lake_phycodnavirus(100.0%)	1	NA	NA
WP_001717941.1|4048181_4049900_-	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.1	3.1e-31
>prophage 297
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	4060535	4084320	4943397	protease,tRNA	uncultured_Mediterranean_phage(16.67%)	16	NA	NA
WP_001612725.1|4060535_4062482_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.1	2.5e-37
WP_000410785.1|4062554_4062779_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
WP_000520781.1|4063101_4063422_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_000934041.1|4063452_4065729_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
WP_001040187.1|4066412_4066631_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_001612726.1|4066915_4067620_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001612727.1|4067661_4069383_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	25.2	2.9e-21
WP_001043606.1|4069383_4071150_-	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.3	5.4e-23
WP_001612728.1|4071272_4072238_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	1.1e-62
WP_000228473.1|4072782_4073277_+	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_001717944.1|4073411_4077506_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
WP_001295343.1|4077660_4078272_+	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_000067767.1|4078282_4079626_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.8	2.1e-80
WP_000886683.1|4079716_4081009_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
WP_001612731.1|4081247_4083692_+	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.7	1.5e-220
WP_000213098.1|4083702_4084320_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	60.6	5.0e-77
>prophage 298
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	4090630	4093845	4943397		Tetraselmis_virus(100.0%)	2	NA	NA
WP_000111043.1|4090630_4091371_-	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.5	8.0e-21
WP_001292812.1|4091562_4093845_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.4	1.3e-162
>prophage 299
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	4097943	4099032	4943397		Streptococcus_phage(100.0%)	1	NA	NA
WP_001612734.1|4097943_4099032_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	46.8	3.5e-81
>prophage 300
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	4104118	4108659	4943397		Bacillus_phage(100.0%)	3	NA	NA
WP_000167336.1|4104118_4104403_+	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	3.2e-10
WP_001612737.1|4104609_4106874_+	ComEC family protein	NA	NA	NA	NA	NA
WP_000551273.1|4106910_4108659_+	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	29.8	4.3e-57
>prophage 301
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	4123364	4134482	4943397	tRNA	Rhodobacter_phage(20.0%)	8	NA	NA
WP_001295932.1|4123364_4123913_+	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	7.0e-06
WP_001109487.1|4123939_4124587_+	hydroxyacylglutathione hydrolase GloC	NA	NA	NA	NA	NA
WP_001612744.1|4124808_4125999_-	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_024171461.1|4126183_4127257_-	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	55.1	1.0e-101
WP_000117881.1|4127858_4129259_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	36.1	5.3e-82
WP_001612745.1|4129427_4130630_-	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000193803.1|4130895_4133508_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.6	4.1e-19
WP_001090514.1|4133714_4134482_-	aliphatic sulfonates ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.6	1.7e-29
>prophage 302
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	4150405	4152313	4943397		Tupanvirus(100.0%)	1	NA	NA
WP_001717963.1|4150405_4152313_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.9e-54
>prophage 303
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	4164925	4166980	4943397		Bacillus_phage(100.0%)	1	NA	NA
WP_001612761.1|4164925_4166980_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.8	4.5e-21
>prophage 304
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	4171213	4171873	4943397	protease	uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000375136.1|4171213_4171873_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	4.0e-48
>prophage 305
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	4191160	4203416	4943397		Morganella_phage(20.0%)	13	NA	NA
WP_000066490.1|4191160_4191373_+	cold shock protein CspG	NA	A0A1W6JNX5	Morganella_phage	71.4	7.8e-22
WP_071524879.1|4191383_4191572_+	cold-shock protein	NA	NA	NA	NA	NA
WP_032201002.1|4191546_4191777_+	protein YmcE	NA	NA	NA	NA	NA
WP_001019197.1|4191766_4191940_+	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_001717981.1|4191988_4193062_-	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_072148431.1|4193133_4195878_-	TMAO reductase system sensor histidine kinase/response regulator TorS	NA	A0A1V0SGX0	Hokovirus	31.9	1.2e-37
WP_001717983.1|4195960_4196989_+	TMAO reductase system periplasmic protein TorT	NA	NA	NA	NA	NA
WP_001120120.1|4196961_4197654_-	two-component system response regulator TorR	NA	W8CYM9	Bacillus_phage	28.0	4.5e-18
WP_001717984.1|4197783_4198956_+	pentaheme c-type cytochrome TorC	NA	NA	NA	NA	NA
WP_001717985.1|4198955_4201502_+	trimethylamine-N-oxide reductase TorA	NA	A0A077SK27	Escherichia_phage	30.7	7.7e-71
WP_001717986.1|4201498_4202098_+	molecular chaperone TorD	NA	NA	NA	NA	NA
WP_000024560.1|4202190_4202496_-	chaperone modulator CbpM	NA	NA	NA	NA	NA
WP_001717987.1|4202495_4203416_-	curved DNA-binding protein	NA	A0A1V0SIM1	Klosneuvirus	43.0	4.2e-11
>prophage 306
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	4207714	4209989	4943397		Enterobacteria_phage(100.0%)	3	NA	NA
WP_001273658.1|4207714_4207888_+	general stress protein	NA	Q9KX95	Enterobacteria_phage	96.3	4.9e-06
WP_032201005.1|4208145_4209474_-	pyrimidine utilization transport protein G	NA	Q9KX94	Enterobacteria_phage	99.5	1.5e-235
WP_001028095.1|4209494_4209989_-	pyrimidine utilization flavin reductase protein F	NA	Q9KX93	Enterobacteria_phage	97.9	5.0e-51
>prophage 307
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	4226756	4227821	4943397		Cronobacter_phage(100.0%)	1	NA	NA
WP_000258770.1|4226756_4227821_+	phosphate starvation-inducible protein PhoH	NA	R4II13	Cronobacter_phage	76.7	8.1e-91
>prophage 308
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	4232466	4233300	4943397		Pelagibacter_phage(100.0%)	1	NA	NA
WP_001189321.1|4232466_4233300_-	curli production assembly/transport protein CsgG	NA	M1ICK2	Pelagibacter_phage	40.1	5.1e-40
>prophage 309
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	4237434	4237968	4943397		Red_sea_bream_iridovirus(100.0%)	1	NA	NA
WP_000857405.1|4237434_4237968_+	O-acetyl-ADP-ribose deacetylase	NA	Q71G61	Red_sea_bream_iridovirus	40.2	5.9e-26
>prophage 310
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	4247275	4248196	4943397		Morganella_phage(100.0%)	1	NA	NA
WP_001612800.1|4247275_4248196_-	LpxL/LpxP family Kdo(2)-lipid IV(A) lauroyl/palmitoleoyl acyltransferasee	NA	A0A1W6JP29	Morganella_phage	41.1	2.5e-56
>prophage 311
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	4252858	4253104	4943397		Salmonella_phage(100.0%)	1	NA	NA
WP_001217754.1|4252858_4253104_-	DNA damage-inducible protein I	NA	H6WRY5	Salmonella_phage	48.7	7.7e-13
>prophage 312
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	4268985	4269927	4943397		Brevibacillus_phage(100.0%)	1	NA	NA
WP_001612811.1|4268985_4269927_+	flagellar assembly peptidoglycan hydrolase FlgJ	NA	S5M633	Brevibacillus_phage	31.3	3.6e-10
>prophage 313
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	4282284	4283466	4943397		Trichoplusia_ni_ascovirus(50.0%)	2	NA	NA
WP_001008535.1|4282284_4283019_+	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	34.1	1.3e-15
WP_000103754.1|4283229_4283466_+	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	45.2	1.5e-10
>prophage 314
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	4286738	4288381	4943397		Pseudomonas_phage(50.0%)	2	NA	NA
WP_001257000.1|4286738_4287380_+	dTMP kinase	NA	Q2Z0N0	Pseudomonas_phage	36.9	4.5e-28
WP_001612817.1|4287376_4288381_+	DNA polymerase III subunit delta'	NA	A0A1U9WR94	Streptococcus_virus	30.9	2.9e-05
>prophage 315
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	4300704	4300962	4943397		Erwinia_phage(100.0%)	1	NA	NA
WP_000800153.1|4300704_4300962_+	multiple stress resistance protein BhsA	NA	A0A1B2IFR9	Erwinia_phage	37.1	9.6e-06
>prophage 316
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	4308251	4311974	4943397		Planktothrix_phage(50.0%)	4	NA	NA
WP_001033694.1|4308251_4308953_+	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	40.3	1.1e-35
WP_024171465.1|4308952_4310197_+	lipoprotein-releasing ABC transporter permease subunit LolE	NA	NA	NA	NA	NA
WP_000291292.1|4310225_4311137_+	N-acetylglucosamine kinase	NA	NA	NA	NA	NA
WP_000952736.1|4311152_4311974_+	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	35.6	5.6e-23
>prophage 317
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	4315415	4374454	4943397	holin,terminase,tRNA,integrase,protease,lysis,tail,portal,transposase	Enterobacteria_phage(47.73%)	69	4310514:4310528	4316990:4317004
4310514:4310528	attL	GATCGCGATGTACGC	NA	NA	NA	NA
WP_000074983.1|4315415_4316534_-|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z04	Phage_21	44.2	7.7e-84
WP_000003742.1|4316502_4316772_-	excisionase	NA	NA	NA	NA	NA
WP_099490879.1|4319349_4320558_+|transposase	IS4 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	99.8	8.8e-235
4316990:4317004	attR	GCGTACATCGCGATC	NA	NA	NA	NA
WP_001083283.1|4320735_4320927_-|lysis	lysis protein YdfD	lysis	NA	NA	NA	NA
WP_000449196.1|4320923_4321112_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_000202162.1|4321670_4321892_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394538.1|4321881_4322256_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001171936.1|4322278_4322497_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379589.1|4322656_4322812_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	8.8e-07
WP_023486593.1|4323004_4323412_-	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	45.4	5.5e-24
WP_000476994.1|4323489_4323717_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_001718103.1|4323700_4324222_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000054487.1|4324202_4325168_+	hypothetical protein	NA	U5P0A0	Shigella_phage	60.8	2.6e-56
WP_001718104.1|4325208_4325631_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	91.0	1.4e-62
WP_032200795.1|4325883_4326783_+	SMEK domain-containing protein	NA	NA	NA	NA	NA
WP_001718106.1|4327097_4327751_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_024171483.1|4327763_4328459_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000967408.1|4329144_4329357_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	94.3	1.1e-26
WP_000980987.1|4329573_4329825_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032200798.1|4329891_4330170_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	46.9	3.7e-11
WP_001718109.1|4330171_4331230_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	48.6	1.1e-90
WP_001718110.1|4331230_4331596_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	66.7	1.6e-38
WP_001718111.1|4331592_4332282_+	phage antitermination Q family protein	NA	I6PDF8	Cronobacter_phage	50.6	2.1e-60
WP_000839567.1|4333094_4333310_+|holin	holin	holin	M1FN85	Enterobacteria_phage	97.2	6.9e-34
WP_001718112.1|4333314_4333659_+	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	95.2	2.2e-37
WP_000370545.1|4333624_4333897_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001718113.1|4334002_4334536_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	94.3	5.8e-98
WP_157186075.1|4335099_4335237_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001228685.1|4335458_4335644_+	hypothetical protein	NA	A0A0P0ZE50	Stx2-converting_phage	80.3	6.4e-20
WP_001595003.1|4335727_4336090_+	hypothetical protein	NA	A5LH85	Enterobacteria_phage	98.3	3.4e-65
WP_000373425.1|4336543_4337038_+	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	100.0	9.9e-84
WP_032200799.1|4337037_4339140_+|terminase	phage terminase large subunit family protein	terminase	A0A291AWY5	Escherichia_phage	97.1	0.0e+00
WP_001718117.1|4339136_4339349_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	91.4	1.1e-28
WP_032200800.1|4339348_4340854_+|portal	phage portal protein	portal	S5MW34	Escherichia_phage	89.0	1.4e-258
WP_077841550.1|4340798_4342859_+|protease	Clp protease ClpP	protease	A0A291AWT6	Escherichia_phage	93.1	0.0e+00
WP_001097050.1|4342945_4343269_+	DUF2190 family protein	NA	A0A291AWX2	Escherichia_phage	100.0	8.5e-52
WP_001283153.1|4343261_4343537_+	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
WP_000677097.1|4343548_4344127_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	99.5	5.5e-102
WP_001079419.1|4344123_4344525_+|tail	tail protein	tail	A5LH34	Enterobacteria_phage	99.2	1.9e-72
WP_001718121.1|4344535_4345279_+	cell motility protein	NA	A5LH35	Enterobacteria_phage	98.8	4.3e-131
WP_001429942.1|4345339_4345726_+|tail	phage minor tail protein G	tail	K7PLV8	Enterobacteria_phage	99.2	2.8e-65
WP_001161009.1|4345734_4346064_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_001718122.1|4346035_4349101_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	98.7	0.0e+00
WP_000447256.1|4349100_4349430_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	99.1	3.9e-60
WP_001718123.1|4349439_4350138_+|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	99.1	4.3e-133
WP_001718124.1|4350142_4350886_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	98.4	7.0e-150
WP_001531692.1|4350783_4351431_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	97.7	7.8e-113
WP_001718126.1|4351491_4354887_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	90.1	0.0e+00
WP_001228270.1|4354954_4355554_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	88.9	7.7e-99
WP_001718127.1|4355608_4357438_+|tail	phage tail fiber protein	tail	A0A2D1UII2	Escherichia_phage	77.0	3.2e-47
WP_071586406.1|4357732_4357831_+|tail	phage tail protein	tail	K7PMH7	Enterobacteria_phage	78.1	1.2e-06
WP_000239880.1|4357885_4358554_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001394135.1|4358610_4358877_+|tail	caudovirales tail fiber assembly family protein	tail	K7PMH7	Enterobacteria_phage	81.7	9.2e-20
WP_000799406.1|4359108_4359972_-	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000531594.1|4359955_4361092_-	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
WP_000359447.1|4361341_4362571_+	peptidase T	NA	NA	NA	NA	NA
WP_001718130.1|4362716_4363838_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_000735413.1|4363913_4365374_-	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_001265481.1|4365373_4366045_-	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_032200804.1|4366214_4367585_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	7.2e-108
WP_001297479.1|4367588_4368230_-	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_001353282.1|4368265_4369372_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_000476093.1|4369425_4369887_-	phosphatase NudJ	NA	NA	NA	NA	NA
WP_024171487.1|4369896_4370550_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000444488.1|4370721_4371972_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	96.3	3.2e-22
WP_032149907.1|4372074_4372398_-	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	63.6	7.5e-40
WP_032082692.1|4372934_4373045_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000373095.1|4373097_4373502_-	DUF1398 domain-containing protein	NA	NA	NA	NA	NA
WP_000332303.1|4373722_4374454_-	DNA-binding transcriptional repressor BluR	NA	Q9EYF2	Enterobacteria_phage	50.5	2.7e-53
>prophage 318
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	4380322	4382644	4943397		Escherichia_phage(100.0%)	1	NA	NA
WP_001718135.1|4380322_4382644_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	43.8	3.2e-92
>prophage 319
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	4391177	4392865	4943397		Morganella_phage(50.0%)	2	NA	NA
WP_000897378.1|4391177_4391597_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	62.1	6.9e-38
WP_000457622.1|4391596_4392865_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	83.4	1.0e-209
>prophage 320
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	4410983	4411742	4943397		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_000173324.1|4410983_4411742_-	ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	29.7	1.5e-14
>prophage 321
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	4427640	4430392	4943397		uncultured_Caudovirales_phage(50.0%)	2	NA	NA
WP_001033352.1|4427640_4429320_-	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	23.6	1.3e-23
WP_001298109.1|4429444_4430392_-	ribose-phosphate pyrophosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.8	3.9e-44
>prophage 322
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	4433528	4440332	4943397		Pseudomonas_phage(33.33%)	9	NA	NA
WP_000804726.1|4433528_4434611_+	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	41.6	1.5e-07
WP_000456467.1|4434610_4435444_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_001612854.1|4435440_4435833_+	SirB family protein	NA	NA	NA	NA	NA
WP_001257044.1|4435836_4436646_+	tetratricopeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_000811065.1|4436681_4437536_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	39.0	8.3e-46
WP_000170954.1|4437683_4437791_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000170963.1|4438219_4438327_-	small toxic polypeptide LdrB	NA	NA	NA	NA	NA
WP_001301956.1|4438731_4439832_-	sodium-potassium/proton antiporter ChaA	NA	NA	NA	NA	NA
WP_001146444.1|4440101_4440332_+	putative cation transport regulator ChaB	NA	A5IZT6	Spodoptera_litura_granulovirus	40.0	8.5e-06
>prophage 323
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	4451464	4461474	4943397		Escherichia_phage(25.0%)	10	NA	NA
WP_001612858.1|4451464_4453003_+	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	40.8	4.8e-20
WP_000571681.1|4452999_4453710_+	nitrate reductase molybdenum cofactor assembly chaperone	NA	NA	NA	NA	NA
WP_001160110.1|4453709_4454387_+	respiratory nitrate reductase subunit gamma	NA	NA	NA	NA	NA
WP_000555853.1|4455111_4455954_-	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	47.6	3.7e-14
WP_001612859.1|4456003_4456462_-	YchJ family protein	NA	NA	NA	NA	NA
WP_001226476.1|4456574_4457480_+	patatin-like phospholipase RssA	NA	NA	NA	NA	NA
WP_000193447.1|4457571_4458585_+	two-component system response regulator RssB	NA	NA	NA	NA	NA
WP_000718995.1|4458786_4459695_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	46.8	1.4e-59
WP_001287378.1|4459838_4460252_-	DNA-binding transcriptional regulator H-NS	NA	NA	NA	NA	NA
WP_000068079.1|4460856_4461474_+	thymidine kinase	NA	A0A0A0YP64	Citrobacter_phage	53.6	1.3e-53
>prophage 324
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	4469883	4471898	4943397		Planktothrix_phage(50.0%)	2	NA	NA
WP_001612864.1|4469883_4470897_+	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppD	NA	G9BWD6	Planktothrix_phage	31.7	2.0e-14
WP_000994905.1|4470893_4471898_+	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppF	NA	G3M9Y6	Bacillus_virus	30.7	2.3e-15
>prophage 325
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	4483552	4486510	4943397		Acinetobacter_phage(100.0%)	2	NA	NA
WP_001718161.1|4483552_4484911_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	41.2	3.9e-37
WP_000763511.1|4484914_4486510_-	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	3.8e-52
>prophage 326
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	4493478	4498770	4943397	protease	Chrysochromulina_ericina_virus(33.33%)	4	NA	NA
WP_000559268.1|4493478_4494237_-	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.9	6.7e-07
WP_000422045.1|4494456_4495506_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
WP_001031530.1|4495541_4495793_-	YciN family protein	NA	NA	NA	NA	NA
WP_001295576.1|4496172_4498770_+	type I DNA topoisomerase	NA	A0A2K9L1Q2	Tupanvirus	34.5	7.0e-88
>prophage 327
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	4503693	4504284	4943397		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001176295.1|4503693_4504284_-	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	48.9	7.7e-43
>prophage 328
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	4512100	4517666	4943397		Lactococcus_phage(50.0%)	5	NA	NA
WP_001612906.1|4512100_4514035_-	exoribonuclease II	NA	Q0GXV6	Lactococcus_phage	27.2	5.3e-32
WP_001718172.1|4514102_4515230_-	CMD domain-containing protein	NA	NA	NA	NA	NA
WP_000506490.1|4515373_4516162_-	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
WP_001612907.1|4516426_4516792_-	DUF559 domain-containing protein	NA	NA	NA	NA	NA
WP_000573412.1|4516859_4517666_-	peptide ABC transporter ATP-binding protein SapF	NA	G3M9Y6	Bacillus_virus	28.6	7.2e-15
>prophage 329
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	4530581	4531847	4943397		Klosneuvirus(100.0%)	1	NA	NA
WP_001612910.1|4530581_4531847_+	4-aminobutyrate transaminase	NA	A0A1V0SKB7	Klosneuvirus	26.8	7.0e-25
>prophage 330
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	4536024	4539658	4943397	transposase	Bluetongue_virus(50.0%)	3	NA	NA
WP_099490915.1|4536024_4537233_+|transposase	IS4-like element ISVsa5 family transposase	transposase	Q9E8P4	Bluetongue_virus	99.5	7.5e-234
WP_000428546.1|4537746_4538340_+	tetracyline resistance-associated transcriptional repressor TetC	NA	NA	NA	NA	NA
WP_001089068.1|4538452_4539658_-	tetracycline efflux MFS transporter Tet(B)	NA	A0A2H4UVM2	Bodo_saltans_virus	24.4	3.0e-09
>prophage 331
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	4543748	4544957	4943397	transposase	uncultured_marine_virus(100.0%)	1	NA	NA
WP_001352368.1|4543748_4544957_-|transposase	IS4-like element ISVsa5 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	100.0	1.8e-235
>prophage 332
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	4555003	4556086	4943397		Planktothrix_phage(100.0%)	1	NA	NA
WP_001612920.1|4555003_4556086_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.7	9.6e-23
>prophage 333
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	4574249	4574765	4943397		Streptococcus_phage(100.0%)	1	NA	NA
WP_000945005.1|4574249_4574765_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	42.8	2.4e-24
>prophage 334
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	4581092	4634859	4943397	holin,terminase,integrase,tail,tRNA	Escherichia_phage(74.14%)	66	4578480:4578495	4599950:4599965
4578480:4578495	attL	AGTAAAATAATCAACA	NA	NA	NA	NA
WP_000628065.1|4581092_4582325_-	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
WP_000387388.1|4582579_4583563_+	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_000123745.1|4584040_4585414_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_001157377.1|4585542_4586478_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	100.0	2.8e-148
WP_024171493.1|4586529_4587765_-|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	98.3	6.7e-238
WP_000079604.1|4587766_4587982_-	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_001302840.1|4588081_4588270_-	DUF1187 family protein	NA	A0A0U2QL97	Escherichia_phage	98.4	5.5e-27
WP_000166322.1|4588512_4589346_-	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	66.8	7.2e-95
WP_001718192.1|4589338_4592014_-	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	81.7	0.0e+00
WP_001594001.1|4592112_4592388_-	phage protein	NA	A0A0U2QW85	Escherichia_phage	96.7	2.3e-42
WP_001594002.1|4592462_4592639_-	phage protein	NA	A0A0U2SHB5	Escherichia_phage	87.9	1.5e-23
WP_000560220.1|4592632_4592854_-	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	100.0	6.2e-38
WP_001594003.1|4593274_4593427_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	55.3	3.5e-08
WP_000233319.1|4593859_4594279_-	helix-turn-helix domain-containing protein	NA	A0A2I6PIE7	Escherichia_phage	46.5	5.5e-19
WP_001072340.1|4594358_4594613_+	hypothetical protein	NA	A0A2I6PIE5	Escherichia_phage	63.0	5.7e-19
WP_001594005.1|4594609_4595032_+	phage protein	NA	A0A0U2RXZ9	Escherichia_phage	94.3	7.7e-69
WP_001718193.1|4595044_4595341_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024171494.1|4595341_4595593_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001684845.1|4595882_4596791_+	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	90.1	2.2e-97
WP_001718195.1|4596822_4597245_+	hypothetical protein	NA	A0A0U2JGJ0	Escherichia_phage	94.3	5.1e-73
WP_001353252.1|4597274_4597670_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	53.6	3.5e-31
WP_001353251.1|4597666_4597963_+	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	94.7	2.0e-47
WP_001017772.1|4597959_4598244_+	DUF4752 family protein	NA	A0A088CD82	Shigella_phage	80.9	2.9e-35
WP_000935426.1|4598343_4598556_+	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	88.6	3.7e-32
WP_001033793.1|4598594_4599149_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001718196.1|4599145_4600078_-	hypothetical protein	NA	NA	NA	NA	NA
4599950:4599965	attR	AGTAAAATAATCAACA	NA	NA	NA	NA
WP_000018421.1|4600447_4600660_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	92.9	8.1e-27
WP_001594015.1|4601126_4601726_+	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	92.5	7.7e-107
WP_001594016.1|4601725_4602016_+	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	85.4	3.1e-45
WP_001594017.1|4602012_4602555_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	76.8	8.9e-78
WP_000833653.1|4604060_4604213_+	DUF3927 family protein	NA	NA	NA	NA	NA
WP_001297664.1|4604299_4604692_+|holin	holin	holin	Q9MBZ5	Enterobacteria_phage	78.5	3.4e-47
WP_000950577.1|4604681_4604957_+|holin	phage holin family protein	holin	Q9MBZ4	Enterobacteria_phage	96.7	7.2e-44
WP_001718205.1|4604959_4605337_+	M15 family metallopeptidase	NA	Q9MBZ3	Enterobacteria_phage	97.6	3.9e-64
WP_001353217.1|4605351_4605534_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001291088.1|4605938_4606730_+	ParB N-terminal domain-containing protein	NA	R4TG31	Halovirus	40.2	1.7e-48
WP_001204026.1|4606722_4607655_+	hypothetical protein	NA	A0A1B1INP7	uncultured_Mediterranean_phage	54.5	5.4e-83
WP_000126790.1|4607632_4607842_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000089436.1|4607845_4608937_+	hypothetical protein	NA	A0A0U2RXW9	Escherichia_phage	90.8	4.3e-148
WP_000021156.1|4608926_4610255_+|terminase	terminase	terminase	A0A0U2JTW9	Escherichia_phage	98.6	3.2e-262
WP_001718207.1|4610273_4611710_+	DUF1073 domain-containing protein	NA	A0A0U2S5X9	Escherichia_phage	95.8	5.7e-265
WP_001507252.1|4611768_4612488_+	hypothetical protein	NA	A0A0U2I1R8	Escherichia_phage	97.9	2.3e-134
WP_001718208.1|4612468_4613791_+	DUF2213 domain-containing protein	NA	A0A0U2QW61	Escherichia_phage	96.1	5.0e-191
WP_001353212.1|4613783_4614401_+	hypothetical protein	NA	A0A0U2S600	Escherichia_phage	99.0	8.5e-117
WP_001272372.1|4614415_4615444_+	hypothetical protein	NA	A0A0U2QQI2	Escherichia_phage	99.1	1.6e-189
WP_000780863.1|4615501_4615972_+	hypothetical protein	NA	A0A0U2SAX6	Escherichia_phage	99.4	5.5e-84
WP_000175375.1|4615971_4616412_+	hypothetical protein	NA	A0A0U2S646	Escherichia_phage	98.6	2.7e-77
WP_001718209.1|4616408_4616849_+	hypothetical protein	NA	A0A0U2RTA8	Escherichia_phage	94.5	1.9e-78
WP_001139505.1|4616835_4617780_+	hypothetical protein	NA	A0A0U2SH76	Escherichia_phage	99.7	1.3e-172
WP_001718210.1|4617779_4619117_+	hypothetical protein	NA	A0A0U2KD19	Escherichia_phage	96.2	2.6e-243
WP_000613368.1|4619140_4619572_+	hypothetical protein	NA	A0A0U2S616	Escherichia_phage	100.0	3.3e-75
WP_000703984.1|4619568_4620186_+	hypothetical protein	NA	A0A0U2S634	Escherichia_phage	75.5	2.1e-83
WP_000918397.1|4620250_4622326_+	hypothetical protein	NA	A0A0U2QV45	Escherichia_phage	42.8	2.1e-127
WP_000056327.1|4622329_4622998_+	hypothetical protein	NA	A0A0U2JGI7	Escherichia_phage	97.3	4.0e-120
WP_000209262.1|4622994_4623261_+	hypothetical protein	NA	A0A0U2JGJ3	Escherichia_phage	100.0	9.8e-46
WP_001271165.1|4623260_4624268_+	hypothetical protein	NA	A0A0U2QL72	Escherichia_phage	91.3	4.7e-181
WP_000063619.1|4624267_4624981_+	hypothetical protein	NA	A0A0U2JTX5	Escherichia_phage	95.4	2.8e-124
WP_001261327.1|4625231_4625579_+	hypothetical protein	NA	A0A0U2I1S2	Escherichia_phage	97.4	2.2e-61
WP_000426903.1|4625728_4626889_+	hypothetical protein	NA	A0A1S5SAB0	Streptococcus_phage	30.0	4.9e-33
WP_072148422.1|4626929_4628156_+	hypothetical protein	NA	A0A0U2RJZ0	Escherichia_phage	98.5	4.4e-226
WP_001199727.1|4628139_4628766_+	hypothetical protein	NA	A0A0U2RK03	Escherichia_phage	99.0	1.7e-120
WP_001718212.1|4628762_4630148_+	hypothetical protein	NA	A0A0U2SAV1	Escherichia_phage	90.2	1.9e-241
WP_001718213.1|4630150_4630696_+|tail	caudovirales tail fiber assembly family protein	tail	Q8W612	Enterobacteria_phage	78.6	2.4e-78
WP_032200929.1|4630719_4632546_+|tail	tail fiber protein	tail	Q8W611	Enterobacteria_phage	98.2	1.9e-55
WP_001295593.1|4633150_4633585_-	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.4e-28
WP_000837924.1|4633725_4634859_-	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	58.8	8.3e-118
>prophage 335
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	4639818	4640808	4943397		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_000762229.1|4639818_4640808_-	D-lactate dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	44.0	2.5e-70
>prophage 336
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	4669795	4673698	4943397		Klosneuvirus(100.0%)	1	NA	NA
WP_001718243.1|4669795_4673698_+	ATP-dependent RNA helicase HrpA	NA	A0A1V0SIV3	Klosneuvirus	29.5	2.2e-53
>prophage 337
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	4677637	4678586	4943397		Escherichia_phage(50.0%)	2	NA	NA
WP_001340313.1|4677637_4678168_+	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	44.9	3.1e-19
WP_000731833.1|4678412_4678586_+	periplasmic protein	NA	A0A0R6PKG1	Moraxella_phage	67.4	4.4e-07
>prophage 338
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	4690393	4700567	4943397	transposase	Escherichia_phage(20.0%)	10	NA	NA
WP_024194360.1|4690393_4691602_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	92.0	1.1e-205
WP_072148478.1|4691641_4692856_-	BenE family transporter YdcO	NA	NA	NA	NA	NA
WP_000429147.1|4692908_4693445_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001718255.1|4693517_4695479_+	23S rRNA 5-hydroxycytidine C2501 synthase	NA	Q6DW11	Phage_TP	28.9	5.4e-24
WP_000494244.1|4695570_4695801_-	YncJ family protein	NA	NA	NA	NA	NA
WP_001612987.1|4696022_4696199_+	type II toxin-antitoxin system mRNA interferase toxin HicA	NA	A0A0M3LQ86	Mannheimia_phage	56.1	8.0e-12
WP_001270286.1|4696244_4696661_+	type II toxin-antitoxin system antitoxin HicB	NA	F1C593	Cronobacter_phage	57.8	6.3e-31
WP_001718258.1|4696739_4698146_+	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_001612991.1|4698390_4699536_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000220411.1|4699553_4700567_+	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	37.9	2.1e-27
>prophage 339
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	4707699	4709802	4943397		Salmonella_phage(100.0%)	1	NA	NA
WP_001612994.1|4707699_4709802_-	TonB-dependent receptor	NA	A0A1B0VCF0	Salmonella_phage	65.6	1.1e-134
>prophage 340
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	4721933	4728768	4943397	transposase	uncultured_Caudovirales_phage(100.0%)	5	NA	NA
WP_157774301.1|4721933_4726127_+	type IV secretion protein Rhs	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	43.1	5.4e-21
WP_001613027.1|4726127_4726652_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001717795.1|4726712_4726877_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099490919.1|4727006_4728143_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_024171500.1|4728120_4728768_+	RHS repeat-associated core domain-containing protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	48.9	4.1e-13
>prophage 341
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	4735008	4736553	4943397		Escherichia_phage(100.0%)	1	NA	NA
WP_001718285.1|4735008_4736553_-	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	39.2	6.4e-20
>prophage 342
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	4744841	4745942	4943397		Enterobacteria_phage(100.0%)	1	NA	NA
WP_001613040.1|4744841_4745942_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	65.1	1.6e-137
>prophage 343
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	4751954	4753395	4943397		Escherichia_phage(50.0%)	2	NA	NA
WP_001613048.1|4751954_4752239_-	HigA family addiction module antidote protein	NA	A0A2L1IV52	Escherichia_phage	51.1	1.5e-20
WP_000642406.1|4752384_4753395_-	alcohol dehydrogenase AdhP	NA	A0A2K9L339	Tupanvirus	25.3	9.6e-25
>prophage 344
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	4756668	4758574	4943397		Planktothrix_phage(100.0%)	2	NA	NA
WP_001613053.1|4756668_4757595_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.6	7.0e-14
WP_001613054.1|4757587_4758574_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.1	1.7e-18
>prophage 345
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	4762890	4766697	4943397		Klosneuvirus(50.0%)	2	NA	NA
WP_072148463.1|4762890_4765290_-	oxygen-sensing cyclic-di-GMP phosphodiesterase	NA	A0A1V0SL97	Klosneuvirus	22.0	1.6e-09
WP_000426272.1|4765314_4766697_-	diguanylate cyclase DosC	NA	G3MA91	Bacillus_virus	31.5	2.0e-17
>prophage 346
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	4771971	4778907	4943397		Powai_lake_megavirus(50.0%)	3	NA	NA
WP_072148476.1|4771971_4774767_-	insulinase family protein	NA	A0A167R9K4	Powai_lake_megavirus	24.2	1.2e-19
WP_001613062.1|4774811_4777184_-	TonB-dependent receptor plug domain-containing protein	NA	NA	NA	NA	NA
WP_000628551.1|4777221_4778907_-	ABC transporter ATP-binding protein/permease	NA	W8CYL7	Bacillus_phage	23.3	2.2e-10
>prophage 347
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	4795516	4796917	4943397		Escherichia_phage(100.0%)	1	NA	NA
WP_032149973.1|4795516_4796917_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	49.8	1.6e-107
>prophage 348
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	4800504	4801713	4943397	transposase	uncultured_marine_virus(100.0%)	1	NA	NA
WP_099490879.1|4800504_4801713_+|transposase	IS4 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	99.8	8.8e-235
>prophage 349
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	4805678	4807214	4943397		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001613077.1|4805678_4807214_+	autoinducer 2 ABC transporter ATP-binding protein LsrA	NA	A0A2H4PQG7	Staphylococcus_phage	30.4	9.8e-21
>prophage 350
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	4815085	4816504	4943397		Bacillus_phage(100.0%)	1	NA	NA
WP_001551135.1|4815085_4816504_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	36.1	1.4e-18
>prophage 351
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	4824249	4826379	4943397		Streptococcus_phage(50.0%)	3	NA	NA
WP_000091199.1|4824249_4824633_+	MDR efflux pump AcrAB transcriptional activator MarA	NA	D0R0F8	Streptococcus_phage	32.3	4.7e-09
WP_000803526.1|4824664_4824883_+	multiple antibiotic resistance protein MarB	NA	NA	NA	NA	NA
WP_001718317.1|4824939_4826379_-	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	25.7	6.3e-30
>prophage 352
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	4835365	4836256	4943397		Bacillus_phage(100.0%)	1	NA	NA
WP_001613095.1|4835365_4836256_-	diguanylate cyclase DgcZ	NA	A0A127AWB9	Bacillus_phage	37.0	3.1e-19
>prophage 353
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	4841621	4883457	4943397	tail,lysis,integrase,transposase	Enterobacteria_phage(29.03%)	49	4841185:4841198	4874317:4874330
4841185:4841198	attL	CTGACGCAGATTGC	NA	NA	NA	NA
WP_000214712.1|4841621_4841825_+	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
WP_001613099.1|4841860_4843321_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	4.3e-42
WP_001613100.1|4843410_4844694_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_001593356.1|4845237_4845819_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.3	2.5e-102
WP_001352368.1|4845915_4847124_-|transposase	IS4-like element ISVsa5 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	100.0	1.8e-235
WP_000738423.1|4848025_4848319_+	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	91.8	2.0e-44
WP_001228695.1|4848409_4848592_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_001135280.1|4848808_4849306_-	lysozyme	NA	M1FJA0	Enterobacteria_phage	97.6	1.1e-90
WP_000839561.1|4849305_4849521_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	95.8	5.9e-33
WP_001348108.1|4849772_4850147_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000506937.1|4850318_4850747_-	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
WP_000562553.1|4851113_4851245_-	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	100.0	3.7e-06
WP_000762868.1|4852144_4852966_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	58.6	2.1e-78
WP_000904112.1|4852962_4853337_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	8.4e-35
WP_001265040.1|4853349_4854399_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	1.1e-108
WP_011478175.1|4854400_4854679_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	46.9	1.3e-11
WP_024171509.1|4854846_4855059_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	96.9	5.2e-26
WP_122083109.1|4855103_4855211_+	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	100.0	3.8e-09
WP_001718323.1|4855722_4856922_+	MFS transporter	NA	NA	NA	NA	NA
WP_000957771.1|4856933_4857626_+	calcium transporter ChaC	NA	NA	NA	NA	NA
WP_000019008.1|4857622_4858504_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000625668.1|4858634_4859912_-	DUF2254 domain-containing protein	NA	NA	NA	NA	NA
WP_001676522.1|4859975_4861973_-	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	26.2	3.3e-21
WP_001151151.1|4862313_4862736_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	88.5	4.8e-63
WP_001262352.1|4862776_4863847_-	hypothetical protein	NA	A0A088CD36	Shigella_phage	64.6	4.7e-62
WP_000693836.1|4863918_4864344_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000391949.1|4864327_4864609_-	hypothetical protein	NA	K7PHA1	Enterobacteria_phage	72.6	8.5e-24
WP_000362155.1|4864709_4865129_+	hypothetical protein	NA	K7PK07	Enterobacteria_phage	65.1	8.8e-25
WP_000379589.1|4865394_4865550_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	8.8e-07
WP_001171928.1|4865709_4865925_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001331024.1|4865911_4866064_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001331023.1|4866464_4866653_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001083273.1|4866649_4866841_+|lysis	lysis protein YdfD	lysis	NA	NA	NA	NA
WP_000048286.1|4866934_4869406_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.7	1.5e-58
WP_001296941.1|4869493_4869730_+	excisionase family protein	NA	S4TND0	Salmonella_phage	50.7	6.1e-15
WP_000876976.1|4869764_4871045_+|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	62.6	1.0e-156
WP_001389342.1|4871046_4871175_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001613128.1|4871232_4872252_-	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	25.9	2.2e-16
WP_001613129.1|4872263_4873478_-	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.8e-46
WP_001613130.1|4873683_4874010_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	1.7e-23
WP_000705197.1|4874144_4874486_+	DUF1283 family protein	NA	NA	NA	NA	NA
4874317:4874330	attR	GCAATCTGCGTCAG	NA	NA	NA	NA
WP_001138584.1|4874520_4875081_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_001321287.1|4875083_4875794_-	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001295396.1|4875901_4876207_+	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_001613131.1|4876405_4878832_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.2	1.3e-213
WP_072148439.1|4878892_4881316_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	2.2e-208
WP_000213028.1|4881326_4881944_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_001613133.1|4881945_4882800_+	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000148698.1|4882842_4883457_+	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	1.1e-28
>prophage 354
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	4901217	4902519	4943397		Bacillus_phage(100.0%)	1	NA	NA
WP_000732487.1|4901217_4902519_+	two-component system sensor histidine kinase RstB	NA	W8CYF6	Bacillus_phage	23.9	7.2e-17
>prophage 355
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	4912414	4914226	4943397		Vaccinia_virus(100.0%)	1	NA	NA
WP_023308011.1|4912414_4914226_-	beta-glucuronidase	NA	B9U1V4	Vaccinia_virus	99.5	0.0e+00
>prophage 356
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	4934109	4935384	4943397	tRNA	Cronobacter_phage(100.0%)	1	NA	NA
WP_001295400.1|4934109_4935384_-|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	41.4	8.8e-84
>prophage 357
NZ_CP024223	Escherichia coli O169:H41 strain 2014EL-1345-2 chromosome, complete genome	4943397	4942293	4942815	4943397		Salmonella_phage(100.0%)	1	NA	NA
WP_001296937.1|4942293_4942815_-	superoxide dismutase [Cu-Zn] SodC2	NA	Q9MC02	Salmonella_phage	55.7	7.8e-47
>prophage 1
NZ_CP024226	Escherichia coli O169:H41 strain 2014EL-1345-2 plasmid unnamed3	85864	4847	11731	85864		Vibrio_phage(16.67%)	8	NA	NA
WP_000086153.1|4847_5531_-	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	37.9	5.1e-30
WP_001134370.1|5915_6842_-	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
WP_000618110.1|7236_7485_+	DinI-like family protein	NA	Q2A098	Sodalis_phage	48.0	1.9e-14
WP_000109071.1|7481_7919_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	48.4	8.3e-26
WP_000457515.1|7918_9190_+	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	60.4	2.2e-143
WP_000587689.1|9393_10020_+	ParA family plasmid-partitioning AAA ATPase	NA	E5FFJ3	Burkholderia_phage	31.1	2.0e-17
WP_005015281.1|10139_10319_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000239590.1|10855_11731_+	class A extended-spectrum beta-lactamase CTX-M-15	NA	A0A1B0VBP7	Salmonella_phage	82.4	1.1e-125
>prophage 1
NZ_CP024227	Escherichia coli O169:H41 strain 2014EL-1345-2 plasmid unnamed4, complete sequence	145086	54760	117138	145086	integrase,transposase	Salmonella_phage(18.75%)	47	48006:48019	62617:62630
48006:48019	attL	CTGCGTCTGAGTCA	NA	NA	NA	NA
WP_001717448.1|54760_55501_+|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	1.6e-24
WP_023486339.1|57469_58447_-	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	59.2	6.1e-101
WP_000766063.1|60496_60793_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001595119.1|60896_61223_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	48.9	1.6e-18
WP_001595120.1|61219_61471_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001595122.1|62024_62891_+	ParA family protein	NA	NA	NA	NA	NA
62617:62630	attR	TGACTCAGACGCAG	NA	NA	NA	NA
WP_001595123.1|62890_63922_+	ParB/RepB/Spo0J family partition protein	NA	S5WII0	Leptospira_phage	26.6	7.5e-09
WP_032159708.1|63945_64359_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071600071.1|64418_64634_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001595125.1|64717_65992_-	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	63.3	5.2e-153
WP_001595126.1|65991_66414_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	52.4	1.6e-29
WP_001595131.1|68131_68479_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	99.1	4.8e-61
WP_001595132.1|70750_71059_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001413878.1|71573_71771_-	ANR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001595134.1|71968_72766_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_099490938.1|75015_75678_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001595151.1|77039_77600_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	87.1	1.9e-51
WP_001717584.1|77602_80572_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	66.2	0.0e+00
WP_000766063.1|80785_81082_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157757767.1|83023_85459_-	CS6 fimbrial biogenesis usher CssD	NA	NA	NA	NA	NA
WP_001595139.1|85415_86114_-	CS6 fimbrial biogenesis chaperone CssC	NA	NA	NA	NA	NA
WP_001595140.1|86162_86666_-	CS6 fimbrial subunit CssB	NA	NA	NA	NA	NA
WP_024171410.1|86683_87148_-	CS6 fimbrial subunit A	NA	NA	NA	NA	NA
WP_001717498.1|87745_87919_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000566440.1|89044_89317_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001400936.1|89309_89888_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	40.2	1.2e-27
WP_001717496.1|90037_93085_+|transposase	Tn3 family transposase	transposase	NA	NA	NA	NA
WP_148717951.1|93250_93463_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024191434.1|93873_95061_+	peptide antibiotic transporter SbmA	NA	NA	NA	NA	NA
WP_001595210.1|96627_97254_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.5	1.8e-18
WP_050437394.1|97246_98020_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001595205.1|97976_99179_-	TolC family protein	NA	NA	NA	NA	NA
WP_001718764.1|99175_100306_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_001401515.1|102775_103633_-	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
WP_001365705.1|103625_103700_-	RepA leader peptide Tap	NA	NA	NA	NA	NA
WP_000083817.1|103925_104186_-	replication regulatory protein RepA	NA	NA	NA	NA	NA
WP_001312851.1|104469_104619_-	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_001393357.1|104967_105150_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001717613.1|105373_106105_-	type-F conjugative transfer system pilin acetylase TraX	NA	NA	NA	NA	NA
WP_032201473.1|106101_106491_-	DUF2726 domain-containing protein	NA	NA	NA	NA	NA
WP_001702847.1|109889_111041_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	1.5e-42
WP_099490939.1|111325_111538_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099490891.1|111524_113117_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	61.2	3.0e-174
WP_000624718.1|113147_113498_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	2.1e-40
WP_000422741.1|113494_113920_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
WP_001595189.1|115121_115340_-	heat-stable enterotoxin ST-I group a	NA	NA	NA	NA	NA
WP_157757766.1|116682_117138_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	49.2	3.3e-33
