The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP024278	Escherichia coli strain ATCC 43896 chromosome, complete genome	5088038	577686	589726	5088038	integrase	Escherichia_phage(62.5%)	9	571065:571078	590741:590754
571065:571078	attL	GACTGAGGGCAAAG	NA	NA	NA	NA
WP_001278994.1|577686_578325_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_000590397.1|578321_579584_-	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	1.3e-135
WP_000847985.1|579580_580489_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_001297141.1|580684_581452_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	3.3e-70
WP_001141325.1|581502_582159_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.3	1.6e-49
WP_001696757.1|582264_584832_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.0e-30
WP_000858985.1|584991_586452_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0R6PGY7	Moraxella_phage	26.2	5.4e-21
WP_001696754.1|586448_587711_+	RNA-directed DNA polymerase	NA	NA	NA	NA	NA
WP_001696753.1|587707_589726_+	RNA-directed DNA polymerase	NA	A0A0H4TEY7	Erysipelothrix_phage	25.9	2.0e-29
590741:590754	attR	CTTTGCCCTCAGTC	NA	NA	NA	NA
>prophage 2
NZ_CP024278	Escherichia coli strain ATCC 43896 chromosome, complete genome	5088038	668357	686288	5088038	transposase,integrase	Enterobacteria_phage(53.85%)	17	659518:659531	687842:687855
659518:659531	attL	TACCGCCGCAGTCA	NA	NA	NA	NA
WP_085947771.1|668357_669519_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
WP_000577258.1|669671_671390_+	ATP-binding protein	NA	A0A1B5FPD5	Escherichia_phage	95.5	5.2e-305
WP_000214990.1|671391_673140_+	hypothetical protein	NA	A0A1B5FPH1	Escherichia_phage	99.8	0.0e+00
WP_000448925.1|673209_673626_-	hypothetical protein	NA	A0A1B5FPM5	Escherichia_phage	100.0	1.1e-72
WP_001341819.1|673664_674894_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	100.0	1.5e-234
WP_001392511.1|675575_677909_-	P4-specific DNA primase	NA	Q7M2A8	Enterobacteria_phage	99.0	0.0e+00
WP_000856729.1|677923_678244_-	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_001357995.1|678379_678835_-	hypothetical protein	NA	Q7M298	Enterobacteria_phage	98.2	4.7e-64
WP_001244670.1|678827_679115_-	hypothetical protein	NA	Q7M2A0	Enterobacteria_phage	96.8	2.5e-47
WP_000980224.1|679107_679698_-	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	90.3	5.3e-60
WP_001149160.1|679694_679961_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	100.0	4.9e-45
WP_001283014.1|680512_681247_+	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	98.4	6.1e-130
WP_099486145.1|681243_681744_+	transactivation protein	NA	NA	NA	NA	NA
WP_000446148.1|681817_682390_+	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	96.2	1.4e-94
WP_001696665.1|682743_684138_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_001696664.1|684134_685061_+	DUF4435 domain-containing protein	NA	NA	NA	NA	NA
WP_001392502.1|685100_686288_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	50.1	1.5e-106
687842:687855	attR	TGACTGCGGCGGTA	NA	NA	NA	NA
>prophage 3
NZ_CP024278	Escherichia coli strain ATCC 43896 chromosome, complete genome	5088038	973220	1063667	5088038	capsid,holin,plate,integrase,portal,terminase,tRNA,head,transposase,tail	Enterobacteria_phage(74.51%)	101	1012146:1012165	1048468:1048487
WP_000381395.1|973220_974792_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_000126951.1|974951_975503_-	Polarity suppression protein	NA	NA	NA	NA	NA
WP_001066218.1|975499_976243_-	septation initiation protein	NA	NA	NA	NA	NA
WP_000155333.1|976643_979316_-	DUF927 domain-containing protein	NA	A0A1B0VP75	Pseudomonas_phage	34.6	3.2e-59
WP_001075580.1|979312_979696_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001027152.1|979692_979977_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001246996.1|980008_980368_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001118612.1|980360_980537_-	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	55.6	4.2e-05
WP_024135328.1|980668_980848_+	hypothetical protein	NA	A0A2H4JB52	uncultured_Caudovirales_phage	54.2	5.8e-10
WP_000173141.1|980897_981113_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_001164862.1|981215_982097_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000996991.1|982127_983402_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	40.8	5.9e-72
WP_000368131.1|983737_984670_-	transporter	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
WP_000776768.1|984963_985719_+	phospholipid-binding lipoprotein MlaA	NA	NA	NA	NA	NA
WP_000937836.1|985900_986959_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001296861.1|987324_988665_-	long-chain fatty acid transporter FadL	NA	NA	NA	NA	NA
WP_000030901.1|989036_989321_+	YfcZ/YiiS family protein	NA	NA	NA	NA	NA
WP_000531954.1|989500_990811_+	acetyl-CoA C-acyltransferase FadI	NA	NA	NA	NA	NA
WP_000425058.1|990810_992955_+	fatty acid oxidation complex subunit alpha FadJ	NA	NA	NA	NA	NA
WP_001195819.1|993157_993643_+	phosphohistidine phosphatase SixA	NA	NA	NA	NA	NA
WP_000033328.1|994317_994881_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_001356050.1|994962_997608_+	fimbrial usher protein YfcU	NA	NA	NA	NA	NA
WP_096974544.1|997627_998380_+	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_000018471.1|998395_998905_+	fimbrial protein	NA	NA	NA	NA	NA
WP_000714140.1|998901_999390_+	fimbrial protein	NA	NA	NA	NA	NA
WP_000844745.1|999386_999926_+	fimbrial protein	NA	NA	NA	NA	NA
WP_099486151.1|999927_1000764_+	DUF2544 domain-containing protein	NA	NA	NA	NA	NA
WP_000730806.1|1000836_1001388_-	endonuclease SmrB	NA	NA	NA	NA	NA
WP_001295704.1|1001553_1002486_+	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_001760174.1|1002520_1003606_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	48.6	1.8e-90
WP_001043820.1|1003609_1004434_+	penicillin-insensitive murein endopeptidase	NA	NA	NA	NA	NA
WP_000447361.1|1004433_1005243_+	TSUP family transporter	NA	NA	NA	NA	NA
WP_001089235.1|1005242_1005791_+	elongation factor P hydroxylase	NA	NA	NA	NA	NA
WP_000559764.1|1005824_1006103_+	YfcL family protein	NA	NA	NA	NA	NA
WP_000683799.1|1006223_1008230_-|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
WP_000817178.1|1008388_1009609_+	beta-ketoacyl-ACP synthase I	NA	NA	NA	NA	NA
WP_096974543.1|1009873_1011052_+	MFS transporter	NA	NA	NA	NA	NA
WP_000615821.1|1011048_1012044_-	flagella biosynthesis regulator Flk	NA	NA	NA	NA	NA
1012146:1012165	attL	AAAATCCTTGTTGATGAAAA	NA	NA	NA	NA
WP_001512983.1|1012311_1013205_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001515357.1|1013209_1013542_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000078916.1|1013719_1013860_-	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	97.8	1.5e-18
WP_000488107.1|1014051_1014312_-	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_001512980.1|1014354_1015464_-	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	93.5	1.3e-192
WP_001512979.1|1015621_1016806_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	99.0	2.4e-224
WP_000290450.1|1016805_1017318_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	100.0	3.2e-93
WP_000665314.1|1017372_1017738_+|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	98.3	1.7e-56
WP_000763327.1|1017773_1017902_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	97.6	3.0e-16
WP_001512978.1|1017888_1020696_+|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	90.2	0.0e+00
WP_001512977.1|1020708_1021197_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	97.5	7.5e-84
WP_000905063.1|1021225_1021816_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	97.4	1.3e-101
WP_001512651.1|1023404_1023932_-|tail	tail fiber assembly protein	tail	A0A077SK10	Escherichia_phage	97.7	1.6e-92
WP_099486153.1|1023935_1026218_-|tail	phage tail protein	tail	Q7Y4D4	Escherichia_virus	73.9	1.3e-276
WP_001512969.1|1026220_1026751_-|tail	phage tail protein I	tail	A0A0A7NPV1	Enterobacteria_phage	98.2	9.6e-93
WP_001512968.1|1026743_1027640_-|plate	baseplate J-like family protein	plate	A0A0A7NPY5	Enterobacteria_phage	98.0	3.9e-155
WP_000213453.1|1027643_1027994_-|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	99.1	6.0e-59
WP_001271898.1|1027990_1028572_-|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	98.4	1.5e-102
WP_000356368.1|1028568_1029204_-	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	98.6	3.4e-113
WP_000920601.1|1029196_1029664_-|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	99.4	5.9e-86
WP_000780489.1|1029801_1030209_-	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	97.0	2.5e-64
WP_000072327.1|1030205_1030598_-	M15 family metallopeptidase	NA	A0A0A7NQ86	Enterobacteria_phage	100.0	5.8e-71
WP_000104350.1|1030594_1030918_-|holin	holin	holin	A0A0A7NRY9	Enterobacteria_phage	99.1	1.6e-50
WP_000864901.1|1030920_1031121_-|tail	tail protein	tail	A0A0A7NV57	Enterobacteria_phage	100.0	3.5e-32
WP_000063096.1|1031120_1031615_-|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	98.2	3.0e-88
WP_000632328.1|1031716_1032517_-|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	86.8	1.0e-122
WP_001055128.1|1032562_1033615_-|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	92.0	8.0e-184
WP_000180563.1|1033638_1034475_-|capsid	phage capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	80.6	1.5e-119
WP_000613789.1|1034629_1036381_+|terminase	terminase	terminase	A0A0A7NV54	Enterobacteria_phage	98.3	0.0e+00
WP_000087812.1|1036380_1037427_+|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	100.0	1.5e-206
WP_096974518.1|1037957_1039337_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000763711.1|1039353_1039692_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000484450.1|1039675_1040485_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096974517.1|1040530_1043278_-	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	96.4	0.0e+00
WP_000599412.1|1043284_1043650_-	hypothetical protein	NA	A0A0A7NRY1	Enterobacteria_phage	95.0	1.3e-59
WP_000013458.1|1043722_1043953_-	hypothetical protein	NA	A0A0A7NV48	Enterobacteria_phage	69.7	4.0e-19
WP_001512961.1|1044275_1044575_-	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	84.7	2.1e-36
WP_001512960.1|1044571_1044838_-	winged helix-turn-helix transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	77.3	8.9e-31
WP_000985157.1|1044834_1045038_-	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	83.6	2.5e-25
WP_000021661.1|1045124_1045238_-	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	97.3	1.6e-10
WP_000514277.1|1045234_1045477_-	DUF4754 domain-containing protein	NA	A0A0A7NQ71	Enterobacteria_phage	100.0	2.3e-38
WP_001512959.1|1045488_1045767_-	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	77.2	4.5e-33
WP_001383522.1|1045777_1046128_-	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	88.8	7.5e-54
WP_000203260.1|1046247_1046454_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000004248.1|1046460_1046748_-	hypothetical protein	NA	A0A0M4RCW1	Salmonella_phage	53.7	6.7e-24
WP_024203596.1|1046863_1047184_+	helix-turn-helix transcriptional regulator	NA	Q1JS29	Enterobacteria_phage	46.2	9.1e-14
WP_096974516.1|1047280_1048285_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M4RTQ0	Salmonella_phage	55.4	4.9e-98
WP_096974515.1|1048443_1049601_+	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	28.8	1.5e-21
1048468:1048487	attR	AAAATCCTTGTTGATGAAAA	NA	NA	NA	NA
WP_001289162.1|1049666_1050680_+	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001283590.1|1050679_1051492_+|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_000364331.1|1051574_1052234_+	DedA family protein	NA	NA	NA	NA	NA
WP_000118404.1|1052389_1053304_+	acetyl-CoA carboxylase, carboxyltransferase subunit beta	NA	NA	NA	NA	NA
WP_000584582.1|1053373_1054642_+	bifunctional tetrahydrofolate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_000146992.1|1054631_1055294_+	cell division protein DedD	NA	NA	NA	NA	NA
WP_000262113.1|1055552_1056041_+	colicin V production protein	NA	NA	NA	NA	NA
WP_000334218.1|1056077_1057595_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	44.0	1.0e-86
WP_000825689.1|1057689_1058259_+	UbiX family flavin prenyltransferase	NA	NA	NA	NA	NA
WP_000748261.1|1058524_1059307_+	lysine/arginine/ornithine ABC transporter substrate-binding protein ArgT	NA	NA	NA	NA	NA
WP_000737621.1|1059527_1060310_+	histidine ABC transporter substrate-binding protein HisJ	NA	NA	NA	NA	NA
WP_000965518.1|1060399_1061086_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_000569958.1|1061082_1061799_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001293612.1|1061806_1062580_+	histidine ABC transporter ATP-binding protein HisP	NA	M1I0T9	Acanthocystis_turfacea_Chlorella_virus	28.2	2.1e-08
WP_001696459.1|1062776_1063667_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	44.2	1.2e-66
>prophage 4
NZ_CP024278	Escherichia coli strain ATCC 43896 chromosome, complete genome	5088038	1120026	1205518	5088038	plate,integrase,protease,head,transposase,tail	Burkholderia_virus(32.69%)	83	1129017:1129035	1193117:1193135
WP_000140570.1|1120026_1120929_-|transposase	ISNCY family transposase	transposase	Q2A0A7	Sodalis_phage	54.8	2.5e-69
WP_001000358.1|1121122_1122313_-	anaerobic glycerol-3-phosphate dehydrogenase subunit C	NA	NA	NA	NA	NA
WP_001209921.1|1122309_1123569_-	glycerol-3-phosphate dehydrogenase subunit GlpB	NA	NA	NA	NA	NA
WP_000857257.1|1123558_1125187_-	anaerobic glycerol-3-phosphate dehydrogenase subunit A	NA	NA	NA	NA	NA
WP_000948732.1|1125459_1126818_+	glycerol-3-phosphate transporter	NA	NA	NA	NA	NA
WP_000779084.1|1126822_1127899_+	glycerophosphodiester phosphodiesterase	NA	A0A220BYK6	Staphylococcus_phage	46.0	5.1e-08
WP_000301050.1|1128361_1129012_+	lipopolysaccharide kinase InaA	NA	NA	NA	NA	NA
1129017:1129035	attL	TGTAGGCCAGATAAGACGC	NA	NA	NA	NA
WP_000135040.1|1129065_1129320_-	ferredoxin-like diferric-tyrosyl radical cofactor maintenance protein YfaE	NA	G9IAA2	Pseudomonas_phage	73.1	2.6e-24
WP_000332036.1|1129319_1130450_-	ribonucleotide-diphosphate reductase subunit beta	NA	G9IAA3	Pseudomonas_phage	78.9	2.5e-175
WP_001075170.1|1130538_1132824_-	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2D1GNB1	Pseudoalteromonas_phage	63.6	1.9e-283
WP_001220042.1|1133519_1137278_+	AIDA-I family autotransporter adhesin YfaL/EhaC	NA	NA	NA	NA	NA
WP_000990765.1|1137338_1138061_-	bifunctional 3-demethylubiquinone 3-O-methyltransferase/2-octaprenyl-6-hydroxy phenol methylase	NA	NA	NA	NA	NA
WP_001760164.1|1138207_1140835_+	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	G3M9Z5	Bacillus_virus	30.4	6.2e-92
WP_000012296.1|1140983_1142672_+	DUF2138 domain-containing protein	NA	NA	NA	NA	NA
WP_001298790.1|1142668_1143292_+	DUF1175 domain-containing protein	NA	NA	NA	NA	NA
WP_122996849.1|1143435_1147830_+	alpha-2-macroglobulin family protein	NA	NA	NA	NA	NA
WP_001104541.1|1147830_1149480_+	DUF2300 domain-containing protein	NA	NA	NA	NA	NA
WP_001225868.1|1149484_1150261_+	YfaP family protein	NA	NA	NA	NA	NA
WP_001281694.1|1150521_1150911_-	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	54.2	5.8e-31
WP_000972907.1|1150882_1151335_-	regulatory protein GemA	NA	A4JWM5	Burkholderia_virus	45.1	4.7e-24
WP_001297463.1|1151324_1151540_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000631818.1|1151529_1151760_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000131940.1|1151756_1152440_-	DUF2786 domain-containing protein	NA	A0A2P9JZH4	Alteromonadaceae_phage	37.3	2.0e-34
WP_000197789.1|1152436_1152742_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000632572.1|1152751_1153024_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001140141.1|1153312_1153843_-	host-nuclease inhibitor protein Gam	NA	L7P7T1	Pseudomonas_phage	67.9	1.1e-59
WP_000843446.1|1153870_1154140_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000960679.1|1154142_1155309_-	AAA family ATPase	NA	A4JWN1	Burkholderia_virus	59.4	2.2e-121
WP_096974514.1|1155319_1157089_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	Q6QIE0	Burkholderia_phage	68.3	1.1e-228
WP_000533824.1|1157092_1158004_-	DUF3102 domain-containing protein	NA	A4JWN3	Burkholderia_virus	54.3	7.2e-72
WP_000049026.1|1158014_1158323_-	helix-turn-helix domain-containing protein	NA	Q5ZR02	Pseudomonas_phage	54.9	2.1e-23
WP_000200154.1|1158375_1158564_-	DNA-binding protein	NA	Q5ZQZ9	Pseudomonas_phage	71.0	7.9e-18
WP_001259267.1|1158614_1159076_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000031885.1|1159072_1160059_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000522931.1|1160079_1160691_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001297461.1|1161100_1161676_+	DUF2441 domain-containing protein	NA	NA	NA	NA	NA
WP_000838563.1|1162041_1162392_+	membrane protein	NA	A4JWP3	Burkholderia_virus	52.2	9.9e-22
WP_001104434.1|1162394_1163123_+	transglycosylase SLT domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	57.9	4.1e-62
WP_000264662.1|1163106_1163757_+	hypothetical protein	NA	J9SVN7	Pseudomonas_phage	32.2	1.1e-08
WP_000175097.1|1163753_1164080_+	membrane protein	NA	Q6QIC4	Burkholderia_phage	49.5	9.6e-19
WP_000227701.1|1164079_1164391_+	hypothetical protein	NA	A0A0S4L0A3	Pseudomonas_phage	62.6	9.4e-32
WP_000124058.1|1164390_1164936_+	DUF3486 family protein	NA	A4JWJ3	Burkholderia_virus	67.0	6.0e-58
WP_000167504.1|1164932_1166528_+	hypothetical protein	NA	A4JWJ4	Burkholderia_virus	63.2	5.9e-186
WP_000090676.1|1166527_1168021_+	DUF935 domain-containing protein	NA	A4JWJ5	Burkholderia_virus	59.9	3.9e-168
WP_000117553.1|1168001_1168823_+|head	phage head morphogenesis protein	head	A4JWJ6	Burkholderia_virus	60.8	4.5e-97
WP_000135514.1|1168825_1169284_+	phage virion morphogenesis protein	NA	Q6QIB8	Burkholderia_phage	44.8	2.6e-30
WP_001273068.1|1169498_1170614_+	hypothetical protein	NA	A4JWJ9	Burkholderia_virus	51.6	9.4e-98
WP_001286909.1|1170628_1171582_+	hypothetical protein	NA	A4JWK0	Burkholderia_virus	44.5	4.0e-65
WP_000537460.1|1171591_1171930_+	DUF2190 family protein	NA	NA	NA	NA	NA
WP_000271671.1|1171931_1172378_+	DUF1320 domain-containing protein	NA	A4JWK2	Burkholderia_virus	53.0	2.9e-34
WP_001101808.1|1172377_1172842_+	hypothetical protein	NA	Q6QIB2	Burkholderia_phage	52.3	9.7e-41
WP_032143918.1|1172838_1173093_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001275725.1|1173082_1174510_+|tail	tail protein	tail	A4JWK5	Burkholderia_virus	77.1	3.7e-216
WP_000034292.1|1174509_1175031_+|tail	phage major tail tube protein	tail	A4JWK6	Burkholderia_virus	68.2	8.0e-68
WP_000110115.1|1175033_1175315_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096974513.1|1175412_1175748_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_001148841.1|1175692_1175830_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_021552771.1|1175922_1178388_+|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	42.5	2.9e-168
WP_000458381.1|1178387_1179272_+|tail	phage tail protein	tail	A4JWL1	Burkholderia_virus	45.0	1.6e-52
WP_010989167.1|1179268_1179484_+	membrane protein	NA	Q6QIA3	Burkholderia_phage	60.0	2.4e-18
WP_047089395.1|1179471_1180626_+	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	47.3	5.5e-85
WP_074539801.1|1180622_1181135_+|plate	phage baseplate assembly protein V	plate	A4JWL4	Burkholderia_virus	39.5	8.5e-22
WP_000381395.1|1181401_1182973_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_000624622.1|1182992_1183340_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_001339397.1|1183339_1184017_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000859110.1|1184870_1185218_+|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	61.5	1.3e-34
WP_074470397.1|1185208_1186312_+|plate	baseplate protein	plate	Q6QI99	Burkholderia_phage	54.3	3.9e-104
WP_000796549.1|1186304_1186883_+|tail	phage tail protein I	tail	A4JWL7	Burkholderia_virus	67.4	2.2e-66
WP_000002033.1|1186885_1187833_+|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	55.3	1.7e-68
WP_000384231.1|1187832_1188435_+|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	90.5	7.8e-99
WP_000376435.1|1188406_1188826_-|tail	tail assembly chaperone	tail	A0A0F7LDZ0	Escherichia_phage	55.1	5.0e-36
WP_001420297.1|1188829_1189186_-	hypothetical protein	NA	F1BUP1	Erwinia_phage	36.3	8.3e-08
WP_001165549.1|1189257_1189830_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	84.2	4.4e-83
WP_000876014.1|1190091_1192941_+	two-component system sensor histidine kinase RcsC	NA	A0A1V0SGX0	Hokovirus	27.2	1.4e-41
WP_001061917.1|1193140_1193791_-	transcriptional regulator RcsB	NA	NA	NA	NA	NA
1193117:1193135	attR	GCGTCTTATCTGGCCTACA	NA	NA	NA	NA
WP_001249075.1|1193807_1196480_-	phosphotransferase RcsD	NA	NA	NA	NA	NA
WP_000865609.1|1197218_1198343_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	58.8	2.4e-117
WP_000406099.1|1198454_1199510_+	FAD:protein FMN transferase ApbE	NA	NA	NA	NA	NA
WP_000786385.1|1199583_1200648_+	bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	50.5	1.8e-18
WP_000884942.1|1200647_1201298_+	DNA oxidative demethylase AlkB	NA	A0A2K9L3R7	Tupanvirus	31.7	1.4e-05
WP_000422188.1|1201373_1203017_+	microcin J25 efflux ABC transporter YojI	NA	W8CYL7	Bacillus_phage	24.0	9.5e-14
WP_000758074.1|1203234_1204881_+	malate dehydrogenase (quinone)	NA	NA	NA	NA	NA
WP_000849214.1|1205029_1205518_-|protease	serine protease inhibitor ecotin	protease	NA	NA	NA	NA
>prophage 5
NZ_CP024278	Escherichia coli strain ATCC 43896 chromosome, complete genome	5088038	1290563	1300004	5088038		Enterobacteria_phage(85.71%)	10	NA	NA
WP_000569329.1|1290563_1291490_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	2.8e-23
WP_000783120.1|1291494_1292226_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216961.1|1292206_1292314_-	protein YohO	NA	NA	NA	NA	NA
WP_001240401.1|1292373_1293105_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001295431.1|1293326_1295012_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_000598641.1|1295008_1295728_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000950409.1|1295774_1296245_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	5.2e-82
WP_001295429.1|1296284_1296746_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001356047.1|1296870_1298871_-	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	95.5	0.0e+00
WP_001292774.1|1298867_1300004_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.7	1.1e-162
>prophage 6
NZ_CP024278	Escherichia coli strain ATCC 43896 chromosome, complete genome	5088038	1312569	1377170	5088038	capsid,holin,plate,integrase,portal,terminase,tRNA,head,lysis,tail	Escherichia_phage(46.94%)	75	1339819:1339846	1372086:1372113
WP_001696417.1|1312569_1314603_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	2.3e-54
WP_001005448.1|1314734_1315844_+	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_001351454.1|1316106_1316388_+	YehE family protein	NA	NA	NA	NA	NA
WP_000830468.1|1316680_1317223_+	fimbrial protein	NA	NA	NA	NA	NA
WP_000677398.1|1317303_1317978_+	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_000945407.1|1317993_1320474_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_001696414.1|1320487_1321522_+	putative fimbrial-like adhesin protein	NA	NA	NA	NA	NA
WP_000153074.1|1321603_1321942_-	Ni(II)/Co(II) efflux transporter accessory subunit RcnB	NA	NA	NA	NA	NA
WP_000134576.1|1322160_1322985_-	nickel/cobalt efflux protein RcnA	NA	NA	NA	NA	NA
WP_000019944.1|1323105_1323378_+	Ni(II)/Co(II)-binding transcriptional repressor RcnR	NA	NA	NA	NA	NA
WP_001195588.1|1323600_1324389_+	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
WP_000822270.1|1324385_1325186_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_001351455.1|1325250_1326069_+	glycoside hydrolase family 25 protein	NA	D0R7H8	Paenibacillus_phage	38.5	1.7e-24
WP_000434038.1|1326120_1326867_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001696413.1|1326840_1327806_-	carbohydrate kinase	NA	NA	NA	NA	NA
WP_000846217.1|1327802_1328807_-	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	29.4	7.5e-14
WP_000858498.1|1328803_1330081_-	MFS transporter	NA	NA	NA	NA	NA
WP_000129551.1|1330337_1331390_+	class I fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_001356057.1|1331699_1332554_+	tagatose-bisphosphate aldolase subunit GatY	NA	NA	NA	NA	NA
WP_001696412.1|1332582_1333845_+	tagatose-bisphosphate aldolase subunit GatZ	NA	NA	NA	NA	NA
WP_000182914.1|1333854_1334307_+	PTS galactitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_000823272.1|1334337_1334622_+	PTS galactitol transporter subunit IIB	NA	NA	NA	NA	NA
WP_001696411.1|1334625_1335990_+	galactitol permease IIC component	NA	NA	NA	NA	NA
WP_000844219.1|1336037_1337078_+	galactitol-1-phosphate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_000178552.1|1337177_1337957_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_000807362.1|1338038_1338938_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	1.3e-12
WP_001352710.1|1339343_1339661_+	hypothetical protein	NA	NA	NA	NA	NA
1339819:1339846	attL	TAAAAAATAAGCCCGTGTAAGGGAGATT	NA	NA	NA	NA
WP_000985256.1|1339925_1340939_-|integrase	site-specific integrase	integrase	Q83VS6	Escherichia_phage	99.1	1.4e-193
WP_001306384.1|1341054_1341354_-	helix-turn-helix transcriptional regulator	NA	Q1JS63	Enterobacteria_phage	100.0	2.5e-50
WP_000043869.1|1341468_1341744_+	hypothetical protein	NA	Q1JS62	Enterobacteria_phage	100.0	1.3e-48
WP_000217670.1|1341921_1342422_+	hypothetical protein	NA	M1SV55	Escherichia_phage	100.0	2.6e-92
WP_021525846.1|1342485_1342710_+	DUF2732 family protein	NA	S4TP68	Salmonella_phage	98.6	2.3e-32
WP_001277958.1|1342709_1343012_+	hypothetical protein	NA	U5N0U2	Enterobacteria_phage	98.0	5.0e-46
WP_001113258.1|1343011_1343236_+	hypothetical protein	NA	S4TRY6	Salmonella_phage	97.3	2.5e-34
WP_000027664.1|1343232_1343508_+	hypothetical protein	NA	U5N3W1	Enterobacteria_phage	100.0	3.8e-45
WP_096974505.1|1343497_1345774_+	replication endonuclease	NA	A0A0F7LBQ2	Escherichia_phage	98.9	0.0e+00
WP_001605760.1|1346261_1347806_-	RNA-directed DNA polymerase	NA	A0A0F7LCK9	Escherichia_phage	100.0	4.5e-292
WP_050516365.1|1348320_1349547_+	RNA-directed DNA polymerase	NA	A0A0F7LDS3	Escherichia_phage	100.0	6.6e-222
WP_021565819.1|1350294_1351314_-|portal	phage portal protein	portal	A0A0F7L9Y5	Escherichia_phage	99.4	3.1e-196
WP_000156872.1|1351313_1353086_-|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCK3	Escherichia_phage	100.0	0.0e+00
WP_001085953.1|1353259_1354114_+|capsid	GPO family capsid scaffolding protein	capsid	Q778Z1	Enterobacteria_phage	100.0	4.6e-137
WP_001248583.1|1354172_1355246_+|capsid	phage major capsid protein, P2 family	capsid	Q94MK2	Enterobacteria_phage	100.0	6.7e-202
WP_016239051.1|1355249_1355993_+|terminase	terminase endonuclease subunit	terminase	Q94MH8	Enterobacteria_phage	99.6	1.2e-125
WP_096974506.1|1356092_1356602_+|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	99.4	2.5e-90
WP_000846409.1|1356601_1356805_+|tail	tail protein X	tail	A0A0F7LCN2	Escherichia_phage	100.0	3.0e-31
WP_000123123.1|1356808_1357090_+|holin	holin	holin	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
WP_001144101.1|1357089_1357587_+	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	100.0	3.1e-93
WP_046623128.1|1357601_1358027_+	hypothetical protein	NA	Q858W1	Yersinia_virus	95.0	1.1e-62
WP_046623127.1|1358014_1358440_+|lysis	LysB family phage lysis regulatory protein	lysis	U5N3W5	Enterobacteria_phage	95.7	3.0e-65
WP_001440152.1|1358411_1358585_+	hypothetical protein	NA	Q7Y4E1	Escherichia_virus	96.5	2.3e-24
WP_000917186.1|1358547_1359015_+|tail	phage tail protein	tail	Q7Y4E0	Escherichia_virus	98.7	2.5e-81
WP_046623126.1|1359007_1359460_+	phage virion morphogenesis protein	NA	A0A0F7LBV9	Escherichia_phage	99.3	1.4e-76
WP_039022208.1|1359526_1360162_+|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	98.1	1.7e-112
WP_096778158.1|1360158_1360506_+|plate	baseplate assembly protein	plate	A0A0F7LDQ1	Escherichia_phage	99.1	3.8e-58
WP_024247206.1|1360510_1361419_+|plate	baseplate assembly protein	plate	U5N3T9	Enterobacteria_phage	99.3	3.7e-161
WP_001285307.1|1361411_1362023_+|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	99.5	2.4e-116
WP_099486160.1|1362019_1363312_+|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	70.2	9.6e-179
WP_096974539.1|1363311_1363905_+|tail	phage tail protein	tail	Q9MCR5	Enterobacteria_phage	59.3	8.3e-53
WP_000376436.1|1363876_1364296_-|tail	tail assembly chaperone	tail	A0A0F7LDZ0	Escherichia_phage	55.8	1.7e-36
WP_099486162.1|1364299_1364701_-|tail	phage tail protein	tail	F1BUP1	Erwinia_phage	37.7	1.7e-09
WP_000905108.1|1364728_1365322_+	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	96.4	8.7e-103
WP_001286716.1|1365381_1366572_+|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	100.0	1.6e-225
WP_096974537.1|1366584_1367103_+|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	99.4	2.5e-93
WP_001031303.1|1367159_1367435_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
WP_000785970.1|1367467_1367587_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_096974536.1|1367579_1370027_+|tail	phage tail tape measure protein	tail	M1T2S3	Escherichia_phage	96.7	0.0e+00
WP_000978907.1|1370041_1370521_+|tail	phage tail protein	tail	A0A0F7LDE8	Escherichia_phage	99.4	1.5e-84
WP_096974535.1|1370520_1371684_+	phage late control D family protein	NA	Q7Y4C6	Escherichia_virus	97.4	9.1e-205
WP_000468308.1|1371765_1371984_+	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_000475999.1|1372257_1373619_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	99.7	4.2e-217
1372086:1372113	attR	TAAAAAATAAGCCCGTGTAAGGGAGATT	NA	NA	NA	NA
WP_001696394.1|1373721_1374018_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001305156.1|1374019_1374316_-	type II toxin-antitoxin system ParD family antitoxin	NA	NA	NA	NA	NA
WP_001696393.1|1374524_1374857_-	YegP family protein	NA	NA	NA	NA	NA
WP_000137877.1|1375047_1375770_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.6	3.7e-31
WP_001696391.1|1375766_1377170_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.8	4.1e-34
>prophage 7
NZ_CP024278	Escherichia coli strain ATCC 43896 chromosome, complete genome	5088038	1460318	1533360	5088038	transposase	Stx2-converting_phage(46.67%)	54	NA	NA
WP_000343765.1|1460318_1461539_+|transposase	ISL3-like element ISEc53 family transposase	transposase	NA	NA	NA	NA
WP_001200891.1|1462265_1463324_+	FUSC family protein	NA	NA	NA	NA	NA
WP_000450409.1|1463495_1463825_+	DUF496 family protein	NA	NA	NA	NA	NA
WP_064765985.1|1463925_1464075_-	propanediol utilization protein	NA	NA	NA	NA	NA
WP_001339397.1|1464115_1464793_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000624622.1|1464792_1465140_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_000381395.1|1465159_1466731_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_001667685.1|1467088_1467871_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.2	1.0e-138
WP_001696684.1|1467864_1468839_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	98.1	2.5e-187
WP_001171554.1|1468941_1469322_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|1469318_1469666_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998068.1|1469715_1471254_+|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	97.3	3.1e-293
WP_077631950.1|1472007_1472337_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_024181773.1|1472449_1475374_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_000105682.1|1475366_1476587_-	autotransporter strand-loop-strand O-heptosyltransferase	NA	NA	NA	NA	NA
WP_000809339.1|1476910_1477528_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071596603.1|1477524_1477986_-	CaiF/GrlA family transcriptional regulator	NA	NA	NA	NA	NA
WP_001254932.1|1479836_1480988_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
WP_000422741.1|1481225_1481651_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
WP_000624722.1|1481647_1481998_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
WP_001189123.1|1482890_1484399_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	3.6e-44
WP_032142224.1|1484707_1485079_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001161660.1|1487345_1487459_-	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_000976829.1|1487471_1487678_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000854762.1|1487674_1488049_-	toxin	NA	NA	NA	NA	NA
WP_001295723.1|1488138_1488507_-	antitoxin	NA	NA	NA	NA	NA
WP_000692341.1|1488669_1488891_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	44.4	4.2e-10
WP_001186774.1|1488953_1489430_-	RadC family protein	NA	NA	NA	NA	NA
WP_000855059.1|1489445_1489919_-	antirestriction protein	NA	A9J566	Pseudomonas_phage	30.3	1.5e-12
WP_001234652.1|1490260_1491079_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	39.7	1.6e-46
WP_001433433.1|1491233_1491392_-	DUF905 domain-containing protein	NA	NA	NA	NA	NA
WP_001760116.1|1491462_1494309_-	autotransporter adhesin Ag43	NA	NA	NA	NA	NA
WP_001360328.1|1494681_1495554_-	GTPase family protein	NA	NA	NA	NA	NA
WP_000250228.1|1495638_1496556_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001329788.1|1497389_1497587_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000813456.1|1497758_1498361_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001329787.1|1498455_1498734_-	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_000840364.1|1498802_1499069_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001344112.1|1499369_1499546_+	hemolysin activation protein	NA	NA	NA	NA	NA
WP_000221536.1|1500261_1500831_+	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_000271005.1|1500996_1501389_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001221604.1|1502552_1502963_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000973159.1|1508615_1509161_+	bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase	NA	NA	NA	NA	NA
WP_001297350.1|1509157_1509901_+	adenosylcobinamide-GDP ribazoletransferase	NA	NA	NA	NA	NA
WP_001696348.1|1509912_1510992_+	nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000986331.1|1511053_1511989_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_001011466.1|1512445_1513363_+	nitrogen assimilation transcriptional regulator	NA	NA	NA	NA	NA
WP_001011017.1|1513464_1514415_+	HTH-type transcriptional regulator Cbl	NA	NA	NA	NA	NA
WP_122452224.1|1514532_1516176_+	toxic metabolite efflux MATE transporter YeeO	NA	NA	NA	NA	NA
WP_000532923.1|1516804_1517521_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_096974560.1|1518622_1520095_-	AMP nucleosidase	NA	NA	NA	NA	NA
WP_000378575.1|1520196_1521513_-	shikimate transporter	NA	NA	NA	NA	NA
WP_001392298.1|1530706_1531504_-	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_001760113.1|1532226_1533360_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
>prophage 8
NZ_CP024278	Escherichia coli strain ATCC 43896 chromosome, complete genome	5088038	1911554	1977862	5088038	integrase,portal,terminase,protease,lysis,transposase,tail	Enterobacteria_phage(41.3%)	74	1919130:1919146	1952202:1952218
WP_001260849.1|1911554_1912376_-|protease	serine protease	protease	NA	NA	NA	NA
WP_000233090.1|1912475_1912559_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000743951.1|1912651_1912987_-	acid shock protein	NA	NA	NA	NA	NA
WP_000091849.1|1913383_1914637_-	MFS transporter	NA	NA	NA	NA	NA
WP_001019530.1|1914743_1915637_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000225276.1|1915771_1916992_+	DNA-binding transcriptional repressor Mlc	NA	NA	NA	NA	NA
WP_000919231.1|1917116_1917812_+	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_071524606.1|1917764_1919057_-	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
1919130:1919146	attL	CTTTAAGAGATAAAAAA	NA	NA	NA	NA
WP_000148710.1|1919214_1919829_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
WP_000526492.1|1919871_1920726_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000213028.1|1920727_1921345_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_001340362.1|1921355_1923779_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	1.7e-208
WP_001760064.1|1923839_1926266_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.2	1.3e-213
WP_001356084.1|1926464_1926770_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_001704511.1|1926877_1927588_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001138584.1|1927590_1928151_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_000705197.1|1928185_1928527_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001295394.1|1929192_1930407_+	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_001696244.1|1930418_1931438_+	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	26.2	1.9e-17
WP_001360138.1|1931495_1931606_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001696243.1|1931625_1932906_-|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	62.1	1.5e-155
WP_001296941.1|1932940_1933177_-	excisionase family protein	NA	S4TND0	Salmonella_phage	50.7	6.1e-15
WP_001339397.1|1933800_1934478_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000624622.1|1934477_1934825_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_000381395.1|1934844_1936416_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_001083280.1|1938536_1938728_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000854559.1|1938724_1938913_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001613120.1|1939399_1939975_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379589.1|1939976_1940132_-	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	51.1	8.8e-07
WP_000381212.1|1940300_1940708_-	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	51.9	7.2e-32
WP_000909905.1|1940788_1941016_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000705349.1|1940999_1941521_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001613119.1|1941501_1942467_+	phage replication protein O	NA	U5P0A0	Shigella_phage	61.2	4.5e-56
WP_001151126.1|1942507_1942930_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	91.0	7.7e-61
WP_000354584.1|1943247_1944735_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000887491.1|1944950_1945163_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	97.1	1.7e-29
WP_000980999.1|1945379_1945631_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032149942.1|1945697_1945976_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001695976.1|1945977_1947027_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.0	2.7e-107
WP_000904112.1|1947039_1947414_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	8.4e-35
WP_001695977.1|1947410_1948232_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	58.6	1.8e-77
WP_029380182.1|1948953_1949082_+	DUF3927 domain-containing protein	NA	H6WZJ7	Escherichia_phage	96.4	4.7e-06
WP_000506936.1|1949448_1949877_+	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
WP_001348108.1|1950048_1950423_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000839562.1|1950674_1950890_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	1.3e-32
WP_000189918.1|1950894_1951206_+	DUF1327 domain-containing protein	NA	K7PGU6	Enterobacteria_phage	62.6	5.0e-25
WP_001092966.1|1951202_1951736_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.2	8.4e-97
WP_001071776.1|1951732_1952230_+	DUF2514 domain-containing protein	NA	NA	NA	NA	NA
1952202:1952218	attR	CTTTAAGAGATAAAAAA	NA	NA	NA	NA
WP_001356335.1|1952593_1952806_+	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.6e-22
WP_071526745.1|1952816_1953005_+	cold-shock protein	NA	NA	NA	NA	NA
WP_001443523.1|1953152_1953308_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001019207.1|1953480_1953654_+	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_000548593.1|1953949_1954156_+	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	79.4	3.4e-22
WP_000421825.1|1954706_1955246_+	DUF1441 family protein	NA	A5LH26	Enterobacteria_phage	100.0	1.8e-94
WP_000507029.1|1955254_1957354_+|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	99.0	0.0e+00
WP_001072975.1|1957350_1957563_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_001613114.1|1957562_1959071_+|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	99.2	1.2e-286
WP_001613113.1|1959015_1961043_+|protease	Clp protease ClpP	protease	A5LH30	Enterobacteria_phage	99.2	0.0e+00
WP_001097050.1|1961129_1961453_+	DUF2190 family protein	NA	A0A291AWX2	Escherichia_phage	100.0	8.5e-52
WP_001283153.1|1961445_1961721_+	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
WP_000677108.1|1961732_1962311_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	99.5	7.2e-102
WP_001079398.1|1962307_1962709_+|tail	tail protein	tail	A0A291AWY2	Escherichia_phage	100.0	8.3e-73
WP_000211109.1|1962720_1963464_+|tail	tail protein	tail	A0A291AWU6	Escherichia_phage	100.0	7.8e-133
WP_001297778.1|1963524_1963911_+|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	99.2	3.6e-65
WP_001161009.1|1963919_1964249_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_001613112.1|1964220_1967286_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	98.2	0.0e+00
WP_000447248.1|1967285_1967615_+|tail	phage tail protein	tail	A0A291AWW9	Escherichia_phage	100.0	1.7e-60
WP_001724602.1|1967624_1968323_+|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	98.7	5.6e-133
WP_024170790.1|1968328_1969072_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.4	4.7e-146
WP_000090847.1|1969008_1969611_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	85.1	1.8e-87
WP_069914273.1|1969671_1973151_+	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	89.9	0.0e+00
WP_001233114.1|1973218_1973818_+	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	93.5	2.5e-105
WP_099481759.1|1973882_1977281_+	short-chain fatty acid transporter	NA	X2KTY7	Enterobacteria_phage	37.3	2.4e-11
WP_001613101.1|1977280_1977862_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	91.7	4.0e-100
>prophage 9
NZ_CP024278	Escherichia coli strain ATCC 43896 chromosome, complete genome	5088038	2135186	2243139	5088038	integrase,terminase,tRNA,lysis,transposase,tail	Escherichia_phage(40.38%)	102	2147791:2147807	2242272:2242288
WP_000343747.1|2135186_2136395_-|transposase	IS256-like element IS1414 family transposase	transposase	A0A218MNI5	uncultured_virus	45.7	9.6e-48
WP_000115948.1|2136549_2137989_-	aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001027931.1|2138185_2138986_-	YdcF family protein	NA	NA	NA	NA	NA
WP_000139570.1|2139257_2143160_-	ATP-dependent RNA helicase HrpA	NA	A0A1V0SIV3	Klosneuvirus	29.5	2.2e-53
WP_000048948.1|2143360_2143966_+	FMN-dependent NADH-azoreductase	NA	NA	NA	NA	NA
WP_000627367.1|2144016_2145333_-	phosphatase PAP2/dual specificity phosphatase family protein	NA	NA	NA	NA	NA
WP_000431817.1|2145322_2147080_-	bifunctional alpha/beta hydrolase/class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_096974541.1|2147095_2147992_-	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
2147791:2147807	attL	TTATCAGCGCAAAAAAC	NA	NA	NA	NA
WP_000177525.1|2147991_2148597_-	CDP-alcohol phosphatidyltransferase family protein	NA	NA	NA	NA	NA
WP_000471489.1|2148767_2151074_-	DUF2773 domain-containing bactofilin	NA	NA	NA	NA	NA
WP_000097794.1|2151137_2151998_-	pyridoxine 4-dehydrogenase	NA	NA	NA	NA	NA
WP_001123457.1|2152229_2152820_-	phenylacetic acid degradation protein PaaY	NA	NA	NA	NA	NA
WP_000039880.1|2152801_2153752_-	phenylacetic acid degradation operon negative regulatory protein PaaX	NA	NA	NA	NA	NA
WP_000632280.1|2153852_2155166_-	phenylacetate--CoA ligase	NA	NA	NA	NA	NA
WP_001206190.1|2155192_2156398_-	3-oxoadipyl-CoA thiolase	NA	NA	NA	NA	NA
WP_000018413.1|2156397_2156820_-	hydroxyphenylacetyl-CoA thioesterase PaaI	NA	NA	NA	NA	NA
WP_000973362.1|2156809_2158237_-	3-hydroxyacyl-CoA dehydrogenase PaaC	NA	NA	NA	NA	NA
WP_000969779.1|2158238_2159027_-	2-(1,2-epoxy-1,2-dihydrophenyl)acetyl-CoA isomerase	NA	NA	NA	NA	NA
WP_001292341.1|2159026_2159794_-	2,3-dehydroadipyl-CoA hydratase	NA	NA	NA	NA	NA
WP_000206364.1|2159790_2160861_-	phenylacetate-CoA oxygenase/reductase subunit PaaK	NA	NA	NA	NA	NA
WP_001189197.1|2160868_2161366_-	phenylacetate degradation protein PaaD	NA	NA	NA	NA	NA
WP_001072837.1|2161380_2162127_-	phenylacetate-CoA oxygenase subunit PaaC	NA	NA	NA	NA	NA
WP_000073393.1|2162135_2162423_-	1,2-phenylacetyl-CoA epoxidase subunit B	NA	NA	NA	NA	NA
WP_000191072.1|2162434_2163364_-	1,2-phenylacetyl-CoA epoxidase subunit A	NA	NA	NA	NA	NA
WP_001186463.1|2163648_2165694_+	phenylacetic acid degradation bifunctional protein PaaZ	NA	NA	NA	NA	NA
WP_000535473.1|2165941_2168215_+	primary-amine oxidase	NA	NA	NA	NA	NA
WP_000138615.1|2168272_2169772_-	NAD-dependent phenylacetaldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001542872.1|2170007_2170913_+	transcriptional regulator FeaR	NA	NA	NA	NA	NA
WP_000752043.1|2171084_2171411_-	YdbL family protein	NA	NA	NA	NA	NA
WP_000698141.1|2171418_2171604_-	YnbE family lipoprotein	NA	NA	NA	NA	NA
WP_000900918.1|2171600_2174240_-	YdbH family protein	NA	NA	NA	NA	NA
WP_000762229.1|2174447_2175437_+	D-lactate dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	44.0	2.5e-70
WP_001296048.1|2175547_2175970_+	heat shock protein HslJ	NA	NA	NA	NA	NA
WP_001295715.1|2175966_2176233_-	DUF333 domain-containing protein	NA	NA	NA	NA	NA
WP_001696063.1|2176506_2180031_+	pyruvate:ferredoxin (flavodoxin) oxidoreductase	NA	NA	NA	NA	NA
WP_000837924.1|2180397_2181531_+	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	58.8	8.3e-118
WP_001082294.1|2181671_2182106_+	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.0e-28
WP_001348156.1|2182399_2182543_-	hypothetical protein	NA	NA	NA	NA	NA
WP_120795384.1|2182882_2182996_+	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000836772.1|2183064_2183298_+	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	87.0	4.1e-32
WP_000086519.1|2183614_2184205_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	2.8e-24
WP_099486173.1|2184302_2184878_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	96.3	9.1e-105
WP_071886609.1|2184877_2188408_-	short-chain fatty acid transporter	NA	X2KTY7	Enterobacteria_phage	37.3	2.5e-11
WP_001233133.1|2188472_2189072_-	Ail/Lom family outer membrane beta-barrel protein	NA	A5LH44	Enterobacteria_phage	95.0	1.6e-107
WP_032202219.1|2189139_2192619_-	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	90.5	0.0e+00
WP_000090943.1|2192679_2193282_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	84.7	4.0e-87
WP_001349612.1|2193218_2193962_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.3	8.9e-145
WP_001152432.1|2193967_2194666_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	93.5	1.1e-125
WP_000024051.1|2194665_2195004_-|tail	phage tail protein	tail	H6WZM2	Escherichia_phage	50.0	4.0e-28
WP_096974559.1|2194996_2198230_-|tail	phage tail tape measure protein	tail	A0A2H4J9A1	uncultured_Caudovirales_phage	34.7	1.3e-112
WP_001755909.1|2198395_2198596_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050559596.1|2198703_2199099_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000094292.1|2199200_2200163_-	hypothetical protein	NA	A0A059VG08	Pseudomonas_phage	39.2	4.5e-56
WP_000144678.1|2200189_2200582_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001029815.1|2200578_2200959_-	hypothetical protein	NA	A0A059VF88	Pseudomonas_phage	44.4	1.1e-18
WP_000524260.1|2200959_2201343_-	hypothetical protein	NA	A0A0P0I456	Acinetobacter_phage	39.4	2.2e-14
WP_000634214.1|2201342_2201738_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000918487.1|2201960_2203100_-	hypothetical protein	NA	G8C7P7	Escherichia_phage	75.0	7.4e-159
WP_000770042.1|2203198_2203963_-	hypothetical protein	NA	G8C7P6	Escherichia_phage	64.2	6.9e-84
WP_001351715.1|2204067_2205180_-	hypothetical protein	NA	I6PD76	Cronobacter_phage	54.5	4.2e-114
WP_000763704.1|2205163_2206570_-	DUF4055 domain-containing protein	NA	G8C7P4	Escherichia_phage	69.0	3.0e-186
WP_000625348.1|2206572_2207874_-|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	59.6	3.6e-149
WP_001695611.1|2207854_2208949_-|terminase	terminase small subunit	terminase	A0A0U2RXW9	Escherichia_phage	80.5	5.9e-113
WP_000126788.1|2208952_2209162_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085949154.1|2209342_2210489_+|transposase	IS3-like element ISEc52 family transposase	transposase	Q716C2	Shigella_phage	96.3	2.4e-173
WP_001695609.1|2211317_2212109_-	ParB N-terminal domain-containing protein	NA	R4TG31	Halovirus	40.2	3.7e-48
WP_001097895.1|2212246_2213704_-	Trk system potassium uptake protein TrkG	NA	NA	NA	NA	NA
WP_001228688.1|2213900_2214086_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	96.5	3.6e-15
WP_001135310.1|2214302_2214800_-	lysozyme	NA	M1FJA0	Enterobacteria_phage	96.4	9.3e-90
WP_000839565.1|2214799_2215015_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	1.3e-32
WP_001348108.1|2215266_2215641_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000506936.1|2215812_2216241_-	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
WP_000640162.1|2217283_2217826_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	75.7	4.9e-76
WP_000247763.1|2217822_2218113_-	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	87.5	3.7e-46
WP_000940319.1|2218112_2218712_-	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	92.0	1.1e-105
WP_000149055.1|2219525_2219864_+	DUF1971 domain-containing protein	NA	NA	NA	NA	NA
WP_001117227.1|2220587_2221787_+	MFS transporter	NA	NA	NA	NA	NA
WP_000957774.1|2221798_2222491_+	calcium transporter ChaC	NA	NA	NA	NA	NA
WP_000019009.1|2222487_2223369_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000625667.1|2223499_2224777_-	DUF2254 domain-containing protein	NA	NA	NA	NA	NA
WP_001676522.1|2224840_2226838_-	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	26.2	3.3e-21
WP_001151151.1|2227178_2227601_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	88.5	4.8e-63
WP_001262393.1|2227641_2228712_-	hypothetical protein	NA	A0A088CD36	Shigella_phage	65.2	4.2e-63
WP_000693853.1|2228783_2229209_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001072337.1|2229205_2229460_-	hypothetical protein	NA	A0A2I6PIE5	Escherichia_phage	60.3	2.8e-18
WP_000233320.1|2229539_2229959_+	helix-turn-helix domain-containing protein	NA	A0A2I6PIE7	Escherichia_phage	47.5	4.2e-19
WP_000233809.1|2230245_2230380_+	phage protein	NA	NA	NA	NA	NA
WP_001169151.1|2230390_2230546_+	YdaF family protein	NA	M4QQ57	Salicola_phage	55.3	6.1e-08
WP_001312793.1|2230542_2231031_-	superinfection exclusion protein B	NA	NA	NA	NA	NA
WP_000560225.1|2231472_2231694_+	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	97.3	4.9e-35
WP_001352098.1|2231693_2231864_+	conserved protein, Rac prophage	NA	A0A0U2SHB5	Escherichia_phage	71.4	3.6e-17
WP_000632297.1|2231938_2232214_+	protein RacC	NA	A0A0U2QW85	Escherichia_phage	96.7	1.4e-42
WP_001532611.1|2232315_2234916_+	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	63.5	3.9e-248
WP_000166319.1|2234908_2235718_+	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	8.8e-106
WP_001317028.1|2235774_2235969_+	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	96.9	5.8e-32
WP_000276809.1|2235961_2236171_+	double-strand break reduction protein RcbA	NA	A0A0U2QL97	Escherichia_phage	98.4	6.1e-27
WP_000079604.1|2236249_2236465_+	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_000040852.1|2236466_2237702_+|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	98.8	5.5e-240
WP_001153728.1|2237753_2238689_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.4	1.0e-145
WP_000123745.1|2238817_2240191_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_000387395.1|2240668_2241652_-	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_000628065.1|2241906_2243139_+	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
2242272:2242288	attR	TTATCAGCGCAAAAAAC	NA	NA	NA	NA
>prophage 10
NZ_CP024278	Escherichia coli strain ATCC 43896 chromosome, complete genome	5088038	2423567	2497119	5088038	capsid,holin,integrase,portal,terminase,tRNA,head,transposase,tail	Escherichia_phage(38.18%)	83	2478985:2479000	2498493:2498508
WP_000343747.1|2423567_2424776_-|transposase	IS256-like element IS1414 family transposase	transposase	A0A218MNI5	uncultured_virus	45.7	9.6e-48
WP_001695883.1|2424904_2427226_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	43.0	3.0e-90
WP_001307135.1|2427342_2427552_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001299921.1|2427951_2428170_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001246497.1|2428301_2429825_-	cyclic diguanylate phosphodiesterase	NA	NA	NA	NA	NA
WP_001065752.1|2430155_2430404_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000888772.1|2430516_2430783_-	biofilm/acid-resistance regulator AriR	NA	NA	NA	NA	NA
WP_000858002.1|2430811_2431084_-	two-component-system connector protein YmgA	NA	NA	NA	NA	NA
WP_000554153.1|2431126_2431363_-	two-component-system connector protein YcgZ	NA	NA	NA	NA	NA
WP_001299269.1|2431676_2432888_+	blue light-responsive regulator BluF	NA	NA	NA	NA	NA
WP_000332303.1|2433092_2433824_+	MerR family transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	50.5	2.7e-53
WP_000373101.1|2434044_2434449_+	DUF1398 domain-containing protein	NA	NA	NA	NA	NA
WP_032141808.1|2434501_2434612_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001325741.1|2435143_2435467_+	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	65.4	1.0e-41
WP_000444487.1|2435569_2436820_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_001248691.1|2436991_2437645_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000476093.1|2437654_2438116_+	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001297484.1|2438169_2439276_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_001297479.1|2439311_2439953_+	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_000423750.1|2439956_2441327_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	5.5e-108
WP_001265481.1|2441494_2442166_+	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000735412.1|2442165_2443626_+	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_001295435.1|2443701_2444823_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_000359461.1|2444968_2446198_-	peptidase T	NA	NA	NA	NA	NA
WP_000531594.1|2446447_2447584_+	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
WP_000799406.1|2447567_2448431_+	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_001394135.1|2448662_2448929_-|tail	caudovirales tail fiber assembly family protein	tail	K7PMH7	Enterobacteria_phage	81.7	9.2e-20
WP_122996854.1|2448985_2449654_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000972143.1|2451062_2451596_+|tail	tail fiber assembly protein	tail	C9DGR0	Escherichia_phage	99.4	6.4e-97
WP_001393491.1|2451624_2452152_-|tail	tail fiber assembly protein	tail	A0A077SK10	Escherichia_phage	97.1	4.7e-92
WP_001393473.1|2455309_2455909_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	93.0	2.3e-103
WP_074526252.1|2455976_2459456_-	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	90.5	0.0e+00
WP_000090891.1|2459516_2460149_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.5	2.2e-96
WP_032327624.1|2460085_2460829_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.8	1.2e-146
WP_032250943.1|2460833_2461532_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.7	2.8e-132
WP_001417644.1|2461531_2461861_-|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	97.2	5.8e-56
WP_099481751.1|2461857_2464425_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	96.2	0.0e+00
WP_000459457.1|2464417_2464852_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_096974565.1|2464833_2465256_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	85.7	1.7e-60
WP_001317730.1|2465271_2466012_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	97.2	5.2e-129
WP_000683129.1|2466019_2466415_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	98.5	8.5e-70
WP_001695274.1|2466411_2466990_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	97.4	1.9e-78
WP_000752960.1|2467001_2467355_-|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	99.1	7.6e-62
WP_000158897.1|2467366_2467762_-	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	93.9	2.4e-56
WP_032327490.1|2467803_2468829_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	96.8	2.2e-186
WP_032327489.1|2468884_2469217_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	98.2	2.7e-53
WP_047648762.1|2469226_2470546_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	97.0	5.5e-230
WP_001695861.1|2470526_2472128_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.9	3.2e-309
WP_000198149.1|2472124_2472331_-|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_001410192.1|2473953_2474631_+|transposase	transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	46.0	1.1e-21
WP_000624622.1|2474630_2474978_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_000381395.1|2474997_2476569_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_000867505.1|2476934_2477480_-|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	82.8	2.8e-79
WP_000221037.1|2477737_2477989_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000958717.1|2478328_2478538_-	hypothetical protein	NA	A0A1L6Z528	Klebsiella_phage	58.3	9.1e-15
WP_001695855.1|2478822_2479200_-	M15 family metallopeptidase	NA	Q9MBZ3	Enterobacteria_phage	97.6	3.9e-64
2478985:2479000	attL	ATCCACCGCATCACCG	NA	NA	NA	NA
WP_000950578.1|2479202_2479478_-|holin	phage holin family protein	holin	A0A0U2SHD1	Escherichia_phage	85.7	2.1e-35
WP_001695854.1|2479467_2479857_-	hypothetical protein	NA	Q9MBZ5	Enterobacteria_phage	77.7	2.4e-45
WP_000833651.1|2479945_2480098_-	DUF3927 domain-containing protein	NA	NA	NA	NA	NA
WP_000907693.1|2480094_2480319_-	tellurite resistance TerB family protein	NA	Q71TK7	Escherichia_phage	75.4	1.1e-21
WP_001394189.1|2480640_2481690_-	site-specific DNA-methyltransferase	NA	Q8W637	Enterobacteria_phage	88.8	8.0e-184
WP_000917744.1|2481840_2482038_-	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	98.5	2.1e-29
WP_096974563.1|2482269_2482812_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	72.9	8.6e-73
WP_000140024.1|2482820_2483186_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	64.3	1.6e-38
WP_001418555.1|2483186_2484242_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	47.8	3.2e-87
WP_024181546.1|2484243_2484516_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	49.2	9.4e-12
WP_024181009.1|2484683_2484896_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	95.4	3.4e-25
WP_000157319.1|2485287_2486202_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000715488.1|2486217_2486697_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021526285.1|2486702_2487227_-	hypothetical protein	NA	A0A0P0ZCW0	Stx2-converting_phage	57.9	3.8e-33
WP_001017770.1|2487341_2487617_-	DUF4752 family protein	NA	A0A088CD82	Shigella_phage	80.0	9.8e-33
WP_001151207.1|2487905_2488328_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	93.6	9.4e-67
WP_001394176.1|2488368_2489439_-	hypothetical protein	NA	A0A088CD36	Shigella_phage	65.2	9.4e-63
WP_000693867.1|2489510_2489936_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001397087.1|2490554_2490893_+	peptidase S24-like family protein	NA	H9C160	Pectobacterium_phage	30.7	2.5e-06
WP_001394175.1|2491185_2491338_+	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	55.3	4.6e-08
WP_000394554.1|2491349_2491988_+	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	40.7	1.7e-06
WP_001133036.1|2491988_2492198_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001301390.1|2492760_2492949_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001098305.1|2492945_2493149_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_001763154.1|2493229_2495701_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	60.2	1.3e-59
WP_000003742.1|2495762_2496032_+	excisionase	NA	NA	NA	NA	NA
WP_001397084.1|2496000_2497119_+|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z04	Phage_21	45.0	9.1e-85
2498493:2498508	attR	CGGTGATGCGGTGGAT	NA	NA	NA	NA
>prophage 11
NZ_CP024278	Escherichia coli strain ATCC 43896 chromosome, complete genome	5088038	2826875	2837475	5088038	protease	Vibrio_phage(33.33%)	6	NA	NA
WP_001101569.1|2826875_2830109_-	type I-F CRISPR-associated helicase Cas3	NA	A0A2I7RCU8	Vibrio_phage	28.8	2.8e-62
WP_000097888.1|2830105_2831089_-	type I-F CRISPR-associated endonuclease Cas1	NA	A0A2D0YFC9	Vibrio_phage	35.2	2.9e-42
WP_000934053.1|2832281_2834558_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
WP_000241204.1|2834588_2834909_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_000410785.1|2835231_2835456_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
WP_000188180.1|2835528_2837475_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.1	1.1e-37
>prophage 12
NZ_CP024278	Escherichia coli strain ATCC 43896 chromosome, complete genome	5088038	2900258	2987654	5088038	transposase,tail,integrase,lysis	Enterobacteria_phage(45.28%)	93	2927821:2927855	2989088:2989122
WP_000399616.1|2900258_2901239_-|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
WP_000961458.1|2901517_2903110_-	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.7	6.9e-62
WP_001056384.1|2903328_2904249_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000056444.1|2904307_2905426_-	anion transporter	NA	NA	NA	NA	NA
WP_000091016.1|2905422_2905890_-	transcriptional regulator MntR	NA	NA	NA	NA	NA
WP_001001761.1|2906075_2906204_+	manganase accumulation protein MntS	NA	NA	NA	NA	NA
WP_001054661.1|2906475_2908059_+	phosphoethanolamine transferase	NA	NA	NA	NA	NA
WP_001295296.1|2908107_2908623_-	outer membrane protein OmpX	NA	H6WZM8	Escherichia_phage	33.8	1.1e-16
WP_120795379.1|2908675_2908741_-	protein YliM	NA	NA	NA	NA	NA
WP_032327506.1|2908975_2909863_+	threonine/homoserine exporter RhtA	NA	NA	NA	NA	NA
WP_000100800.1|2910161_2910665_+	DNA starvation/stationary phase protection protein Dps	NA	A0A222YYG6	Streptomyces_phage	29.0	4.9e-06
WP_000843866.1|2911068_2911815_+	glutamine ABC transporter substrate-binding protein GlnH	NA	NA	NA	NA	NA
WP_001159065.1|2911953_2912613_+	glutamine ABC transporter permease GlnP	NA	NA	NA	NA	NA
WP_000569080.1|2912609_2913332_+	glutamine ABC transporter ATP-binding protein GlnQ	NA	G9BWD6	Planktothrix_phage	41.8	2.5e-35
WP_096974557.1|2913448_2915674_+	mechanosensitive channel protein	NA	NA	NA	NA	NA
WP_000526040.1|2915670_2916678_-	23S rRNA (adenine(1618)-N(6))-methyltransferase RlmF	NA	NA	NA	NA	NA
WP_000710619.1|2916872_2917133_+	DUF1471 domain-containing protein	NA	A0A1B2ICL8	Erwinia_phage	51.0	1.6e-05
WP_032327504.1|2917397_2919680_+	catecholate siderophore receptor Fiu	NA	NA	NA	NA	NA
WP_000990176.1|2919721_2920399_+	PKHD-type hydroxylase YbiX	NA	Q5GQB0	Synechococcus_phage	30.1	1.2e-18
WP_000146343.1|2920472_2920739_+	C4-type zinc finger protein YbiI	NA	E5G6L7	Salmonella_phage	45.6	6.9e-07
WP_000849301.1|2921003_2921264_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_000399648.1|2921533_2922514_+|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
WP_000443508.1|2922771_2923857_-	malate/lactate/ureidoglycolate dehydrogenase	NA	NA	NA	NA	NA
WP_001759898.1|2923997_2924960_-	DNA-binding protein YbiB	NA	NA	NA	NA	NA
WP_001389891.1|2924987_2927138_-	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	26.0	7.4e-43
WP_001145128.1|2927257_2927740_+	N-glycosidase YbiA	NA	A0A0H3TLU0	Faustovirus	52.7	1.5e-36
2927821:2927855	attL	TGCCGGATGCGGCGTAAACGCCTTATCCGGCCTAC	NA	NA	NA	NA
WP_000007110.1|2927971_2929336_-	ATP-dependent RNA helicase RhlE	NA	A0A1V0SBR7	Catovirus	31.8	1.5e-52
WP_001296991.1|2929564_2930236_+	DNA-binding transcriptional regulator CecR	NA	NA	NA	NA	NA
WP_001296990.1|2930238_2931234_+	secretion protein HlyD	NA	NA	NA	NA	NA
WP_000996091.1|2931226_2932963_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	30.3	1.3e-18
WP_000070131.1|2932955_2934089_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000469031.1|2934099_2935206_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000871982.1|2935167_2935578_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001113348.1|2935710_2936472_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000650337.1|2936468_2937710_+	cardiolipin synthase ClsB	NA	NA	NA	NA	NA
WP_000045450.1|2937709_2938666_+	UPF0104 family protein	NA	NA	NA	NA	NA
WP_000446938.1|2938701_2939415_-	Bax inhibitor-1/YccA family protein	NA	NA	NA	NA	NA
WP_000373624.1|2939619_2940324_-	Bax inhibitor-1/YccA family protein	NA	NA	NA	NA	NA
WP_000852294.1|2940459_2940912_-	molybdopterin synthase catalytic subunit MoaE	NA	NA	NA	NA	NA
WP_000598613.1|2940913_2941159_-	molybdopterin synthase sulfur carrier subunit	NA	NA	NA	NA	NA
WP_000080885.1|2941151_2941637_-	cyclic pyranopterin monophosphate synthase MoaC	NA	NA	NA	NA	NA
WP_000084639.1|2941639_2942152_-	molybdenum cofactor biosynthesis protein B	NA	NA	NA	NA	NA
WP_001695656.1|2942173_2943163_-	GTP 3',8-cyclase MoaA	NA	NA	NA	NA	NA
WP_096974551.1|2943559_2944468_+	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	30.7	3.5e-26
WP_000042533.1|2944659_2946681_-	excinuclease ABC subunit B	NA	NA	NA	NA	NA
WP_000044868.1|2947259_2947937_-	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_000246805.1|2947929_2948685_-	malonyl-ACP O-methyltransferase BioC	NA	NA	NA	NA	NA
WP_000118864.1|2948671_2949826_-	8-amino-7-oxononanoate synthase	NA	NA	NA	NA	NA
WP_000951213.1|2949822_2950863_-	biotin synthase BioB	NA	NA	NA	NA	NA
WP_001356070.1|2950949_2952239_+	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.1	3.4e-19
WP_000767389.1|2952297_2952774_+	kinase inhibitor	NA	NA	NA	NA	NA
WP_096974550.1|2953519_2954851_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	36.6	7.2e-20
WP_001759894.1|2954924_2955509_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.8	1.6e-104
WP_099481771.1|2955508_2958907_-	short-chain fatty acid transporter	NA	X2KTY7	Enterobacteria_phage	35.5	1.8e-11
WP_001233090.1|2958971_2959571_-	Ail/Lom family protein	NA	A5LH44	Enterobacteria_phage	97.5	8.2e-109
WP_099481743.1|2959640_2963072_-	host specificity protein J	NA	A5LH43	Enterobacteria_phage	95.3	0.0e+00
WP_000090895.1|2963132_2963765_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	89.5	5.5e-95
WP_096974577.1|2963701_2964445_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.0	1.0e-145
WP_001152639.1|2964450_2965149_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	100.0	2.3e-134
WP_000847379.1|2965148_2965478_-|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	100.0	9.6e-59
WP_016230701.1|2965474_2968036_-|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	92.5	0.0e+00
WP_000459457.1|2968028_2968463_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_001695278.1|2968444_2968867_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	83.6	3.2e-59
WP_000904922.1|2969296_2969869_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	85.2	4.6e-85
WP_099486187.1|2969928_2970297_+|tail	phage tail protein	tail	F1BUP1	Erwinia_phage	37.7	1.6e-09
WP_000376429.1|2970300_2970720_+|tail	phage tail assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	54.4	5.0e-36
WP_001339397.1|2971263_2971941_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000624622.1|2971940_2972288_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_000381395.1|2972307_2973879_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_001139678.1|2974035_2974188_-	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	96.0	3.1e-20
WP_001228702.1|2974216_2974423_-	hypothetical protein	NA	H6WRZ6	Salmonella_phage	98.5	5.3e-31
WP_001759865.1|2974639_2975137_-	lysozyme	NA	A0A291AWW2	Escherichia_phage	97.0	2.7e-89
WP_000839582.1|2975136_2975352_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	98.6	1.2e-33
WP_000592543.1|2976621_2977581_-	DUF523 and DUF1722 domain-containing protein	NA	NA	NA	NA	NA
WP_000780581.1|2977773_2978298_+	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	54.1	1.1e-48
WP_001204777.1|2978453_2978831_-	antitermination protein	NA	Q777W5	Enterobacteria_phage	84.2	7.3e-55
WP_000971055.1|2978916_2979057_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	1.1e-08
WP_001099712.1|2979053_2979416_-	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
WP_000950954.1|2979435_2979630_-	protein ninF	NA	NA	NA	NA	NA
WP_000386643.1|2979622_2979964_-	DUF2591 domain-containing protein	NA	Q76H72	Enterobacteria_phage	96.5	1.6e-61
WP_001254223.1|2979966_2980143_-	NinE family protein	NA	K7PHE6	Enterobacteria_phage	98.3	1.4e-27
WP_001752315.1|2980139_2980667_-	phage N-6-adenine-methyltransferase	NA	A0A1I9LJP9	Stx_converting_phage	99.4	4.7e-100
WP_000736903.1|2980663_2981104_-	recombination protein NinB	NA	A0A220NRM1	Escherichia_phage	100.0	7.0e-81
WP_000145931.1|2981177_2981468_-	protein ren	NA	A0A1I9LJP5	Stx_converting_phage	100.0	9.6e-47
WP_000788869.1|2981464_2982166_-	Replication protein P	NA	A0A0P0ZD31	Stx2-converting_phage	99.6	1.3e-129
WP_001540839.1|2982162_2983062_-	replication protein	NA	M1FN81	Enterobacteria_phage	99.7	6.5e-174
WP_001177650.1|2983096_2983375_-	transcriptional regulator	NA	K7P7A2	Enterobacteria_phage	100.0	1.6e-43
WP_000276886.1|2983483_2983669_-	hypothetical protein	NA	A5VW97	Enterobacteria_phage	100.0	1.6e-26
WP_001095981.1|2983749_2984400_+	LexA family transcriptional regulator	NA	K7PM82	Enterobacteria_phage	98.6	4.1e-122
WP_001358311.1|2984712_2984985_+	hypothetical protein	NA	K7PH69	Enterobacterial_phage	96.7	4.0e-26
WP_001066169.1|2985001_2985583_-	superinfection exclusion protein B	NA	Q9EYA9	Enterobacteria_phage	100.0	4.0e-100
WP_085949154.1|2985800_2986947_+|transposase	IS3-like element ISEc52 family transposase	transposase	Q716C2	Shigella_phage	96.3	2.4e-173
WP_050489322.1|2987009_2987654_+|integrase	tyrosine-type recombinase/integrase	integrase	Q9MCR4	Enterobacteria_phage	99.1	9.8e-116
2989088:2989122	attR	TGCCGGATGCGGCGTAAACGCCTTATCCGGCCTAC	NA	NA	NA	NA
>prophage 13
NZ_CP024278	Escherichia coli strain ATCC 43896 chromosome, complete genome	5088038	3512888	3569356	5088038	transposase,tRNA,plate	Stx2-converting_phage(27.27%)	44	NA	NA
WP_000381395.1|3512888_3514460_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_000624622.1|3514479_3514827_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_001339397.1|3514826_3515504_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_001471156.1|3516073_3516523_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001759735.1|3516534_3520785_-	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	44.2	3.2e-21
WP_000103319.1|3520860_3523002_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.0	1.1e-25
WP_001142958.1|3523211_3523730_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000037395.1|3524426_3524927_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_000123970.1|3524961_3525186_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000056978.1|3525236_3526712_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_000611742.1|3526718_3527132_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000393845.1|3527135_3528986_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000348806.1|3528949_3530032_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_001113703.1|3530056_3531337_+	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_001080144.1|3531333_3531858_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_001759733.1|3531860_3533192_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_000343293.1|3533196_3533958_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_000614335.1|3533966_3536726_+	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	31.0	2.7e-82
WP_000088873.1|3536722_3537466_+	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_001240543.1|3537470_3538886_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_122996853.1|3538994_3542429_+	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_000377959.1|3542439_3543792_+	membrane protein	NA	NA	NA	NA	NA
WP_001284199.1|3543815_3544298_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000908057.1|3544341_3545256_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001236649.1|3545265_3545745_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001086142.1|3545881_3546667_-	aminopeptidase	NA	NA	NA	NA	NA
WP_001297205.1|3547206_3547938_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.0	3.4e-40
WP_000917883.1|3548002_3548470_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001297210.1|3548466_3549189_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001052720.1|3549222_3549978_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000644685.1|3550049_3551408_+	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_000211710.1|3551455_3552226_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001230983.1|3552303_3553104_-	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000648572.1|3553344_3554259_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000997043.1|3554255_3555059_-	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.6	3.2e-39
WP_001140187.1|3560944_3561520_-	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_000593994.1|3561707_3562739_+	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	7.2e-36
WP_001294600.1|3562731_3563385_+	methionine ABC transporter permease MetI	NA	NA	NA	NA	NA
WP_000874226.1|3563424_3564240_+	methionine ABC transporter substrate-binding lipoprotein MetQ	NA	NA	NA	NA	NA
WP_001202329.1|3564357_3564762_+	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
WP_000094011.1|3564758_3565466_+|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_001260716.1|3565576_3567295_+|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_001346133.1|3567347_3568172_+	YaeF family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_000399648.1|3568375_3569356_-|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
>prophage 14
NZ_CP024278	Escherichia coli strain ATCC 43896 chromosome, complete genome	5088038	3910341	3922669	5088038	integrase	Enterobacteria_phage(80.0%)	14	3894316:3894330	3928017:3928031
3894316:3894330	attL	CCAGCTGGCTTTTGA	NA	NA	NA	NA
WP_001219054.1|3910341_3911052_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	42.7	1.8e-41
WP_099486200.1|3911811_3914145_-	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	99.2	0.0e+00
WP_000856729.1|3914159_3914480_-	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_000459294.1|3914615_3915071_-	hypothetical protein	NA	Q7M298	Enterobacteria_phage	99.1	1.6e-64
WP_001244670.1|3915063_3915351_-	hypothetical protein	NA	Q7M2A0	Enterobacteria_phage	96.8	2.5e-47
WP_032226384.1|3915343_3915898_-	ash family protein	NA	Q7M2A7	Enterobacteria_phage	80.2	4.0e-41
WP_001149160.1|3915894_3916161_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	100.0	4.9e-45
WP_001760491.1|3916712_3917447_+	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	98.8	8.0e-130
WP_001656861.1|3917443_3917944_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_000446145.1|3918017_3918590_+	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	96.2	1.4e-94
WP_000931915.1|3919000_3919402_+	protein gop	NA	NA	NA	NA	NA
WP_001357996.1|3919404_3920472_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001357997.1|3920499_3921294_-	sce7726 family protein	NA	A0A0U2RXY7	Escherichia_phage	28.6	8.3e-08
WP_000772677.1|3921400_3922669_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	41.0	1.1e-73
3928017:3928031	attR	CCAGCTGGCTTTTGA	NA	NA	NA	NA
>prophage 1
NZ_CP024281	Escherichia coli strain ATCC 43896 plasmid unnamed3, complete sequence	84894	10255	51667	84894	transposase,protease,integrase	Escherichia_phage(33.33%)	37	32239:32298	50911:51731
WP_000381395.1|10255_11827_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_031943252.1|11899_14080_+	type IV conjugative transfer system coupling protein TraD	NA	NA	NA	NA	NA
WP_000986934.1|14079_19350_+	conjugative transfer relaxase/helicase TraI	NA	NA	NA	NA	NA
WP_000205725.1|19369_20116_+	type-F conjugative transfer system pilin acetylase TraX	NA	A0A077JBM8	Xanthomonas_phage	30.8	2.4e-09
WP_000704528.1|20174_21035_+	alpha/beta hydrolase	NA	A2RQC8	Archaeal_BJ1_virus	23.8	6.7e-11
WP_000139321.1|21137_21698_+	fertility inhibition protein FinO	NA	NA	NA	NA	NA
WP_001309245.1|21826_22039_+	ANR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001233838.1|22283_22745_+	thermonuclease family protein	NA	A0A0R6PHV6	Moraxella_phage	37.1	4.2e-20
WP_001298565.1|22790_23000_+	hemolysin expression modulator Hha	NA	NA	NA	NA	NA
WP_000766805.1|23037_23628_+	DUF2726 domain-containing protein	NA	NA	NA	NA	NA
WP_000083819.1|23867_24128_+	replication regulatory protein RepA	NA	NA	NA	NA	NA
WP_001365705.1|24352_24427_+	RepA leader peptide Tap	NA	NA	NA	NA	NA
WP_000130647.1|24419_25277_+	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
WP_000616807.1|26215_26869_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000557619.1|26961_27219_+	type II toxin-antitoxin system antitoxin PemI	NA	NA	NA	NA	NA
WP_001398199.1|27151_27553_+	type II toxin-antitoxin system toxin endoribonuclease PemK	NA	NA	NA	NA	NA
WP_096974573.1|29261_32261_-|transposase	Tn3-like element Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	99.1	0.0e+00
32239:32298	attL	GGCACTGTTGCAAAGTTAGCGATGAGGCAGCCTTTTGTCTTATTCAAAGGCCTTACATTT	NA	NA	NA	NA
WP_001067855.1|32290_32995_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000454193.1|33204_33555_-	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_000845048.1|33757_34771_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_001206316.1|34919_35711_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
WP_000679427.1|35874_36222_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259031.1|36215_37055_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000376623.1|37182_37683_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001163403.1|37858_38641_-	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	35.0	2.5e-33
WP_001324342.1|38630_40154_-|transposase	IS21-like element IS1326 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	24.2	1.2e-15
WP_000344784.1|41871_42732_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_000935451.1|42734_44450_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_000204520.1|44488_45196_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_000993386.1|45192_45429_-	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_001277456.1|45425_45788_-	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_000105636.1|45805_47500_-	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.6	8.8e-39
WP_001340589.1|47551_47974_-	organomercurial transporter MerC	NA	NA	NA	NA	NA
WP_000732292.1|48009_48285_-	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_001294663.1|48298_48649_-	mercuric transport protein MerT	NA	NA	NA	NA	NA
WP_000429836.1|48720_49155_+	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_001067855.1|50962_51667_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
50911:51731	attR	GGCACTGTTGCAAAGTTAGCGATGAGGCAGCCTTTTGTCTTATTCAAAGGCCTTACATTTCAAAAACTCTGCTTACCAGGCGCATTTCGCCCAGGGGATCACCATAATAAAATGCTGAGGCCTGGCCTTTGCGTAGTGCACGCATCACCTCAATACCTTTGATGGTGGCGTAAGCCGTCTTCATGGATTTAAATCCCAGCGTGGCGCCGATTATCCGTTTCAGTTTGCCATGATCGCATTCAATCACGTTGTTCCGGTACTTAATCTGTCGGTGTTCAACGTCAGACGGGCACCGGCCTTCGCGTTTGAGCAGAGCAAGCGCGCGACCATAGGCGGGCGCTTTATCCGTGTTGATGAATCGCGGGATCTGCCACTTCTTCACGTTGTTGAGGATTTTACCCAGAAACCGGTATGCAGCTTTGCTGTTACGACGGGAGGAGAGATAAAAATCGACAGTGCGGCCCCGGCTGTCGACGGCCCGGTACAGATACGCCCAGCGGCCATTGACCTTCACGTAGGTTTCATCCATGTGCCACGGGCAAAGATCGGAAGGGTTACGCCAGTACCAGCGCAGCCGTTTTTCCATTTCAGGCGCATAACGCTGAACCCAGCGGTAAATCGTGGAGTGATCGACATTCACTCCGCGTTCAGCCAGCATCTCCTGCAGCTCACGGTAACTGATGCCGTATTTGCAGTACCAGCGTACGGCCCACAGAATGATGTCACGCTGAAAATGCCGGCCTTTGAATGGGTTCATGTGCAGCTCCATCAGCAAAAGGGGATGATAAGTTTATCACCACCGACTATTTGCAACAGTGCCC	NA	NA	NA	NA
