The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP024257	Escherichia coli O25:H16 strain F5505-C1 chromosome, complete genome	4886938	1106828	1156086	4886938	integrase,tRNA,protease,transposase	Stx2-converting_phage(41.67%)	48	1113888:1113903	1158041:1158056
WP_000952428.1|1106828_1108001_+|transposase	IS21-like element ISEc62 family transposase	transposase	U5N3F9	Enterobacteria_phage	93.1	8.9e-216
WP_000544809.1|1108000_1108795_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	94.3	1.3e-138
WP_001380893.1|1109262_1109595_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000813456.1|1111378_1111981_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000840364.1|1112418_1112685_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000422741.1|1112838_1113264_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
WP_000624722.1|1113260_1113611_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
1113888:1113903	attL	GAAGTTGAACTGGCTG	NA	NA	NA	NA
WP_000255944.1|1115617_1116640_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_077758818.1|1116636_1117419_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_072148235.1|1117479_1117650_+	hemolysin activation protein	NA	NA	NA	NA	NA
WP_000221530.1|1118395_1118965_+	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_001736061.1|1119224_1119626_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001221620.1|1119613_1120048_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001339397.1|1120433_1121111_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000624622.1|1121110_1121458_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_000381395.1|1121477_1123049_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_000612632.1|1123486_1123834_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	98.3	1.4e-60
WP_005761259.1|1126097_1127363_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	37.6	3.3e-75
WP_000234533.1|1127741_1128449_-	DUF554 domain-containing protein	NA	NA	NA	NA	NA
WP_099558278.1|1128841_1130977_+	ornithine decarboxylase	NA	NA	NA	NA	NA
WP_001049791.1|1131025_1132282_-	nucleoside permease	NA	NA	NA	NA	NA
WP_001298916.1|1132483_1133563_-	membrane-bound lytic murein transglycosylase MltC	NA	NA	NA	NA	NA
WP_000091700.1|1133627_1133903_-	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_001295382.1|1133930_1134983_-	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_000786911.1|1135143_1135863_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_001107564.1|1135862_1136189_+	YggL family protein	NA	NA	NA	NA	NA
WP_000984796.1|1136372_1137092_+	DUF2884 domain-containing protein	NA	NA	NA	NA	NA
WP_000394125.1|1137267_1138314_+	L-asparaginase 2	NA	NA	NA	NA	NA
WP_000745217.1|1138430_1139438_+	DUF1202 family protein	NA	NA	NA	NA	NA
WP_000239928.1|1139592_1140729_-	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_001174735.1|1140721_1141315_-	XTP/dITP diphosphatase	NA	NA	NA	NA	NA
WP_001277222.1|1141322_1141613_-	YggU family protein	NA	NA	NA	NA	NA
WP_001094831.1|1141609_1142176_-	osmotic shock tolerance protein YggT	NA	NA	NA	NA	NA
WP_000997795.1|1142193_1142898_-	pyridoxal phosphate homeostasis protein	NA	NA	NA	NA	NA
WP_001389259.1|1142915_1143896_+	type IV pilus twitching motility protein PilT	NA	NA	NA	NA	NA
WP_000017111.1|1144070_1144487_-	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_001053178.1|1144486_1145050_-	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_000593273.1|1145158_1146109_-	glutathione synthase	NA	NA	NA	NA	NA
WP_001222509.1|1146121_1146853_-	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_000286517.1|1146932_1147640_-	deoxyribonuclease I	NA	NA	NA	NA	NA
WP_032142436.1|1147734_1148232_-|protease	SprT family zinc-dependent metalloprotease	protease	NA	NA	NA	NA
WP_001112301.1|1148308_1149703_-	sugar porter family MFS transporter	NA	NA	NA	NA	NA
WP_001062128.1|1150138_1151293_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	63.2	4.0e-128
WP_001298919.1|1151432_1151600_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001297406.1|1151947_1152079_+	acid stress response protein YqgB	NA	NA	NA	NA	NA
WP_001556203.1|1152087_1154064_+	biosynthetic arginine decarboxylase	NA	NA	NA	NA	NA
WP_000105566.1|1154201_1155122_+	agmatinase	NA	NA	NA	NA	NA
WP_001319878.1|1155327_1156086_-|protease	metalloprotease LoiP	protease	NA	NA	NA	NA
1158041:1158056	attR	GAAGTTGAACTGGCTG	NA	NA	NA	NA
>prophage 2
NZ_CP024257	Escherichia coli O25:H16 strain F5505-C1 chromosome, complete genome	4886938	1730557	1749223	4886938	integrase,tail,transposase	Enterobacteria_phage(50.0%)	28	1726867:1726883	1751804:1751820
1726867:1726883	attL	GGTTGTCGATACCAATA	NA	NA	NA	NA
WP_001163428.1|1730557_1730758_-	response regulator inhibitor TorI	NA	K7P7V0	Enterobacteria_phage	100.0	2.4e-33
WP_032199548.1|1730890_1731070_-	Eag protein	NA	K7PL40	Enterobacteria_phage	98.3	7.3e-29
WP_032199551.1|1731166_1731700_-	DUF551 domain-containing protein	NA	K7PK20	Enterobacteria_phage	90.1	1.5e-77
WP_065225552.1|1731702_1731894_-	hypothetical protein	NA	G9L660	Escherichia_phage	95.2	8.9e-25
WP_099558285.1|1731895_1732423_-	ead/Ea22-like family protein	NA	K7P6J7	Enterobacteria_phage	66.0	1.7e-73
WP_000118152.1|1732424_1732724_-	hypothetical protein	NA	Q716F3	Shigella_phage	100.0	1.5e-58
WP_001214453.1|1732720_1732888_-	DUF2737 family protein	NA	Q716F2	Shigella_phage	100.0	1.7e-24
WP_001111303.1|1732898_1733192_-	DUF2856 family protein	NA	K7P7E6	Enterobacteria_phage	100.0	5.0e-51
WP_000951323.1|1733215_1733599_-	hypothetical protein	NA	K7P6P8	Enterobacteria_phage	99.2	8.5e-67
WP_097517341.1|1733598_1734204_-	ERF family protein	NA	Q9MCQ9	Enterobacteria_phage	99.5	7.1e-108
WP_032146364.1|1734460_1734736_-	hypothetical protein	NA	K7PGS9	Enterobacteria_phage	98.9	1.3e-45
WP_000167595.1|1734825_1735296_-	hypothetical protein	NA	A0A1I9LJN4	Stx_converting_phage	100.0	3.7e-88
WP_099558287.1|1735653_1736106_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024169843.1|1736108_1736492_-	hypothetical protein	NA	Q08J47	Stx2-converting_phage	99.2	1.1e-63
WP_001645093.1|1737161_1737386_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001274760.1|1737608_1738322_-	LexA family transcriptional regulator	NA	A4KWV9	Enterobacteria_phage	100.0	1.8e-131
WP_000437876.1|1738422_1738623_+	hypothetical protein	NA	A4KWW0	Enterobacteria_phage	100.0	3.3e-30
WP_000438527.1|1738761_1739058_+	hypothetical protein	NA	A4KWW1	Enterobacteria_phage	99.0	1.5e-47
WP_000539350.1|1739238_1740060_+	replication protein	NA	K7PJZ3	Enterobacterial_phage	99.3	4.4e-153
WP_032199562.1|1740056_1741433_+	AAA family ATPase	NA	A0A0P0ZC27	Stx2-converting_phage	99.6	2.8e-253
WP_032199564.1|1741505_1741712_+	membrane protein	NA	G8C7M4	Escherichia_phage	98.5	2.1e-27
WP_032199566.1|1741729_1742050_+	hypothetical protein	NA	A0A2I6PIG0	Escherichia_phage	74.5	5.9e-37
WP_014640011.1|1742195_1742978_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.2	7.7e-139
WP_000255946.1|1742974_1743997_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.4	4.6e-200
WP_099558389.1|1744205_1745807_+|tail	tail fiber domain-containing protein	tail	A0A1P8BK41	Escherichia_virus	42.4	3.7e-39
WP_077823771.1|1745901_1746546_-	CatB-related O-acetyltransferase	NA	M1HKK6	Paramecium_bursaria_Chlorella_virus	41.9	2.6e-20
WP_074480944.1|1746821_1747979_-|integrase	prophage integrase IntS	integrase	A5VW56	Enterobacteria_phage	99.0	1.4e-221
WP_000368140.1|1748290_1749223_-	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	99.0	2.5e-165
1751804:1751820	attR	GGTTGTCGATACCAATA	NA	NA	NA	NA
>prophage 3
NZ_CP024257	Escherichia coli O25:H16 strain F5505-C1 chromosome, complete genome	4886938	1997275	2006716	4886938		Enterobacteria_phage(85.71%)	10	NA	NA
WP_000569357.1|1997275_1998202_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	1.7e-23
WP_000783120.1|1998206_1998938_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|1998918_1999026_-	protein YohO	NA	NA	NA	NA	NA
WP_001240401.1|1999085_1999817_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001295431.1|2000038_2001724_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_000598641.1|2001720_2002440_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000950409.1|2002486_2002957_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	5.2e-82
WP_001295429.1|2002996_2003458_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001375261.1|2003582_2005583_-	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	96.1	0.0e+00
WP_001333512.1|2005579_2006716_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.7	1.9e-162
>prophage 4
NZ_CP024257	Escherichia coli O25:H16 strain F5505-C1 chromosome, complete genome	4886938	2018347	2095213	4886938	head,lysis,transposase,terminase,holin,integrase,tRNA,plate,capsid,portal,tail	Escherichia_phage(30.43%)	76	2045589:2045615	2077634:2077660
WP_001350533.1|2018347_2020381_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.8e-54
WP_001005448.1|2020512_2021622_+	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_001324851.1|2021884_2022166_+	YehE family protein	NA	NA	NA	NA	NA
WP_000830456.1|2022458_2023001_+	fimbrial protein	NA	NA	NA	NA	NA
WP_000945448.1|2023770_2026251_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_000405695.1|2026266_2027301_+	putative fimbrial-like adhesin protein	NA	NA	NA	NA	NA
WP_000153074.1|2027382_2027721_-	Ni(II)/Co(II) efflux transporter accessory subunit RcnB	NA	NA	NA	NA	NA
WP_001735444.1|2027939_2028764_-	nickel/cobalt efflux protein RcnA	NA	NA	NA	NA	NA
WP_000019944.1|2028884_2029157_+	Ni(II)/Co(II)-binding transcriptional repressor RcnR	NA	NA	NA	NA	NA
WP_001195568.1|2029379_2030168_+	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
WP_000822266.1|2030164_2030965_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_001352238.1|2031029_2031848_+	glycoside hydrolase family 25 protein	NA	D0R7H8	Paenibacillus_phage	38.0	1.9e-23
WP_000434038.1|2031899_2032646_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000011958.1|2032619_2033585_-	sugar kinase	NA	NA	NA	NA	NA
WP_001735443.1|2033581_2034586_-	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	28.7	3.2e-12
WP_000858484.1|2034582_2035860_-	nucleoside permease	NA	NA	NA	NA	NA
WP_000129543.1|2036116_2037169_+	class I fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_001735442.1|2037476_2038331_+	tagatose-bisphosphate aldolase subunit GatY	NA	NA	NA	NA	NA
WP_000853883.1|2038359_2039622_+	tagatose-bisphosphate aldolase subunit GatZ	NA	NA	NA	NA	NA
WP_001735440.1|2039631_2040084_+	PTS galactitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_000823270.1|2040114_2040399_+	PTS galactitol transporter subunit IIB	NA	NA	NA	NA	NA
WP_000490679.1|2040402_2041758_+	galactitol permease IIC component	NA	NA	NA	NA	NA
WP_000844219.1|2041805_2042846_+	galactitol-1-phosphate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_000178552.1|2042945_2043725_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_000807356.1|2043806_2044706_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	1.7e-12
WP_001318299.1|2045111_2045429_+	hypothetical protein	NA	NA	NA	NA	NA
2045589:2045615	attL	AAAAAATAAGCCCGTGTAAGGGAGATT	NA	NA	NA	NA
WP_001516670.1|2045694_2046708_-|integrase	site-specific integrase	integrase	Q83VS6	Escherichia_phage	99.1	3.1e-193
WP_000020919.1|2046823_2047123_-	helix-turn-helix domain-containing protein	NA	Q1JS61	Enterobacteria_phage	100.0	2.4e-48
WP_001081582.1|2047244_2047520_+	hypothetical protein	NA	Q1JS60	Enterobacteria_phage	100.0	1.3e-48
WP_000217684.1|2047697_2048198_+	hypothetical protein	NA	S4TTB7	Salmonella_phage	99.4	3.8e-91
WP_000557703.1|2048261_2048486_+	DUF2732 family protein	NA	S4TP68	Salmonella_phage	100.0	4.7e-33
WP_001516669.1|2048485_2048785_+	hypothetical protein	NA	S4TUD1	Salmonella_phage	98.0	1.2e-44
WP_001113264.1|2048787_2049012_+	TraR/DksA family transcriptional regulator	NA	S4TRY6	Salmonella_phage	100.0	2.9e-35
WP_000027664.1|2049008_2049284_+	hypothetical protein	NA	U5N3W1	Enterobacteria_phage	100.0	3.8e-45
WP_032199509.1|2049273_2051559_+	replication endonuclease	NA	Q858T4	Yersinia_virus	97.8	0.0e+00
WP_001735437.1|2052119_2054714_-	SIR2-like domain protein	NA	NA	NA	NA	NA
WP_000038182.1|2055218_2056253_-|portal	phage portal protein	portal	Q858W8	Yersinia_virus	99.7	2.4e-201
WP_000156872.1|2056252_2058025_-|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCK3	Escherichia_phage	100.0	0.0e+00
WP_001735435.1|2058198_2059053_+|capsid	GPO family capsid scaffolding protein	capsid	Q94MH0	Enterobacteria_phage	99.3	9.6e-135
WP_032199507.1|2059111_2060185_+|capsid	phage major capsid protein, P2 family	capsid	Q94ME5	Enterobacteria_phage	99.4	2.8e-200
WP_024169832.1|2060188_2060932_+|terminase	terminase endonuclease subunit	terminase	Q94ME4	Enterobacteria_phage	98.0	4.7e-122
WP_005759421.1|2061031_2061541_+|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	98.8	4.3e-90
WP_001735431.1|2061540_2061744_+	phage Tail protein X family protein	NA	U5N3E7	Enterobacteria_phage	98.5	2.0e-30
WP_099558299.1|2061747_2062029_+|holin	holin	holin	A0A0F7LA12	Escherichia_phage	98.9	2.8e-43
WP_001735430.1|2062028_2062526_+	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	98.8	9.9e-92
WP_001598741.1|2062540_2062966_+	hypothetical protein	NA	A0A0F7LDU9	Escherichia_phage	97.2	5.0e-60
WP_001735429.1|2062953_2063379_+|lysis	LysB family phage lysis regulatory protein	lysis	U5N3W5	Enterobacteria_phage	95.7	1.0e-65
WP_001300730.1|2063350_2063524_+	hypothetical protein	NA	Q7Y4E1	Escherichia_virus	94.7	5.2e-24
WP_001735428.1|2063486_2063954_+|tail	phage tail protein	tail	A0A0F7LA33	Escherichia_phage	98.7	8.7e-82
WP_001001767.1|2063946_2064399_+	phage virion morphogenesis protein	NA	A0A0F7LBV9	Escherichia_phage	99.3	2.4e-76
WP_001735427.1|2064465_2065101_+|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	97.6	1.0e-112
WP_001735426.1|2065097_2065445_+	lysozyme family protein	NA	A0A0F7L9X3	Escherichia_phage	99.1	6.5e-58
WP_001735425.1|2065449_2066358_+|plate	baseplate assembly protein	plate	U5N3T9	Enterobacteria_phage	99.7	4.4e-162
WP_001735424.1|2066350_2066881_+|tail	phage tail protein I	tail	U5N0U8	Enterobacteria_phage	99.4	8.6e-102
WP_032199506.1|2066891_2069186_+|tail	phage tail protein	tail	U5N099	Enterobacteria_phage	62.2	8.7e-183
WP_001461858.1|2069189_2069717_+|tail	tail fiber assembly protein	tail	Q7Y4D3	Escherichia_virus	95.4	2.3e-91
WP_001735421.1|2070106_2070634_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001251408.1|2072134_2072653_+|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_001031303.1|2072709_2072985_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
WP_000785970.1|2073017_2073137_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_001735420.1|2073129_2075577_+|tail	phage tail tape measure protein	tail	M1T2S3	Escherichia_phage	96.3	0.0e+00
WP_001389981.1|2075591_2076071_+|tail	phage tail protein	tail	M1TAU1	Escherichia_phage	99.4	1.1e-84
WP_005759234.1|2076070_2077234_+	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	99.5	8.3e-206
WP_000468308.1|2077315_2077534_+	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_000476014.1|2077804_2079166_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	99.7	1.9e-217
2077634:2077660	attR	AAAAAATAAGCCCGTGTAAGGGAGATT	NA	NA	NA	NA
WP_000929408.1|2079312_2079645_-	YegP family protein	NA	NA	NA	NA	NA
WP_000137877.1|2079835_2080558_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.6	3.7e-31
WP_074483220.1|2080554_2081958_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.0	2.3e-32
WP_001735415.1|2083369_2086447_-	multidrug efflux RND transporter permease subunit MdtC	NA	NA	NA	NA	NA
WP_001197880.1|2086447_2089570_-	multidrug efflux RND transporter permease subunit MdtB	NA	NA	NA	NA	NA
WP_000678989.1|2089569_2090817_-	multidrug efflux RND transporter subunit MdtA	NA	NA	NA	NA	NA
WP_001386899.1|2091095_2091152_+	type I toxin-antitoxin system Ibs family toxin	NA	NA	NA	NA	NA
WP_001300563.1|2091231_2092344_+|transposase	IS4-like element IS421 family transposase	transposase	NA	NA	NA	NA
WP_099554548.1|2092597_2094169_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.9	9.9e-170
WP_000624622.1|2094188_2094536_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_099554551.1|2094535_2095213_-|transposase	transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
>prophage 5
NZ_CP024257	Escherichia coli O25:H16 strain F5505-C1 chromosome, complete genome	4886938	2133201	2139501	4886938		Enterobacteria_phage(33.33%)	6	NA	NA
WP_001735404.1|2133201_2134596_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	33.5	1.3e-19
WP_000183060.1|2134770_2135664_+	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	1.0e-46
WP_000699428.1|2136035_2137121_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.4	1.7e-99
WP_001023634.1|2137120_2138020_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.5	7.4e-29
WP_001735403.1|2138077_2138956_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	A0A291LA53	Escherichia_phage	63.4	2.1e-105
WP_001100809.1|2138958_2139501_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	62.5	2.4e-51
>prophage 6
NZ_CP024257	Escherichia coli O25:H16 strain F5505-C1 chromosome, complete genome	4886938	2812823	2890110	4886938	lysis,transposase,terminase,integrase,tRNA,tail	Escherichia_phage(39.66%)	82	2853477:2853492	2895711:2895726
WP_099554595.1|2812823_2813986_-|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
WP_000138617.1|2815707_2817207_-	NAD-dependent phenylacetaldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001067519.1|2817442_2818348_+	transcriptional regulator FeaR	NA	NA	NA	NA	NA
WP_001300734.1|2818519_2818846_-	YdbL family protein	NA	NA	NA	NA	NA
WP_000698145.1|2818853_2819039_-	YnbE family lipoprotein	NA	NA	NA	NA	NA
WP_000900942.1|2819035_2821675_-	YdbH family protein	NA	NA	NA	NA	NA
WP_000762236.1|2821882_2822872_+	D-lactate dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	44.0	1.5e-70
WP_001298828.1|2822982_2823405_+	heat shock protein HslJ	NA	NA	NA	NA	NA
WP_001295715.1|2823401_2823668_-	DUF333 domain-containing protein	NA	NA	NA	NA	NA
WP_000628243.1|2823941_2827466_+	pyruvate:ferredoxin (flavodoxin) oxidoreductase	NA	NA	NA	NA	NA
WP_001735186.1|2827832_2828966_+	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	58.3	7.0e-117
WP_001300461.1|2829106_2829541_+	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.8e-28
WP_000286865.1|2830126_2831041_+	iron/manganese ABC transporter substrate-binding protein SitA	NA	NA	NA	NA	NA
WP_000983718.1|2831040_2831868_+	iron/manganese ABC transporter ATP-binding protein SitB	NA	G9BWD6	Planktothrix_phage	28.5	3.8e-11
WP_099558309.1|2831864_2832722_+	iron/manganese ABC transporter permease subunit SitC	NA	NA	NA	NA	NA
WP_000968125.1|2832718_2833576_+	iron/manganese ABC transporter permease subunit SitD	NA	NA	NA	NA	NA
WP_024186259.1|2833923_2834217_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001353819.1|2834259_2835300_-|tail	tail fiber domain-containing protein	tail	A0A0E3M4A9	Enterobacteria_phage	67.3	1.4e-124
WP_000654155.1|2835309_2835591_-	hypothetical protein	NA	A0A1X7QHA1	Escherichia_phage	50.0	1.4e-18
WP_000741751.1|2835587_2837939_-	hypothetical protein	NA	A0A0E3M0V5	Enterobacteria_phage	43.7	7.0e-87
WP_099558311.1|2838003_2838603_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	92.5	1.2e-102
WP_099558313.1|2838670_2842066_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	89.3	0.0e+00
WP_032156414.1|2842126_2842774_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	95.3	2.1e-110
WP_002431209.1|2842671_2843415_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	98.8	1.4e-150
WP_001152433.1|2843420_2844119_-|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	94.4	2.1e-127
WP_000024051.1|2844118_2844457_-|tail	phage tail protein	tail	H6WZM2	Escherichia_phage	50.0	4.0e-28
WP_099558315.1|2844449_2847683_-|tail	phage tail tape measure protein	tail	A0A2H4J9A1	uncultured_Caudovirales_phage	33.1	3.3e-103
WP_001755909.1|2847846_2848047_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012565075.1|2848154_2848514_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000094292.1|2848664_2849627_-	hypothetical protein	NA	A0A059VG08	Pseudomonas_phage	39.2	4.5e-56
WP_000144678.1|2849653_2850046_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001029816.1|2850042_2850423_-	hypothetical protein	NA	A0A059VF88	Pseudomonas_phage	44.4	8.6e-19
WP_000524260.1|2850423_2850807_-	hypothetical protein	NA	A0A0P0I456	Acinetobacter_phage	39.4	2.2e-14
WP_000634212.1|2850806_2851202_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016242649.1|2851424_2852564_-	hypothetical protein	NA	G8C7P7	Escherichia_phage	75.0	2.6e-159
WP_000770042.1|2852662_2853427_-	hypothetical protein	NA	G8C7P6	Escherichia_phage	64.2	6.9e-84
2853477:2853492	attL	ATCGCAGCAATAAAAA	NA	NA	NA	NA
WP_001363932.1|2853531_2854644_-	hypothetical protein	NA	I6PD76	Cronobacter_phage	54.5	7.1e-114
WP_000763702.1|2854627_2856034_-	DUF4055 domain-containing protein	NA	G8C7P4	Escherichia_phage	69.2	1.0e-186
WP_099558317.1|2856036_2857338_-|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	59.6	4.7e-149
WP_000089450.1|2857318_2858413_-	hypothetical protein	NA	A0A0U2RXW9	Escherichia_phage	80.5	1.0e-112
WP_000126788.1|2858416_2858626_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099558319.1|2858603_2859536_-	hypothetical protein	NA	A0A1B1INP7	uncultured_Mediterranean_phage	54.9	6.4e-84
WP_001291093.1|2859528_2860320_-	ParB N-terminal domain-containing protein	NA	R4TG31	Halovirus	40.2	2.8e-48
WP_024165216.1|2860457_2861915_-	potassium transporter TrkG	NA	NA	NA	NA	NA
WP_001228696.1|2862111_2862297_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.2	2.8e-15
WP_000992105.1|2862513_2863047_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	96.0	4.8e-100
WP_000370546.1|2863152_2863425_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000193293.1|2863390_2863735_-	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	94.0	1.4e-36
WP_000839599.1|2863739_2863955_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	98.6	2.0e-33
WP_024233158.1|2864267_2864777_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021562591.1|2864777_2865818_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032342160.1|2866098_2866920_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	60.4	2.6e-81
WP_053289978.1|2866916_2867291_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	64.5	1.7e-35
WP_099558322.1|2867303_2868353_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.4	1.8e-106
WP_023141427.1|2868354_2868627_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	50.8	4.2e-12
WP_000813254.1|2868794_2868950_-	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_001224662.1|2870040_2870223_-	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	100.0	1.4e-27
WP_000403785.1|2870316_2870673_-	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	99.2	1.8e-58
WP_099558324.1|2870730_2871153_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	90.6	9.7e-64
WP_024250660.1|2871168_2871930_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	90.9	9.1e-121
WP_000788969.1|2871952_2872699_-	ATP-binding protein	NA	V5UQI5	Shigella_phage	78.5	4.9e-111
WP_099558326.1|2872705_2873494_-	hypothetical protein	NA	G9L6A8	Escherichia_phage	64.3	2.0e-41
WP_000952428.1|2873897_2875070_+|transposase	IS21-like element ISEc62 family transposase	transposase	U5N3F9	Enterobacteria_phage	93.1	8.9e-216
WP_000544809.1|2875069_2875864_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	94.3	1.3e-138
WP_099558391.1|2875880_2876093_-	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	87.5	8.1e-27
WP_001551044.1|2876145_2876442_-	toxin YdaS	NA	A0A0R6PH31	Moraxella_phage	43.5	1.6e-09
WP_001551043.1|2876565_2877042_+	DNA-binding transcriptional repressor RacR	NA	NA	NA	NA	NA
WP_086977727.1|2877361_2877517_+	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	53.2	6.8e-07
WP_001312793.1|2877513_2878002_-	superinfection exclusion protein B	NA	NA	NA	NA	NA
WP_000560223.1|2878443_2878665_+	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	98.6	2.0e-36
WP_099558393.1|2878664_2878835_+	hypothetical protein	NA	A0A0U2SHB5	Escherichia_phage	69.6	7.9e-17
WP_000632297.1|2878909_2879185_+	protein RacC	NA	A0A0U2QW85	Escherichia_phage	96.7	1.4e-42
WP_089075074.1|2879286_2881887_+	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	63.6	7.9e-249
WP_000166319.1|2881879_2882689_+	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	8.8e-106
WP_001317028.1|2882745_2882940_+	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	96.9	5.8e-32
WP_000276809.1|2882932_2883142_+	double-strand break reduction protein RcbA	NA	A0A0U2QL97	Escherichia_phage	98.4	6.1e-27
WP_000079604.1|2883220_2883436_+	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_000040852.1|2883437_2884673_+|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	98.8	5.5e-240
WP_001157406.1|2884724_2885660_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.8	5.9e-146
WP_000123737.1|2885788_2887162_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_000387388.1|2887639_2888623_-	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_000628058.1|2888877_2890110_+	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
2895711:2895726	attR	TTTTTATTGCTGCGAT	NA	NA	NA	NA
>prophage 7
NZ_CP024257	Escherichia coli O25:H16 strain F5505-C1 chromosome, complete genome	4886938	2958627	3021799	4886938	head,protease,transposase,terminase,holin,integrase,capsid,portal,tail	Escherichia_phage(38.46%)	70	2981477:2981490	3023538:3023551
WP_000422045.1|2958627_2959677_-|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
WP_000559286.1|2959896_2960655_+	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.9	4.4e-06
WP_001278906.1|2960651_2961242_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_001291217.1|2961280_2962156_-	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001735169.1|2962366_2964262_-	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
WP_001295575.1|2964289_2964910_-	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001285661.1|2964906_2965788_-	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001700591.1|2965925_2965970_+	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001735168.1|2966061_2967624_+	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_000763511.1|2967623_2969219_+	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	3.8e-52
WP_000209520.1|2970591_2971785_+	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_000443067.1|2971784_2972591_+	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000807651.1|2972971_2973151_+	general stress protein	NA	NA	NA	NA	NA
WP_001056490.1|2973236_2973737_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001079505.1|2973782_2974289_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000937495.1|2975062_2975332_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	79.4	9.3e-20
WP_022645610.1|2975388_2976057_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000885577.1|2976111_2976696_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.8	6.6e-103
WP_000216487.1|2976695_2979722_-	membrane protein	NA	A0A0K2FIZ6	Escherichia_phage	54.5	7.0e-55
WP_001228316.1|2979873_2980473_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	96.5	2.0e-107
2981477:2981490	attL	CCTGATTTCAGCCA	NA	NA	NA	NA
WP_157774315.1|2983197_2984019_-	hypothetical protein	NA	K7PKJ2	Enterobacteria_phage	98.5	1.6e-150
WP_032156414.1|2984079_2984727_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	95.3	2.1e-110
WP_032180051.1|2984624_2985368_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	98.8	1.8e-150
WP_001735013.1|2985373_2986072_-|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	97.0	7.6e-130
WP_001330090.1|2986071_2986428_-|tail	tail protein	tail	A0A0P0ZDL9	Stx2-converting_phage	66.7	2.8e-40
WP_077628067.1|2989678_2989939_-	DUF4035 domain-containing protein	NA	A0A1B5FP87	Escherichia_phage	96.5	1.7e-39
WP_001324129.1|2989980_2990367_-|tail	tail assembly protein	tail	A0A1B5FP91	Escherichia_phage	100.0	8.9e-64
WP_001735010.1|2990366_2991071_-	hypothetical protein	NA	A0A1B5FP82	Escherichia_phage	93.2	3.8e-113
WP_001206306.1|2991130_2991475_-	DUF3168 domain-containing protein	NA	A0A1B5FP84	Escherichia_phage	97.4	1.4e-55
WP_000968644.1|2991471_2991921_-	HK97 gp10 family phage protein	NA	S4TR46	Salmonella_phage	81.2	6.1e-64
WP_001147814.1|2991917_2992256_-|head	phage head closure protein	head	A0A1B5FP90	Escherichia_phage	90.2	7.5e-51
WP_000719065.1|2992264_2992582_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1W6JNZ5	Morganella_phage	49.5	1.8e-22
WP_099554548.1|2992619_2994191_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.9	9.9e-170
WP_000624622.1|2994210_2994558_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_099554551.1|2994557_2995235_-|transposase	transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000766109.1|2995365_2996583_-|capsid	phage major capsid protein	capsid	A0A1W6JP20	Morganella_phage	71.6	5.9e-162
WP_000999828.1|2996597_2997197_-|head,protease	HK97 family phage prohead protease	head,protease	Q8SBH9	Shigella_phage	81.0	1.9e-89
WP_001735009.1|2997189_2998416_-|portal	phage portal protein	portal	Q8SBI0	Shigella_phage	82.8	3.1e-203
WP_001140892.1|2998563_3000321_-|terminase	terminase large subunit	terminase	A0A1B5FP96	Escherichia_phage	99.3	0.0e+00
WP_023153903.1|3000320_3000803_-|terminase	phage terminase small subunit P27 family	terminase	A0A1B5FPA0	Escherichia_phage	97.5	4.3e-84
WP_099558331.1|3000950_3001289_-	HNH endonuclease	NA	A0A1B5FP94	Escherichia_phage	98.2	1.1e-62
WP_000738421.1|3001825_3002119_+	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	90.7	5.9e-44
WP_075202333.1|3002209_3002392_-	hypothetical protein	NA	A0A0P0ZE50	Stx2-converting_phage	77.0	2.2e-17
WP_000992097.1|3002608_3003142_-	lysozyme	NA	Q08J98	Stx2-converting_phage	93.2	1.5e-98
WP_000193264.1|3003205_3003556_-	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	94.0	1.4e-36
WP_000372595.1|3003560_3003776_-|holin	holin	holin	A0A2R2Z340	Escherichia_phage	98.6	3.4e-33
WP_000874243.1|3004083_3004272_-	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	95.2	7.2e-27
WP_000871291.1|3004532_3004868_+	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	74.8	5.2e-44
WP_000562553.1|3005148_3005280_-	DUF3927 domain-containing protein	NA	H6WZJ7	Escherichia_phage	100.0	3.7e-06
WP_001545909.1|3006175_3006997_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	58.6	1.8e-77
WP_000904111.1|3007011_3007368_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	6.1e-35
WP_001332495.1|3008430_3008709_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	46.9	1.3e-11
WP_000813256.1|3009167_3009323_-	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	98.0	5.0e-18
WP_000936611.1|3009423_3009606_+	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	74.5	2.8e-12
WP_000544809.1|3010361_3011156_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	94.3	1.3e-138
WP_000952428.1|3011155_3012328_-|transposase	IS21-like element ISEc62 family transposase	transposase	U5N3F9	Enterobacteria_phage	93.1	8.9e-216
WP_099558333.1|3012409_3012604_-	hypothetical protein	NA	A0A2R2X2A8	Escherichia_phage	94.8	2.5e-27
WP_001224679.1|3012596_3012779_-	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	96.7	1.2e-26
WP_001151210.1|3013286_3013709_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	90.6	1.3e-63
WP_001262393.1|3013749_3014820_-	hypothetical protein	NA	A0A088CD36	Shigella_phage	65.2	4.2e-63
WP_000693853.1|3014891_3015317_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001072337.1|3015313_3015568_-	hypothetical protein	NA	A0A2I6PIE5	Escherichia_phage	60.3	2.8e-18
WP_000233320.1|3015647_3016067_+	helix-turn-helix domain-containing protein	NA	A0A2I6PIE7	Escherichia_phage	47.5	4.2e-19
WP_000379589.1|3016364_3016520_+	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	51.1	8.8e-07
WP_001171960.1|3016679_3016898_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001317853.1|3017437_3017626_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001090200.1|3017622_3017814_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_074504043.1|3017906_3020378_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	57.1	2.3e-56
WP_000113189.1|3020442_3020691_+	excisionase	NA	NA	NA	NA	NA
WP_001735157.1|3020668_3021799_+|integrase	tyrosine-type recombinase/integrase	integrase	O21940	Phage_21	51.4	5.7e-103
3023538:3023551	attR	CCTGATTTCAGCCA	NA	NA	NA	NA
>prophage 8
NZ_CP024257	Escherichia coli O25:H16 strain F5505-C1 chromosome, complete genome	4886938	3508241	3557973	4886938	head,lysis,transposase,terminase,integrase,capsid,tail	Enterobacteria_phage(47.54%)	68	3530761:3530776	3559681:3559696
WP_001507144.1|3508241_3509573_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	37.1	1.4e-20
WP_001735045.1|3509785_3510079_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001735044.1|3510089_3510794_-|tail	tail fiber domain-containing protein	tail	A0A1X7QGH6	Escherichia_phage	61.1	3.0e-57
WP_001735043.1|3510803_3511085_-	hypothetical protein	NA	A0A1X7QHA1	Escherichia_phage	47.8	2.7e-17
WP_077899145.1|3511081_3513433_-|tail	phage tail protein	tail	A0A0E3M0V5	Enterobacteria_phage	43.7	7.0e-87
WP_074483257.1|3513497_3514097_-	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	93.5	1.9e-105
WP_099554600.1|3514164_3517644_-	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	90.2	0.0e+00
WP_000090891.1|3517703_3518336_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.5	2.2e-96
WP_032200299.1|3518272_3519016_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.8	4.3e-147
WP_004000017.1|3519021_3519720_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	99.6	5.1e-134
WP_000847379.1|3519719_3520049_-|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	100.0	9.6e-59
WP_001735026.1|3520045_3522625_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	97.2	0.0e+00
WP_000459457.1|3522617_3523052_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_001735025.1|3523033_3523456_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	95.7	3.4e-69
WP_032200302.1|3523471_3524212_-|tail	phage tail protein	tail	A0A2I6TC77	Escherichia_phage	98.0	9.5e-131
WP_000683129.1|3524219_3524615_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	98.5	8.5e-70
WP_000975081.1|3524611_3525190_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.5	5.9e-80
WP_000785282.1|3525201_3525555_-|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	97.4	6.4e-61
WP_000158875.1|3525566_3525962_-	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	95.5	1.1e-58
WP_000063221.1|3526003_3527029_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	97.9	8.1e-189
WP_001358225.1|3527084_3527417_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	98.2	2.5e-54
WP_000123309.1|3527426_3528746_-	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	99.1	7.4e-235
WP_000198149.1|3530324_3530531_-|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_001027268.1|3530527_3532453_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.7	0.0e+00
3530761:3530776	attL	GCTCTTCAGCAGTCAG	NA	NA	NA	NA
WP_000453580.1|3532427_3532973_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	100.0	2.8e-95
WP_001331705.1|3533361_3533595_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	96.3	9.5e-21
WP_000079508.1|3533652_3534063_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	76.3	1.3e-52
WP_099558345.1|3534506_3536078_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.9	7.6e-170
WP_000624622.1|3536097_3536445_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_001339397.1|3536444_3537122_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_001028465.1|3537228_3537750_-	DNA-binding protein	NA	K7P7K9	Enterobacteria_phage	100.0	1.5e-93
WP_021566044.1|3537954_3538413_-|lysis	lysis protein	lysis	K7PJW6	Enterobacteria_phage	94.1	4.4e-70
WP_000992106.1|3538409_3538943_-	lysozyme	NA	Q08J98	Stx2-converting_phage	93.8	1.1e-99
WP_000370550.1|3539048_3539321_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001468348.1|3539286_3539631_-	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	96.4	4.4e-38
WP_000839596.1|3539635_3539851_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_000737271.1|3540440_3541523_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	80.1	1.6e-166
WP_001204791.1|3541712_3542096_-	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	83.3	4.4e-55
WP_000971095.1|3542181_3542322_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	72.1	1.7e-09
WP_001735006.1|3542318_3542681_-	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	9.5e-60
WP_001735005.1|3542677_3542968_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	94.8	2.5e-47
WP_000224914.1|3542960_3543131_-	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	69.8	2.4e-13
WP_001053009.1|3543130_3543586_-	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.9	9.2e-60
WP_072142085.1|3543582_3543684_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024169787.1|3543776_3544229_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001735002.1|3544225_3544549_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085947771.1|3544698_3545860_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
WP_001735000.1|3546532_3546826_-	hypothetical protein	NA	A0A0N6WES4	Escherichia_phage	93.5	9.4e-42
WP_001734999.1|3546822_3547524_-	replication P family protein	NA	A0A0K2FIT1	Enterobacteria_phage	97.4	1.2e-127
WP_157774317.1|3547495_3548449_-	Replication protein O	NA	A0A0M5M7Y1	Salmonella_phage	63.4	2.2e-108
WP_001182890.1|3548535_3549075_-	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	66.7	8.9e-62
WP_000184665.1|3549105_3549333_-	helix-turn-helix domain-containing protein	NA	Q76H55	Enterobacteria_phage	69.0	3.8e-22
WP_024169786.1|3549443_3550136_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	86.1	1.9e-109
WP_000741702.1|3550265_3551405_+	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_000581650.1|3551401_3551914_+	DUF4411 family protein	NA	NA	NA	NA	NA
WP_000233576.1|3552392_3552599_+	phage encoded cell division inhibitor protein	NA	K7P6H3	Enterobacteria_phage	85.3	3.2e-28
WP_000995491.1|3552674_3552971_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	99.0	3.6e-49
WP_000100847.1|3552976_3553762_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000186848.1|3553758_3554439_+	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	100.0	1.6e-132
WP_000682318.1|3554435_3554618_+	DUF1317 domain-containing protein	NA	A0A0N7CHV0	Escherichia_phage	98.3	1.3e-28
WP_000548531.1|3554590_3554782_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	100.0	7.3e-27
WP_001386642.1|3554792_3555074_+	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	98.9	5.5e-47
WP_000763363.1|3555172_3555394_+	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	98.6	6.4e-35
WP_001289873.1|3555390_3555939_+	ead/Ea22-like family protein	NA	A0A0K2FJF6	Enterobacteria_phage	100.0	2.2e-100
WP_000026224.1|3556130_3556412_+	hypothetical protein	NA	A0A0K2FIU9	Enterobacteria_phage	100.0	2.8e-51
WP_000545728.1|3556499_3556667_+	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	98.2	1.3e-27
WP_001303849.1|3556706_3556925_+	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_000533643.1|3556902_3557973_+|integrase	tyrosine-type recombinase/integrase	integrase	K7P6P6	Enterobacteria_phage	100.0	3.9e-202
3559681:3559696	attR	GCTCTTCAGCAGTCAG	NA	NA	NA	NA
>prophage 9
NZ_CP024257	Escherichia coli O25:H16 strain F5505-C1 chromosome, complete genome	4886938	4014541	4115595	4886938	lysis,protease,transposase,holin,terminase,integrase,portal,tail	Enterobacteria_phage(33.93%)	95	4081246:4081264	4105805:4105823
WP_000131044.1|4014541_4016575_-|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	27.4	3.4e-21
WP_001734849.1|4016703_4017291_+	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_032200161.1|4017304_4018777_+	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_099558360.1|4018790_4020461_+|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.2	4.7e-61
WP_001209109.1|4020673_4021117_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000370307.1|4021584_4022280_-	lactate utilization protein C	NA	NA	NA	NA	NA
WP_000023927.1|4022272_4023700_-	iron-sulfur cluster-binding protein	NA	NA	NA	NA	NA
WP_001102108.1|4023710_4024430_-	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_000339594.1|4024956_4025811_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001046307.1|4026036_4027362_+	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	47.6	2.5e-113
WP_000474084.1|4027470_4027707_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001299021.1|4027718_4028312_+	reactive chlorine species resistance protein RclC	NA	NA	NA	NA	NA
WP_000621009.1|4028901_4029753_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_032200162.1|4029892_4034149_-	intimin-like adhesin FdeC	NA	NA	NA	NA	NA
WP_000662258.1|4035263_4035365_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000803998.1|4035728_4035992_+	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_000866436.1|4035991_4036132_+	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_001147279.1|4036166_4036394_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157774316.1|4037217_4037760_+	ECP biosynthesis operon DNA-binding transcriptional regulator EcpR	NA	NA	NA	NA	NA
WP_000730972.1|4037834_4038422_+	common pilus major fimbrillin subunit EcpA	NA	NA	NA	NA	NA
WP_001131096.1|4039157_4041683_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_001310578.1|4041672_4043316_+	fimbrial adhesin EcpD	NA	NA	NA	NA	NA
WP_001350485.1|4043284_4043995_+	fimbrial chaperone EcpE	NA	NA	NA	NA	NA
WP_001303809.1|4044307_4044637_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_000070699.1|4045915_4046605_+	aldehyde dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_000643332.1|4046601_4047558_+	xanthine dehydrogenase family protein subunit M	NA	NA	NA	NA	NA
WP_000667036.1|4047554_4049753_+	xanthine dehydrogenase family protein molybdopterin-binding subunit	NA	A0A0P0I429	Acinetobacter_phage	25.7	4.3e-38
WP_000121346.1|4049762_4050719_+	molybdenum cofactor insertion chaperone PaoD	NA	NA	NA	NA	NA
WP_001111348.1|4050697_4051108_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000381395.1|4051330_4052902_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_000624622.1|4052921_4053269_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_001339397.1|4053268_4053946_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_052978476.1|4054370_4058825_-	hypothetical protein	NA	A0A2H4PQV1	Staphylococcus_phage	32.4	4.8e-44
WP_052978475.1|4059362_4059947_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	96.4	7.0e-105
WP_052978474.1|4059946_4062973_-	hypothetical protein	NA	A0A0K2FIZ6	Escherichia_phage	55.7	1.1e-63
WP_052978471.1|4063037_4063637_-	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	96.5	4.5e-107
WP_052978470.1|4063704_4067184_-	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	89.7	0.0e+00
WP_023277304.1|4067244_4067892_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	94.9	4.7e-110
WP_099558364.1|4067789_4068533_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	98.0	2.0e-149
WP_063080031.1|4068538_4069237_-|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	96.6	6.4e-129
WP_000847379.1|4069236_4069566_-|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	100.0	9.6e-59
WP_052978462.1|4069562_4072637_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	94.5	0.0e+00
WP_001161009.1|4072608_4072938_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_001300035.1|4072946_4073333_-|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	100.0	1.6e-65
WP_000211104.1|4073393_4074137_-|tail	tail protein	tail	A5LH35	Enterobacteria_phage	99.6	7.8e-133
WP_015674834.1|4074147_4074549_-|tail	tail protein	tail	A0A291AWY2	Escherichia_phage	98.5	3.2e-72
WP_000677097.1|4074545_4075124_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	99.5	5.5e-102
WP_001283153.1|4075135_4075411_-	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
WP_001097050.1|4075403_4075727_-	DUF2190 family protein	NA	A0A291AWX2	Escherichia_phage	100.0	8.5e-52
WP_001442205.1|4075814_4077842_-|protease	Clp protease ClpP	protease	K7PGT6	Enterobacteria_phage	99.4	0.0e+00
WP_072108306.1|4077786_4079367_-|portal	phage portal protein	portal	K7PJP3	Enterobacteria_phage	99.6	8.1e-289
WP_001072975.1|4079294_4079507_-	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_052978460.1|4079503_4081606_-|terminase	phage terminase large subunit family protein	terminase	A0A291AWY5	Escherichia_phage	96.7	0.0e+00
4081246:4081264	attL	ACGTTCTGGCGAGTCGTTT	NA	NA	NA	NA
WP_000373425.1|4081605_4082100_-	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	100.0	9.9e-84
WP_000072969.1|4082404_4083697_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000005499.1|4083693_4084116_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024183607.1|4084304_4084817_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	31.1	7.3e-05
WP_000992103.1|4084822_4085356_-	lysozyme	NA	Q08J98	Stx2-converting_phage	92.7	6.9e-99
WP_052978306.1|4085419_4085770_-	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	94.0	1.9e-36
WP_052978305.1|4085774_4085990_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	98.6	2.0e-33
WP_099558366.1|4086057_4087110_-	site-specific DNA-methyltransferase	NA	A5LH81	Enterobacteria_phage	99.4	1.8e-207
WP_001355891.1|4087259_4087454_-	hypothetical protein	NA	Q8SBE3	Shigella_phage	100.0	1.8e-28
WP_087879886.1|4089507_4089873_-	antitermination protein Q	NA	A5LH77	Enterobacteria_phage	89.2	8.4e-56
WP_099558370.1|4089888_4090878_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.4	2.1e-194
WP_032083252.1|4090885_4091695_-	KilA-N domain-containing protein	NA	A0A291AWU7	Escherichia_phage	98.9	1.3e-149
WP_052904508.1|4091714_4092104_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	99.2	4.6e-68
WP_000210164.1|4092100_4092427_-	LexA family transcriptional regulator	NA	A0A0N7KZF7	Stx2-converting_phage	100.0	9.2e-54
WP_001377816.1|4092423_4093077_-	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	98.6	8.1e-126
WP_021576994.1|4093076_4093571_-	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	99.4	2.5e-87
WP_001377815.1|4093567_4094509_-	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	92.7	2.2e-140
WP_001250269.1|4094498_4094678_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_001191669.1|4095402_4095663_-	helix-turn-helix transcriptional regulator	NA	K7PJQ8	Enterobacteria_phage	100.0	5.4e-41
WP_001020632.1|4095760_4096453_+	helix-turn-helix transcriptional regulator	NA	S5FUZ3	Shigella_phage	96.5	6.4e-121
WP_000135680.1|4097155_4097518_+	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
WP_000081294.1|4097583_4098408_+	YfdQ family protein	NA	Q8SBF9	Shigella_phage	100.0	3.5e-150
WP_052978458.1|4098535_4099072_+	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	98.9	2.2e-100
WP_001242749.1|4099062_4099425_+	phage protein	NA	U5P092	Shigella_phage	100.0	2.1e-67
WP_000206734.1|4099424_4099730_+	hypothetical protein	NA	U5P0J0	Shigella_phage	99.0	2.6e-50
WP_077873866.1|4099645_4100080_+	helix-turn-helix domain-containing protein	NA	U5P4J3	Shigella_phage	100.0	6.4e-79
WP_000051893.1|4099956_4101120_+|integrase	site-specific integrase	integrase	U5P434	Shigella_phage	99.7	5.3e-229
WP_000893278.1|4101324_4102578_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	9.8e-96
WP_001285288.1|4102589_4103693_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000749863.1|4103980_4105036_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	61.1	9.1e-119
WP_000174677.1|4105074_4105476_-	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
WP_000189541.1|4105533_4106778_-	esterase FrsA	NA	NA	NA	NA	NA
4105805:4105823	attR	AAACGACTCGCCAGAACGT	NA	NA	NA	NA
WP_001291990.1|4106869_4107328_-	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001329160.1|4109101_4109638_-	peptide chain release factor H	NA	NA	NA	NA	NA
WP_002431156.1|4109570_4109837_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001059847.1|4110070_4110523_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001263493.1|4110532_4110931_-	type II toxin-antitoxin system YafO family toxin	NA	NA	NA	NA	NA
WP_000554757.1|4110933_4111227_-	type I toxin-antitoxin system antitoxin YafN	NA	NA	NA	NA	NA
WP_001226164.1|4111278_4112334_-	DNA polymerase IV	NA	NA	NA	NA	NA
WP_000636841.1|4112404_4113175_-	putative lateral flagellar export/assembly protein LafU	NA	NA	NA	NA	NA
WP_001734840.1|4113134_4114874_+	flagellar type III secretion system protein FlhA	NA	NA	NA	NA	NA
WP_000006242.1|4115097_4115595_-|transposase	REP-associated tyrosine transposase RayT	transposase	NA	NA	NA	NA
>prophage 10
NZ_CP024257	Escherichia coli O25:H16 strain F5505-C1 chromosome, complete genome	4886938	4474905	4519475	4886938	integrase,transposase	Enterobacteria_phage(36.36%)	35	4480982:4480996	4522846:4522860
WP_001254928.1|4474905_4476057_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.3	2.2e-41
WP_023566195.1|4477005_4477842_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_001734682.1|4478123_4480037_-	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_001041752.1|4480273_4481470_+	CoA transferase	NA	NA	NA	NA	NA
4480982:4480996	attL	TATGACTCTTTCCAG	NA	NA	NA	NA
WP_000102863.1|4481481_4482399_+	hydroxymethylglutaryl-CoA lyase	NA	NA	NA	NA	NA
WP_000981734.1|4482419_4483769_+	MFS transporter	NA	NA	NA	NA	NA
WP_000228394.1|4484123_4484468_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001352291.1|4484677_4485004_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001375333.1|4485912_4486347_+	RNA-directed DNA polymerase	NA	NA	NA	NA	NA
WP_001485238.1|4486364_4487171_+	reverse transcriptase	NA	NA	NA	NA	NA
WP_000416153.1|4487697_4488729_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	27.0	8.0e-19
WP_000916805.1|4488999_4489443_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_000705931.1|4489458_4489746_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_000345346.1|4489758_4491015_+	PTS ascorbate transporter subunit IIC	NA	NA	NA	NA	NA
WP_001446914.1|4491225_4491465_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	66.0	1.5e-13
WP_000381395.1|4492050_4493622_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_000624622.1|4493641_4493989_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_001339397.1|4493988_4494666_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000107480.1|4495975_4496989_-	aldose 1-epimerase family protein	NA	NA	NA	NA	NA
WP_000998347.1|4497000_4498317_-	L-fucose:H+ symporter permease	NA	NA	NA	NA	NA
WP_000350265.1|4498344_4499265_-	ribokinase	NA	NA	NA	NA	NA
WP_001295538.1|4499570_4500353_+	DeoR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001387298.1|4500354_4500453_-	acetolactate synthase	NA	NA	NA	NA	NA
WP_000544809.1|4502640_4503435_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	94.3	1.3e-138
WP_000952428.1|4503434_4504607_-|transposase	IS21-like element ISEc62 family transposase	transposase	U5N3F9	Enterobacteria_phage	93.1	8.9e-216
WP_126123275.1|4505657_4505768_+	alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_000145475.1|4505948_4506605_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001375347.1|4506852_4508130_-	DUF2254 domain-containing protein	NA	NA	NA	NA	NA
WP_001293435.1|4508192_4510190_-	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	25.9	7.4e-21
WP_001254928.1|4511246_4512398_-|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.3	2.2e-41
WP_001352287.1|4512990_4513893_+	DUF1837 domain-containing protein	NA	NA	NA	NA	NA
WP_001352286.1|4514010_4516191_+	DEAD/DEAH box helicase	NA	NA	NA	NA	NA
WP_001446910.1|4516193_4516568_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001735687.1|4516610_4517876_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	40.5	1.1e-73
WP_001735688.1|4518203_4519475_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
4522846:4522860	attR	CTGGAAAGAGTCATA	NA	NA	NA	NA
>prophage 1
NZ_CP024259	Escherichia coli O25:H16 strain F5505-C1 plasmid unnamed2, complete sequence	94817	11895	82352	94817	transposase,protease	Stx2-converting_phage(34.78%)	56	NA	NA
WP_014640011.1|11895_12678_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.2	7.7e-139
WP_000255946.1|12674_13697_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.4	4.6e-200
WP_071598279.1|15106_15289_-	mdtC domain protein	NA	NA	NA	NA	NA
WP_024169893.1|15344_15869_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	85.7	3.9e-70
WP_001339397.1|15969_16647_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000624622.1|16646_16994_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_000544809.1|17537_18332_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	94.3	1.3e-138
WP_000952428.1|18331_19504_-|transposase	IS21-like element ISEc62 family transposase	transposase	U5N3F9	Enterobacteria_phage	93.1	8.9e-216
WP_099558248.1|20877_22090_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.3	1.4e-168
WP_001734642.1|23275_24139_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_024169750.1|25656_25848_-	ANR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001734638.1|26050_26848_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_072148231.1|27036_27303_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032200404.1|27490_28597_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_013188479.1|32173_32548_-	heat-labile enterotoxin LT subunit B	NA	D1GID8	Vibrio_virus	79.8	3.7e-51
WP_001734409.1|32544_33321_-	heat-labile enterotoxin LT subunit A	NA	A0A023W6A1	Vibrio_virus	80.2	8.4e-122
WP_001401515.1|34841_35699_-	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
WP_001365705.1|35691_35766_-	RepA leader peptide Tap	NA	NA	NA	NA	NA
WP_000083817.1|35990_36251_-	replication regulatory protein RepA	NA	NA	NA	NA	NA
WP_001734555.1|36774_38181_+|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	47.2	1.0e-117
WP_099554554.1|38183_39397_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.3	1.4e-168
WP_064727294.1|40080_40203_-	Hok/Gef family protein	NA	NA	NA	NA	NA
WP_001393357.1|40551_40734_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001734655.1|40957_41689_-	type-F conjugative transfer system pilin acetylase TraX	NA	NA	NA	NA	NA
WP_024169751.1|41685_42252_-	DUF2726 domain-containing protein	NA	NA	NA	NA	NA
WP_001734653.1|42269_47453_-	conjugative transfer relaxase/helicase TraI	NA	NA	NA	NA	NA
WP_001734652.1|47621_48608_-	conjugal transfer pilus assembly protein TraU	NA	NA	NA	NA	NA
WP_000286241.1|48604_49240_-	type-F conjugative transfer system protein TraW	NA	NA	NA	NA	NA
WP_001735611.1|52300_52900_-	type IV conjugative transfer system lipoprotein TraV	NA	NA	NA	NA	NA
WP_001735612.1|53006_53231_-	prokaryotic dksA/traR C4-type zinc finger family protein	NA	H2BDI2	Pseudomonas_virus	61.1	3.7e-06
WP_001735613.1|53342_54707_-	F-type conjugal transfer pilus assembly protein TraB	NA	NA	NA	NA	NA
WP_099554542.1|54693_55434_-	type-F conjugative transfer system secretin TraK	NA	NA	NA	NA	NA
WP_001735616.1|56005_56311_-	type IV conjugative transfer system protein TraL	NA	NA	NA	NA	NA
WP_001735617.1|56312_56672_-	type IV conjugative transfer system pilin TraA	NA	NA	NA	NA	NA
WP_157187929.1|56769_56937_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000974581.1|57152_57434_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024169848.1|57913_58300_-	relaxosome protein TraM	NA	NA	NA	NA	NA
WP_099554545.1|58926_60088_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	4.0e-51
WP_071594245.1|60126_60213_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_071594245.1|60374_60461_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_001735678.1|60598_61063_+	CS6 fimbrial subunit CssA	NA	NA	NA	NA	NA
WP_001297627.1|61080_61584_+	CS6 fimbrial subunit CssB	NA	NA	NA	NA	NA
WP_024169853.1|61636_62335_+	CS6 fimbrial biogenesis chaperone CssC	NA	NA	NA	NA	NA
WP_157195932.1|62291_64751_+	CS6 fimbrial biogenesis usher CssD	NA	NA	NA	NA	NA
WP_000845954.1|67705_68140_+	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
WP_001734594.1|68136_68856_+	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
WP_001312861.1|69126_69285_+	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_099554548.1|69578_71150_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.9	9.9e-170
WP_000624622.1|71169_71517_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_099554551.1|71516_72194_-|transposase	transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_001339397.1|72747_73425_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000624622.1|73424_73772_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_000381395.1|73791_75363_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_099558425.1|75548_79649_-|protease	serine protease autotransporter toxin EatA	protease	Q9LA58	Enterobacterial_phage	39.8	9.2e-276
WP_088563528.1|79927_80621_+|transposase	IS1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	96.1	1.7e-129
WP_099554554.1|81139_82352_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.3	1.4e-168
