The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP024228	Escherichia coli O25:NM strain 2014EL-1343-2 chromosome, complete genome	4848034	72112	78412	4848034		Enterobacteria_phage(33.33%)	6	NA	NA
WP_001735404.1|72112_73507_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	33.5	1.3e-19
WP_000183060.1|73681_74575_+	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	1.0e-46
WP_000699428.1|74946_76032_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.4	1.7e-99
WP_001023634.1|76031_76931_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.5	7.4e-29
WP_001735403.1|76988_77867_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	A0A291LA53	Escherichia_phage	63.4	2.1e-105
WP_001100809.1|77869_78412_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	62.5	2.4e-51
>prophage 2
NZ_CP024228	Escherichia coli O25:NM strain 2014EL-1343-2 chromosome, complete genome	4848034	816749	913999	4848034	tRNA,head,tail,holin,transposase,integrase,portal,protease,capsid,terminase	Escherichia_phage(34.48%)	100	875803:875816	915738:915751
WP_085947771.1|816749_817911_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
WP_000081192.1|818544_819810_+	MFS transporter	NA	NA	NA	NA	NA
WP_000383469.1|819821_820688_+	quinate/shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_000860200.1|820718_821477_+	type I 3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
WP_001735312.1|821619_823215_+	acyl CoA:acetate/3-ketoacid CoA transferase	NA	NA	NA	NA	NA
WP_000347850.1|823228_824380_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000284799.1|824422_825334_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000692135.1|825649_826414_+	electron transfer flavoprotein	NA	NA	NA	NA	NA
WP_005757427.1|826433_827372_+	electron transfer flavoprotein subunit alpha	NA	NA	NA	NA	NA
WP_001278525.1|827427_828717_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_000081081.1|828713_829007_+	ferredoxin family protein	NA	NA	NA	NA	NA
WP_000553704.1|829009_830710_+	medium-chain fatty-acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	25.3	3.0e-31
WP_000069375.1|830766_833145_-	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	36.7	9.4e-172
WP_000368046.1|833477_834311_+	posphoenolpyruvate synthetase regulatory kinase/phosphorylase PpsR	NA	NA	NA	NA	NA
WP_001082229.1|834467_835514_+	3-deoxy-7-phosphoheptulonate synthase AroH	NA	S4W5F1	Pandoravirus	47.7	3.2e-84
WP_001270809.1|835645_835837_+	hemin uptake protein HemP	NA	NA	NA	NA	NA
WP_000175703.1|835840_837277_-	YdiU family protein	NA	NA	NA	NA	NA
WP_001300634.1|837339_838053_-	anti-FlhDC factor	NA	NA	NA	NA	NA
WP_001209795.1|838299_838764_-	endopeptidase	NA	S5MM68	Bacillus_phage	36.9	2.1e-11
WP_000029466.1|838841_839591_-	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	28.2	9.3e-09
WP_001154168.1|839590_840142_-	glutathione peroxidase	NA	NA	NA	NA	NA
WP_000956528.1|840204_841185_-	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
WP_001229265.1|841285_841585_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
WP_000672380.1|841589_843977_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_000018596.1|843991_844975_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	1.4e-33
WP_001386830.1|845258_845303_-|tRNA	phenylalanyl--tRNA ligase operon leader peptide	tRNA	NA	NA	NA	NA
WP_000124850.1|845425_845782_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_001124225.1|845834_846032_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_001700733.1|846128_846671_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.9	6.3e-15
WP_001144202.1|846674_848603_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.3	9.4e-130
WP_001142445.1|851192_851300_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000771391.1|851352_852111_-	YdiY family protein	NA	NA	NA	NA	NA
WP_000251727.1|852397_853327_+	6-phosphofructokinase II	NA	NA	NA	NA	NA
WP_000146159.1|853427_853718_+	type V toxin-antitoxin system endoribonuclease antitoxin GhoS	NA	NA	NA	NA	NA
WP_000267650.1|853823_854684_+	fructosamine kinase family protein	NA	NA	NA	NA	NA
WP_000222163.1|854724_855261_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000106811.1|855407_856076_+	hexitol phosphatase HxpB	NA	NA	NA	NA	NA
WP_001297653.1|856238_856829_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_001010696.1|856961_858353_+	L-cystine transporter	NA	NA	NA	NA	NA
WP_001310874.1|858356_859160_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001241561.1|859448_859712_-	cell division activator CedA	NA	NA	NA	NA	NA
WP_001735321.1|859894_862156_+	catalase HPII	NA	A0A2K9L572	Tupanvirus	48.5	1.3e-143
WP_000440475.1|862413_863163_-	chitin disaccharide deacetylase	NA	NA	NA	NA	NA
WP_000078757.1|863175_864528_-	6-phospho-beta-glucosidase	NA	NA	NA	NA	NA
WP_001301288.1|864632_865472_-	transcriptional regulator ChbR	NA	NA	NA	NA	NA
WP_000968919.1|865482_865833_-	PTS N,N'-diacetylchitobiose transporter subunit IIA	NA	NA	NA	NA	NA
WP_001079505.1|868108_868615_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000937495.1|869388_869658_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	79.4	9.3e-20
WP_022645610.1|869714_870383_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000885577.1|870437_871022_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.8	6.6e-103
WP_000216487.1|871021_874048_-	membrane protein	NA	A0A0K2FIZ6	Escherichia_phage	54.5	7.0e-55
WP_001228316.1|874199_874799_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	96.5	2.0e-107
WP_099582841.1|874866_878346_-	host specificity protein J	NA	A5LH43	Enterobacteria_phage	89.4	0.0e+00
875803:875816	attL	CCTGATTTCAGCCA	NA	NA	NA	NA
WP_032156414.1|878406_879054_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	95.3	2.1e-110
WP_032180051.1|878951_879695_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	98.8	1.8e-150
WP_001735013.1|879700_880399_-|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	97.0	7.6e-130
WP_001330090.1|880398_880755_-|tail	tail protein	tail	A0A0P0ZDL9	Stx2-converting_phage	66.7	2.8e-40
WP_004000059.1|880732_883960_-|tail	phage tail tape measure protein	tail	A0A1B5FPE2	Escherichia_phage	92.8	0.0e+00
WP_077628067.1|884006_884267_-	DUF4035 domain-containing protein	NA	A0A1B5FP87	Escherichia_phage	96.5	1.7e-39
WP_001324129.1|884308_884695_-|tail	tail assembly protein	tail	A0A1B5FP91	Escherichia_phage	100.0	8.9e-64
WP_001735010.1|884694_885399_-	hypothetical protein	NA	A0A1B5FP82	Escherichia_phage	93.2	3.8e-113
WP_001206306.1|885458_885803_-	DUF3168 domain-containing protein	NA	A0A1B5FP84	Escherichia_phage	97.4	1.4e-55
WP_000968644.1|885799_886249_-	HK97 gp10 family phage protein	NA	S4TR46	Salmonella_phage	81.2	6.1e-64
WP_001147814.1|886245_886584_-|head	phage head closure protein	head	A0A1B5FP90	Escherichia_phage	90.2	7.5e-51
WP_000719065.1|886592_886910_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1W6JNZ5	Morganella_phage	49.5	1.8e-22
WP_099554548.1|886947_888519_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.9	9.9e-170
WP_000624622.1|888538_888886_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_099554551.1|888885_889563_-|transposase	transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000766109.1|889693_890911_-|capsid	phage major capsid protein	capsid	A0A1W6JP20	Morganella_phage	71.6	5.9e-162
WP_000999828.1|890925_891525_-|head,protease	HK97 family phage prohead protease	head,protease	Q8SBH9	Shigella_phage	81.0	1.9e-89
WP_001735009.1|891517_892744_-|portal	phage portal protein	portal	Q8SBI0	Shigella_phage	82.8	3.1e-203
WP_001140892.1|892891_894649_-|terminase	terminase large subunit	terminase	A0A1B5FP96	Escherichia_phage	99.3	0.0e+00
WP_023153903.1|894648_895131_-|terminase	phage terminase small subunit P27 family	terminase	A0A1B5FPA0	Escherichia_phage	97.5	4.3e-84
WP_001135103.1|895278_895629_-	HNH endonuclease	NA	A0A1B5FP94	Escherichia_phage	97.4	4.7e-64
WP_000738421.1|896154_896448_+	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	90.7	5.9e-44
WP_075202333.1|896538_896721_-	hypothetical protein	NA	A0A0P0ZE50	Stx2-converting_phage	77.0	2.2e-17
WP_000992097.1|896937_897471_-	lysozyme	NA	Q08J98	Stx2-converting_phage	93.2	1.5e-98
WP_000193264.1|897534_897885_-	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	94.0	1.4e-36
WP_000372595.1|897889_898105_-|holin	holin	holin	A0A2R2Z340	Escherichia_phage	98.6	3.4e-33
WP_000874243.1|898412_898601_-	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	95.2	7.2e-27
WP_000871291.1|898861_899197_+	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	74.8	5.2e-44
WP_000562553.1|899477_899609_-	DUF3927 domain-containing protein	NA	H6WZJ7	Escherichia_phage	100.0	3.7e-06
WP_001545909.1|900504_901326_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	58.6	1.8e-77
WP_000904111.1|901340_901697_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	6.1e-35
WP_001332495.1|902759_903038_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	46.9	1.3e-11
WP_000813256.1|903496_903652_-	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	98.0	5.0e-18
WP_000936611.1|903752_903935_+	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	74.5	2.8e-12
WP_001224679.1|904796_904979_-	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	96.7	1.2e-26
WP_001151210.1|905486_905909_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	90.6	1.3e-63
WP_001262393.1|905949_907020_-	hypothetical protein	NA	A0A088CD36	Shigella_phage	65.2	4.2e-63
WP_000693853.1|907091_907517_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001072337.1|907513_907768_-	hypothetical protein	NA	A0A2I6PIE5	Escherichia_phage	60.3	2.8e-18
WP_000233320.1|907847_908267_+	helix-turn-helix domain-containing protein	NA	A0A2I6PIE7	Escherichia_phage	47.5	4.2e-19
WP_000379589.1|908564_908720_+	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	51.1	8.8e-07
WP_001171960.1|908879_909098_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001317853.1|909637_909826_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001090200.1|909822_910014_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_074504043.1|910106_912578_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	57.1	2.3e-56
WP_000113189.1|912642_912891_+	excisionase	NA	NA	NA	NA	NA
WP_001735157.1|912868_913999_+|integrase	tyrosine-type recombinase/integrase	integrase	O21940	Phage_21	51.4	5.7e-103
915738:915751	attR	CCTGATTTCAGCCA	NA	NA	NA	NA
>prophage 3
NZ_CP024228	Escherichia coli O25:NM strain 2014EL-1343-2 chromosome, complete genome	4848034	1398323	1489206	4848034	head,tail,integrase,transposase,lysis,capsid,plate,terminase	Enterobacteria_phage(31.07%)	124	1459034:1459049	1490914:1490929
WP_001507144.1|1398323_1399655_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	37.1	1.4e-20
WP_001735045.1|1399867_1400161_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001735044.1|1400171_1400876_-|tail	tail fiber domain-containing protein	tail	A0A1X7QGH6	Escherichia_phage	61.1	3.0e-57
WP_001735043.1|1400885_1401167_-	hypothetical protein	NA	A0A1X7QHA1	Escherichia_phage	47.8	2.7e-17
WP_077899145.1|1401163_1403515_-|tail	phage tail protein	tail	A0A0E3M0V5	Enterobacteria_phage	43.7	7.0e-87
WP_074483257.1|1403579_1404179_-	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	93.5	1.9e-105
WP_099582856.1|1404246_1407612_-	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	89.8	0.0e+00
WP_000904922.1|1407706_1408279_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	85.2	4.6e-85
WP_014639621.1|1408350_1408812_+|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	50.0	3.9e-34
WP_000072167.1|1408818_1409433_-|tail	tail assembly protein	tail	Q9MCR5	Enterobacteria_phage	61.5	1.7e-61
WP_001304341.1|1409432_1409945_-|tail	tail fiber protein	tail	K7P7Q7	Enterobacteria_phage	48.5	4.4e-34
WP_099582858.1|1409953_1411753_-	short-chain fatty acid transporter	NA	A0A0K2FIZ6	Escherichia_phage	43.9	1.4e-42
WP_000138756.1|1411755_1412334_-|tail	phage tail protein I	tail	A4JWL7	Burkholderia_virus	66.8	1.7e-66
WP_001219102.1|1412326_1413430_-|plate	baseplate protein	plate	Q6QI99	Burkholderia_phage	55.2	8.3e-107
WP_000859111.1|1413420_1413768_-|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	62.4	5.9e-35
WP_000148265.1|1413822_1414419_-|plate	phage baseplate assembly protein V	plate	A4JWL4	Burkholderia_virus	45.2	5.4e-36
WP_000807995.1|1414415_1415570_-	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	47.6	2.5e-85
WP_010989167.1|1415557_1415773_-	membrane protein	NA	Q6QIA3	Burkholderia_phage	60.0	2.4e-18
WP_000458384.1|1415769_1416654_-|tail	phage tail protein	tail	A4JWL1	Burkholderia_virus	47.9	6.8e-51
WP_074483225.1|1416653_1419866_-|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	31.3	5.8e-84
WP_001202894.1|1419941_1420100_-|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_000084213.1|1420023_1420359_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_000110114.1|1420456_1420738_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000034294.1|1420740_1421262_-|tail	phage major tail tube protein	tail	A4JWK6	Burkholderia_virus	67.6	1.8e-67
WP_000729833.1|1421261_1422689_-|tail	tail protein	tail	A4JWK5	Burkholderia_virus	76.5	2.7e-214
WP_032355442.1|1422678_1422933_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001101802.1|1422929_1423394_-	hypothetical protein	NA	Q6QIB2	Burkholderia_phage	51.0	9.1e-39
WP_000271668.1|1423393_1423840_-	DUF1320 domain-containing protein	NA	A4JWK2	Burkholderia_virus	52.3	2.2e-34
WP_000537457.1|1423841_1424180_-	DUF2190 family protein	NA	NA	NA	NA	NA
WP_001286913.1|1424189_1425143_-	hypothetical protein	NA	A4JWK0	Burkholderia_virus	43.5	1.3e-63
WP_001273074.1|1425157_1426273_-	hypothetical protein	NA	A4JWJ9	Burkholderia_virus	51.6	9.4e-98
WP_000135513.1|1426487_1426946_-	phage virion morphogenesis protein	NA	Q6QIB8	Burkholderia_phage	44.8	1.5e-30
WP_000117560.1|1426948_1427770_-|head	phage head morphogenesis protein	head	A4JWJ6	Burkholderia_virus	61.2	1.2e-97
WP_000090679.1|1427750_1429247_-	DUF935 domain-containing protein	NA	A4JWJ5	Burkholderia_virus	59.6	8.0e-169
WP_000137893.1|1429246_1430770_-	hypothetical protein	NA	A4JWJ4	Burkholderia_virus	62.5	1.8e-184
WP_000533684.1|1430766_1431309_-	DUF3486 family protein	NA	A4JWJ3	Burkholderia_virus	53.3	4.9e-44
WP_000227704.1|1431311_1431623_-	hypothetical protein	NA	A0A0S4L0A3	Pseudomonas_phage	60.6	4.0e-30
WP_000175097.1|1431622_1431949_-	membrane protein	NA	Q6QIC4	Burkholderia_phage	49.5	9.6e-19
WP_001299256.1|1431945_1432557_-	hypothetical protein	NA	A0A0S4L1H0	Pseudomonas_phage	34.2	6.9e-10
WP_001104438.1|1432585_1433323_-	transglycosylase SLT domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	59.5	2.9e-63
WP_000793145.1|1433325_1433676_-	membrane protein	NA	A4JWP3	Burkholderia_virus	53.9	9.0e-23
WP_000194949.1|1433806_1434550_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000972292.1|1434525_1434930_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001069609.1|1434928_1435144_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000783855.1|1435333_1436098_+	DNA adenine methylase	NA	A2I2Y7	Vibrio_virus	64.4	5.2e-100
WP_074483224.1|1436214_1436553_-	helix-turn-helix domain-containing protein	NA	F6MII3	Haemophilus_phage	34.4	4.8e-05
WP_000123378.1|1436653_1436842_+	DNA-binding protein	NA	Q5ZQZ9	Pseudomonas_phage	71.0	3.9e-17
WP_000047758.1|1436894_1437203_+	helix-turn-helix domain-containing protein	NA	Q5ZR02	Pseudomonas_phage	55.9	3.5e-23
WP_000533819.1|1437213_1438125_+	hypothetical protein	NA	A4JWN3	Burkholderia_virus	55.3	2.0e-74
WP_000990530.1|1438128_1439898_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	Q6QIE0	Burkholderia_phage	68.3	1.4e-228
WP_000960678.1|1439908_1441075_+	AAA family ATPase	NA	A4JWN1	Burkholderia_virus	59.9	4.4e-122
WP_000843445.1|1441077_1441347_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001140139.1|1441374_1441905_+	host-nuclease inhibitor protein Gam	NA	L7P7T1	Pseudomonas_phage	66.7	9.0e-59
WP_000632579.1|1442192_1442465_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000197789.1|1442474_1442780_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000131939.1|1442776_1443460_+	DUF2786 domain-containing protein	NA	A0A2P9JZH4	Alteromonadaceae_phage	36.9	4.5e-34
WP_000631814.1|1443456_1443687_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000123379.1|1443676_1443892_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000988473.1|1443881_1444334_+	regulatory protein GemA	NA	A4JWM5	Burkholderia_virus	46.6	1.6e-24
WP_001281696.1|1444305_1444704_+	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	55.9	3.9e-30
WP_000460689.1|1444818_1445451_+	hypothetical protein	NA	NA	NA	NA	NA
WP_139298604.1|1445975_1446608_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.0	2.2e-96
WP_032200299.1|1446544_1447288_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.8	4.3e-147
WP_004000017.1|1447293_1447992_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	99.6	5.1e-134
WP_000847379.1|1447991_1448321_-|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	100.0	9.6e-59
WP_000459457.1|1450890_1451325_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_001735025.1|1451306_1451729_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	95.7	3.4e-69
WP_032200302.1|1451744_1452485_-|tail	phage tail protein	tail	A0A2I6TC77	Escherichia_phage	98.0	9.5e-131
WP_000683129.1|1452492_1452888_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	98.5	8.5e-70
WP_000975081.1|1452884_1453463_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.5	5.9e-80
WP_000785282.1|1453474_1453828_-|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	97.4	6.4e-61
WP_000158875.1|1453839_1454235_-	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	95.5	1.1e-58
WP_000063221.1|1454276_1455302_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	97.9	8.1e-189
WP_001358225.1|1455357_1455690_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	98.2	2.5e-54
WP_000123309.1|1455699_1457019_-	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	99.1	7.4e-235
WP_000198149.1|1458597_1458804_-|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_001027268.1|1458800_1460726_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.7	0.0e+00
1459034:1459049	attL	GCTCTTCAGCAGTCAG	NA	NA	NA	NA
WP_000453580.1|1460700_1461246_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	100.0	2.8e-95
WP_001331705.1|1461634_1461868_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	96.3	9.5e-21
WP_000079508.1|1461925_1462336_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	76.3	1.3e-52
WP_000381395.1|1462779_1464351_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_000624622.1|1464370_1464718_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_001339397.1|1464717_1465395_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000381395.1|1465737_1467309_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_000624622.1|1467328_1467676_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_001339397.1|1467675_1468353_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_001028465.1|1468459_1468981_-	DNA-binding protein	NA	K7P7K9	Enterobacteria_phage	100.0	1.5e-93
WP_021566044.1|1469186_1469645_-|lysis	lysis protein	lysis	K7PJW6	Enterobacteria_phage	94.1	4.4e-70
WP_000992106.1|1469641_1470175_-	lysozyme	NA	Q08J98	Stx2-converting_phage	93.8	1.1e-99
WP_000370550.1|1470280_1470553_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001468348.1|1470518_1470863_-	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	96.4	4.4e-38
WP_000839596.1|1470867_1471083_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_000737271.1|1471672_1472755_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	80.1	1.6e-166
WP_001204791.1|1472944_1473328_-	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	83.3	4.4e-55
WP_000971095.1|1473413_1473554_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	72.1	1.7e-09
WP_001735006.1|1473550_1473913_-	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	9.5e-60
WP_001735005.1|1473909_1474200_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	94.8	2.5e-47
WP_000224914.1|1474192_1474363_-	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	69.8	2.4e-13
WP_001053009.1|1474362_1474818_-	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.9	9.2e-60
WP_072142085.1|1474814_1474916_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024169787.1|1475008_1475461_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001735002.1|1475457_1475781_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085947771.1|1475930_1477092_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
WP_001735000.1|1477764_1478058_-	hypothetical protein	NA	A0A0N6WES4	Escherichia_phage	93.5	9.4e-42
WP_001734999.1|1478054_1478756_-	replication P family protein	NA	A0A0K2FIT1	Enterobacteria_phage	97.4	1.2e-127
WP_001415152.1|1478752_1479682_-	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	63.4	1.2e-109
WP_001182890.1|1479768_1480308_-	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	66.7	8.9e-62
WP_000184665.1|1480338_1480566_-	helix-turn-helix domain-containing protein	NA	Q76H55	Enterobacteria_phage	69.0	3.8e-22
WP_024169786.1|1480676_1481369_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	86.1	1.9e-109
WP_000741702.1|1481498_1482638_+	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_000581650.1|1482634_1483147_+	DUF4411 family protein	NA	NA	NA	NA	NA
WP_000233576.1|1483625_1483832_+	phage encoded cell division inhibitor protein	NA	K7P6H3	Enterobacteria_phage	85.3	3.2e-28
WP_000995491.1|1483907_1484204_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	99.0	3.6e-49
WP_000100847.1|1484209_1484995_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000186848.1|1484991_1485672_+	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	100.0	1.6e-132
WP_000682318.1|1485668_1485851_+	DUF1317 domain-containing protein	NA	A0A0N7CHV0	Escherichia_phage	98.3	1.3e-28
WP_000548531.1|1485823_1486015_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	100.0	7.3e-27
WP_001386642.1|1486025_1486307_+	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	98.9	5.5e-47
WP_000763363.1|1486405_1486627_+	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	98.6	6.4e-35
WP_001289873.1|1486623_1487172_+	ead/Ea22-like family protein	NA	A0A0K2FJF6	Enterobacteria_phage	100.0	2.2e-100
WP_000026224.1|1487363_1487645_+	hypothetical protein	NA	A0A0K2FIU9	Enterobacteria_phage	100.0	2.8e-51
WP_000545728.1|1487732_1487900_+	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	98.2	1.3e-27
WP_001303849.1|1487939_1488158_+	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_000533643.1|1488135_1489206_+|integrase	tyrosine-type recombinase/integrase	integrase	K7P6P6	Enterobacteria_phage	100.0	3.9e-202
1490914:1490929	attR	GCTCTTCAGCAGTCAG	NA	NA	NA	NA
>prophage 4
NZ_CP024228	Escherichia coli O25:NM strain 2014EL-1343-2 chromosome, complete genome	4848034	2740146	2858186	4848034	tRNA,head,tail,holin,integrase,portal,protease,lysis,capsid,plate,terminase	Escherichia_phage(39.13%)	114	2749846:2749882	2840851:2840887
WP_000187022.1|2740146_2741247_+|tRNA	tRNA (uridine(54)-C5)-methyltransferase TrmA	tRNA	NA	NA	NA	NA
WP_000806411.1|2741286_2741646_-	YijD family membrane protein	NA	NA	NA	NA	NA
WP_001309117.1|2741645_2742296_-	HTH-type transcriptional repressor FabR	NA	NA	NA	NA	NA
WP_001120810.1|2742626_2744027_+	Si-specific NAD(P)(+) transhydrogenase	NA	NA	NA	NA	NA
WP_001025939.1|2744009_2744927_-	DNA-binding transcriptional regulator OxyR	NA	NA	NA	NA	NA
WP_001230087.1|2745193_2746567_-	argininosuccinate lyase	NA	NA	NA	NA	NA
WP_001302318.1|2746627_2747404_-	acetylglutamate kinase	NA	NA	NA	NA	NA
WP_000935370.1|2747411_2748416_-	N-acetyl-gamma-glutamyl-phosphate reductase	NA	NA	NA	NA	NA
WP_001298964.1|2748569_2749721_+	acetylornithine deacetylase	NA	NA	NA	NA	NA
2749846:2749882	attL	CCGTAGGCCGGATAAGGCGCTCGCGCCGCATCCGGCA	NA	NA	NA	NA
WP_001005586.1|2750318_2752970_+	phosphoenolpyruvate carboxylase	NA	NA	NA	NA	NA
WP_000556306.1|2753151_2754885_+	phosphoethanolamine transferase CptA	NA	NA	NA	NA	NA
WP_000274636.1|2755099_2755951_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000323854.1|2755937_2756279_-	PTS fructose-like transporter subunit IIB	NA	NA	NA	NA	NA
WP_000204097.1|2756280_2757159_-	[formate-C-acetyltransferase]-activating enzyme	NA	NA	NA	NA	NA
WP_000184868.1|2757124_2759422_-	formate C-acetyltransferase	NA	A0A1S6UAD4	Serratia_phage	48.1	4.6e-06
WP_000161265.1|2759472_2759793_-	PTS fructose-like transporter subunit IIB	NA	NA	NA	NA	NA
WP_001004454.1|2759807_2760887_-	PTS fructose transporter subunit EIIC	NA	NA	NA	NA	NA
WP_032199503.1|2761195_2763697_+	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	26.9	1.0e-11
WP_000424840.1|2763708_2764371_+	fructose-6-phosphate aldolase	NA	A0A0E3F0E2	Synechococcus_phage	34.6	5.5e-29
WP_000374004.1|2764381_2765485_+	bifunctional L-1,2-propanediol dehydrogenase/glycerol dehydrogenase	NA	NA	NA	NA	NA
WP_000647891.1|2765759_2766377_+	DUF1287 domain-containing protein	NA	NA	NA	NA	NA
WP_001271242.1|2766403_2767309_-	cystine transporter YijE	NA	NA	NA	NA	NA
WP_001295695.1|2767401_2769582_-	catalase/peroxidase HPI	NA	NA	NA	NA	NA
WP_000007523.1|2769910_2770801_-	methylenetetrahydrofolate reductase	NA	NA	NA	NA	NA
WP_000110772.1|2771149_2773582_-	bifunctional aspartate kinase/homoserine dehydrogenase II	NA	NA	NA	NA	NA
WP_001295694.1|2773584_2774745_-	cystathionine gamma-synthase	NA	NA	NA	NA	NA
WP_000852812.1|2775021_2775339_+	met regulon transcriptional regulator MetJ	NA	NA	NA	NA	NA
WP_000797353.1|2775522_2776131_+	YiiX family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_000710769.1|2776191_2776404_-	50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_001735949.1|2776606_2778805_+	primosomal protein N'	NA	NA	NA	NA	NA
WP_000644904.1|2778960_2779986_+	DNA-binding transcriptional regulator CytR	NA	NA	NA	NA	NA
WP_000068828.1|2780077_2781037_+	cell division protein FtsN	NA	NA	NA	NA	NA
WP_000208242.1|2781129_2781660_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_001293341.1|2781669_2783001_+	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	29.9	1.7e-45
WP_000139496.1|2783067_2783994_+	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_000872908.1|2784086_2784572_+	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_001296623.1|2784656_2784902_-	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
WP_000084268.1|2785326_2786172_+	glycerol uptake facilitator protein GlpF	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.0	4.4e-15
WP_000136788.1|2786194_2787703_+	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_001250644.1|2787837_2788848_+	class II fructose-bisphosphatase	NA	NA	NA	NA	NA
WP_000796332.1|2788944_2789691_+	ferredoxin--NADP(+) reductase	NA	NA	NA	NA	NA
WP_000323556.1|2789695_2790124_-	universal stress protein UspD	NA	NA	NA	NA	NA
WP_000655989.1|2790150_2790450_-	DUF406 domain-containing protein	NA	NA	NA	NA	NA
WP_000155257.1|2790661_2791102_-	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_000802214.1|2791202_2791802_+	YiiQ family protein	NA	NA	NA	NA	NA
WP_001216325.1|2791909_2792677_+	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_001351967.1|2792731_2793487_-	CDP-diacylglycerol diphosphatase	NA	NA	NA	NA	NA
WP_074483030.1|2793593_2794583_-	sulfate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000591795.1|2794902_2795865_-	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_001076742.1|2796045_2796948_-	CDF family cation-efflux transporter FieF	NA	NA	NA	NA	NA
WP_000468308.1|2797184_2797403_-	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_000882969.1|2797484_2798648_-	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	100.0	2.8e-206
WP_032192493.1|2798647_2799127_-|tail	phage tail protein	tail	O64315	Escherichia_phage	98.1	2.8e-83
WP_099582904.1|2799141_2801589_-|tail	phage tail tape measure protein	tail	M1T2S3	Escherichia_phage	92.3	0.0e+00
WP_000785970.1|2801581_2801701_-|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_001031303.1|2801733_2802009_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
WP_001251408.1|2802065_2802584_-|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_001286716.1|2802596_2803787_-|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	100.0	1.6e-225
WP_099582906.1|2804085_2804613_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001461858.1|2805002_2805530_-|tail	tail fiber assembly protein	tail	Q7Y4D3	Escherichia_virus	95.4	2.3e-91
WP_032199506.1|2805533_2807828_-|tail	phage tail protein	tail	U5N099	Enterobacteria_phage	62.2	8.7e-183
WP_001735424.1|2807838_2808369_-|tail	phage tail protein I	tail	U5N0U8	Enterobacteria_phage	99.4	8.6e-102
WP_001735425.1|2808361_2809270_-|plate	baseplate assembly protein	plate	U5N3T9	Enterobacteria_phage	99.7	4.4e-162
WP_001735426.1|2809274_2809622_-	lysozyme family protein	NA	A0A0F7L9X3	Escherichia_phage	99.1	6.5e-58
WP_001735427.1|2809618_2810254_-|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	97.6	1.0e-112
WP_099582908.1|2810320_2810773_-	phage virion morphogenesis protein	NA	A0A0F7LBV9	Escherichia_phage	98.7	1.2e-75
WP_001735428.1|2810765_2811233_-|tail	phage tail protein	tail	A0A0F7LA33	Escherichia_phage	98.7	8.7e-82
WP_001735429.1|2811340_2811766_-|lysis	LysB family phage lysis regulatory protein	lysis	U5N3W5	Enterobacteria_phage	95.7	1.0e-65
WP_001598741.1|2811753_2812179_-	hypothetical protein	NA	A0A0F7LDU9	Escherichia_phage	97.2	5.0e-60
WP_074483246.1|2812193_2812691_-	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	99.4	1.2e-92
WP_000123123.1|2812690_2812972_-|holin	holin	holin	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
WP_001735431.1|2812975_2813179_-	phage Tail protein X family protein	NA	U5N3E7	Enterobacteria_phage	98.5	2.0e-30
WP_099582910.1|2813178_2813688_-|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	98.2	9.5e-90
WP_074483247.1|2813787_2814531_-|terminase	terminase endonuclease subunit	terminase	A0A0F7LBP7	Escherichia_phage	98.0	1.1e-123
WP_024224595.1|2814534_2815608_-|capsid	phage major capsid protein, P2 family	capsid	Q94MH9	Enterobacteria_phage	99.4	1.1e-201
WP_047603076.1|2815666_2816521_-|capsid	GPO family capsid scaffolding protein	capsid	Q778Z1	Enterobacteria_phage	97.2	7.6e-132
WP_099582913.1|2816694_2818467_+|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCK3	Escherichia_phage	99.7	0.0e+00
WP_047603079.1|2818466_2819501_+|portal	phage portal protein	portal	Q858W8	Yersinia_virus	99.4	9.3e-201
WP_000500143.1|2821604_2822606_+	hypothetical protein	NA	Q2P9X7	Enterobacteria_phage	41.9	4.5e-67
WP_099582915.1|2822907_2825196_-	replication endonuclease	NA	Q858T4	Yersinia_virus	97.8	0.0e+00
WP_000027664.1|2825185_2825461_-	hypothetical protein	NA	U5N3W1	Enterobacteria_phage	100.0	3.8e-45
WP_001390857.1|2825457_2825682_-	TraR/DksA family transcriptional regulator	NA	A0A0F7LDG9	Escherichia_phage	97.3	1.9e-34
WP_062874112.1|2825684_2825984_-	hypothetical protein	NA	S4TUD1	Salmonella_phage	97.0	6.0e-44
WP_000557703.1|2825983_2826208_-	DUF2732 family protein	NA	S4TP68	Salmonella_phage	100.0	4.7e-33
WP_000217670.1|2826271_2826772_-	hypothetical protein	NA	M1SV55	Escherichia_phage	100.0	2.6e-92
WP_001308179.1|2826941_2827214_-	hypothetical protein	NA	Q1JS36	Enterobacteria_phage	100.0	1.4e-47
WP_000777029.1|2827350_2827644_+	helix-turn-helix domain-containing protein	NA	Q1JS37	Enterobacteria_phage	100.0	2.7e-49
WP_000985246.1|2827713_2828694_+|integrase	tyrosine-type recombinase/integrase	integrase	S4TP66	Salmonella_phage	100.0	4.7e-186
WP_001223800.1|2828880_2829381_-	cell-envelope stress modulator CpxP	NA	NA	NA	NA	NA
WP_001033722.1|2829530_2830229_+	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
WP_000580417.1|2830225_2831599_+	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.9	3.8e-16
WP_001270260.1|2831704_2832379_-	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_001166063.1|2832527_2833511_-	2-keto-3-deoxygluconate transporter	NA	NA	NA	NA	NA
WP_000122641.1|2833770_2834391_-	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	59.3	8.4e-64
WP_000063517.1|2834675_2835710_+	L-rhamnose/proton symporter RhaT	NA	NA	NA	NA	NA
WP_000863142.1|2835706_2836645_-	HTH-type transcriptional activator RhaR	NA	NA	NA	NA	NA
WP_000217137.1|2836628_2837465_-	HTH-type transcriptional activator RhaS	NA	NA	NA	NA	NA
WP_001735947.1|2837752_2839222_+	rhamnulokinase	NA	NA	NA	NA	NA
WP_001311268.1|2839218_2840478_+	L-rhamnose isomerase	NA	NA	NA	NA	NA
WP_001179745.1|2840928_2841753_+	rhamnulose-1-phosphate aldolase	NA	NA	NA	NA	NA
2840851:2840887	attR	TGCCGGATGCGGCGCGAGCGCCTTATCCGGCCTACGG	NA	NA	NA	NA
WP_000619493.1|2841762_2842077_+	L-rhamnose mutarotase	NA	NA	NA	NA	NA
WP_000729595.1|2842377_2842824_+	PTS fructose transporter subunit IIA	NA	NA	NA	NA	NA
WP_000446023.1|2842834_2844286_+	PTS fructose-like transporter subunit IIBC	NA	NA	NA	NA	NA
WP_001019484.1|2844275_2845346_+	aminopeptidase	NA	NA	NA	NA	NA
WP_032199501.1|2845345_2847094_+	PTS transporter subunit EIIA	NA	NA	NA	NA	NA
WP_000753617.1|2848351_2849185_-	formate dehydrogenase accessory sulfurtransferase FdhD	NA	NA	NA	NA	NA
WP_077249888.1|2849378_2852429_+	formate dehydrogenase-N subunit alpha	NA	A0A077SK27	Escherichia_phage	23.8	1.1e-07
WP_000331377.1|2852441_2853344_+	formate dehydrogenase subunit beta	NA	NA	NA	NA	NA
WP_000829013.1|2853340_2853976_+	formate dehydrogenase cytochrome b556 subunit	NA	NA	NA	NA	NA
WP_000027705.1|2853972_2854902_+	formate dehydrogenase accessory protein FdhE	NA	NA	NA	NA	NA
WP_001086388.1|2855231_2855474_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001295676.1|2855691_2855910_-	CopG family transcriptional regulator	NA	NA	NA	NA	NA
WP_021566627.1|2856762_2857704_-	fatty acid biosynthesis protein FabY	NA	NA	NA	NA	NA
WP_000560983.1|2857748_2858186_-|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
>prophage 5
NZ_CP024228	Escherichia coli O25:NM strain 2014EL-1343-2 chromosome, complete genome	4848034	4525726	4566164	4848034	head,holin,integrase,portal,terminase	Enterobacteria_phage(43.64%)	59	4522036:4522052	4569989:4570005
4522036:4522052	attL	GGTTGTCGATACCAATA	NA	NA	NA	NA
WP_001163428.1|4525726_4525927_-	response regulator inhibitor TorI	NA	K7P7V0	Enterobacteria_phage	100.0	2.4e-33
WP_099582961.1|4526253_4526790_-	DUF551 domain-containing protein	NA	Q6H9Z7	Enterobacteria_phage	61.5	3.9e-49
WP_099582963.1|4526791_4527415_-	ead/Ea22-like family protein	NA	Q6H9Z5	Enterobacteria_phage	64.1	1.8e-74
WP_001214451.1|4527411_4527579_-	DUF2737 family protein	NA	Q716F2	Shigella_phage	96.4	3.6e-22
WP_099582966.1|4527589_4527886_-	DUF2856 family protein	NA	A0A220NRR0	Escherichia_phage	98.0	3.3e-50
WP_000951325.1|4527909_4528293_-	hypothetical protein	NA	A0A2I6PID1	Escherichia_phage	100.0	3.8e-67
WP_021562549.1|4528292_4528898_-	ERF family protein	NA	Q9MCQ9	Enterobacteria_phage	99.5	4.1e-108
WP_001243356.1|4529154_4529307_-	host cell division inhibitory peptide Kil	NA	A5VWA5	Enterobacteria_phage	98.0	1.8e-20
WP_000972063.1|4529291_4529426_-	hypothetical protein	NA	K7PHK2	Enterobacteria_phage	100.0	3.1e-16
WP_096323931.1|4529622_4529949_-	hypothetical protein	NA	A0A0M4R4L8	Citrobacter_phage	29.0	2.1e-05
WP_097680306.1|4529987_4530302_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157774441.1|4530305_4530647_-	hypothetical protein	NA	F1C5C1	Cronobacter_phage	68.2	3.5e-32
WP_001519589.1|4531000_4531696_-	LexA family transcriptional regulator	NA	A0A0N7BTS4	Escherichia_phage	96.5	1.3e-129
WP_000067727.1|4531771_4531987_+	helix-turn-helix transcriptional regulator	NA	A0A0N7C2U7	Escherichia_phage	100.0	2.2e-35
WP_000438538.1|4532096_4532396_+	hypothetical protein	NA	A0A0P0ZBJ0	Stx2-converting_phage	99.0	4.8e-49
WP_099582971.1|4532558_4533335_+	helix-turn-helix domain-containing protein	NA	A0A0P0ZC04	Stx2-converting_phage	99.2	3.5e-136
WP_001331794.1|4533445_4535326_+	bifunctional DNA primase/helicase	NA	K7PK08	Enterobacteria_phage	100.0	0.0e+00
WP_001036029.1|4535326_4535596_+	hypothetical protein	NA	G9L682	Escherichia_phage	98.9	1.9e-44
WP_021561742.1|4535674_4536286_+	HNH endonuclease	NA	A0A2I6PIF0	Escherichia_phage	98.5	1.3e-109
WP_000736903.1|4536334_4536775_+	recombination protein NinB	NA	A0A220NRM1	Escherichia_phage	100.0	7.0e-81
WP_000153280.1|4536771_4537299_+	phage N-6-adenine-methyltransferase	NA	A0A1I9LJP9	Stx_converting_phage	100.0	9.5e-101
WP_001254220.1|4537295_4537472_+	NinE family protein	NA	K7PHE6	Enterobacteria_phage	100.0	2.7e-28
WP_021514413.1|4537474_4537876_+	hypothetical protein	NA	G9L690	Escherichia_phage	98.5	1.6e-71
WP_077776196.1|4537835_4538045_+	protein ninF	NA	G9L691	Escherichia_phage	95.7	2.6e-30
WP_001286917.1|4538037_4538250_+	hypothetical protein	NA	K7PK10	Enterobacteria_phage	100.0	1.6e-35
WP_028125967.1|4538242_4538533_+	DUF1364 domain-containing protein	NA	Q9MCN9	Enterobacteria_phage	96.9	4.2e-50
WP_001008199.1|4538529_4538892_+	RusA family crossover junction endodeoxyribonuclease	NA	A5VW85	Enterobacteria_phage	100.0	9.2e-63
WP_000994516.1|4538888_4539077_+	protein ninH	NA	A5VW84	Enterobacteria_phage	100.0	5.5e-27
WP_001235461.1|4539073_4539697_+	antitermination protein	NA	K7PM87	Enterobacteria_phage	100.0	3.0e-114
WP_000783734.1|4540480_4540804_+|holin	phage holin, lambda family	holin	G5DA93	Enterobacteria_phage	100.0	1.3e-52
WP_099582973.1|4540787_4541264_+	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	99.4	1.4e-87
WP_001228699.1|4541480_4541687_+	hypothetical protein	NA	H6WRZ6	Salmonella_phage	97.1	1.5e-30
WP_001139676.1|4541715_4541868_+	hypothetical protein	NA	A0A088CQ22	Enterobacteria_phage	100.0	1.2e-21
WP_001109020.1|4542074_4542617_+	Rha family transcriptional regulator	NA	A5VW78	Enterobacteria_phage	100.0	1.4e-99
WP_099582978.1|4542955_4543135_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099582981.1|4543247_4543988_+	trypsin-like peptidase domain-containing protein	NA	A0A2H4J9L7	uncultured_Caudovirales_phage	79.2	1.8e-105
WP_000807788.1|4544151_4544394_+	DUF2560 family protein	NA	A5VW77	Enterobacteria_phage	100.0	1.3e-36
WP_099582983.1|4544473_4544899_+	ubiquitin carboxyl-hydrolase	NA	Q716H4	Shigella_phage	87.2	1.5e-64
WP_099582986.1|4544895_4546308_+|terminase	PBSX family phage terminase large subunit	terminase	Q716H3	Shigella_phage	99.4	1.1e-276
WP_000852334.1|4546310_4548437_+|portal	portal protein	portal	Q9AYZ9	Salmonella_phage	99.7	0.0e+00
WP_000426729.1|4548450_4549335_+	hypothetical protein	NA	Q716H1	Shigella_phage	99.3	1.8e-144
WP_097732013.1|4549346_4550618_+|head	head protein	head	Q716H0	Shigella_phage	99.5	7.3e-240
WP_059331131.1|4550660_4550846_+	hypothetical protein	NA	Q716G9	Shigella_phage	96.7	1.3e-25
WP_000246750.1|4550820_4551303_+	packaged DNA stabilization protein p27	NA	Q716G8	Shigella_phage	100.0	3.8e-88
WP_099582988.1|4551311_4552730_+	hypothetical protein	NA	A0A088CQ70	Enterobacteria_phage	98.7	3.3e-273
WP_059331135.1|4552729_4553431_+	hypothetical protein	NA	A5VW68	Enterobacteria_phage	95.3	1.2e-114
WP_000627636.1|4553430_4553886_+	DUF2824 family protein	NA	A0A2D1GLX4	Escherichia_phage	99.3	2.3e-87
WP_045133253.1|4553888_4554581_+	DNA transfer protein	NA	A5VW66	Enterobacteria_phage	97.0	2.9e-113
WP_042111353.1|4554591_4555923_+	DNA transfer protein	NA	A0A0M5M1J8	Salmonella_phage	71.9	1.6e-160
WP_033558936.1|4555922_4558046_+	hypothetical protein	NA	B9UDL1	Salmonella_phage	98.6	0.0e+00
WP_000288816.1|4558046_4558370_-	hypothetical protein	NA	B9UDL2	Salmonella_phage	100.0	1.1e-14
WP_024187648.1|4558391_4558604_-	hypothetical protein	NA	H6WRV2	Salmonella_phage	49.3	2.0e-09
WP_099582991.1|4558719_4559085_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021533962.1|4559081_4559333_-	Arc family DNA-binding protein	NA	A5VW59	Enterobacteria_phage	94.0	8.1e-34
WP_000865491.1|4559438_4559579_+	Arc family DNA-binding protein	NA	A0A0M4S6R9	Salmonella_phage	59.1	5.7e-05
WP_032199583.1|4559676_4560555_+	antirepressor	NA	I6R977	Salmonella_phage	75.4	3.0e-91
WP_099582993.1|4560655_4562926_+|head	head-binding protein	head	A5VW57	Enterobacteria_phage	33.6	4.7e-11
WP_050438166.1|4562991_4564737_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_032199585.1|4565006_4566164_-|integrase	prophage integrase IntS	integrase	A5VW56	Enterobacteria_phage	99.5	2.2e-222
4569989:4570005	attR	GGTTGTCGATACCAATA	NA	NA	NA	NA
>prophage 6
NZ_CP024228	Escherichia coli O25:NM strain 2014EL-1343-2 chromosome, complete genome	4848034	4816263	4825704	4848034		Enterobacteria_phage(85.71%)	10	NA	NA
WP_000569357.1|4816263_4817190_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	1.7e-23
WP_000783120.1|4817194_4817926_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|4817906_4818014_-	protein YohO	NA	NA	NA	NA	NA
WP_001240401.1|4818073_4818805_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001295431.1|4819026_4820712_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_000598641.1|4820708_4821428_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000950409.1|4821474_4821945_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	5.2e-82
WP_001295429.1|4821984_4822446_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001375261.1|4822570_4824571_-	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	96.1	0.0e+00
WP_001333512.1|4824567_4825704_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.7	1.9e-162
