The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP024256	Escherichia coli strain ATCC 43886 chromosome, complete genome	4914654	1434959	1498861	4914654	transposase,integrase,protease,tRNA	Vibrio_phage(16.67%)	48	1465269:1465284	1469762:1469777
WP_001162184.1|1434959_1436312_+|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
WP_001232255.1|1436367_1436754_+	cytochrome b562	NA	NA	NA	NA	NA
WP_001106226.1|1436798_1437263_-	anaerobic ribonucleoside-triphosphate reductase-activating protein	NA	H6WXC9	Vibrio_phage	59.7	2.5e-52
WP_000187791.1|1437422_1439561_-	anaerobic ribonucleoside-triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	64.6	9.1e-267
WP_001299669.1|1439954_1441610_-	alpha,alpha-phosphotrehalase	NA	NA	NA	NA	NA
WP_001299664.1|1441658_1443080_-	PTS trehalose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_001181324.1|1443198_1444146_-	HTH-type transcriptional regulator TreR	NA	C6ZCU4	Enterobacteria_phage	21.8	7.9e-13
WP_001387276.1|1444330_1444384_+	mgtA regulatory leader peptide MgtL	NA	NA	NA	NA	NA
WP_032199674.1|1444524_1447221_+	magnesium-translocating P-type ATPase	NA	M1HLC0	Paramecium_bursaria_Chlorella_virus	27.4	1.5e-45
WP_000047539.1|1447426_1447813_-	2-iminobutanoate/2-iminopropanoate deaminase	NA	NA	NA	NA	NA
WP_000148581.1|1447885_1448347_-	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_000013047.1|1448359_1449295_-	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	39.9	3.2e-51
WP_001296693.1|1449298_1449433_-	pyr operon leader peptide	NA	NA	NA	NA	NA
WP_000230281.1|1449713_1450109_-	RidA family protein	NA	NA	NA	NA	NA
WP_000500727.1|1450239_1450953_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_000256658.1|1451023_1451617_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000583469.1|1451761_1452214_+	YhcH/YjgK/YiaL family protein	NA	NA	NA	NA	NA
WP_032199672.1|1452336_1454079_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000012931.1|1454134_1455139_-	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_000002953.1|1455300_1455717_+	ribonuclease E inhibitor RraB	NA	NA	NA	NA	NA
WP_001736017.1|1455861_1456365_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000079635.1|1456557_1457754_+	DUF898 domain-containing protein	NA	NA	NA	NA	NA
WP_005766531.1|1457807_1460663_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.7	3.0e-140
WP_000786399.1|1460662_1461106_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_000397144.1|1461239_1462751_-	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.0	6.0e-47
WP_000584107.1|1463017_1464118_+	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_001295681.1|1464117_1465200_+	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
1465269:1465284	attL	CTGAAAAATAATTAAA	NA	NA	NA	NA
WP_001352285.1|1466991_1468011_-	NADPH-dependent aldehyde reductase Ahr	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	30.7	4.9e-45
WP_001735687.1|1468454_1469720_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	40.5	1.1e-73
WP_001254928.1|1473932_1475084_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.3	2.2e-41
1469762:1469777	attR	TTTAATTATTTTTCAG	NA	NA	NA	NA
WP_164997629.1|1475132_1475987_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	2.7e-68
WP_001293435.1|1476140_1478138_+	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	25.9	7.4e-21
WP_001375347.1|1478200_1479478_+	DUF2254 domain-containing protein	NA	NA	NA	NA	NA
WP_000145475.1|1479725_1480382_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_126123275.1|1480562_1480673_-	alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_001390361.1|1480781_1481063_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001298855.1|1481140_1481920_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_001387298.1|1483748_1483847_+	acetolactate synthase	NA	NA	NA	NA	NA
WP_001295538.1|1483848_1484631_-	DeoR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000350265.1|1484936_1485857_+	ribokinase	NA	NA	NA	NA	NA
WP_000998347.1|1485884_1487201_+	L-fucose:H+ symporter permease	NA	NA	NA	NA	NA
WP_000107480.1|1487212_1488226_+	aldose 1-epimerase family protein	NA	NA	NA	NA	NA
WP_001339397.1|1489535_1490213_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000624622.1|1490212_1490560_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_000381395.1|1490579_1492151_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_157909987.1|1492736_1492976_+	IS66 family insertion sequence element accessory protein TnpB	NA	Q6H9S5	Enterobacteria_phage	61.7	1.5e-13
WP_023566195.1|1495924_1496761_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_032200379.1|1497709_1498861_-|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.0	1.1e-40
>prophage 2
NZ_CP024256	Escherichia coli strain ATCC 43886 chromosome, complete genome	4914654	1751854	1769285	4914654	head,capsid,integrase,protease,tail,terminase,portal	uncultured_Caudovirales_phage(66.67%)	23	1750320:1750334	1766441:1766455
1750320:1750334	attL	AAAAGCCCACAGCAG	NA	NA	NA	NA
WP_032199960.1|1751854_1753075_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	56.3	9.8e-133
WP_032199958.1|1753173_1754103_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000169439.1|1754240_1754525_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_072148204.1|1754534_1755443_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_000543625.1|1755435_1755663_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032199956.1|1755668_1755956_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_000761823.1|1755952_1757767_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	49.7	2.2e-128
WP_016245299.1|1758054_1758300_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024236074.1|1758296_1758722_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_001735910.1|1758758_1759289_+	ProQ/FinO family protein	NA	Q2A0A1	Sodalis_phage	37.1	4.3e-08
WP_001145410.1|1759279_1759528_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032199954.1|1759801_1760947_+|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	67.2	3.7e-142
WP_000798767.1|1760996_1761557_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	84.4	5.7e-88
WP_000270245.1|1761558_1762773_+|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	86.3	6.0e-207
WP_001287547.1|1762765_1763068_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4JD08	uncultured_Caudovirales_phage	61.1	1.0e-27
WP_001145900.1|1763067_1763508_+	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	75.3	1.6e-64
WP_072148203.1|1763491_1763677_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032199968.1|1763796_1764153_+|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	82.9	1.4e-50
WP_032199966.1|1764136_1765798_+|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	82.6	2.3e-278
WP_032199952.1|1765803_1766085_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000680691.1|1767010_1767547_+	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	33.1	5.1e-17
1766441:1766455	attR	CTGCTGTGGGCTTTT	NA	NA	NA	NA
WP_000651599.1|1767587_1768250_-	carbonate dehydratase	NA	NA	NA	NA	NA
WP_000150637.1|1768358_1769285_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	34.0	1.2e-21
>prophage 3
NZ_CP024256	Escherichia coli strain ATCC 43886 chromosome, complete genome	4914654	1872025	1948017	4914654	lysis,integrase,protease,tail,transposase,terminase,portal	Enterobacteria_phage(33.93%)	80	1932146:1932168	1948103:1948125
WP_000006242.1|1872025_1872523_+|transposase	REP-associated tyrosine transposase RayT	transposase	NA	NA	NA	NA
WP_001734840.1|1872746_1874486_-	flagellar type III secretion system protein FlhA	NA	NA	NA	NA	NA
WP_000207587.1|1874430_1875216_+	putative lateral flagellar export/assembly protein LafU	NA	NA	NA	NA	NA
WP_000554757.1|1876392_1876686_+	type I toxin-antitoxin system antitoxin YafN	NA	NA	NA	NA	NA
WP_001263493.1|1876688_1877087_+	type II toxin-antitoxin system mRNA interferase toxin YafO	NA	NA	NA	NA	NA
WP_001059847.1|1877096_1877549_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002431156.1|1877782_1878049_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001329160.1|1877981_1878518_+	peptide chain release factor H	NA	NA	NA	NA	NA
WP_001293002.1|1878574_1880032_-	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
WP_001291990.1|1880292_1880751_+	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_032200258.1|1880842_1882087_+	esterase FrsA	NA	NA	NA	NA	NA
WP_000174677.1|1882144_1882546_+	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
WP_000749863.1|1882584_1883640_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	61.1	9.1e-119
WP_001285288.1|1883927_1885031_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000893278.1|1885042_1886296_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	9.8e-96
WP_000051894.1|1886500_1887664_-|integrase	site-specific integrase	integrase	U5P434	Shigella_phage	99.5	4.5e-228
WP_000433939.1|1887540_1887891_-	helix-turn-helix domain-containing protein	NA	U5P4J3	Shigella_phage	100.0	4.9e-61
WP_000206737.1|1887890_1888196_-	hypothetical protein	NA	U5P0J0	Shigella_phage	98.0	5.8e-50
WP_001242749.1|1888195_1888558_-	phage protein	NA	U5P092	Shigella_phage	100.0	2.1e-67
WP_000008200.1|1888548_1889085_-	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	100.0	4.3e-101
WP_000081287.1|1889212_1890037_-	DUF2303 family protein	NA	U5P439	Shigella_phage	100.0	6.0e-150
WP_000135680.1|1890102_1890465_-	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
WP_001020632.1|1891167_1891860_-	helix-turn-helix transcriptional regulator	NA	S5FUZ3	Shigella_phage	96.5	6.4e-121
WP_032198020.1|1891957_1892218_+	helix-turn-helix transcriptional regulator	NA	K7PJQ8	Enterobacteria_phage	98.8	7.1e-41
WP_032198019.1|1892210_1892762_+	hypothetical protein	NA	U5P4K1	Shigella_phage	98.9	3.8e-100
WP_001250272.1|1892937_1893117_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_032200253.1|1893106_1894048_+	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	99.4	3.3e-152
WP_072130040.1|1894044_1894539_+	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	98.8	4.3e-87
WP_032200251.1|1894538_1895192_+	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.1	4.3e-127
WP_032200250.1|1895188_1895515_+	LexA family transcriptional regulator	NA	A0A0N7KZF7	Stx2-converting_phage	97.2	2.9e-52
WP_000767113.1|1895511_1895901_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	100.0	7.1e-69
WP_032200249.1|1895920_1896730_+	KilA-N domain-containing protein	NA	A0A291AWU7	Escherichia_phage	99.3	4.5e-150
WP_061089070.1|1896737_1897727_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	98.5	2.0e-192
WP_001504953.1|1897744_1898116_+	phage antitermination Q family protein	NA	Q777W5	Enterobacteria_phage	82.5	6.1e-54
WP_032083250.1|1898288_1899740_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_001504956.1|1900152_1900347_+	hypothetical protein	NA	Q8SBE3	Shigella_phage	100.0	5.1e-28
WP_000799656.1|1900496_1901549_+	site-specific DNA-methyltransferase	NA	A5LH81	Enterobacteria_phage	100.0	2.7e-208
WP_000839596.1|1901616_1901832_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_001135250.1|1901831_1902329_+	lysozyme RrrD	NA	A0A291AWW2	Escherichia_phage	100.0	4.5e-92
WP_001341210.1|1902325_1902793_+|lysis	lysis protein	lysis	A0A291AWW3	Escherichia_phage	100.0	7.7e-78
WP_032200247.1|1902780_1902933_+	hypothetical protein	NA	A0A291AWZ2	Escherichia_phage	98.0	4.7e-21
WP_000349509.1|1903608_1904100_+	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	87.2	1.3e-72
WP_000934130.1|1904099_1906202_+|terminase	phage terminase large subunit family protein	terminase	A0A291AWY5	Escherichia_phage	97.3	0.0e+00
WP_001072973.1|1906198_1906411_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	98.6	7.1e-31
WP_000985938.1|1906410_1907919_+|portal	phage portal protein	portal	K7PJP3	Enterobacteria_phage	99.2	2.3e-288
WP_096947437.1|1907863_1909891_+|protease	Clp protease ClpP	protease	A5LH30	Enterobacteria_phage	99.7	0.0e+00
WP_001097050.1|1909977_1910301_+	DUF2190 family protein	NA	A0A291AWX2	Escherichia_phage	100.0	8.5e-52
WP_001283144.1|1910293_1910569_+	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	98.9	8.6e-45
WP_000677108.1|1910580_1911159_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	99.5	7.2e-102
WP_001079398.1|1911155_1911557_+|tail	tail protein	tail	A0A291AWY2	Escherichia_phage	100.0	8.3e-73
WP_000211099.1|1911568_1912312_+	hypothetical protein	NA	A0A291AWU6	Escherichia_phage	99.6	3.0e-132
WP_001440689.1|1912372_1912759_+|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	99.2	6.1e-65
WP_001161009.1|1912767_1913097_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_099554586.1|1913068_1916134_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	98.9	0.0e+00
WP_000447247.1|1916133_1916463_+|tail	phage tail protein	tail	A0A291AWW9	Escherichia_phage	99.1	1.7e-60
WP_001152385.1|1916472_1917171_+|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	100.0	6.0e-135
WP_000140731.1|1917176_1917920_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	95.5	8.6e-148
WP_072148233.1|1917817_1918465_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	96.3	1.2e-110
WP_099554587.1|1918525_1922023_+	host specificity protein J	NA	A5LH43	Enterobacteria_phage	98.2	0.0e+00
WP_001233090.1|1922093_1922693_+	Ail/Lom family protein	NA	A5LH44	Enterobacteria_phage	97.5	8.2e-109
WP_072148206.1|1922757_1926159_+	short-chain fatty acid transporter	NA	X2KTY7	Enterobacteria_phage	35.5	1.8e-11
WP_032199983.1|1926158_1926743_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	96.9	2.9e-106
WP_032199984.1|1927280_1931735_+	hypothetical protein	NA	A0A2H4PQV1	Staphylococcus_phage	32.4	1.1e-43
1932146:1932168	attL	ACTCCTATTATCGGCACCATTAA	NA	NA	NA	NA
WP_164997628.1|1932773_1932938_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000381395.1|1932941_1934513_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_000624622.1|1934532_1934880_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_001339397.1|1934879_1935557_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000550449.1|1935699_1935858_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001323651.1|1936252_1936804_+	hypothetical protein	NA	A0A1L5C2A2	Pseudoalteromonas_phage	60.0	1.2e-05
WP_001396243.1|1939164_1939341_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032200170.1|1939488_1940157_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000580785.1|1940465_1940669_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000390658.1|1940668_1940977_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000807036.1|1941961_1942159_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000013186.1|1942163_1942547_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000999103.1|1942561_1943593_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001374248.1|1943744_1943942_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000890105.1|1943976_1945878_+	hypothetical protein	NA	K7QJV2	Escherichia_phage	32.4	5.6e-50
WP_032200166.1|1945951_1946608_+	hypothetical protein	NA	A0A1D7XFF4	Escherichia_phage	61.5	2.9e-59
WP_032200165.1|1946682_1948017_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
1948103:1948125	attR	ACTCCTATTATCGGCACCATTAA	NA	NA	NA	NA
>prophage 4
NZ_CP024256	Escherichia coli strain ATCC 43886 chromosome, complete genome	4914654	2444502	2496282	4914654	head,capsid,integrase,transposase,tail,lysis,terminase	Enterobacteria_phage(45.9%)	68	2442780:2442795	2471179:2471194
2442780:2442795	attL	CTGACTGCTGAAGAGC	NA	NA	NA	NA
WP_000533643.1|2444502_2445573_-|integrase	tyrosine-type recombinase/integrase	integrase	K7P6P6	Enterobacteria_phage	100.0	3.9e-202
WP_001303849.1|2445550_2445769_-	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_000545728.1|2445808_2445976_-	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	98.2	1.3e-27
WP_000026224.1|2446063_2446345_-	hypothetical protein	NA	A0A0K2FIU9	Enterobacteria_phage	100.0	2.8e-51
WP_001289873.1|2446536_2447085_-	ead/Ea22-like family protein	NA	A0A0K2FJF6	Enterobacteria_phage	100.0	2.2e-100
WP_000763363.1|2447081_2447303_-	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	98.6	6.4e-35
WP_001386642.1|2447401_2447683_-	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	98.9	5.5e-47
WP_000548531.1|2447693_2447885_-	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	100.0	7.3e-27
WP_000682318.1|2447857_2448040_-	DUF1317 domain-containing protein	NA	A0A0N7CHV0	Escherichia_phage	98.3	1.3e-28
WP_000186848.1|2448036_2448717_-	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	100.0	1.6e-132
WP_000100847.1|2448713_2449499_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000995491.1|2449504_2449801_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	99.0	3.6e-49
WP_000233576.1|2449876_2450083_-	phage encoded cell division inhibitor protein	NA	K7P6H3	Enterobacteria_phage	85.3	3.2e-28
WP_000581650.1|2450561_2451074_-	DUF4411 family protein	NA	NA	NA	NA	NA
WP_024169786.1|2453116_2453809_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	86.1	1.9e-109
WP_000184665.1|2453919_2454147_+	helix-turn-helix domain-containing protein	NA	Q76H55	Enterobacteria_phage	69.0	3.8e-22
WP_001182890.1|2454177_2454717_+	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	66.7	8.9e-62
WP_001415152.1|2454803_2455733_+	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	63.4	1.2e-109
WP_001734999.1|2455729_2456431_+	replication P family protein	NA	A0A0K2FIT1	Enterobacteria_phage	97.4	1.2e-127
WP_032199515.1|2456427_2456721_+	DUF977 family protein	NA	A0A0N6WES4	Escherichia_phage	94.6	2.5e-42
WP_000720581.1|2457206_2457767_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032199514.1|2457763_2458216_+	membrane protein	NA	NA	NA	NA	NA
WP_072142085.1|2458308_2458410_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001053009.1|2458406_2458862_+	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.9	9.2e-60
WP_000224914.1|2458861_2459032_+	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	69.8	2.4e-13
WP_000774498.1|2459024_2459315_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	95.8	6.7e-48
WP_001735006.1|2459311_2459674_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	9.5e-60
WP_000971095.1|2459670_2459811_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	72.1	1.7e-09
WP_001204791.1|2459896_2460280_+	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	83.3	4.4e-55
WP_000737271.1|2460469_2461552_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	80.1	1.6e-166
WP_000839596.1|2462141_2462357_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_001468348.1|2462361_2462706_+	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	96.4	4.4e-38
WP_000370550.1|2462671_2462944_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000992106.1|2463049_2463583_+	lysozyme	NA	Q08J98	Stx2-converting_phage	93.8	1.1e-99
WP_021566044.1|2463579_2464038_+|lysis	lysis protein	lysis	K7PJW6	Enterobacteria_phage	94.1	4.4e-70
WP_001028465.1|2464242_2464764_+	DNA-binding protein	NA	K7P7K9	Enterobacteria_phage	100.0	1.5e-93
WP_001339397.1|2464832_2465510_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000624622.1|2465509_2465857_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_000381395.1|2465876_2467448_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_000079508.1|2467891_2468302_-	DUF1398 family protein	NA	C6ZCX4	Enterobacteria_phage	76.3	1.3e-52
WP_001331705.1|2468359_2468593_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	96.3	9.5e-21
WP_000453580.1|2468981_2469527_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	100.0	2.8e-95
WP_001027268.1|2469501_2471427_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.7	0.0e+00
2471179:2471194	attR	CTGACTGCTGAAGAGC	NA	NA	NA	NA
WP_000198149.1|2471423_2471630_+|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_001358225.1|2474536_2474869_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	98.2	2.5e-54
WP_000063221.1|2474924_2475950_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	97.9	8.1e-189
WP_000158875.1|2475991_2476387_+	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	95.5	1.1e-58
WP_000785282.1|2476398_2476752_+|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	97.4	6.4e-61
WP_000975081.1|2476763_2477342_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.5	5.9e-80
WP_000683129.1|2477338_2477734_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	98.5	8.5e-70
WP_032200302.1|2477741_2478482_+|tail	phage tail protein	tail	A0A2I6TC77	Escherichia_phage	98.0	9.5e-131
WP_001735025.1|2478497_2478920_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	95.7	3.4e-69
WP_000459457.1|2478901_2479336_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_001735026.1|2479328_2481908_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	97.2	0.0e+00
WP_000847379.1|2481904_2482234_+|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	100.0	9.6e-59
WP_004000017.1|2482233_2482932_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	99.6	5.1e-134
WP_032200299.1|2482937_2483681_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.8	4.3e-147
WP_000090891.1|2483617_2484250_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.5	2.2e-96
WP_099554600.1|2484309_2487789_+	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	90.2	0.0e+00
WP_074483257.1|2487856_2488456_+	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	93.5	1.9e-105
WP_024169790.1|2488520_2490872_+|tail	phage tail protein	tail	A0A0E3M0V5	Enterobacteria_phage	43.7	7.0e-87
WP_001735043.1|2490868_2491150_+	hypothetical protein	NA	A0A1X7QHA1	Escherichia_phage	47.8	2.7e-17
WP_096947431.1|2491159_2491546_+	hypothetical protein	NA	A0A1X7QGH6	Escherichia_phage	58.2	1.1e-16
WP_096947432.1|2491633_2491864_+|tail	phage tail protein	tail	A0A1X7QGH6	Escherichia_phage	61.5	1.4e-16
WP_001735045.1|2491874_2492168_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001507144.1|2492380_2493712_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	37.1	1.4e-20
WP_000767389.1|2494457_2494934_-	kinase inhibitor	NA	NA	NA	NA	NA
WP_001295303.1|2494992_2496282_-	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.5	5.3e-20
>prophage 5
NZ_CP024256	Escherichia coli strain ATCC 43886 chromosome, complete genome	4914654	2868434	2932328	4914654	holin,head,capsid,integrase,protease,tRNA,tail,transposase,terminase,portal	Enterobacteria_phage(37.04%)	79	2867046:2867061	2886574:2886589
2867046:2867061	attL	ATCCACCGCATCACCG	NA	NA	NA	NA
WP_032200190.1|2868434_2869553_-|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z04	Phage_21	44.4	3.5e-84
WP_000003742.1|2869521_2869791_-	excisionase	NA	NA	NA	NA	NA
WP_032255802.1|2869852_2872324_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.8	5.0e-59
WP_032200362.1|2872403_2872607_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_001507242.1|2872603_2872792_-	hypothetical protein	NA	NA	NA	NA	NA
WP_122993763.1|2873200_2873368_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001735122.1|2873361_2873595_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001735123.1|2873572_2873980_-	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	46.4	2.5e-08
WP_001171921.1|2874002_2874221_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379557.1|2874380_2874536_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	2.3e-07
WP_000444613.1|2874813_2875458_-	LexA family transcriptional regulator	NA	A0A1P8DTH0	Proteus_phage	25.9	8.8e-08
WP_024197699.1|2875557_2875785_+	cell division protein	NA	NA	NA	NA	NA
WP_032200361.1|2875781_2876207_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_032200360.1|2876231_2877197_+	phage O protein family	NA	U5P0A0	Shigella_phage	63.3	3.7e-58
WP_000788772.1|2877203_2877950_+	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	85.1	5.1e-116
WP_001409082.1|2877964_2878381_+	DUF977 family protein	NA	A0A088CBK9	Shigella_phage	59.7	3.7e-39
WP_032200359.1|2878377_2878683_+	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	93.1	6.4e-49
WP_032200358.1|2878669_2879125_+	ead/Ea22-like family protein	NA	Q5G8U8	Enterobacteria_phage	68.5	5.4e-28
WP_001509831.1|2879302_2879638_+	hypothetical protein	NA	A0A076GCN9	Escherichia_phage	67.1	7.0e-25
WP_072130110.1|2879810_2880029_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000935258.1|2880231_2880444_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	95.7	6.6e-29
WP_072148222.1|2880611_2880890_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	43.8	2.4e-10
WP_032200357.1|2880891_2881950_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	48.3	2.0e-89
WP_000140022.1|2881950_2882316_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	64.3	4.6e-38
WP_001398904.1|2882324_2882867_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	69.3	1.9e-67
WP_000917767.1|2883179_2883377_+	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	100.0	2.1e-29
WP_099554605.1|2883527_2884577_+	site-specific DNA-methyltransferase	NA	Q8W637	Enterobacteria_phage	89.1	3.6e-184
WP_000466939.1|2885051_2885477_+	tellurite/colicin resistance protein	NA	Q71TK7	Escherichia_phage	85.8	3.3e-59
WP_000833653.1|2885473_2885626_+	DUF3927 family protein	NA	NA	NA	NA	NA
WP_001355862.1|2885713_2886106_+|holin	holin	holin	Q9MBZ5	Enterobacteria_phage	78.5	4.5e-47
WP_032242134.1|2886095_2886371_+|holin	phage holin family protein	holin	Q9MBZ4	Enterobacteria_phage	98.9	6.6e-45
WP_001117825.1|2886373_2886751_+	M15 family metallopeptidase	NA	Q9MBZ3	Enterobacteria_phage	96.0	5.6e-63
2886574:2886589	attR	CGGTGATGCGGTGGAT	NA	NA	NA	NA
WP_001297666.1|2886883_2886997_+	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	86.5	5.6e-11
WP_001138287.1|2887025_2887181_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001140108.1|2887523_2887874_+	HNH endonuclease	NA	Q8W633	Enterobacteria_phage	98.3	4.0e-63
WP_001297663.1|2887989_2888460_+|terminase	phage terminase small subunit P27 family	terminase	Q8W632	Enterobacteria_phage	98.1	1.5e-84
WP_122993758.1|2888693_2890187_+|terminase	terminase large subunit	terminase	Q8W631	Enterobacteria_phage	99.8	5.1e-301
WP_001297668.1|2890198_2890381_+	hypothetical protein	NA	S5FXQ9	Shigella_phage	98.3	2.9e-25
WP_016236636.1|2890380_2891622_+|portal	phage portal protein	portal	U5P411	Shigella_phage	99.5	3.4e-242
WP_001193631.1|2891599_2892250_+|head,protease	HK97 family phage prohead protease	head,protease	U5P4H2	Shigella_phage	100.0	2.5e-119
WP_032200236.1|2892264_2893470_+|capsid	phage major capsid protein	capsid	A0A1B5FPI9	Escherichia_phage	99.5	1.2e-223
WP_001297480.1|2893519_2893720_+	hypothetical protein	NA	S5FNU1	Shigella_phage	97.0	8.4e-26
WP_000927711.1|2893722_2894046_+|head,tail	phage gp6-like head-tail connector protein	head,tail	U5P072	Shigella_phage	99.1	1.1e-56
WP_032200235.1|2894042_2894453_+|head	phage head closure protein	head	M1FJ87	Enterobacteria_phage	95.6	6.5e-73
WP_032200233.1|2894427_2894934_+	hypothetical protein	NA	Q8SBH5	Shigella_phage	94.6	4.1e-85
WP_032200232.1|2894930_2895491_+	hypothetical protein	NA	M1FQV7	Enterobacteria_phage	99.5	2.3e-105
WP_000497751.1|2895499_2895670_+	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	100.0	9.3e-26
WP_032200231.1|2895653_2897150_+|tail	tail sheath protein	tail	M1FN90	Enterobacteria_phage	98.8	1.0e-272
WP_021534249.1|2897149_2897506_+|tail	phage tail protein	tail	U5P076	Shigella_phage	99.2	1.2e-62
WP_064763519.1|2897505_2897847_+	hypothetical protein	NA	M1FPE4	Enterobacteria_phage	97.4	1.7e-34
WP_099554609.1|2897818_2900875_+|tail	phage tail tape measure protein	tail	A5LH38	Enterobacteria_phage	97.9	0.0e+00
WP_001506650.1|2900874_2901204_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	98.2	5.6e-59
WP_001152385.1|2901213_2901912_+|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	100.0	6.0e-135
WP_032200414.1|2901917_2902661_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.4	1.1e-147
WP_032200413.1|2902558_2903206_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	96.3	5.6e-111
WP_052939088.1|2906812_2907412_+	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	94.5	2.9e-106
WP_072005394.1|2907476_2910503_+	hypothetical protein	NA	A0A0K2FIZ6	Escherichia_phage	56.0	4.4e-65
WP_000885577.1|2910502_2911087_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.8	6.6e-103
WP_000240999.1|2911141_2911810_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000937496.1|2911866_2912133_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	78.3	2.3e-18
WP_000799406.1|2912365_2913229_-	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000531594.1|2913212_2914349_-	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
WP_000359434.1|2914598_2915825_+	peptidase T	NA	NA	NA	NA	NA
WP_000456506.1|2915873_2916995_-	[50S ribosomal protein L16]-arginine 3-hydroxylase	NA	NA	NA	NA	NA
WP_000735412.1|2917070_2918531_-	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_001265471.1|2918530_2919202_-	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000423742.1|2919370_2920741_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	1.2e-107
WP_032199458.1|2920744_2921386_-	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_001297484.1|2921421_2922528_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_000476093.1|2922581_2923043_-	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001248691.1|2923052_2923706_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000444488.1|2923877_2925128_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	96.3	3.2e-22
WP_071598244.1|2925230_2925362_-	lycopene biosynthesis protein	NA	NA	NA	NA	NA
WP_001246498.1|2926229_2927753_+	cyclic diguanylate phosphodiesterase	NA	NA	NA	NA	NA
WP_001065861.1|2927884_2928103_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001301095.1|2928502_2930023_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_071598245.1|2930035_2931103_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	41.6	2.4e-74
WP_000169527.1|2931165_2931465_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_000878218.1|2931461_2932328_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	2.3e-51
>prophage 6
NZ_CP024256	Escherichia coli strain ATCC 43886 chromosome, complete genome	4914654	3023853	3084899	4914654	holin,head,capsid,integrase,protease,tail,transposase,terminase,portal	Escherichia_phage(40.74%)	74	3018481:3018494	3031194:3031207
3018481:3018494	attL	TTCCCGCTTTCTTT	NA	NA	NA	NA
WP_001735157.1|3023853_3024984_-|integrase	tyrosine-type recombinase/integrase	integrase	O21940	Phage_21	51.4	5.7e-103
WP_000113189.1|3024961_3025210_-	excisionase	NA	NA	NA	NA	NA
WP_074504043.1|3025274_3027746_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	57.1	2.3e-56
WP_001090200.1|3027838_3028030_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_001317853.1|3028026_3028215_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001171960.1|3028754_3028973_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379589.1|3029132_3029288_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	8.8e-07
WP_000233320.1|3029585_3030005_-	helix-turn-helix domain-containing protein	NA	A0A2I6PIE7	Escherichia_phage	47.5	4.2e-19
WP_001072337.1|3030084_3030339_+	hypothetical protein	NA	A0A2I6PIE5	Escherichia_phage	60.3	2.8e-18
WP_000693853.1|3030335_3030761_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262393.1|3030832_3031903_+	hypothetical protein	NA	A0A088CD36	Shigella_phage	65.2	4.2e-63
3031194:3031207	attR	AAAGAAAGCGGGAA	NA	NA	NA	NA
WP_001151210.1|3031943_3032366_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	90.6	1.3e-63
WP_001224679.1|3032873_3033056_+	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	96.7	1.2e-26
WP_000753064.1|3033048_3033225_+	hypothetical protein	NA	A0A2R2X2A8	Escherichia_phage	94.8	3.9e-27
WP_001339397.1|3033720_3034398_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000624622.1|3034397_3034745_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_000381395.1|3034764_3036336_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_011076332.1|3036431_3036650_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000936611.1|3036624_3036807_-	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	74.5	2.8e-12
WP_000813256.1|3036907_3037063_+	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	98.0	5.0e-18
WP_001332495.1|3037521_3037800_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	46.9	1.3e-11
WP_000904111.1|3038862_3039219_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	6.1e-35
WP_001545909.1|3039233_3040055_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	58.6	1.8e-77
WP_000562553.1|3040950_3041082_+	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	100.0	3.7e-06
WP_000871291.1|3041362_3041698_-	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	74.8	5.2e-44
WP_000874243.1|3041958_3042147_+	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	95.2	7.2e-27
WP_001355909.1|3042143_3042305_+	hypothetical protein	NA	Q08JA2	Stx2-converting_phage	89.1	1.6e-14
WP_000372595.1|3042454_3042670_+|holin	holin	holin	A0A2R2Z340	Escherichia_phage	98.6	3.4e-33
WP_000193264.1|3042674_3043025_+	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	94.0	1.4e-36
WP_000992097.1|3043088_3043622_+	lysozyme	NA	Q08J98	Stx2-converting_phage	93.2	1.5e-98
WP_075202333.1|3043838_3044021_+	hypothetical protein	NA	A0A0P0ZE50	Stx2-converting_phage	77.0	2.2e-17
WP_000738421.1|3044111_3044405_-	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	90.7	5.9e-44
WP_001135103.1|3044930_3045281_+	HNH endonuclease	NA	A0A1B5FP94	Escherichia_phage	97.4	4.7e-64
WP_023153903.1|3045428_3045911_+|terminase	phage terminase small subunit P27 family	terminase	A0A1B5FPA0	Escherichia_phage	97.5	4.3e-84
WP_001140892.1|3045910_3047668_+|terminase	terminase large subunit	terminase	A0A1B5FP96	Escherichia_phage	99.3	0.0e+00
WP_000811487.1|3047664_3047826_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001735009.1|3047815_3049042_+|portal	phage portal protein	portal	Q8SBI0	Shigella_phage	82.8	3.1e-203
WP_000999828.1|3049034_3049634_+|head,protease	HK97 family phage prohead protease	head,protease	Q8SBH9	Shigella_phage	81.0	1.9e-89
WP_000766109.1|3049648_3050866_+|capsid	phage major capsid protein	capsid	A0A1W6JP20	Morganella_phage	71.6	5.9e-162
WP_000719065.1|3050942_3051260_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1W6JNZ5	Morganella_phage	49.5	1.8e-22
WP_001147814.1|3051268_3051607_+|head	phage head closure protein	head	A0A1B5FP90	Escherichia_phage	90.2	7.5e-51
WP_000968644.1|3051603_3052053_+	HK97 gp10 family phage protein	NA	S4TR46	Salmonella_phage	81.2	6.1e-64
WP_001206306.1|3052049_3052394_+	DUF3168 domain-containing protein	NA	A0A1B5FP84	Escherichia_phage	97.4	1.4e-55
WP_001735010.1|3052453_3053158_+	hypothetical protein	NA	A0A1B5FP82	Escherichia_phage	93.2	3.8e-113
WP_000164661.1|3053172_3053544_+|tail	tail assembly protein	tail	A0A1B5FP91	Escherichia_phage	100.0	6.5e-64
WP_077628067.1|3053585_3053846_+	DUF4035 domain-containing protein	NA	A0A1B5FP87	Escherichia_phage	96.5	1.7e-39
WP_032200366.1|3053892_3057120_+|tail	phage tail tape measure protein	tail	A0A1B5FPE2	Escherichia_phage	92.5	0.0e+00
WP_001330090.1|3057097_3057454_+|tail	tail protein	tail	A0A0P0ZDL9	Stx2-converting_phage	66.7	2.8e-40
WP_099554613.1|3057453_3058152_+|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	96.1	6.8e-131
WP_001462126.1|3058156_3058900_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	98.4	1.4e-150
WP_000741576.1|3058797_3059445_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	98.6	2.7e-113
WP_099554616.1|3059505_3062985_+	host specificity protein J	NA	A5LH43	Enterobacteria_phage	89.9	0.0e+00
WP_001228316.1|3063052_3063652_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	96.5	2.0e-107
WP_000216487.1|3063803_3066830_+	membrane protein	NA	A0A0K2FIZ6	Escherichia_phage	54.5	7.0e-55
WP_000885577.1|3066829_3067414_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.8	6.6e-103
WP_022645610.1|3067468_3068137_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000937495.1|3068193_3068463_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	79.4	9.3e-20
WP_000251936.1|3068577_3068748_+	hypothetical protein	NA	A0A0U2RK60	Escherichia_phage	62.5	9.4e-10
WP_001079505.1|3069236_3069743_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001056490.1|3069788_3070289_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000807651.1|3070374_3070554_-	general stress protein	NA	NA	NA	NA	NA
WP_000443067.1|3070934_3071741_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000209520.1|3071740_3072934_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_001735167.1|3072945_3074304_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.7	8.6e-37
WP_000763511.1|3074307_3075903_-	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	3.8e-52
WP_001735168.1|3075902_3077465_-	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_001700591.1|3077556_3077601_-	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001285661.1|3077738_3078620_+	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001295575.1|3078616_3079237_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001735169.1|3079264_3081160_+	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
WP_001291217.1|3081370_3082246_+	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001278906.1|3082284_3082875_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_000559286.1|3082871_3083630_-	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.9	4.4e-06
WP_000422045.1|3083849_3084899_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
>prophage 7
NZ_CP024256	Escherichia coli strain ATCC 43886 chromosome, complete genome	4914654	3623371	3713957	4914654	holin,head,capsid,plate,integrase,protease,tRNA,tail,terminase,portal	Enterobacteria_phage(53.85%)	107	3679495:3679510	3707288:3707303
WP_000984517.1|3623371_3624253_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_032199908.1|3624444_3626493_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.5	6.8e-86
WP_001043882.1|3627308_3627806_-	L-methionine (R)-S-oxide reductase	NA	NA	NA	NA	NA
WP_001207283.1|3627935_3629219_+	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
WP_001735355.1|3629187_3631821_+	lipid-binding membrane homeostasis protein YebT	NA	NA	NA	NA	NA
WP_001397399.1|3631900_3633340_+	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
WP_001338166.1|3633457_3633694_+	DUF1480 family protein	NA	NA	NA	NA	NA
WP_001338167.1|3633798_3633990_+	YebW family protein	NA	NA	NA	NA	NA
WP_000812732.1|3633990_3634647_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	50.2	8.0e-57
WP_000976472.1|3635042_3635384_-	YebY family protein	NA	NA	NA	NA	NA
WP_000879295.1|3635396_3636269_-	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000168747.1|3636272_3636647_-	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000916763.1|3636785_3637016_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	1.3e-14
WP_000011658.1|3637117_3637774_+	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_000944258.1|3637797_3638460_+	exodeoxyribonuclease X	NA	Q6UAU3	Klebsiella_phage	41.6	2.0e-07
WP_000936952.1|3638456_3640517_-	oligopeptidase B	NA	NA	NA	NA	NA
WP_000024745.1|3640725_3641385_-	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_001295500.1|3641711_3642068_-	protein YebF	NA	NA	NA	NA	NA
WP_000257738.1|3642134_3642425_-	DNA damage-inducible protein YebG	NA	NA	NA	NA	NA
WP_000173449.1|3642558_3643737_+	formate-dependent phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
WP_000800512.1|3643792_3644434_-	bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase	NA	NA	NA	NA	NA
WP_001069467.1|3644470_3646282_-	phosphogluconate dehydratase	NA	NA	NA	NA	NA
WP_000301719.1|3646516_3647992_-	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	37.3	3.7e-78
WP_001056706.1|3648330_3649200_+	DNA-binding transcriptional regulator HexR	NA	NA	NA	NA	NA
WP_000091148.1|3649327_3650770_+	pyruvate kinase	NA	NA	NA	NA	NA
WP_000448381.1|3650900_3651872_-	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
WP_001184045.1|3651991_3653314_-	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	40.9	1.2e-14
WP_001300644.1|3653329_3654262_-	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_000202996.1|3654340_3655096_+	zinc ABC transporter ATP-binding protein ZnuC	NA	G3M9Y6	Bacillus_virus	28.3	1.3e-18
WP_000571479.1|3655092_3655878_+	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_000568519.1|3656024_3657035_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.5	5.6e-09
WP_000580327.1|3657043_3657655_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_072094247.1|3657793_3657859_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001024904.1|3657929_3658532_+	YebB family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_001295503.1|3658533_3659055_-	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.0e-10
WP_000907234.1|3659089_3659830_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_001300367.1|3659858_3660311_-	dihydroneopterin triphosphate diphosphatase	NA	NA	NA	NA	NA
WP_001258678.1|3660428_3662201_-|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000891599.1|3662510_3663077_+	hydrolase	NA	NA	NA	NA	NA
WP_032199916.1|3663660_3664191_-|tail	tail fiber assembly protein	tail	A0A0U2QV64	Escherichia_phage	85.2	1.4e-83
WP_032199917.1|3664205_3665315_-	hypothetical protein	NA	Q8W613	Enterobacteria_phage	60.0	6.2e-110
WP_032199919.1|3665345_3666395_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000377821.1|3666418_3667378_-	YmfQ family protein	NA	Q8W614	Enterobacteria_phage	91.8	9.5e-107
WP_000785585.1|3667377_3668460_-|plate	baseplate J/gp47 family protein	plate	Q8W615	Enterobacteria_phage	97.2	4.7e-203
WP_032199920.1|3668452_3668866_-	phage GP46 family protein	NA	Q8W616	Enterobacteria_phage	97.1	4.3e-72
WP_001013087.1|3668871_3669405_-|plate	phage baseplate assembly protein	plate	Q8W617	Enterobacteria_phage	98.3	7.9e-95
WP_032199921.1|3669404_3670460_-|plate	baseplate protein	plate	Q8W618	Enterobacteria_phage	98.9	1.0e-199
WP_032199922.1|3670456_3671848_-	DNA circularization protein	NA	Q8W619	Enterobacteria_phage	95.5	4.4e-246
WP_032199923.1|3671863_3673813_-|tail	phage tail tape measure protein	tail	Q8W620	Enterobacteria_phage	95.4	0.0e+00
WP_001251341.1|3673897_3674233_-|tail	phage tail assembly protein	tail	Q8W621	Enterobacteria_phage	98.2	1.2e-51
WP_001062340.1|3674232_3674589_-	hypothetical protein	NA	Q8W622	Enterobacteria_phage	99.2	5.3e-63
WP_032199924.1|3674588_3676085_-|tail	tail sheath protein	tail	Q8W623	Enterobacteria_phage	98.0	3.7e-275
WP_000497741.1|3676081_3676243_-	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	76.6	3.2e-15
WP_000779448.1|3676252_3676816_-	hypothetical protein	NA	Q8W624	Enterobacteria_phage	99.5	1.2e-106
WP_032199925.1|3676812_3677337_-	hypothetical protein	NA	Q8W625	Enterobacteria_phage	97.7	9.5e-93
WP_000702446.1|3677302_3677719_-|head	phage head closure protein	head	Q8HAC9	Salmonella_phage	69.9	8.1e-47
WP_000924706.1|3677715_3678039_-|head,tail	phage gp6-like head-tail connector protein	head,tail	Q8W626	Enterobacteria_phage	100.0	3.3e-56
WP_000257482.1|3678084_3679311_-|capsid	phage major capsid protein	capsid	Q8W627	Enterobacteria_phage	92.1	1.6e-199
WP_032199928.1|3679324_3679975_-|head,protease	HK97 family phage prohead protease	head,protease	Q8W628	Enterobacteria_phage	97.2	5.6e-119
3679495:3679510	attL	CCAGCGCATTTTTCAC	NA	NA	NA	NA
WP_032199929.1|3679952_3681194_-|portal	phage portal protein	portal	Q8W629	Enterobacteria_phage	91.3	6.1e-223
WP_096985425.1|3681386_3683144_-|terminase	terminase large subunit	terminase	A0A1B5FP96	Escherichia_phage	99.3	0.0e+00
WP_024166447.1|3683143_3683626_-|terminase	phage terminase small subunit P27 family	terminase	A0A1B5FPA0	Escherichia_phage	98.1	8.7e-85
WP_096934181.1|3683770_3684124_-	HNH endonuclease	NA	Q8W633	Enterobacteria_phage	99.1	3.6e-64
WP_001138287.1|3684466_3684622_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001297666.1|3684650_3684764_-	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	86.5	5.6e-11
WP_001117825.1|3684896_3685274_-	M15 family metallopeptidase	NA	Q9MBZ3	Enterobacteria_phage	96.0	5.6e-63
WP_000950576.1|3685276_3685552_-|holin	phage holin family protein	holin	Q9MBZ4	Enterobacteria_phage	97.8	1.9e-44
WP_001355862.1|3685541_3685934_-|holin	holin	holin	Q9MBZ5	Enterobacteria_phage	78.5	4.5e-47
WP_032219803.1|3686020_3686173_-	DUF3927 family protein	NA	NA	NA	NA	NA
WP_032239021.1|3686169_3686595_-	tellurite resistance TerB family protein	NA	Q71TK7	Escherichia_phage	86.5	3.8e-60
WP_032205543.1|3687069_3688119_-	site-specific DNA-methyltransferase	NA	Q8W637	Enterobacteria_phage	89.1	2.8e-184
WP_000917691.1|3688269_3688467_-	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	98.5	1.4e-28
WP_000640018.1|3688779_3689322_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	68.8	2.4e-67
WP_001217422.1|3689330_3689690_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	61.7	1.5e-36
WP_001436039.1|3689702_3690692_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	93.9	3.4e-184
WP_032199832.1|3690743_3691001_-	hypothetical protein	NA	Q8W639	Enterobacteria_phage	69.7	1.4e-20
WP_032199833.1|3690997_3692389_-	replicative DNA helicase	NA	Q8W640	Enterobacteria_phage	93.7	1.0e-250
WP_032199834.1|3692385_3693264_-	ATP-binding protein	NA	Q8W641	Enterobacteria_phage	81.6	7.8e-116
WP_032199835.1|3693274_3694267_-	hypothetical protein	NA	Q8W642	Enterobacteria_phage	95.5	1.0e-55
WP_000995578.1|3694263_3694563_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000618007.1|3694559_3694784_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000626792.1|3694780_3694975_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032199836.1|3694971_3695634_-	hypothetical protein	NA	Q8W643	Enterobacteria_phage	89.3	2.0e-103
WP_001090259.1|3695743_3696451_-	DNA-binding protein	NA	Q8W645	Enterobacteria_phage	86.0	9.1e-107
WP_000398850.1|3696447_3696738_-	Cro/Cl family transcriptional regulator	NA	A0A1B5FPK9	Escherichia_phage	89.7	1.7e-35
WP_000800136.1|3696871_3697561_+	LexA family transcriptional regulator	NA	A0A1B5FPF4	Escherichia_phage	88.2	6.1e-116
WP_023151472.1|3697707_3698256_+	helix-turn-helix transcriptional regulator	NA	A0A1B5FPB8	Escherichia_phage	71.9	8.0e-42
WP_001436867.1|3698543_3698750_+	hypothetical protein	NA	Q8W651	Enterobacteria_phage	97.1	6.9e-31
WP_032199837.1|3698945_3699305_+	hypothetical protein	NA	A0A1B5FPB3	Escherichia_phage	73.6	2.4e-39
WP_000002321.1|3699304_3699520_+	hypothetical protein	NA	A0A1B5FPB7	Escherichia_phage	63.4	1.2e-17
WP_162137203.1|3699587_3699710_+	hypothetical protein	NA	A0A286S1P6	Klebsiella_phage	80.0	7.9e-11
WP_001538854.1|3699706_3700099_+	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	57.1	1.4e-35
WP_001538856.1|3700344_3701172_+|protease	serine protease	protease	Q8W654	Enterobacteria_phage	97.8	4.5e-129
WP_032199838.1|3701213_3701585_+	DUF5406 family protein	NA	Q8W655	Enterobacteria_phage	97.6	3.8e-64
WP_001538858.1|3701616_3701859_+	DUF4222 domain-containing protein	NA	Q8W656	Enterobacteria_phage	95.0	1.4e-35
WP_001030139.1|3701862_3702009_+	hypothetical protein	NA	A0A1B5FPC2	Escherichia_phage	95.8	3.1e-22
WP_000528718.1|3702017_3702254_+	excisionase family protein	NA	Q8W657	Enterobacteria_phage	100.0	6.4e-41
WP_016239042.1|3702309_3703623_+|integrase	site-specific integrase	integrase	Q8W658	Enterobacteria_phage	96.8	1.8e-249
WP_050438170.1|3703604_3704375_+	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	99.2	6.1e-72
WP_000252980.1|3704427_3704823_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000019588.1|3704863_3705607_+	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	4.6e-24
WP_000564725.1|3705603_3706575_+|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_001734512.1|3706739_3709169_-	trimethylamine N-oxide reductase TorZ	NA	NA	NA	NA	NA
3707288:3707303	attR	CCAGCGCATTTTTCAC	NA	NA	NA	NA
WP_001734513.1|3709193_3710294_-	cytochrome c-type protein TorY	NA	NA	NA	NA	NA
WP_001185727.1|3710681_3711428_-	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_001295504.1|3711441_3712008_-	VOC family protein	NA	NA	NA	NA	NA
WP_001025322.1|3712223_3713957_+|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.5	3.4e-86
>prophage 8
NZ_CP024256	Escherichia coli strain ATCC 43886 chromosome, complete genome	4914654	3894574	3900874	4914654		Enterobacteria_phage(33.33%)	6	NA	NA
WP_001100809.1|3894574_3895117_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	62.5	2.4e-51
WP_001735403.1|3895119_3895998_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	A0A291LA53	Escherichia_phage	63.4	2.1e-105
WP_001023634.1|3896055_3896955_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.5	7.4e-29
WP_000699428.1|3896954_3898040_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.4	1.7e-99
WP_000183060.1|3898411_3899305_-	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	1.0e-46
WP_001735404.1|3899479_3900874_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	33.5	1.3e-19
>prophage 9
NZ_CP024256	Escherichia coli strain ATCC 43886 chromosome, complete genome	4914654	3949408	4013016	4914654	holin,head,capsid,plate,integrase,tRNA,tail,lysis,terminase,portal	Enterobacteria_phage(32.56%)	67	3953707:3953733	3985751:3985777
WP_000675141.1|3949408_3950812_+	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.0	1.0e-32
WP_000137877.1|3950808_3951531_+	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.6	3.7e-31
WP_000929408.1|3951721_3952054_+	YegP family protein	NA	NA	NA	NA	NA
WP_000476014.1|3952200_3953562_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	99.7	1.9e-217
3953707:3953733	attL	AATCTCCCTTACACGGGCTTATTTTTT	NA	NA	NA	NA
WP_000468308.1|3953832_3954051_-	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_005759234.1|3954132_3955296_-	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	99.5	8.3e-206
WP_001389981.1|3955295_3955775_-|tail	phage tail protein	tail	M1TAU1	Escherichia_phage	99.4	1.1e-84
WP_000785970.1|3958228_3958348_-|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_001031303.1|3958380_3958656_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
WP_001251408.1|3958712_3959231_-|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_001735421.1|3960731_3961259_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001461858.1|3961648_3962176_-|tail	tail fiber assembly protein	tail	Q7Y4D3	Escherichia_virus	95.4	2.3e-91
WP_032199506.1|3962179_3964474_-|tail	phage tail protein	tail	U5N099	Enterobacteria_phage	62.2	8.7e-183
WP_001735424.1|3964484_3965015_-|tail	phage tail protein I	tail	U5N0U8	Enterobacteria_phage	99.4	8.6e-102
WP_001735425.1|3965007_3965916_-|plate	baseplate assembly protein	plate	U5N3T9	Enterobacteria_phage	99.7	4.4e-162
WP_001735426.1|3965920_3966268_-	lysozyme family protein	NA	A0A0F7L9X3	Escherichia_phage	99.1	6.5e-58
WP_001735427.1|3966264_3966900_-|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	97.6	1.0e-112
WP_001001767.1|3966966_3967419_-	phage virion morphogenesis protein	NA	A0A0F7LBV9	Escherichia_phage	99.3	2.4e-76
WP_001735428.1|3967411_3967879_-|tail	phage tail protein	tail	A0A0F7LA33	Escherichia_phage	98.7	8.7e-82
WP_001300730.1|3967841_3968015_-	hypothetical protein	NA	Q7Y4E1	Escherichia_virus	94.7	5.2e-24
WP_001735429.1|3967986_3968412_-|lysis	LysB family phage lysis regulatory protein	lysis	U5N3W5	Enterobacteria_phage	95.7	1.0e-65
WP_001598741.1|3968399_3968825_-	hypothetical protein	NA	A0A0F7LDU9	Escherichia_phage	97.2	5.0e-60
WP_001735430.1|3968839_3969337_-	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	98.8	9.9e-92
WP_000123123.1|3969336_3969618_-|holin	holin	holin	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
WP_001735431.1|3969621_3969825_-	phage Tail protein X family protein	NA	U5N3E7	Enterobacteria_phage	98.5	2.0e-30
WP_005759421.1|3969824_3970334_-|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	98.8	4.3e-90
WP_024169832.1|3970433_3971177_-|terminase	terminase endonuclease subunit	terminase	Q94ME4	Enterobacteria_phage	98.0	4.7e-122
WP_032199507.1|3971180_3972254_-|capsid	phage major capsid protein, P2 family	capsid	Q94ME5	Enterobacteria_phage	99.4	2.8e-200
WP_001735435.1|3972312_3973167_-|capsid	GPO family capsid scaffolding protein	capsid	Q94MH0	Enterobacteria_phage	99.3	9.6e-135
WP_000156872.1|3973340_3975113_+|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCK3	Escherichia_phage	100.0	0.0e+00
WP_000038182.1|3975112_3976147_+|portal	phage portal protein	portal	Q858W8	Yersinia_virus	99.7	2.4e-201
WP_001735437.1|3976651_3979246_+	SIR2-like domain protein	NA	NA	NA	NA	NA
WP_032199509.1|3979806_3982092_-	replication endonuclease	NA	Q858T4	Yersinia_virus	97.8	0.0e+00
WP_000027664.1|3982081_3982357_-	DUF5405 family protein	NA	U5N3W1	Enterobacteria_phage	100.0	3.8e-45
WP_001113264.1|3982353_3982578_-	TraR/DksA family transcriptional regulator	NA	S4TRY6	Salmonella_phage	100.0	2.9e-35
WP_001516669.1|3982580_3982880_-	DUF5405 family protein	NA	S4TUD1	Salmonella_phage	98.0	1.2e-44
WP_000557703.1|3982879_3983104_-	DUF2732 family protein	NA	S4TP68	Salmonella_phage	100.0	4.7e-33
WP_000217684.1|3983167_3983668_-	hypothetical protein	NA	S4TTB7	Salmonella_phage	99.4	3.8e-91
WP_001005162.1|3983664_3983835_-	hypothetical protein	NA	S4TNZ7	Salmonella_phage	100.0	6.1e-25
WP_001081582.1|3983845_3984121_-	hypothetical protein	NA	Q1JS60	Enterobacteria_phage	100.0	1.3e-48
WP_000020919.1|3984242_3984542_+	helix-turn-helix domain-containing protein	NA	Q1JS61	Enterobacteria_phage	100.0	2.4e-48
WP_001516670.1|3984657_3985671_+|integrase	site-specific integrase	integrase	Q83VS6	Escherichia_phage	99.1	3.1e-193
WP_001318299.1|3985936_3986254_-	hypothetical protein	NA	NA	NA	NA	NA
3985751:3985777	attR	AATCTCCCTTACACGGGCTTATTTTTT	NA	NA	NA	NA
WP_000807356.1|3986659_3987559_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	1.7e-12
WP_000178552.1|3987640_3988420_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_000844219.1|3988519_3989560_-	galactitol-1-phosphate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_000490679.1|3989607_3990963_-	galactitol permease IIC component	NA	NA	NA	NA	NA
WP_000823270.1|3990966_3991251_-	PTS galactitol transporter subunit IIB	NA	NA	NA	NA	NA
WP_001735440.1|3991281_3991734_-	PTS galactitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_001735442.1|3993033_3993888_-	tagatose-bisphosphate aldolase subunit GatY	NA	NA	NA	NA	NA
WP_000129543.1|3994195_3995248_-	class I fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_000858484.1|3995504_3996782_+	nucleoside permease	NA	NA	NA	NA	NA
WP_001735443.1|3996778_3997783_+	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	28.7	3.2e-12
WP_000011958.1|3997779_3998745_+	sugar kinase	NA	NA	NA	NA	NA
WP_000434038.1|3998718_3999465_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001352238.1|3999516_4000335_-	glycoside hydrolase family 25 protein	NA	D0R7H8	Paenibacillus_phage	38.0	1.9e-23
WP_000822266.1|4000399_4001200_-	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_001195568.1|4001196_4001985_-	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
WP_000019944.1|4002207_4002480_-	Ni(II)/Co(II)-binding transcriptional repressor RcnR	NA	NA	NA	NA	NA
WP_001735444.1|4002599_4003424_+	nickel/cobalt efflux protein RcnA	NA	NA	NA	NA	NA
WP_000153074.1|4003642_4003981_+	Ni(II)/Co(II) efflux transporter accessory subunit RcnB	NA	NA	NA	NA	NA
WP_000405695.1|4004062_4005097_-	putative fimbrial-like adhesin protein	NA	NA	NA	NA	NA
WP_000945448.1|4005112_4007593_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_000830456.1|4008362_4008905_-	fimbrial protein	NA	NA	NA	NA	NA
WP_001324851.1|4009197_4009479_-	YehE family protein	NA	NA	NA	NA	NA
WP_001005448.1|4009741_4010851_-	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_001350533.1|4010982_4013016_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.8e-54
>prophage 10
NZ_CP024256	Escherichia coli strain ATCC 43886 chromosome, complete genome	4914654	4024647	4034088	4914654		Enterobacteria_phage(85.71%)	10	NA	NA
WP_001333512.1|4024647_4025784_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.7	1.9e-162
WP_001375261.1|4025780_4027781_+	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	96.1	0.0e+00
WP_001295429.1|4027905_4028367_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_000950409.1|4028406_4028877_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	5.2e-82
WP_000598641.1|4028923_4029643_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295431.1|4029639_4031325_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_001240401.1|4031546_4032278_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001216963.1|4032337_4032445_+	protein YohO	NA	NA	NA	NA	NA
WP_000783120.1|4032425_4033157_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_000569357.1|4033161_4034088_-	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	1.7e-23
>prophage 11
NZ_CP024256	Escherichia coli strain ATCC 43886 chromosome, complete genome	4914654	4250339	4322645	4914654	holin,head,integrase,tRNA,lysis,terminase,portal,coat	Enterobacteria_phage(57.38%)	88	4272476:4272492	4296573:4296589
WP_001735504.1|4250339_4251152_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_001289167.1|4251151_4252165_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000699145.1|4252230_4253367_-	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	28.8	5.9e-23
WP_000615834.1|4253465_4254461_+	flagella biosynthesis regulator Flk	NA	NA	NA	NA	NA
WP_000127751.1|4254457_4255636_-	arabinose transporter	NA	NA	NA	NA	NA
WP_000817178.1|4255900_4257121_-	beta-ketoacyl-ACP synthase I	NA	NA	NA	NA	NA
WP_000683789.1|4257279_4259286_+|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
WP_000559764.1|4259406_4259685_-	YfcL family protein	NA	NA	NA	NA	NA
WP_001089222.1|4259718_4260267_-	elongation factor P hydroxylase	NA	NA	NA	NA	NA
WP_000447361.1|4260266_4261076_-	TSUP family transporter	NA	NA	NA	NA	NA
WP_001043825.1|4261075_4261900_-	penicillin-insensitive murein endopeptidase	NA	NA	NA	NA	NA
WP_001333535.1|4261903_4262989_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	47.8	9.1e-90
WP_001300582.1|4263023_4263956_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_000730806.1|4264121_4264673_+	endonuclease SmrB	NA	NA	NA	NA	NA
WP_000698745.1|4264743_4265565_-	YfcO family protein	NA	NA	NA	NA	NA
WP_001043398.1|4265566_4266106_-	fimbrial protein	NA	NA	NA	NA	NA
WP_001232542.1|4266102_4266591_-	fimbrial protein	NA	NA	NA	NA	NA
WP_001311011.1|4266587_4267100_-	fimbrial protein	NA	NA	NA	NA	NA
WP_001281606.1|4267099_4267852_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_001735506.1|4267871_4270517_-	fimbrial usher protein YfcU	NA	NA	NA	NA	NA
WP_000033316.1|4270598_4271162_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_001195819.1|4271842_4272328_-	phosphohistidine phosphatase SixA	NA	NA	NA	NA	NA
4272476:4272492	attL	TACATTTTGACCAACAC	NA	NA	NA	NA
WP_005759751.1|4272530_4274675_-	fatty acid oxidation complex subunit alpha FadJ	NA	NA	NA	NA	NA
WP_032199599.1|4274674_4275985_-	acetyl-CoA C-acyltransferase FadI	NA	NA	NA	NA	NA
WP_001296261.1|4276165_4276450_-	YfcZ/YiiS family protein	NA	NA	NA	NA	NA
WP_001295701.1|4276821_4278162_+	long-chain fatty acid transporter FadL	NA	NA	NA	NA	NA
WP_000776768.1|4280336_4281092_-	phospholipid-binding lipoprotein MlaA	NA	NA	NA	NA	NA
WP_000368140.1|4281385_4282318_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	99.0	2.5e-165
WP_032199585.1|4282629_4283787_+|integrase	prophage integrase IntS	integrase	A5VW56	Enterobacteria_phage	99.5	2.2e-222
WP_050438166.1|4284056_4285802_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_032199584.1|4285867_4288132_-|head	head-binding protein	head	A5VW57	Enterobacteria_phage	33.6	4.6e-11
WP_032199583.1|4288232_4289111_-	antirepressor	NA	I6R977	Salmonella_phage	75.4	3.0e-91
WP_001210981.1|4289173_4289395_-	hypothetical protein	NA	I6RSG6	Salmonella_phage	100.0	1.9e-34
WP_001161119.1|4289391_4289550_-	Arc family DNA-binding protein	NA	I6S1K8	Salmonella_phage	100.0	7.6e-22
WP_099554642.1|4289676_4289886_+	Arc family DNA-binding protein	NA	I6R0M0	Salmonella_phage	100.0	1.2e-30
WP_000437781.1|4289888_4290122_+	hypothetical protein	NA	I6S5X8	Salmonella_phage	100.0	1.7e-38
WP_016049822.1|4290118_4290328_+	hypothetical protein	NA	I6R975	Salmonella_phage	100.0	3.5e-30
WP_000151196.1|4290302_4290488_-	hypothetical protein	NA	I6RSG3	Salmonella_phage	100.0	1.1e-08
WP_000136767.1|4290879_4291848_-	hypothetical protein	NA	A9YX09	Burkholderia_phage	48.6	8.5e-71
WP_000832789.1|4292004_4292232_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000224776.1|4292228_4294352_-	hypothetical protein	NA	A0A0A0P1R1	Enterobacteria_phage	29.3	3.6e-50
WP_032199580.1|4294336_4295686_-	phage DNA ejection protein	NA	A0A0M5M1J8	Salmonella_phage	70.8	4.8e-173
WP_005759988.1|4295696_4296389_-	hypothetical protein	NA	I6S1K1	Salmonella_phage	96.5	6.4e-113
WP_001734499.1|4296391_4296847_-	DUF2824 family protein	NA	A0A2D1GLX4	Escherichia_phage	99.3	5.2e-87
4296573:4296589	attR	GTGTTGGTCAAAATGTA	NA	NA	NA	NA
WP_001734498.1|4296846_4297548_-	hypothetical protein	NA	G5DA78	Enterobacteria_phage	96.1	2.8e-116
WP_001734497.1|4297547_4298966_-	phage stabilization family protein	NA	A0A088CQ70	Enterobacteria_phage	98.9	3.3e-273
WP_001734496.1|4298975_4299437_-	packaged DNA stabilization protein gp4	NA	A5VW70	Enterobacteria_phage	99.3	2.7e-83
WP_001389518.1|4299417_4299606_-	hypothetical protein	NA	A0A088CPR7	Enterobacteria_phage	100.0	2.9e-28
WP_005759997.1|4299647_4300907_-|coat	coat protein	coat	A5VW72	Enterobacteria_phage	94.3	2.3e-222
WP_001734493.1|4300925_4301819_-	hypothetical protein	NA	A0A088CPT0	Enterobacteria_phage	98.3	8.2e-129
WP_032199577.1|4301909_4304108_-|portal	portal protein	portal	A0A088CQ69	Enterobacteria_phage	96.6	0.0e+00
WP_032199576.1|4304109_4305525_-|terminase	PBSX family phage terminase large subunit	terminase	A5VW75	Enterobacteria_phage	99.6	2.6e-278
WP_000113732.1|4305521_4305962_-	hypothetical protein	NA	C7U0V7	Enterobacteria_phage	99.3	1.7e-79
WP_000807788.1|4305964_4306207_-	DUF2560 family protein	NA	A5VW77	Enterobacteria_phage	100.0	1.3e-36
WP_000877024.1|4306463_4306994_-	KilA-N domain-containing protein	NA	B8K1H1	Salmonella_phage	95.5	3.4e-90
WP_032199573.1|4307199_4307352_-	hypothetical protein	NA	K7PHR3	Enterobacteria_phage	98.0	2.8e-21
WP_032199572.1|4307339_4307777_-|lysis	lysis protein	lysis	Q9MCN3	Enterobacteria_phage	97.9	1.9e-70
WP_000229389.1|4307773_4308250_-	glycoside hydrolase family protein	NA	A5VW81	Enterobacteria_phage	100.0	7.5e-89
WP_000783734.1|4308233_4308557_-|holin	phage holin, lambda family	holin	G5DA93	Enterobacteria_phage	100.0	1.3e-52
WP_000512806.1|4309045_4309534_-	late gene antiterminator protein	NA	M1FPN0	Enterobacteria_phage	100.0	5.3e-90
WP_021566244.1|4309524_4310196_-	serine/threonine protein phosphatase	NA	Q716B9	Shigella_phage	96.9	2.5e-130
WP_000144614.1|4310173_4310380_-	protein ninH	NA	Q716C0	Shigella_phage	100.0	7.3e-33
WP_032199569.1|4310376_4310982_-	recombination protein NinG	NA	A0A1I9LJQ2	Stx_converting_phage	97.5	7.3e-97
WP_001543885.1|4310974_4311184_-	protein ninF	NA	G9L691	Escherichia_phage	97.1	3.5e-30
WP_024169840.1|4311143_4311545_-	hypothetical protein	NA	K7PJK0	Enterobacteria_phage	86.5	2.3e-59
WP_001254233.1|4311547_4311724_-	NinE family protein	NA	A5VW90	Enterobacteria_phage	98.3	3.9e-27
WP_032199567.1|4311720_4312131_-	recombination protein NinB	NA	K7PK24	Enterobacteria_phage	98.5	4.7e-71
WP_032199566.1|4312330_4312651_-	hypothetical protein	NA	A0A2I6PIG0	Escherichia_phage	74.5	5.9e-37
WP_032199564.1|4312668_4312875_-	membrane protein	NA	G8C7M4	Escherichia_phage	98.5	2.1e-27
WP_032199562.1|4312947_4314324_-	AAA family ATPase	NA	A0A0P0ZC27	Stx2-converting_phage	99.6	2.8e-253
WP_032199586.1|4314320_4315208_-	replication protein	NA	A5VW95	Enterobacteria_phage	99.3	3.1e-144
WP_001244621.1|4315270_4315543_-	hypothetical protein	NA	G9L679	Escherichia_phage	100.0	2.7e-43
WP_000251072.1|4315565_4315859_-	hypothetical protein	NA	A5VW96	Enterobacteria_phage	100.0	1.7e-46
WP_000276886.1|4315967_4316153_-	hypothetical protein	NA	A5VW97	Enterobacteria_phage	100.0	1.6e-26
WP_000856967.1|4316233_4316884_+	LexA family transcriptional regulator	NA	A5VW98	Enterobacteria_phage	100.0	1.1e-122
WP_032199561.1|4317198_4317498_+	hypothetical protein	NA	A5VW99	Enterobacteria_phage	96.0	1.2e-28
WP_032199560.1|4317509_4318133_+	hypothetical protein	NA	A4KWT2	Enterobacteria_phage	98.1	3.3e-108
WP_001183771.1|4318357_4318528_+	hypothetical protein	NA	A0A192Y6R1	Salmonella_phage	100.0	1.3e-24
WP_000031370.1|4318784_4319390_+	ERF family protein	NA	Q9MCQ9	Enterobacteria_phage	100.0	4.1e-108
WP_000951325.1|4319389_4319773_+	hypothetical protein	NA	A0A2I6PID1	Escherichia_phage	100.0	3.8e-67
WP_001111304.1|4319796_4320093_+	DUF2856 family protein	NA	A5VWB0	Enterobacteria_phage	100.0	7.8e-52
WP_001214452.1|4320103_4320268_+	DUF2737 family protein	NA	A0A2I6PID4	Escherichia_phage	98.1	4.6e-22
WP_032199555.1|4320264_4320783_+	hypothetical protein	NA	A5VWB1	Enterobacteria_phage	64.2	4.5e-55
WP_032199554.1|4320779_4321307_+	ead/Ea22-like family protein	NA	K7P6J7	Enterobacteria_phage	67.6	6.2e-76
WP_032199553.1|4321308_4321500_+	hypothetical protein	NA	G9L660	Escherichia_phage	93.7	2.6e-24
WP_032199551.1|4321502_4322036_+	DUF551 domain-containing protein	NA	K7PK20	Enterobacteria_phage	90.1	1.5e-77
WP_032199548.1|4322132_4322312_+	Eag protein	NA	K7PL40	Enterobacteria_phage	98.3	7.3e-29
WP_001163428.1|4322444_4322645_+	response regulator inhibitor TorI	NA	K7P7V0	Enterobacteria_phage	100.0	2.4e-33
>prophage 1
NZ_CP024254	Escherichia coli strain ATCC 43886 plasmid unnamed1, complete sequence	107732	5154	12972	107732	transposase	Vibrio_phage(16.67%)	9	NA	NA
WP_000086137.1|5154_5838_-	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.9	1.3e-30
WP_072108049.1|6221_7193_-	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
WP_000618110.1|7542_7791_+	DinI-like family protein	NA	Q2A098	Sodalis_phage	48.0	1.9e-14
WP_000109071.1|7787_8225_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	48.4	8.3e-26
WP_000457510.1|8224_9496_+	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	60.4	1.7e-143
WP_000587689.1|9699_10326_+	ParA family plasmid-partitioning AAA ATPase	NA	E5FFJ3	Burkholderia_phage	31.1	2.0e-17
WP_001245884.1|10322_10625_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072148161.1|11175_11700_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164474068.1|11759_12972_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.3	1.4e-168
>prophage 1
NZ_CP024255	Escherichia coli strain ATCC 43886 plasmid unnamed2, complete sequence	95515	0	92036	95515	protease,transposase	Stx2-converting_phage(41.38%)	68	NA	NA
WP_001734574.1|1390_2467_+|transposase	IS110-like element ISEc21 family transposase	transposase	NA	NA	NA	NA
WP_001736027.1|3524_3716_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032200285.1|3775_4453_+	molecular chaperone	NA	NA	NA	NA	NA
WP_024169891.1|7100_7478_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001736034.1|10715_11513_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	98.5	5.2e-143
WP_001736036.1|12580_13720_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001736038.1|13716_14922_+	TolC family protein	NA	NA	NA	NA	NA
WP_050438176.1|14878_15652_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024169892.1|15644_16271_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.0	3.7e-19
WP_001399277.1|17140_17290_-	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	70.5	7.0e-09
WP_164997624.1|19798_20578_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	98.8	1.0e-138
WP_000255946.1|20577_21600_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.4	4.6e-200
WP_001470895.1|23009_23192_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024169893.1|23247_23772_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	85.7	3.9e-70
WP_001339397.1|23872_24550_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000624622.1|24549_24897_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_000381395.1|24916_26488_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_164997625.1|26651_27864_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.3	1.4e-168
WP_001734642.1|29049_29913_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_024169750.1|31430_31622_-	ANR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001734638.1|31824_32622_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_032200404.1|33264_34371_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_001339397.1|36020_36698_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000624622.1|36697_37045_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_000381395.1|37064_38636_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_013188479.1|40654_41029_-	heat-labile enterotoxin LT subunit B	NA	D1GID8	Vibrio_virus	79.8	3.7e-51
WP_001734409.1|41025_41802_-	heat-labile enterotoxin LT subunit A	NA	A0A023W6A1	Vibrio_virus	80.2	8.4e-122
WP_001401515.1|43323_44181_-	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
WP_001365705.1|44173_44248_-	RepA leader peptide Tap	NA	NA	NA	NA	NA
WP_000083817.1|44472_44733_-	replication regulatory protein RepA	NA	NA	NA	NA	NA
WP_001734555.1|45256_46663_+|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	47.2	1.0e-117
WP_139371347.1|46665_47879_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.7	4.9e-169
WP_064727294.1|48562_48685_-	Hok/Gef family protein	NA	NA	NA	NA	NA
WP_001393357.1|49033_49216_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001734655.1|49439_50171_-	type-F conjugative transfer system pilin acetylase TraX	NA	NA	NA	NA	NA
WP_024169751.1|50167_50734_-	DUF2726 domain-containing protein	NA	NA	NA	NA	NA
WP_001734653.1|50751_55935_-	conjugative transfer relaxase/helicase TraI	NA	NA	NA	NA	NA
WP_001734652.1|56103_57090_-	conjugal transfer pilus assembly protein TraU	NA	NA	NA	NA	NA
WP_000286241.1|57086_57722_-	type-F conjugative transfer system protein TraW	NA	NA	NA	NA	NA
WP_032199709.1|57724_58186_-	type-F conjugative transfer system protein TrbI	NA	NA	NA	NA	NA
WP_001735610.1|58182_60774_-	type IV secretion system protein TraC	NA	NA	NA	NA	NA
WP_001735611.1|60784_61384_-	type IV conjugative transfer system lipoprotein TraV	NA	NA	NA	NA	NA
WP_001735612.1|61490_61715_-	prokaryotic dksA/traR C4-type zinc finger family protein	NA	H2BDI2	Pseudomonas_virus	61.1	3.7e-06
WP_001735613.1|61826_63191_-	F-type conjugal transfer pilus assembly protein TraB	NA	NA	NA	NA	NA
WP_099554542.1|63177_63918_-	type-F conjugative transfer system secretin TraK	NA	NA	NA	NA	NA
WP_000406019.1|63907_64471_-	type IV conjugative transfer system protein TraE	NA	NA	NA	NA	NA
WP_001735616.1|64490_64796_-	type IV conjugative transfer system protein TraL	NA	NA	NA	NA	NA
WP_157187929.1|65253_65421_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000974581.1|65636_65918_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024169848.1|66397_66784_-	relaxosome protein TraM	NA	NA	NA	NA	NA
WP_000169527.1|67410_67710_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_164997626.1|67706_68573_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	2.3e-51
WP_001735678.1|69206_69671_+	CS6 fimbrial subunit CssA	NA	NA	NA	NA	NA
WP_001297627.1|69688_70192_+	CS6 fimbrial subunit CssB	NA	NA	NA	NA	NA
WP_024169853.1|70244_70943_+	CS6 fimbrial biogenesis chaperone CssC	NA	NA	NA	NA	NA
WP_157195932.1|70899_73359_+	CS6 fimbrial biogenesis usher CssD	NA	NA	NA	NA	NA
WP_000845954.1|76313_76748_+	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
WP_001312861.1|77734_77893_+	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_099554548.1|78186_79758_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.9	9.9e-170
WP_000624622.1|79777_80125_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_099554551.1|80124_80802_-|transposase	transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_001339397.1|81355_82033_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000624622.1|82032_82380_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_000381395.1|82399_83971_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_032200419.1|84156_88251_-|protease	serine protease autotransporter toxin EatA	protease	Q9LA58	Enterobacterial_phage	39.6	2.7e-259
WP_088563528.1|88529_89223_+|transposase	IS1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	96.1	1.7e-129
WP_164997627.1|89741_90954_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.7	4.9e-169
WP_164997626.1|91169_92036_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	2.3e-51
