The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP024240	Escherichia coli O114:H49 strain 90-9280 chromosome, complete genome	4966338	136936	191656	4966338	tail,tRNA,holin,portal,lysis,terminase,capsid,head,integrase	Enterobacteria_phage(41.67%)	63	135548:135563	153500:153515
135548:135563	attL	ATCCACCGCATCACCG	NA	NA	NA	NA
WP_000074983.1|136936_138055_-|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z04	Phage_21	44.2	7.7e-84
WP_000003742.1|138023_138293_-	excisionase	NA	NA	NA	NA	NA
WP_000048273.1|138354_140826_-	exonuclease	NA	K7PLW7	Enterobacteria_phage	60.3	8.5e-59
WP_001356104.1|140919_141111_-|lysis	lysis protein YdfD	lysis	NA	NA	NA	NA
WP_001358566.1|141107_141296_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001387733.1|141696_142134_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001387734.1|142102_142432_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001387735.1|142443_142596_-	DUF1391 family protein	NA	NA	NA	NA	NA
WP_001420344.1|142888_143227_-	peptidase S24	NA	H9C160	Pectobacterium_phage	32.0	2.5e-06
WP_000747951.1|143618_143861_+	hypothetical protein	NA	H9C161	Pectobacterium_phage	55.8	4.8e-07
WP_000693850.1|143844_144270_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001151150.1|145451_145874_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	90.6	2.6e-64
WP_000403785.1|145931_146288_+	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	99.2	1.8e-58
WP_001224664.1|146381_146564_+	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	98.3	1.5e-26
WP_000813254.1|147654_147810_+	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_023141427.1|147977_148250_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	50.8	4.2e-12
WP_001387739.1|148251_149310_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	48.3	1.2e-89
WP_000140024.1|149310_149676_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	64.3	1.6e-38
WP_000640017.1|149684_150227_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	72.9	1.9e-72
WP_000917767.1|150458_150656_+	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	100.0	2.1e-29
WP_000611206.1|150806_151856_+	site-specific DNA-methyltransferase	NA	Q8W637	Enterobacteria_phage	89.1	2.8e-184
WP_000907693.1|152177_152402_+	tellurite resistance TerB family protein	NA	Q71TK7	Escherichia_phage	75.4	1.1e-21
WP_000833651.1|152398_152551_+	DUF3927 family protein	NA	NA	NA	NA	NA
WP_001297664.1|152639_153032_+|holin	holin	holin	Q9MBZ5	Enterobacteria_phage	78.5	3.4e-47
WP_001297670.1|153021_153297_+|holin	phage holin family protein	holin	Q9MBZ4	Enterobacteria_phage	96.7	1.6e-43
WP_001117825.1|153299_153677_+	M15 family metallopeptidase	NA	Q9MBZ3	Enterobacteria_phage	96.0	5.6e-63
153500:153515	attR	CGGTGATGCGGTGGAT	NA	NA	NA	NA
WP_001297666.1|153809_153923_+	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	86.5	5.6e-11
WP_000415817.1|154281_154674_+	hypothetical protein	NA	Q8W634	Enterobacteria_phage	98.9	3.7e-49
WP_000867506.1|155258_155804_+|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	82.9	5.6e-80
WP_095892498.1|155778_157704_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.4	0.0e+00
WP_000198149.1|157700_157907_+|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_095892499.1|157903_159505_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.9	4.9e-310
WP_001713237.1|159485_160805_+	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	97.7	2.9e-231
WP_001299443.1|160814_161147_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	100.0	1.7e-55
WP_033549155.1|161202_162228_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.2	3.6e-189
WP_000158855.1|162269_162668_+	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	82.6	2.0e-50
WP_000753006.1|162679_163033_+|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	98.3	4.4e-62
WP_000975083.1|163044_163623_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.0	1.7e-79
WP_000683145.1|163619_164015_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	100.0	1.3e-70
WP_001766691.1|164022_164763_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	95.5	7.0e-126
WP_000479153.1|164778_165201_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	100.0	6.7e-73
WP_000459457.1|165182_165617_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_099483556.1|165609_168171_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	91.4	0.0e+00
WP_000847321.1|168167_168497_+|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	97.2	8.9e-57
WP_074470447.1|168496_169195_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	94.0	1.7e-126
WP_000140712.1|169200_169944_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	1.7e-148
WP_000090891.1|169880_170513_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.5	2.2e-96
WP_074470448.1|170573_174053_+	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	90.0	0.0e+00
WP_001228219.1|174120_174720_+	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	94.0	6.5e-106
WP_099483649.1|174784_177754_+|tail	phage tail protein	tail	Q1MVL8	Enterobacteria_phage	60.5	3.4e-203
WP_000972153.1|177756_178290_+|tail	tail fiber assembly protein	tail	C9DGR0	Escherichia_phage	96.6	1.1e-93
WP_001164127.1|178318_178846_-|tail	tail fiber assembly protein	tail	A0A222YWC2	Escherichia_phage	94.9	7.5e-90
WP_001171271.1|178849_179686_-	hypothetical protein	NA	Q7Y4D4	Escherichia_virus	92.1	1.1e-148
WP_000239881.1|180171_180840_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000799406.1|181394_182258_-	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000531594.1|182241_183378_-	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
WP_000359461.1|183627_184857_+	peptidase T	NA	NA	NA	NA	NA
WP_001295435.1|185002_186124_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_000735412.1|186199_187660_-	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_001265481.1|187659_188331_-	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000423750.1|188498_189869_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	5.5e-108
WP_001297479.1|189872_190514_-	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_001297484.1|190549_191656_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
>prophage 2
NZ_CP024240	Escherichia coli O114:H49 strain 90-9280 chromosome, complete genome	4966338	636918	658011	4966338	transposase,tail	Enterobacteria_phage(64.71%)	18	NA	NA
WP_000527756.1|636918_638379_-	mannitol dehydrogenase family protein	NA	G8DCZ3	Micromonas_pusilla_virus	30.1	8.6e-43
WP_000347482.1|638467_639751_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_120795384.1|640355_640469_+	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000836768.1|640537_640771_+	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_000078177.1|641087_641678_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_000885601.1|641775_642351_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	97.4	4.1e-105
WP_024171883.1|642350_645749_-	short-chain fatty acid transporter	NA	X2KTY7	Enterobacteria_phage	35.5	1.8e-11
WP_001233090.1|645813_646413_-	Ail/Lom family protein	NA	A5LH44	Enterobacteria_phage	97.5	8.2e-109
WP_095892505.1|646483_649981_-	host specificity protein J	NA	A5LH43	Enterobacteria_phage	97.1	0.0e+00
WP_000090895.1|650041_650674_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	89.5	5.5e-95
WP_000194783.1|650610_651354_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.4	1.2e-146
WP_001152639.1|651359_652058_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	100.0	2.3e-134
WP_000847373.1|652057_652387_-|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	99.1	2.1e-58
WP_033561711.1|652383_654963_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	97.3	0.0e+00
WP_000459457.1|654955_655390_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000479142.1|655371_655794_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	1.1e-70
WP_029380384.1|655809_656502_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	97.8	5.4e-120
WP_001254932.1|656859_658011_-|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
>prophage 3
NZ_CP024240	Escherichia coli O114:H49 strain 90-9280 chromosome, complete genome	4966338	959076	1036846	4966338	tail,tRNA,holin,portal,terminase,transposase,capsid,head,integrase,plate	Enterobacteria_phage(72.22%)	90	997883:997942	1037789:1037912
WP_000564745.1|959076_960048_+|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_000399648.1|960241_961222_-|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
WP_001387992.1|961491_963921_-	trimethylamine N-oxide reductase TorZ	NA	NA	NA	NA	NA
WP_001214304.1|963945_965046_-	cytochrome c	NA	NA	NA	NA	NA
WP_001185741.1|965433_966180_-	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_001356134.1|966193_966760_-	VOC family protein	NA	NA	NA	NA	NA
WP_001025342.1|966975_968709_+|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.7	8.8e-87
WP_001297434.1|968885_969374_+	lysozyme inhibitor LprI family protein	NA	NA	NA	NA	NA
WP_001259583.1|969493_969886_-	flagellar protein FlhE	NA	NA	NA	NA	NA
WP_001390342.1|969885_971964_-	flagellar biosynthesis protein FlhA	NA	NA	NA	NA	NA
WP_001278954.1|971956_973105_-	flagellar type III secretion system protein FlhB	NA	NA	NA	NA	NA
WP_000983609.1|973306_973951_-	protein phosphatase CheZ	NA	NA	NA	NA	NA
WP_000763867.1|973961_974351_-	chemotaxis protein CheY	NA	A0A2K9L4R0	Tupanvirus	32.0	1.3e-06
WP_000036378.1|974365_975415_-	chemotaxis response regulator protein-glutamate methylesterase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	1.0e-05
WP_000204335.1|975417_976278_-	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_000483220.1|976296_977898_-	methyl-accepting chemotaxis protein IV	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.7	8.3e-15
WP_001387998.1|977943_979605_-	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	35.2	9.9e-11
WP_000147302.1|979749_980253_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_001387999.1|980273_982238_-	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_000795622.1|982242_983169_-	flagellar motor protein MotB	NA	NA	NA	NA	NA
WP_000906336.1|983165_984053_-	flagellar motor stator protein MotA	NA	NA	NA	NA	NA
WP_001291603.1|984179_984758_-	flagellar transcriptional regulator FlhC	NA	NA	NA	NA	NA
WP_001295647.1|984760_985111_-	flagellar transcriptional regulator FlhD	NA	NA	NA	NA	NA
WP_000122426.1|985889_986318_+	universal stress protein UspC	NA	NA	NA	NA	NA
WP_001295646.1|986324_987749_-	alpha,alpha-trehalose-phosphate synthase	NA	NA	NA	NA	NA
WP_001388000.1|987723_988524_-	trehalose-phosphatase	NA	NA	NA	NA	NA
WP_000100203.1|988690_989677_-	L-arabinose ABC transporter permease AraH	NA	NA	NA	NA	NA
WP_001187810.1|989691_991206_-	L-arabinose ABC transporter ATP-binding protein AraG	NA	A0A2H4PQG7	Staphylococcus_phage	27.1	4.3e-13
WP_000548675.1|991275_992265_-	arabinose ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000179469.1|993061_993565_+	non-heme ferritin-like protein	NA	NA	NA	NA	NA
WP_000082127.1|993643_993895_-	DUF2766 domain-containing protein	NA	NA	NA	NA	NA
WP_010723106.1|994009_994096_-	stress response protein AzuC	NA	NA	NA	NA	NA
WP_001237869.1|994358_994682_+	lipoprotein, function unknown	NA	NA	NA	NA	NA
WP_000917208.1|994852_995350_+	non-heme ferritin	NA	NA	NA	NA	NA
WP_000377225.1|995387_995627_-	YecH family protein	NA	NA	NA	NA	NA
WP_001388915.1|995817_997029_+	tyrosine transporter TyrP	NA	NA	NA	NA	NA
WP_000847902.1|997090_997756_-	UPF0149 family protein YecA	NA	NA	NA	NA	NA
997883:997942	attL	ACAAAAAAACCACCCGAAGGTGGTTTCACGACACTGCTTATTGCTTTGATTTTATTCTTA	NA	NA	NA	NA
WP_001300279.1|998112_999114_-|integrase	tyrosine-type recombinase/integrase	integrase	Q94N03	Haemophilus_virus	58.5	4.2e-105
WP_000490856.1|999119_999425_-	DUF2511 domain-containing protein	NA	NA	NA	NA	NA
WP_000290347.1|999495_1000146_-	membrane protein	NA	NA	NA	NA	NA
WP_000786769.1|1000161_1000566_-	transcriptional regulator	NA	Q6QID2	Burkholderia_phage	53.8	1.6e-23
WP_001673482.1|1000655_1000793_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000014505.1|1000864_1001068_+	DNA-binding protein	NA	P79674	Haemophilus_phage	45.2	3.1e-07
WP_000739032.1|1001089_1001440_+	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	84.5	2.7e-51
WP_000158971.1|1001450_1001738_+	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	76.8	7.8e-33
WP_000514277.1|1001749_1001992_+	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	100.0	2.3e-38
WP_000021652.1|1001988_1002102_+	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	97.3	3.3e-11
WP_000985161.1|1002188_1002392_+	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	86.6	2.9e-26
WP_000153674.1|1002388_1002634_+	winged helix-turn-helix domain-containing protein	NA	A0A0A7NV47	Enterobacteria_phage	98.8	3.3e-40
WP_001274214.1|1002630_1002930_+	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	89.8	8.2e-41
WP_000013453.1|1003252_1003483_+	hypothetical protein	NA	A0A0A7NV48	Enterobacteria_phage	92.1	4.2e-29
WP_000599410.1|1003555_1003921_+	hypothetical protein	NA	A0A0A7NRY1	Enterobacteria_phage	96.7	8.7e-61
WP_001388917.1|1003927_1006735_+	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	95.6	0.0e+00
WP_000686494.1|1006811_1007771_+	recombinase	NA	A0A0A7NPX4	Enterobacteria_phage	98.7	1.2e-178
WP_000211268.1|1007775_1008087_+	chromosome partitioning protein	NA	A0A0A7NPT5	Enterobacteria_phage	83.3	8.5e-41
WP_000236493.1|1009281_1009806_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000087814.1|1009820_1010867_-|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	99.7	2.2e-202
WP_000613768.1|1010866_1012618_-|terminase	terminase	terminase	A0A0A7NV54	Enterobacteria_phage	99.8	0.0e+00
WP_001262673.1|1012772_1013609_+|capsid	phage capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	100.0	2.7e-150
WP_001055118.1|1013631_1014684_+|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	100.0	6.8e-199
WP_000632347.1|1014729_1015530_+|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	92.5	1.6e-131
WP_001388919.1|1015633_1016128_+|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	98.8	3.5e-89
WP_000864901.1|1016127_1016328_+|tail	tail protein	tail	A0A0A7NV57	Enterobacteria_phage	100.0	3.5e-32
WP_000104350.1|1016330_1016654_+|holin	holin	holin	A0A0A7NRY9	Enterobacteria_phage	99.1	1.6e-50
WP_001387672.1|1016650_1017043_+	M15 family metallopeptidase	NA	A0A0A7NQ86	Enterobacteria_phage	99.2	3.8e-70
WP_000780562.1|1017039_1017447_+	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	96.3	3.2e-64
WP_001388920.1|1017584_1017719_+	hypothetical protein	NA	A0A0A7NPU6	Enterobacteria_phage	100.0	1.1e-18
WP_001703370.1|1017728_1018052_+|tail	phage tail completion protein R	tail	A0A0A7NPU6	Enterobacteria_phage	98.1	2.2e-55
WP_001388922.1|1018044_1018680_+	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	99.5	2.4e-114
WP_001271945.1|1018676_1019258_+|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	97.9	9.5e-102
WP_000213447.1|1019254_1019605_+|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	100.0	9.2e-60
WP_001111964.1|1019608_1020505_+|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	98.3	1.8e-155
WP_000071720.1|1020497_1021028_+|tail	phage tail protein I	tail	A0A0A7NPV1	Enterobacteria_phage	99.4	1.1e-93
WP_099483571.1|1021030_1023529_+|tail	phage tail protein	tail	Q1MVL8	Enterobacteria_phage	60.5	2.8e-203
WP_000972151.1|1023531_1024065_+|tail	tail fiber assembly protein	tail	C9DGR0	Escherichia_phage	97.2	3.9e-94
WP_001164128.1|1024093_1024621_-|tail	tail fiber assembly protein	tail	A0A222YWC2	Escherichia_phage	93.7	3.7e-89
WP_032162851.1|1024624_1025329_-	hypothetical protein	NA	Q7Y4D4	Escherichia_virus	94.4	8.7e-126
WP_000905056.1|1025565_1026153_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	98.5	6.0e-104
WP_000979956.1|1026188_1026677_-|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	99.4	3.6e-86
WP_001356151.1|1026812_1027835_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	98.2	3.6e-197
WP_001317493.1|1027831_1028614_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	5.9e-139
WP_001390346.1|1028657_1031456_-|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	92.9	0.0e+00
WP_000763327.1|1031442_1031571_-|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	97.6	3.0e-16
WP_000665308.1|1031606_1031972_-|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	97.5	3.8e-56
WP_000290450.1|1032026_1032539_-|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	100.0	3.2e-93
WP_000005413.1|1032538_1033723_-|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	99.5	5.6e-226
WP_001386496.1|1033880_1034204_+	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	98.9	7.2e-43
WP_001254932.1|1034154_1035306_-|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
WP_000488107.1|1036255_1036516_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_000078920.1|1036705_1036846_+	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	100.0	7.0e-19
1037789:1037912	attR	ACAAAAAAACCACCCGAAGGTGGTTTCACGACACTGCTTATTGCTTTGATTTTATTCTTATCTTTCCCATGGTACCCGGAGCGGGACTTGAACCCGCACAGCGCGAACGCCGAGGGATTTTAAA	NA	NA	NA	NA
>prophage 4
NZ_CP024240	Escherichia coli O114:H49 strain 90-9280 chromosome, complete genome	4966338	1194493	1260447	4966338	tail,tRNA,holin,portal,lysis,terminase,capsid,head,integrase,plate,protease	Escherichia_phage(40.74%)	77	1199551:1199578	1233262:1233289
WP_000675150.1|1194493_1195897_+	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.0	3.0e-32
WP_000137869.1|1195893_1196616_+	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	1.4e-30
WP_000929408.1|1196806_1197139_+	YegP family protein	NA	NA	NA	NA	NA
WP_001307279.1|1197347_1197644_+	type II toxin-antitoxin system ParD family antitoxin	NA	NA	NA	NA	NA
WP_001220181.1|1197645_1197942_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001390387.1|1198044_1199406_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	99.7	4.2e-217
1199551:1199578	attL	AATCTCCCTTACACGGGCTTATTTTTTA	NA	NA	NA	NA
WP_000468308.1|1199678_1199897_-	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_000882969.1|1199978_1201142_-	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	100.0	2.8e-206
WP_000978878.1|1201141_1201621_-|tail	phage tail protein	tail	A0A0F7LBX3	Escherichia_phage	98.7	9.6e-84
WP_099483576.1|1201635_1204083_-|tail	phage tail tape measure protein	tail	A0A0F7LA40	Escherichia_phage	99.8	0.0e+00
WP_000785970.1|1204075_1204195_-|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_001031303.1|1204227_1204503_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
WP_001251408.1|1204559_1205078_-|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_001286727.1|1205090_1206281_-|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	99.7	4.8e-225
WP_000905108.1|1206340_1206934_-	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	96.4	8.7e-103
WP_001285352.1|1209726_1210338_-|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	99.5	3.8e-117
WP_089615958.1|1210330_1211239_-|plate	baseplate assembly protein	plate	A0A0F7LCQ9	Escherichia_phage	99.3	2.8e-161
WP_000127164.1|1211243_1211591_-|plate	baseplate assembly protein	plate	A0A0F7LDQ1	Escherichia_phage	100.0	1.3e-58
WP_053920544.1|1211587_1212223_-|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	99.1	4.5e-113
WP_099483579.1|1212289_1212742_-	phage virion morphogenesis protein	NA	A0A0F7LBV9	Escherichia_phage	98.7	1.5e-75
WP_000917189.1|1212734_1213202_-|tail	phage tail protein	tail	U5N0S7	Enterobacteria_phage	98.1	2.5e-81
WP_001300730.1|1213164_1213338_-	hypothetical protein	NA	Q7Y4E1	Escherichia_virus	94.7	5.2e-24
WP_099483581.1|1213309_1213735_-|lysis	LysB family phage lysis regulatory protein	lysis	U5N3W5	Enterobacteria_phage	95.0	4.0e-65
WP_001593488.1|1213722_1214148_-	hypothetical protein	NA	A0A0F7LBP4	Escherichia_phage	96.4	1.9e-59
WP_001144101.1|1214162_1214660_-	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	100.0	3.1e-93
WP_000123124.1|1214659_1214941_-|holin	holin	holin	A0A0F7LDF8	Escherichia_phage	100.0	3.7e-43
WP_000846399.1|1214944_1215148_-|tail	tail protein X	tail	U5N3E7	Enterobacteria_phage	100.0	4.0e-31
WP_000988642.1|1215147_1215657_-|head	head completion/stabilization protein	head	A0A0F7L9Y3	Escherichia_phage	100.0	1.9e-90
WP_024249459.1|1215756_1216500_-|terminase	terminase endonuclease subunit	terminase	U5N091	Enterobacteria_phage	99.2	9.2e-126
WP_001248583.1|1216503_1217577_-|capsid	phage major capsid protein, P2 family	capsid	Q94MK2	Enterobacteria_phage	100.0	6.7e-202
WP_099483583.1|1217635_1218490_-|capsid	GPO family capsid scaffolding protein	capsid	A0A0F7LA11	Escherichia_phage	97.5	1.9e-135
WP_000156872.1|1218663_1220436_+|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCK3	Escherichia_phage	100.0	0.0e+00
WP_000038181.1|1220435_1221470_+|portal	phage portal protein	portal	Q858W8	Yersinia_virus	99.7	1.2e-200
WP_099483586.1|1221917_1223063_+	ATP-binding protein	NA	A0A1B2RW50	Lymphocystis_disease_virus	29.8	1.9e-13
WP_000066157.1|1223059_1225324_+	S8 family peptidase	NA	NA	NA	NA	NA
WP_000457799.1|1225357_1226119_-	hypothetical protein	NA	I6PD67	Cronobacter_phage	46.5	3.0e-55
WP_000981007.1|1226121_1226358_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032185251.1|1226666_1226873_-	hypothetical protein	NA	Q2P9X3	Enterobacteria_phage	86.6	4.6e-27
WP_032185297.1|1226872_1227325_-	DUF3850 domain-containing protein	NA	Q2P9X4	Enterobacteria_phage	96.0	2.3e-79
WP_099483588.1|1227324_1229610_-	replication endonuclease	NA	Q858T4	Yersinia_virus	97.4	0.0e+00
WP_000027664.1|1229599_1229875_-	DUF5405 family protein	NA	U5N3W1	Enterobacteria_phage	100.0	3.8e-45
WP_001113270.1|1229871_1230096_-	TraR/DksA family transcriptional regulator	NA	A0A0F7LDI3	Escherichia_phage	98.6	3.8e-35
WP_001277897.1|1230095_1230398_-	DUF5405 family protein	NA	A0A0F7LCL4	Escherichia_phage	98.0	8.5e-46
WP_000557703.1|1230397_1230622_-	DUF2732 family protein	NA	S4TP68	Salmonella_phage	100.0	4.7e-33
WP_000217670.1|1230685_1231186_-	hypothetical protein	NA	M1SV55	Escherichia_phage	100.0	2.6e-92
WP_000043869.1|1231363_1231639_-	hypothetical protein	NA	Q1JS62	Enterobacteria_phage	100.0	1.3e-48
WP_001306384.1|1231753_1232053_+	helix-turn-helix transcriptional regulator	NA	Q1JS63	Enterobacteria_phage	100.0	2.5e-50
WP_000985264.1|1232168_1233182_+|integrase	site-specific integrase	integrase	Q83VS6	Escherichia_phage	98.8	2.4e-193
WP_000716757.1|1233446_1233764_-	hypothetical protein	NA	NA	NA	NA	NA
1233262:1233289	attR	AATCTCCCTTACACGGGCTTATTTTTTA	NA	NA	NA	NA
WP_000807362.1|1234178_1235078_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	1.3e-12
WP_000178552.1|1235159_1235939_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_000844200.1|1236038_1237079_-	galactitol-1-phosphate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_000490689.1|1237126_1238482_-	PTS galactitol transporter subunit IIC	NA	NA	NA	NA	NA
WP_000823282.1|1238485_1238770_-	PTS galactitol transporter subunit IIB	NA	NA	NA	NA	NA
WP_000182881.1|1238800_1239253_-	PTS galactitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_001356057.1|1240548_1241403_-	tagatose-bisphosphate aldolase subunit GatY	NA	NA	NA	NA	NA
WP_000129551.1|1241700_1242753_-	class I fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_000858500.1|1243009_1244287_+	MFS transporter	NA	NA	NA	NA	NA
WP_000846217.1|1244283_1245288_+	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	29.4	7.5e-14
WP_000011951.1|1245284_1246250_+	sugar kinase	NA	NA	NA	NA	NA
WP_000434038.1|1246223_1246970_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001351455.1|1247021_1247840_-	glycoside hydrolase family 25 protein	NA	D0R7H8	Paenibacillus_phage	38.5	1.7e-24
WP_000822270.1|1247904_1248705_-	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_001195588.1|1248701_1249490_-	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
WP_000197705.1|1250279_1250570_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000127869.1|1250566_1252228_-|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	82.3	4.9e-276
WP_001353110.1|1252211_1252568_-|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	83.8	6.1e-51
WP_001145897.1|1252856_1253297_-	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	76.0	9.1e-65
WP_001287546.1|1253296_1253599_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4JD08	uncultured_Caudovirales_phage	61.1	1.4e-27
WP_122991688.1|1253591_1254764_-|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	88.8	2.1e-204
WP_000798773.1|1254807_1255368_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	84.9	2.6e-88
WP_000733253.1|1255422_1256592_-|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	76.3	1.8e-163
WP_001053662.1|1256878_1257385_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024167808.1|1257420_1257669_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000126652.1|1257685_1258111_-	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_001353108.1|1258107_1258308_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000710154.1|1258629_1260447_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	47.7	1.8e-127
>prophage 5
NZ_CP024240	Escherichia coli O114:H49 strain 90-9280 chromosome, complete genome	4966338	1289350	1297658	4966338		Enterobacteria_phage(83.33%)	9	NA	NA
WP_001356047.1|1289350_1291351_+	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	95.5	0.0e+00
WP_001295429.1|1291475_1291937_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_000950409.1|1291976_1292447_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	5.2e-82
WP_000598641.1|1292493_1293213_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295431.1|1293209_1294895_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_001388061.1|1295116_1295848_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.0	1.4e-110
WP_001216961.1|1295907_1296015_+	protein YohO	NA	NA	NA	NA	NA
WP_000783120.1|1295995_1296727_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_000569329.1|1296731_1297658_-	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	2.8e-23
>prophage 6
NZ_CP024240	Escherichia coli O114:H49 strain 90-9280 chromosome, complete genome	4966338	1497172	1576110	4966338	tRNA,holin,portal,lysis,coat,terminase,transposase,head,integrase	Enterobacteria_phage(50.0%)	91	1494377:1494393	1548830:1548846
1494377:1494393	attL	ATGCGCGACATCAAAAA	NA	NA	NA	NA
WP_001283590.1|1497172_1497985_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_001289162.1|1497984_1498998_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000699104.1|1499063_1500200_-	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.1	3.5e-23
WP_000615821.1|1500298_1501294_+	flagella biosynthesis regulator Flk	NA	NA	NA	NA	NA
WP_000127781.1|1501290_1502469_-	MFS transporter	NA	NA	NA	NA	NA
WP_000817178.1|1502733_1503954_-	beta-ketoacyl-ACP synthase I	NA	NA	NA	NA	NA
WP_000683799.1|1504112_1506119_+|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
WP_000559764.1|1506239_1506518_-	YfcL family protein	NA	NA	NA	NA	NA
WP_001089235.1|1506551_1507100_-	elongation factor P hydroxylase	NA	NA	NA	NA	NA
WP_000447361.1|1507099_1507909_-	TSUP family transporter	NA	NA	NA	NA	NA
WP_001043820.1|1507908_1508733_-	penicillin-insensitive murein endopeptidase	NA	NA	NA	NA	NA
WP_000918470.1|1508736_1509822_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	48.4	9.1e-90
WP_001295704.1|1509856_1510789_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_000730806.1|1510954_1511506_+	endonuclease SmrB	NA	NA	NA	NA	NA
WP_000698675.1|1511578_1512433_-	DUF2544 domain-containing protein	NA	NA	NA	NA	NA
WP_000844745.1|1512434_1512974_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000714140.1|1512970_1513459_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000018471.1|1513455_1513965_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000482747.1|1513980_1514733_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_001356050.1|1514752_1517398_-	fimbrial usher protein YfcU	NA	NA	NA	NA	NA
WP_000033329.1|1517479_1518043_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_001195819.1|1518717_1519203_-	phosphohistidine phosphatase SixA	NA	NA	NA	NA	NA
WP_000425058.1|1519405_1521550_-	fatty acid oxidation complex subunit alpha FadJ	NA	NA	NA	NA	NA
WP_000531954.1|1521549_1522860_-	acetyl-CoA C-acyltransferase FadI	NA	NA	NA	NA	NA
WP_000030901.1|1523039_1523324_-	YfcZ/YiiS family protein	NA	NA	NA	NA	NA
WP_001296861.1|1523695_1525036_+	long-chain fatty acid transporter FadL	NA	NA	NA	NA	NA
WP_000937836.1|1525401_1526460_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000776768.1|1526641_1527397_-	phospholipid-binding lipoprotein MlaA	NA	NA	NA	NA	NA
WP_000368131.1|1527690_1528623_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
WP_001388105.1|1528934_1530086_+|integrase	prophage integrase IntS	integrase	A5VW56	Enterobacteria_phage	99.2	9.0e-221
WP_001703470.1|1530500_1531826_+	oligosaccharide repeat unit polymerase	NA	NA	NA	NA	NA
WP_001386201.1|1531882_1533922_-|head	head-binding family protein	head	S4TU85	Salmonella_phage	50.4	5.1e-158
WP_001386203.1|1534022_1534901_-	phage repressor protein/antirepressor Ant	NA	I6R977	Salmonella_phage	78.5	4.0e-96
WP_001386205.1|1535163_1535304_-	Arc family DNA-binding protein	NA	A0A0M4S6R9	Salmonella_phage	59.1	4.4e-05
WP_021514397.1|1535409_1535658_+	Arc family DNA-binding protein	NA	A5VW59	Enterobacteria_phage	95.1	3.2e-35
WP_000132668.1|1535660_1535939_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001703472.1|1536129_1536507_+	hypothetical protein	NA	K7P6H4	Enterobacteria_phage	36.9	4.2e-10
WP_000816058.1|1536535_1536763_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000224776.1|1536759_1538883_-	hypothetical protein	NA	A0A0A0P1R1	Enterobacteria_phage	29.3	3.6e-50
WP_001386090.1|1538867_1540208_-	acyltransferase	NA	A0A0M5M1J8	Salmonella_phage	70.5	1.9e-158
WP_099483595.1|1540217_1540898_-	DNA transfer protein	NA	G5DA80	Enterobacteria_phage	73.7	4.3e-53
WP_001386092.1|1540884_1541352_-	DUF2824 family protein	NA	Q2A0B3	Sodalis_phage	74.0	2.8e-64
WP_001388949.1|1541351_1542200_-	hypothetical protein	NA	Q716G6	Shigella_phage	93.3	3.6e-102
WP_001386094.1|1542199_1543618_-	phage stabilization family protein	NA	Q716G7	Shigella_phage	98.7	2.3e-274
WP_001054834.1|1543617_1544118_-	DNA recombination protein RmuC	NA	G8EYJ2	Enterobacteria_phage	99.4	6.5e-91
WP_001386095.1|1544095_1544344_-	hypothetical protein	NA	A0A2D1GLK1	Escherichia_phage	92.0	2.3e-25
WP_001388950.1|1544388_1545684_-|coat	coat protein	coat	A0A2D1GLV2	Escherichia_phage	99.1	1.2e-242
WP_000373006.1|1545683_1546595_-	scaffold protein	NA	A0A2D1GLN7	Escherichia_phage	100.0	1.3e-161
WP_001386097.1|1546608_1548774_-|portal	portal protein	portal	A0A2D1GLJ6	Escherichia_phage	99.9	0.0e+00
WP_000417851.1|1548774_1550274_-|terminase	terminase	terminase	A0A2D1GLW6	Escherichia_phage	100.0	4.8e-307
1548830:1548846	attR	TTTTTGATGTCGCGCAT	NA	NA	NA	NA
WP_024167798.1|1550251_1550740_-	DNA-packaging protein	NA	G8EYI7	Enterobacteria_phage	98.8	4.1e-90
WP_000807785.1|1550775_1551018_-	DUF2560 family protein	NA	A0A0M4R322	Salmonella_phage	100.0	7.5e-37
WP_000191869.1|1551789_1552269_-	DUF2829 domain-containing protein	NA	A0A1Y0T2L3	Pseudomonas_phage	60.4	1.1e-55
WP_001385991.1|1552347_1552785_-|lysis	lysis protein	lysis	Q9MCN3	Enterobacteria_phage	98.6	8.5e-71
WP_000229392.1|1552781_1553258_-	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	100.0	1.7e-88
WP_000783734.1|1553241_1553565_-|holin	phage holin, lambda family	holin	G5DA93	Enterobacteria_phage	100.0	1.3e-52
WP_001385993.1|1554053_1554542_-	phage antitermination Q family protein	NA	M1FPN0	Enterobacteria_phage	99.4	3.5e-89
WP_000994516.1|1554538_1554727_-	protein ninH	NA	A5VW84	Enterobacteria_phage	100.0	5.5e-27
WP_001008200.1|1554723_1555086_-	RusA family crossover junction endodeoxyribonuclease	NA	K7P6I9	Enterobacteria_phage	100.0	9.2e-63
WP_001385994.1|1555372_1555900_-	phage N-6-adenine-methyltransferase	NA	A0A1I9LJP9	Stx_converting_phage	99.4	8.0e-100
WP_001385995.1|1555896_1556343_-	recombination protein NinB	NA	A0A1U9AJ79	Stx1_converting_phage	98.6	3.5e-80
WP_001281772.1|1556299_1556536_-	restriction alleviation protein, Lar family	NA	Q8HA09	Enterobacteria_phage	100.0	1.2e-39
WP_000103679.1|1556546_1556762_-	hypothetical protein	NA	A0A1I9LJP7	Stx_converting_phage	100.0	1.3e-32
WP_001317493.1|1557450_1558233_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	5.9e-139
WP_001356151.1|1558229_1559252_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	98.2	3.6e-197
WP_001036029.1|1559471_1559741_-	hypothetical protein	NA	G9L682	Escherichia_phage	98.9	1.9e-44
WP_001388106.1|1559740_1561177_-	AAA family ATPase	NA	K7PGR8	Enterobacteria_phage	99.8	6.7e-274
WP_001554884.1|1561166_1562057_-	hypothetical protein	NA	K7PH45	Enterobacterial_phage	98.3	5.4e-157
WP_001388108.1|1562237_1562534_-	bacteriophage CII family protein	NA	K7PKU6	Enterobacteria_phage	98.0	5.2e-48
WP_000276885.1|1562649_1562835_-	hypothetical protein	NA	K7PHK4	Enterobacteria_phage	100.0	1.2e-26
WP_001095982.1|1562915_1563566_+	LexA family transcriptional regulator	NA	K7PM82	Enterobacteria_phage	100.0	4.9e-123
WP_000256573.1|1563880_1564186_+	hypothetical protein	NA	K7PJM7	Enterobacteria_phage	99.0	7.0e-48
WP_000930322.1|1564188_1564527_+	hypothetical protein	NA	K7PJW2	Enterobacteria_phage	100.0	2.0e-59
WP_000167581.1|1564660_1565131_+	hypothetical protein	NA	A0A1I9LJN4	Stx_converting_phage	98.7	3.1e-87
WP_032243332.1|1565220_1565496_+	hypothetical protein	NA	K7PGS9	Enterobacteria_phage	97.8	2.9e-45
WP_000365280.1|1565750_1566458_+	recombinase	NA	K7PKU3	Enterobacteria_phage	100.0	7.6e-138
WP_000018646.1|1566458_1566926_+	hypothetical protein	NA	A0A2I7QWC6	Vibrio_phage	62.0	1.2e-46
WP_000098523.1|1566922_1567429_+	single-stranded DNA-binding protein	NA	K7PHK1	Enterobacteria_phage	98.8	6.8e-80
WP_001016186.1|1567437_1567986_+	3'-5' exoribonuclease	NA	K7PM77	Enterobacteria_phage	98.9	9.5e-104
WP_001388110.1|1568002_1568296_+	DUF2856 family protein	NA	K7P7E6	Enterobacteria_phage	99.0	1.9e-50
WP_001388111.1|1568306_1568597_+	hypothetical protein	NA	K7P7M4	Enterobacteria_phage	94.8	1.5e-44
WP_001388112.1|1568593_1568761_+	DUF2737 family protein	NA	K7PJY9	Enterobacterial_phage	98.2	3.0e-24
WP_032243331.1|1568906_1569635_+	site-specific DNA-methyltransferase	NA	A0A2I7QM56	Vibrio_phage	58.2	3.5e-77
WP_001388115.1|1569653_1570040_+	ead/Ea22-like family protein	NA	A0A077SLK5	Escherichia_phage	88.5	5.4e-29
WP_001707223.1|1569993_1570836_+	DUF551 domain-containing protein	NA	A5LH60	Enterobacteria_phage	53.5	1.0e-59
WP_001388117.1|1570835_1571114_+	DUF4752 family protein	NA	K7P6P7	Enterobacteria_phage	100.0	1.9e-47
WP_032243330.1|1571272_1571440_+	hypothetical protein	NA	A0A2D1GM11	Escherichia_phage	92.7	5.4e-26
WP_001163428.1|1571497_1571698_+	response regulator inhibitor TorI	NA	K7P7V0	Enterobacteria_phage	100.0	2.4e-33
WP_001197023.1|1572227_1573475_-	oligosaccharide MFS transporter	NA	NA	NA	NA	NA
WP_001274887.1|1573546_1574461_-	aminoimidazole riboside kinase	NA	NA	NA	NA	NA
WP_000194515.1|1574676_1576110_+	glycoside hydrolase family 32 protein	NA	F8WPR5	Bacillus_phage	25.4	7.0e-29
>prophage 7
NZ_CP024240	Escherichia coli O114:H49 strain 90-9280 chromosome, complete genome	4966338	1839157	1846921	4966338	transposase,integrase	Escherichia_phage(66.67%)	6	1836945:1836958	1844058:1844071
1836945:1836958	attL	CGACTATTTGAACT	NA	NA	NA	NA
WP_000162574.1|1839157_1839640_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
WP_001341819.1|1840382_1841612_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	100.0	1.5e-234
WP_000448925.1|1841650_1842067_+	hypothetical protein	NA	A0A1B5FPM5	Escherichia_phage	100.0	1.1e-72
WP_000214990.1|1842138_1843887_-	hypothetical protein	NA	A0A1B5FPH1	Escherichia_phage	99.8	0.0e+00
WP_001703571.1|1843888_1845607_-	histidine kinase-, DNA gyrase B-, and HSP90-like ATPase	NA	A0A1B5FPD5	Escherichia_phage	95.3	2.0e-304
1844058:1844071	attR	AGTTCAAATAGTCG	NA	NA	NA	NA
WP_085947771.1|1845758_1846921_-|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
>prophage 8
NZ_CP024240	Escherichia coli O114:H49 strain 90-9280 chromosome, complete genome	4966338	1918034	1925174	4966338		Escherichia_phage(83.33%)	6	NA	NA
WP_001272897.1|1918034_1920596_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.3e-30
WP_001388213.1|1920701_1921358_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.3	1.2e-49
WP_001297141.1|1921408_1922176_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	3.3e-70
WP_001388215.1|1922371_1923280_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.5	1.1e-117
WP_000590397.1|1923276_1924539_+	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	1.3e-135
WP_001278994.1|1924535_1925174_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
>prophage 9
NZ_CP024240	Escherichia coli O114:H49 strain 90-9280 chromosome, complete genome	4966338	4041045	4104153	4966338	transposase,plate,tRNA,protease	Emiliania_huxleyi_virus(11.11%)	52	NA	NA
WP_001325807.1|4041045_4042398_+|protease	sigma E protease regulator RseP	protease	NA	NA	NA	NA
WP_001240896.1|4042427_4044860_+	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_000758956.1|4044981_4045467_+	molecular chaperone Skp	NA	NA	NA	NA	NA
WP_001139279.1|4045470_4046496_+	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_000210739.1|4046600_4047056_+	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_000565966.1|4047059_4047848_+	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_000139654.1|4047847_4048996_+	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_000569430.1|4048992_4049589_+	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.0	1.0e-26
WP_001294757.1|4049625_4053108_+	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.9	2.2e-209
WP_000055746.1|4053120_4054080_+	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
WP_001020973.1|4054178_4056320_+	lysine decarboxylase LdcC	NA	NA	NA	NA	NA
WP_000901098.1|4056376_4056766_+	VOC family protein	NA	NA	NA	NA	NA
WP_000176573.1|4056830_4058129_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_000062312.1|4058177_4058438_-	Rho-binding antiterminator	NA	NA	NA	NA	NA
WP_000417058.1|4058424_4058625_-	YaeP family protein	NA	NA	NA	NA	NA
WP_001185290.1|4058790_4059336_+	YaeQ family protein	NA	NA	NA	NA	NA
WP_000635545.1|4059332_4059755_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_000239192.1|4059768_4060479_+	envelope stress response activation lipoprotein NlpE	NA	NA	NA	NA	NA
WP_000399648.1|4060728_4061709_+|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
WP_001346133.1|4061912_4062737_-	YaeF family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_001260716.1|4062789_4064508_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000094011.1|4064617_4065325_-|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_001202329.1|4065321_4065726_-	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
WP_000874226.1|4065843_4066659_-	methionine ABC transporter substrate-binding lipoprotein MetQ	NA	NA	NA	NA	NA
WP_001294600.1|4066698_4067352_-	methionine ABC transporter permease MetI	NA	NA	NA	NA	NA
WP_001387031.1|4067344_4068376_-	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	39.7	6.1e-35
WP_001140187.1|4068563_4069139_+	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_000997043.1|4075025_4075829_+	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.6	3.2e-39
WP_000648572.1|4075825_4076740_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001230983.1|4076980_4077781_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000211710.1|4077858_4078629_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000644685.1|4078676_4080035_-	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_001052720.1|4080106_4080862_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_001297210.1|4080895_4081618_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000917883.1|4081614_4082082_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001297205.1|4082146_4082878_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.0	3.4e-40
WP_001086142.1|4083417_4084203_+	aminopeptidase	NA	NA	NA	NA	NA
WP_001236649.1|4084339_4084819_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000908057.1|4084828_4085743_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001284199.1|4085786_4086269_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000377959.1|4086292_4087645_-	membrane protein	NA	NA	NA	NA	NA
WP_134688340.1|4087655_4091090_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_001240543.1|4091198_4092614_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_000088873.1|4092618_4093362_-	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_000614336.1|4093358_4096118_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	30.6	8.0e-82
WP_000343293.1|4096126_4096888_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_000246416.1|4096892_4098224_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_001080144.1|4098226_4098751_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_001113703.1|4098747_4100028_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_000348806.1|4100052_4101135_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_001356142.1|4101098_4102661_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_001254932.1|4103001_4104153_-|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
>prophage 10
NZ_CP024240	Escherichia coli O114:H49 strain 90-9280 chromosome, complete genome	4966338	4420243	4490747	4966338	tail,tRNA,portal,lysis,terminase,transposase,capsid,head,protease	Enterobacteria_phage(52.54%)	77	NA	NA
WP_000912345.1|4420243_4421629_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.9e-45
WP_001143565.1|4421664_4422186_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000190288.1|4422293_4422506_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_000729161.1|4422507_4423374_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
WP_000776555.1|4423854_4424397_+	type 1 fimbrial protein subunit FimA	NA	NA	NA	NA	NA
WP_000988366.1|4424616_4425309_+	type 1 fimbria chaperone FimC	NA	NA	NA	NA	NA
WP_001356128.1|4425339_4427949_+	fimbrial biogenesis usher protein	NA	NA	NA	NA	NA
WP_001250424.1|4428978_4429494_+	fimbria assembly protein	NA	NA	NA	NA	NA
WP_000805422.1|4429496_4430129_-	fimbria biosynthesis transcriptional regulator FimZ	NA	NA	NA	NA	NA
WP_001356151.1|4431321_4432344_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	98.2	3.6e-197
WP_099483641.1|4432340_4433123_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.2	3.2e-137
WP_024168150.1|4433166_4433478_-	hypothetical protein	NA	A0A088CD23	Shigella_phage	80.2	4.2e-40
WP_000446905.1|4433441_4433813_-	helix-turn-helix domain-containing protein	NA	M1FJ59	Enterobacteria_phage	81.0	2.1e-46
WP_000488407.1|4433784_4434063_-	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	97.8	4.9e-48
WP_000763385.1|4434110_4434329_-	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	100.0	7.5e-36
WP_001386642.1|4434427_4434709_-	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	98.9	5.5e-47
WP_000129285.1|4434719_4435277_-	phage N-6-adenine-methyltransferase	NA	E5AGF8	Erwinia_phage	62.3	2.0e-61
WP_000682319.1|4435269_4435431_-	DUF1317 family protein	NA	A0A0P0ZAS9	Stx2-converting_phage	100.0	9.1e-23
WP_000186811.1|4435427_4436108_-	YqaJ viral recombinase family protein	NA	A0A0N6WET1	Escherichia_phage	99.6	4.6e-132
WP_000100847.1|4436104_4436890_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000995433.1|4436895_4437192_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	99.0	6.2e-49
WP_001309317.1|4437267_4437558_-	hypothetical protein	NA	K7P6H3	Enterobacteria_phage	83.8	5.0e-27
WP_000340376.1|4437951_4438815_-	hypothetical protein	NA	M9NYX6	Enterobacteria_phage	62.1	1.8e-93
WP_000858975.1|4438881_4439571_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	75.0	2.8e-92
WP_001067458.1|4439675_4439906_+	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	68.0	1.5e-21
WP_001182888.1|4439975_4440515_+	hypothetical protein	NA	K7PJT7	Enterobacteria_phage	66.5	1.3e-60
WP_001387574.1|4440601_4441531_+	replication protein	NA	A0A0K2FJ31	Enterobacteria_phage	68.7	1.6e-111
WP_001387575.1|4441527_4442250_+	replication P family protein	NA	A0A0K2FIT1	Enterobacteria_phage	93.4	3.0e-121
WP_134688352.1|4442294_4442501_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001702985.1|4442595_4443564_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077629860.1|4446010_4446112_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001053043.1|4446108_4446564_+	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.0	1.0e-58
WP_000224915.1|4446563_4446734_+	protein NinE from lambdoid prophage DLP12	NA	K7P7K0	Enterobacteria_phage	69.8	2.4e-13
WP_000774476.1|4446726_4447017_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	95.8	3.0e-48
WP_001099698.1|4447013_4447376_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.6	1.5e-60
WP_000971095.1|4447372_4447513_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	72.1	1.7e-09
WP_001204791.1|4447598_4447982_+	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	83.3	4.4e-55
WP_000737266.1|4448171_4449269_-	porin	NA	Q1MVN1	Enterobacteria_phage	76.5	2.2e-155
WP_000839596.1|4449841_4450057_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_001135274.1|4450056_4450554_+	lysozyme	NA	M1FJA0	Enterobacteria_phage	97.0	3.2e-90
WP_001228695.1|4450770_4450953_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_000738423.1|4451043_4451337_-	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	91.8	2.0e-44
WP_032083248.1|4451699_4451894_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	95.2	2.2e-26
WP_000453581.1|4452282_4452828_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	99.4	4.0e-94
WP_001714056.1|4452802_4454728_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.5	0.0e+00
WP_000198153.1|4454724_4454931_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001356148.1|4454927_4456529_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	1.4e-307
WP_000123235.1|4456509_4457841_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	97.3	2.7e-229
WP_000201478.1|4457850_4458183_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	90.9	9.7e-51
WP_099483643.1|4458238_4459264_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	95.3	9.3e-185
WP_000158875.1|4459305_4459701_+	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	95.5	1.1e-58
WP_000785282.1|4459712_4460066_+|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	97.4	6.4e-61
WP_001709668.1|4460077_4460656_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	98.4	2.9e-79
WP_001566190.1|4460652_4461048_+|tail	phage tail protein	tail	A0A2R9YJI2	Escherichia_phage	99.2	1.7e-70
WP_095892529.1|4461055_4461796_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	97.2	2.0e-128
WP_000479153.1|4461811_4462234_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	100.0	6.7e-73
WP_000459457.1|4462215_4462650_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_001703004.1|4462642_4465204_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	90.1	0.0e+00
WP_000847345.1|4465200_4465530_+|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	98.2	8.1e-58
WP_001152502.1|4465529_4466228_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	97.8	8.9e-131
WP_000194784.1|4466233_4466977_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.8	5.0e-148
WP_000090891.1|4466913_4467546_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.5	2.2e-96
WP_000993921.1|4467681_4468332_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	42.7	6.8e-16
WP_000624622.1|4468331_4468679_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_095892491.1|4468698_4470270_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.3	2.9e-169
WP_095892492.1|4470318_4473717_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	90.3	0.0e+00
WP_001230362.1|4473783_4474383_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	97.0	3.7e-109
WP_001356157.1|4474447_4477675_+	hypothetical protein	NA	X2KTY7	Enterobacteria_phage	58.8	6.4e-06
WP_001704483.1|4477674_4478259_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.3	5.0e-103
WP_122985473.1|4478313_4478982_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000386784.1|4479844_4480594_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001389524.1|4480843_4481797_-|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_001177464.1|4482310_4483072_-	DNA-binding transcriptional regulator EnvY	NA	NA	NA	NA	NA
WP_001224567.1|4483254_4484145_-	DUF4434 family protein	NA	NA	NA	NA	NA
WP_000662366.1|4484145_4487118_-	bacteriophage adsorption protein NfrA	NA	NA	NA	NA	NA
WP_000383945.1|4487104_4489342_-	phage adsorption protein NrfB	NA	NA	NA	NA	NA
WP_000394594.1|4489610_4490747_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
>prophage 11
NZ_CP024240	Escherichia coli O114:H49 strain 90-9280 chromosome, complete genome	4966338	4838669	4849329	4966338	protease	Vibrio_phage(33.33%)	7	NA	NA
WP_000188180.1|4838669_4840616_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.1	1.1e-37
WP_000410785.1|4840688_4840913_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
WP_000241204.1|4841235_4841556_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_000934053.1|4841586_4843863_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
WP_001716360.1|4844106_4844598_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000097888.1|4845115_4846099_+	type I-F CRISPR-associated endonuclease Cas1	NA	A0A2D0YFC9	Vibrio_phage	35.2	2.9e-42
WP_001101569.1|4846095_4849329_+	type I-F CRISPR-associated helicase Cas3	NA	A0A2I7RCU8	Vibrio_phage	28.8	2.8e-62
>prophage 1
NZ_CP024241	Escherichia coli O114:H49 strain 90-9280 plasmid unnamed1	104674	4965	65571	104674	integrase,transposase	Escherichia_phage(30.0%)	57	NA	NA
WP_000618110.1|4965_5214_+	DinI-like family protein	NA	Q2A098	Sodalis_phage	48.0	1.9e-14
WP_000109061.1|5210_5648_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	48.4	1.4e-25
WP_000457531.1|5647_6919_+	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	60.7	1.4e-142
WP_000340829.1|6923_7316_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001103690.1|7320_8292_-	hypothetical protein	NA	A0A222YXF2	Escherichia_phage	42.9	7.4e-67
WP_000633910.1|8520_9165_+	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	43.5	5.1e-40
WP_000239529.1|9158_9434_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000016491.1|9571_10363_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	92.0	2.5e-52
WP_000796228.1|10359_11049_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000493398.1|11092_11443_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000371891.1|11996_12254_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000194553.1|12253_12844_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000142439.1|12863_13211_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000762577.1|13329_13650_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000588735.1|14622_15483_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001386351.1|15798_16911_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_024172958.1|17099_17468_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000346361.1|19037_19841_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_071595697.1|20051_20255_+	ANR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001385800.1|20925_22119_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	32.5	2.0e-29
WP_095892533.1|23695_24478_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	98.8	9.4e-137
WP_001356151.1|24474_25497_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	98.2	3.6e-197
WP_085947598.1|25682_26844_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	4.0e-51
WP_001387713.1|28278_28683_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_001106584.1|29942_31157_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000124145.1|32018_32258_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095892534.1|32285_33448_-|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	1.4e-51
WP_000620425.1|35091_35718_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	33.2	3.7e-19
WP_000775193.1|35698_36484_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000673444.1|36440_37646_-	TolC family protein	NA	NA	NA	NA	NA
WP_000465104.1|37642_38779_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000421259.1|39562_39838_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001178087.1|39837_40122_-	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
WP_003964539.1|41028_42060_-	replication initiation protein	NA	NA	NA	NA	NA
WP_024167927.1|43031_43295_+	hypothetical protein	NA	Q7M2A7	Enterobacteria_phage	54.0	6.1e-08
WP_000483804.1|43263_43500_+	conjugal transfer protein TraA	NA	NA	NA	NA	NA
WP_001712498.1|43941_44475_+	transcription termination factor nusG family protein	NA	NA	NA	NA	NA
WP_000213855.1|44728_45412_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001136187.1|45583_45838_+	PilI type IV pilus biogenesis protein	NA	NA	NA	NA	NA
WP_085949617.1|45871_46168_+	pilJ	NA	NA	NA	NA	NA
WP_001492935.1|46788_47856_+	type IV pilus biogenesis lipoprotein PilL	NA	NA	NA	NA	NA
WP_000539807.1|47855_48293_+	type IV pilus biogenesis protein PilM	NA	NA	NA	NA	NA
WP_001388809.1|48306_49752_+	PilN family type IVB pilus formation outer membrane protein	NA	NA	NA	NA	NA
WP_001317493.1|49802_50585_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	5.9e-139
WP_001356151.1|50581_51604_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	98.2	3.6e-197
WP_001378495.1|52605_53382_+	heat-labile enterotoxin LT subunit A	NA	A0A023W6A1	Vibrio_virus	80.2	6.5e-122
WP_024167121.1|53378_53753_+	heat-labile enterotoxin LT subunit B	NA	D1GID8	Vibrio_virus	79.8	1.4e-50
WP_032272301.1|54073_54874_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	48.1	2.7e-62
WP_095892535.1|54839_56053_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	98.6	1.3e-166
WP_001702528.1|56119_56326_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000905948.1|56338_57103_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001390944.1|57738_58857_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001703699.1|58853_59039_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000694253.1|59544_60156_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000699814.1|62614_63286_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000727989.1|63343_63955_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001282172.1|65181_65571_+|transposase	transposase	transposase	B6DZU5	Stx2-converting_phage	97.7	4.3e-66
>prophage 1
NZ_CP024242	Escherichia coli O114:H49 strain 90-9280 plasmid unnamed2, complete sequence	74644	7270	13736	74644	transposase	Stx2-converting_phage(33.33%)	10	NA	NA
WP_000624622.1|7270_7618_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_099483686.1|7617_8268_-|transposase	transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	42.7	6.8e-16
WP_099483688.1|8336_8987_-	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
WP_032251633.1|8983_9418_-	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
WP_099483690.1|9472_11431_-	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	29.4	8.1e-20
WP_000006004.1|11489_11723_-	DUF905 domain-containing protein	NA	A0A096XUX0	Cronobacter_phage	51.1	3.9e-06
WP_077221344.1|11778_12300_-	single-stranded DNA-binding protein	NA	I3PGW4	Xanthomonas_phage	74.4	1.0e-46
WP_062895548.1|12527_12722_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071606928.1|12772_13021_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001311069.1|13172_13736_-	class I SAM-dependent methyltransferase	NA	A8HNV9	Thalassomonas_phage	38.0	2.7e-21
