The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	0	16158	6593819		Mycobacterium_phage(33.33%)	12	NA	NA
WP_077566332.1|959_1409_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_099476295.1|1729_2602_+	aminoglycoside phosphotransferase family protein	NA	NA	NA	NA	NA
WP_099476296.1|3208_4285_+	phosphotransferase	NA	NA	NA	NA	NA
WP_157929244.1|4673_4859_+	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_099476299.1|5881_6640_+	TIM barrel protein	NA	NA	NA	NA	NA
WP_162292780.1|6951_7791_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_099476301.1|7928_9914_+	beta-galactosidase	NA	NA	NA	NA	NA
WP_099476302.1|10578_11430_+	alpha/beta hydrolase	NA	A0A286MQ79	Mycobacterium_phage	23.4	2.0e-07
WP_099476303.1|11550_12342_+	phosphotransferase	NA	NA	NA	NA	NA
WP_157929245.1|13206_14157_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	39.6	7.3e-35
WP_099476305.1|14158_14899_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_077566317.1|15876_16158_+	winged helix-turn-helix transcriptional regulator	NA	A0A218MNF3	uncultured_virus	38.6	1.4e-05
>prophage 2
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	78827	79823	6593819		Tupanvirus(100.0%)	1	NA	NA
WP_099476329.1|78827_79823_+	NADP-dependent oxidoreductase	NA	A0A2K9L7I1	Tupanvirus	25.5	3.0e-07
>prophage 3
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	90104	91916	6593819		Pandoravirus(100.0%)	1	NA	NA
WP_077566244.1|90104_91916_-	DUF1835 domain-containing protein	NA	S4W232	Pandoravirus	28.9	3.1e-10
>prophage 4
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	97967	99506	6593819		Tupanvirus(100.0%)	1	NA	NA
WP_099476337.1|97967_99506_+	sulfatase-like hydrolase/transferase	NA	A0A2K9L1A5	Tupanvirus	25.2	2.3e-14
>prophage 5
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	104688	106434	6593819		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_099476340.1|104688_106434_+	biosynthetic-type acetolactate synthase large subunit	NA	G9E4W7	Ostreococcus_lucimarinus_virus	30.0	1.5e-25
>prophage 6
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	111774	112485	6593819		Bacillus_phage(100.0%)	1	NA	NA
WP_099476343.1|111774_112485_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	37.9	5.3e-38
>prophage 7
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	117665	122382	6593819		Bacillus_phage(50.0%)	4	NA	NA
WP_099476348.1|117665_119117_-	phosphomannomutase/phosphoglucomutase	NA	A0A127AWJ1	Bacillus_phage	31.4	1.5e-50
WP_077566215.1|119145_120210_-	glycosyl transferase	NA	NA	NA	NA	NA
WP_099476349.1|120184_121345_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_099476350.1|121341_122382_-	NDP-sugar synthase	NA	I7I009	Enterobacteria_phage	30.1	3.2e-15
>prophage 8
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	126711	127446	6593819		Staphylococcus_phage(100.0%)	1	NA	NA
WP_077566199.1|126711_127446_-	heme ABC exporter ATP-binding protein CcmA	NA	A0A2H4PQG7	Staphylococcus_phage	30.2	2.1e-21
>prophage 9
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	132571	136110	6593819		Bacillus_phage(100.0%)	2	NA	NA
WP_077566185.1|132571_134293_-	thiol reductant ABC exporter subunit CydC	NA	W8CYL7	Bacillus_phage	24.5	1.5e-14
WP_099476360.1|134289_136110_-	thiol reductant ABC exporter subunit CydD	NA	W8CYL7	Bacillus_phage	23.0	9.8e-20
>prophage 10
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	143806	149524	6593819		Bacillus_phage(33.33%)	7	NA	NA
WP_099476367.1|143806_144475_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	34.9	3.3e-26
WP_099476368.1|144504_145272_-	lantibiotic immunity ABC transporter MutG family permease subunit	NA	NA	NA	NA	NA
WP_099476369.1|145278_146025_-	lantibiotic immunity ABC transporter MutE/EpiE family permease subunit	NA	NA	NA	NA	NA
WP_167393000.1|146021_146747_-	lantibiotic protection ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	47.5	2.4e-54
WP_099476370.1|146792_147284_-	NisI/SpaI family lantibiotic immunity lipoprotein	NA	NA	NA	NA	NA
WP_099476371.1|147458_148502_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_099476372.1|148498_149524_-	iron ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	24.8	1.4e-10
>prophage 11
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	155230	156001	6593819		Bacillus_phage(100.0%)	1	NA	NA
WP_099476376.1|155230_156001_+	phosphonate ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.6	5.4e-12
>prophage 12
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	161314	164023	6593819		Anomala_cuprea_entomopoxvirus(50.0%)	3	NA	NA
WP_077566150.1|161314_162265_-	ATP-binding cassette domain-containing protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	29.6	1.1e-19
WP_077566149.1|162284_163112_-	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_099476380.1|163108_164023_-	YafY family transcriptional regulator	NA	A0A1B0RXM1	Streptococcus_phage	28.7	2.3e-09
>prophage 13
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	167199	167832	6593819		Salicola_phage(100.0%)	1	NA	NA
WP_099476381.1|167199_167832_-	RNA ligase family protein	NA	A0A248SJ81	Salicola_phage	49.3	6.3e-59
>prophage 14
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	177407	178142	6593819		Enterococcus_phage(100.0%)	1	NA	NA
WP_099476388.1|177407_178142_-	glycerophosphodiester phosphodiesterase	NA	A0A0S2MYI4	Enterococcus_phage	29.5	1.5e-19
>prophage 15
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	186830	188261	6593819		Mycobacterium_phage(100.0%)	1	NA	NA
WP_077566109.1|186830_188261_-	MFS transporter	NA	A0A0M3UL24	Mycobacterium_phage	32.0	3.1e-53
>prophage 16
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	195056	195989	6593819		Streptococcus_phage(100.0%)	1	NA	NA
WP_099476400.1|195056_195989_-	YafY family transcriptional regulator	NA	A0A1B0RXM1	Streptococcus_phage	31.1	7.7e-21
>prophage 17
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	205156	206167	6593819		Enterobacteria_phage(100.0%)	1	NA	NA
WP_077566093.1|205156_206167_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	26.7	1.2e-19
>prophage 18
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	217453	220648	6593819		Enterococcus_phage(100.0%)	1	NA	NA
WP_099476411.1|217453_220648_-	Ig-like domain-containing protein	NA	A0A0C5KL53	Enterococcus_phage	47.7	1.2e-12
>prophage 19
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	224952	227659	6593819		Bacillus_phage(66.67%)	3	NA	NA
WP_099476413.1|224952_225876_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	48.3	4.0e-46
WP_099476414.1|226025_226961_-	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	31.3	1.8e-25
WP_077566070.1|226963_227659_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	35.4	1.8e-35
>prophage 20
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	234125	236528	6593819		Orpheovirus(50.0%)	2	NA	NA
WP_077566062.1|234125_234920_-	DUF2935 domain-containing protein	NA	A0A2I2L551	Orpheovirus	41.1	9.1e-47
WP_077568955.1|235058_236528_-	serine hydrolase	NA	G1BNF7	Mycobacterium_phage	25.1	3.9e-11
>prophage 21
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	266927	270991	6593819		Cowpox_virus(33.33%)	4	NA	NA
WP_077566015.1|266927_267767_-	alpha/beta hydrolase	NA	A0A212Q3G8	Cowpox_virus	24.6	2.2e-06
WP_077566013.1|267966_268674_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_099476428.1|268679_270128_+	HAMP domain-containing histidine kinase	NA	A0A1V0SGX0	Hokovirus	24.8	1.3e-14
WP_099476429.1|270226_270991_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	23.2	1.2e-14
>prophage 22
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	288612	290555	6593819		Acanthocystis_turfacea_Chlorella_virus(50.0%)	2	NA	NA
WP_099476443.1|288612_289578_-	ABC transporter ATP-binding protein	NA	M1IB70	Acanthocystis_turfacea_Chlorella_virus	23.8	8.6e-07
WP_099476444.1|289574_290555_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.9	2.1e-16
>prophage 23
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	313897	318456	6593819		Staphylococcus_phage(50.0%)	6	NA	NA
WP_099476458.1|313897_314764_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	31.3	4.5e-23
WP_099476459.1|314760_315144_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_099476460.1|315372_315831_-	DUF2269 family protein	NA	NA	NA	NA	NA
WP_157929253.1|315852_316464_-	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_099476462.1|316492_316945_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_099476463.1|317169_318456_-	adenylosuccinate synthase	NA	A0A2H4UVZ8	Bodo_saltans_virus	28.4	8.5e-18
>prophage 24
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	341646	342501	6593819		Pithovirus(100.0%)	1	NA	NA
WP_099476478.1|341646_342501_-	ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	30.9	3.1e-16
>prophage 25
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	355079	359422	6593819		Bacillus_phage(66.67%)	5	NA	NA
WP_077565882.1|355079_355862_-	alpha/beta hydrolase	NA	R4JP33	Mycobacterium_phage	23.9	2.2e-08
WP_077565880.1|355845_356454_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_099476486.1|356633_357188_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_099476487.1|357398_358733_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	27.4	5.1e-26
WP_077565874.1|358735_359422_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.9	9.0e-35
>prophage 26
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	371018	372378	6593819	transposase	Streptococcus_phage(100.0%)	1	NA	NA
WP_099476497.1|371018_372378_+|transposase	IS1182 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	40.7	2.4e-87
>prophage 27
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	377194	379854	6593819		Planktothrix_phage(50.0%)	3	NA	NA
WP_099476498.1|377194_377962_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.5	9.5e-33
WP_077565855.1|378157_378829_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_099476499.1|378825_379854_+	sensor histidine kinase	NA	B5LWN0	Feldmannia_species_virus	33.0	8.3e-08
>prophage 28
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	385974	390944	6593819		uncultured_virus(50.0%)	4	NA	NA
WP_099476504.1|385974_388161_-	cadmium-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	34.6	1.0e-95
WP_077565839.1|388309_388879_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_077565838.1|389238_390000_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_099476505.1|390263_390944_-	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A075BUR2	Microcystis_phage	36.8	3.3e-29
>prophage 29
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	404198	405485	6593819		Catovirus(100.0%)	1	NA	NA
WP_157929257.1|404198_405485_+	glycosyltransferase	NA	A0A1V0SAH6	Catovirus	31.5	5.1e-07
>prophage 30
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	409144	413305	6593819		Salmonella_phage(50.0%)	5	NA	NA
WP_099476513.1|409144_409894_-	glycosyltransferase	NA	I1TED8	Salmonella_phage	26.7	2.1e-05
WP_077565809.1|409898_410594_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_077565807.1|410630_411737_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_077565806.1|411776_412349_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167393004.1|412348_413305_-	glycosyltransferase family 4 protein	NA	A0A2K9L0K5	Tupanvirus	27.7	6.5e-07
>prophage 31
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	418982	419924	6593819		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_099476519.1|418982_419924_-	phosphoglycerate dehydrogenase	NA	M1H9J0	Paramecium_bursaria_Chlorella_virus	31.1	6.6e-28
>prophage 32
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	447470	448253	6593819		Mollivirus(100.0%)	1	NA	NA
WP_099480414.1|447470_448253_-	SDR family oxidoreductase	NA	A0A0M4JSW6	Mollivirus	28.3	4.8e-08
>prophage 33
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	455670	457547	6593819		Bacillus_phage(100.0%)	2	NA	NA
WP_077565758.1|455670_456837_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	24.9	5.7e-21
WP_099476534.1|456833_457547_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.8	1.1e-35
>prophage 34
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	467586	470034	6593819		Bordetella_phage(50.0%)	2	NA	NA
WP_077565742.1|467586_468456_+	AraC family transcriptional regulator	NA	A0A291LAM3	Bordetella_phage	36.8	1.3e-06
WP_077565741.1|468600_470034_-	MFS transporter	NA	A0A0M3UL24	Mycobacterium_phage	25.7	9.1e-21
>prophage 35
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	477856	483884	6593819		Malacosoma_sp._alphabaculovirus(50.0%)	5	NA	NA
WP_099476544.1|477856_478720_+	serine/threonine-protein kinase	NA	A0A1B1UZQ2	Malacosoma_sp._alphabaculovirus	23.7	6.3e-09
WP_077565732.1|478841_479117_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099476545.1|479262_480441_-	MFS transporter	NA	NA	NA	NA	NA
WP_077565730.1|480437_481265_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_099476546.1|481490_483884_-	polyprenyl synthetase family protein	NA	A0A1V0SE37	Indivirus	27.8	3.4e-12
>prophage 36
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	497124	500196	6593819		Bacillus_phage(100.0%)	2	NA	NA
WP_099476552.1|497124_498861_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.3	5.8e-54
WP_077565718.1|499377_500196_+	TerC family protein	NA	S5MAL1	Bacillus_phage	45.7	3.6e-30
>prophage 37
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	510393	511092	6593819		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_099476558.1|510393_511092_+	glycosyltransferase	NA	A0A0N9QZQ5	Chrysochromulina_ericina_virus	32.6	4.1e-19
>prophage 38
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	517310	518846	6593819		Escherichia_phage(100.0%)	1	NA	NA
WP_099476564.1|517310_518846_-	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	47.8	7.5e-21
>prophage 39
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	540029	545449	6593819	tRNA	Escherichia_phage(50.0%)	4	NA	NA
WP_099476580.1|540029_541724_-|tRNA	glutamine--tRNA ligase/YqeY domain fusion protein	tRNA	A0A222YZ70	Escherichia_phage	49.7	4.3e-155
WP_099476581.1|542139_542628_-	translation initiation factor IF-3	NA	NA	NA	NA	NA
WP_099476582.1|542752_543196_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_099476583.1|543496_545449_+	TetM/TetW/TetO/TetS family tetracycline resistance ribosomal protection protein	NA	E4ZFJ7	Streptococcus_phage	35.5	1.2e-108
>prophage 40
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	552419	556008	6593819		Bacillus_phage(100.0%)	2	NA	NA
WP_099476589.1|552419_554156_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.8	2.1e-51
WP_099480425.1|554172_556008_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	30.6	4.1e-58
>prophage 41
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	563161	570596	6593819		Erysipelothrix_phage(25.0%)	7	NA	NA
WP_099476592.1|563161_563704_-	GrpB family protein	NA	A0A2K5B2B6	Erysipelothrix_phage	35.0	7.7e-21
WP_099476593.1|563884_565135_-	oligoribonuclease	NA	A0A2H4UU35	Bodo_saltans_virus	28.9	9.4e-06
WP_077565669.1|565306_565645_-	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_077565668.1|565787_566174_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_099476594.1|566317_567313_-	biotin synthase BioB	NA	NA	NA	NA	NA
WP_099476595.1|567572_569489_-	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	28.9	1.5e-47
WP_099476596.1|569678_570596_+	NAD-dependent epimerase/dehydratase family protein	NA	E3T4Y8	Cafeteria_roenbergensis_virus	33.8	4.4e-37
>prophage 42
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	576864	578001	6593819		Synechococcus_phage(100.0%)	1	NA	NA
WP_099476600.1|576864_578001_-	alcohol dehydrogenase catalytic domain-containing protein	NA	E3SJ82	Synechococcus_phage	25.4	6.1e-12
>prophage 43
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	624269	625355	6593819		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_077565619.1|624269_625355_+	tyrosine recombinase XerS	NA	A0A1B1IQT7	uncultured_Mediterranean_phage	30.8	4.1e-05
>prophage 44
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	632255	633878	6593819		Bacillus_phage(50.0%)	2	NA	NA
WP_077568931.1|632255_632966_-	LysM peptidoglycan-binding domain-containing protein	NA	J9PR33	Bacillus_phage	41.8	8.0e-10
WP_167392954.1|633155_633878_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.3	5.8e-32
>prophage 45
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	641584	647822	6593819		Bacillus_phage(50.0%)	6	NA	NA
WP_099476640.1|641584_642799_+	glucose-1-phosphate adenylyltransferase	NA	H9NC64	Sphingomonas_phage	27.2	4.1e-14
WP_099476641.1|642970_643501_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_099476642.1|643569_645021_-	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	35.9	1.2e-39
WP_007130017.1|645020_645716_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	33.9	4.3e-32
WP_099476643.1|645719_647048_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077565600.1|647102_647822_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	30.5	2.8e-18
>prophage 46
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	651041	656656	6593819		Streptococcus_phage(33.33%)	4	NA	NA
WP_099476645.1|651041_653318_-	type IA DNA topoisomerase	NA	A0A1X9I6W8	Streptococcus_phage	26.6	6.7e-42
WP_099476646.1|653442_654930_-	glutamate synthase subunit beta	NA	NA	NA	NA	NA
WP_099476647.1|655261_655753_-	dihydrofolate reductase	NA	G3MBI7	Bacillus_virus	40.7	6.0e-33
WP_077565593.1|655861_656656_-	thymidylate synthase	NA	A6M9A2	Geobacillus_virus	74.6	4.7e-120
>prophage 47
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	667148	671098	6593819		Catovirus(50.0%)	3	NA	NA
WP_099480436.1|667148_668225_-	ThiF family adenylyltransferase	NA	A0A1V0SAV8	Catovirus	29.7	1.1e-10
WP_099476653.1|668339_669143_-	aminoglycoside phosphotransferase family protein	NA	NA	NA	NA	NA
WP_099476654.1|669544_671098_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	29.4	6.1e-55
>prophage 48
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	680369	691903	6593819		Megavirus(16.67%)	10	NA	NA
WP_099476661.1|680369_681833_-	serine/threonine protein kinase	NA	K7YID8	Megavirus	25.4	2.1e-12
WP_099476662.1|681990_683055_-	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_099476663.1|683060_683834_-	ATP-binding cassette domain-containing protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	28.7	5.4e-12
WP_077565571.1|683830_684178_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_099476664.1|684174_684516_-	cell division protein FtsJ	NA	A0A292GK84	Xanthomonas_phage	34.1	8.8e-07
WP_099476665.1|684534_685383_-	deoxyribonuclease IV	NA	A0A1V0SID1	Klosneuvirus	28.2	1.3e-22
WP_099476666.1|685372_686191_-	DNA-formamidopyrimidine glycosylase	NA	G3MA33	Bacillus_virus	29.3	2.9e-11
WP_077565567.1|686244_687033_-	TIGR01457 family HAD-type hydrolase	NA	NA	NA	NA	NA
WP_077565566.1|687447_688377_-	ribonuclease Z	NA	NA	NA	NA	NA
WP_099476667.1|688462_691903_-	methionine synthase	NA	A0A140XBC7	Dickeya_phage	46.7	1.7e-09
>prophage 49
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	695903	696530	6593819		Phage_Wrath(100.0%)	1	NA	NA
WP_007129967.1|695903_696530_+	transcriptional repressor LexA	NA	A0A1B2APZ1	Phage_Wrath	60.9	1.9e-15
>prophage 50
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	700033	771007	6593819	capsid,protease,terminase,coat,head,portal,tRNA,holin,integrase,tail	Paenibacillus_phage(36.17%)	77	701462:701521	743020:743112
WP_077568926.1|700033_700456_+	hypothetical protein	NA	A0A0K2CZD8	Paenibacillus_phage	38.1	2.6e-24
WP_099476675.1|700585_700792_-	hypothetical protein	NA	A0A2I7SCV7	Paenibacillus_phage	41.4	5.7e-09
701462:701521	attL	AAAAAATCCCCCACGCCATACGGCGCAAGGGATTCCTCTATTAATACATGGTGATGTACT	NA	NA	NA	NA
WP_099476676.1|701806_702217_+	hypothetical protein	NA	A0A0N9SIM5	Paenibacillus_phage	41.7	1.4e-22
WP_099480440.1|702312_702930_-	N-acetylmuramoyl-L-alanine amidase	NA	D6QWL7	uncultured_phage	39.9	8.7e-29
WP_099476677.1|702989_703259_-|holin	phage holin family protein	holin	A0A249XXG8	Clostridium_phage	37.5	1.8e-07
WP_099476678.1|703277_703526_-	hemolysin XhlA family protein	NA	A0A0A7RWP8	Clostridium_phage	41.0	1.4e-06
WP_099476680.1|703789_704326_-	hypothetical protein	NA	R9TPZ8	Paenibacillus_phage	41.9	1.1e-22
WP_099476681.1|704397_705873_-|tail	phage tail protein	tail	R9TMD0	Paenibacillus_phage	41.8	1.8e-27
WP_099476682.1|705894_706959_-	acyltransferase family protein	NA	NA	NA	NA	NA
WP_157929263.1|707026_708901_-	hypothetical protein	NA	R9TQH9	Paenibacillus_phage	30.1	8.0e-25
WP_099476684.1|708915_709728_-|tail	phage tail family protein	tail	A0A290FZP5	Caldibacillus_phage	35.4	4.3e-36
WP_099476685.1|709724_714416_-|tail	phage tail tape measure protein	tail	A0A059T5F4	Listeria_phage	54.7	3.2e-107
WP_099480442.1|714609_714921_-	hypothetical protein	NA	A0A288WGA9	Bacillus_phage	32.3	7.3e-08
WP_099476687.1|714970_715543_-|tail	phage tail protein	tail	A0A1G5SA63	Enterococcus_phage	40.1	3.6e-29
WP_099476688.1|715544_715910_-	DUF3168 domain-containing protein	NA	A0A2H4JAR3	uncultured_Caudovirales_phage	52.6	5.7e-28
WP_099476689.1|716067_716460_-	HK97 gp10 family phage protein	NA	Q9ZXF1	Bacillus_phage	46.1	2.7e-15
WP_099476690.1|716452_716794_-|head	phage head closure protein	head	NA	NA	NA	NA
WP_099480444.1|716790_716997_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099476691.1|717424_717724_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2I7SBZ6	Paenibacillus_phage	65.1	2.8e-25
WP_099476692.1|717704_717911_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099476693.1|717966_719154_-|capsid	phage major capsid protein	capsid	A0A2I7SBY4	Paenibacillus_phage	64.3	4.9e-137
WP_099476694.1|719192_719825_-|head,protease	HK97 family phage prohead protease	head,protease	A0A288WFQ5	Bacillus_phage	71.6	1.0e-77
WP_099480446.1|719742_721062_-|portal	phage portal protein	portal	A0A2I7SBY0	Paenibacillus_phage	76.8	4.0e-188
WP_099476695.1|721112_722834_-|terminase	terminase large subunit	terminase	A6M948	Geobacillus_virus	72.4	3.2e-254
WP_099476696.1|722830_723337_-|terminase	phage terminase small subunit P27 family	terminase	Q9ZXG2	Bacillus_phage	58.8	2.0e-47
WP_099476697.1|723667_724024_-	HNH endonuclease	NA	A0A1U7Q1S7	Geobacillus_virus	50.8	6.5e-29
WP_099476699.1|724456_724885_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099476700.1|725203_726070_-	ATP-dependent DNA ligase	NA	NA	NA	NA	NA
WP_099476701.1|726150_727338_-	DUF3800 domain-containing protein	NA	NA	NA	NA	NA
WP_099476702.1|727396_727876_-	RNA polymerase subunit sigma-24	NA	R9TMH4	Paenibacillus_phage	56.5	2.4e-42
WP_157929264.1|728113_728275_-	hypothetical protein	NA	A0A2I7RHL2	Vibrio_phage	56.0	2.0e-06
WP_099476704.1|728271_728682_-	hypothetical protein	NA	R9TQK5	Paenibacillus_phage	46.6	5.8e-21
WP_099476705.1|728678_729119_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099476706.1|729366_729939_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099476707.1|730165_730948_-	hypothetical protein	NA	A0A0E3T7R2	Bacillus_phage	53.4	4.3e-81
WP_099476708.1|730970_731279_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099476709.1|731281_731485_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099476710.1|731528_731795_-	hypothetical protein	NA	R9TNJ5	Paenibacillus_phage	71.0	2.0e-22
WP_099476711.1|731796_732093_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157929265.1|732124_732286_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099476712.1|732315_732813_-	deoxyuridine 5'-triphosphate nucleotidohydrolase	NA	D2XR49	Bacillus_phage	56.4	2.9e-43
WP_099476713.1|732897_733422_-	crossover junction endodeoxyribonuclease RuvC	NA	A0A0C5AFB5	Paenibacillus_phage	41.7	5.3e-35
WP_157929266.1|733555_733813_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157929267.1|733942_734737_-	ATP-binding protein	NA	A0A1B1P7U2	Bacillus_phage	33.5	1.4e-31
WP_099476716.1|734723_735608_-	DUF4373 domain-containing protein	NA	A0A0H4TKJ7	Bacillus_phage	27.7	1.0e-14
WP_099476717.1|735611_736025_-	hypothetical protein	NA	A0A0A0RNS8	Bacillus_phage	45.6	1.8e-17
WP_099476718.1|736036_736462_-	single-stranded DNA-binding protein	NA	A0A0K2CYR2	Paenibacillus_phage	69.9	1.2e-48
WP_099476719.1|736478_737282_-	PD-(D/E)XK nuclease-like domain-containing protein	NA	A0A290GJV0	Caldibacillus_phage	47.5	1.7e-56
WP_099476720.1|737244_738135_-	hypothetical protein	NA	A0A0A7S0A9	Clostridium_phage	59.9	5.0e-86
WP_157929268.1|738197_738389_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157929269.1|738748_738916_-	hypothetical protein	NA	R9TLP9	Paenibacillus_phage	91.8	5.4e-18
WP_099476723.1|739063_739363_-	hypothetical protein	NA	R9TQ15	Paenibacillus_phage	75.9	6.5e-30
WP_099476724.1|739387_740146_-	ORF6N domain-containing protein	NA	A0A2I7SCV5	Paenibacillus_phage	57.8	1.8e-76
WP_099480448.1|740159_740429_-	DUF771 domain-containing protein	NA	A0A1B1P7U4	Bacillus_phage	57.0	1.1e-25
WP_099480450.1|740917_741253_+	helix-turn-helix transcriptional regulator	NA	A6M973	Geobacillus_virus	46.9	3.0e-15
WP_099480452.1|741403_741751_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A0A7RTX7	Clostridium_phage	47.7	4.6e-27
WP_099476726.1|741837_742992_+|integrase	site-specific integrase	integrase	A0A0S2SXP1	Bacillus_phage	70.5	4.0e-67
WP_077565554.1|743059_744388_-	type I glutamate--ammonia ligase	NA	NA	NA	NA	NA
743020:743112	attR	AAAAAATCCCCCACGCCATACGGCGCAAGGGATTCCTCTATTAATACATGGTGATGTACTGATCGCGTTCCCATTGGTGAACTTGCGTGCGGT	NA	NA	NA	NA
WP_007129961.1|744438_744849_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_099476727.1|744931_746185_-	methionine gamma-lyase family protein	NA	NA	NA	NA	NA
WP_099476728.1|746629_747916_-	GTPase HflX	NA	NA	NA	NA	NA
WP_099476729.1|749304_750909_+	hypothetical protein	NA	A0A1L2JXK8	Streptococcus_phage	34.7	2.7e-05
WP_099476730.1|751301_752786_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099480453.1|753297_754230_-	AAA family ATPase	NA	G3MAX6	Bacillus_virus	43.5	2.8e-55
WP_099476731.1|754837_755497_-	YdcF family protein	NA	NA	NA	NA	NA
WP_077565549.1|755496_756054_-	DUF402 domain-containing protein	NA	NA	NA	NA	NA
WP_099476732.1|756154_758854_-	PBP1A family penicillin-binding protein	NA	NA	NA	NA	NA
WP_077565547.1|759117_759357_-	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_099476733.1|759411_760359_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_077565545.1|760348_761128_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_099476734.1|761145_763125_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	31.2	7.0e-64
WP_077565543.1|763311_766116_-	DNA mismatch repair protein MutS	NA	A0A1V0SJ67	Klosneuvirus	23.3	2.2e-31
WP_099476735.1|766175_767480_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077565541.1|767588_768155_-|coat	outer spore coat protein CotE	coat	NA	NA	NA	NA
WP_099476736.1|768284_769265_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099476737.1|769388_770267_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_077565538.1|770233_771007_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	35.8	9.2e-36
>prophage 51
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	794841	802500	6593819		Hokovirus(33.33%)	3	NA	NA
WP_099476756.1|794841_797871_+	PAS domain S-box protein	NA	A0A1V0SGX0	Hokovirus	31.2	3.4e-49
WP_099476757.1|797930_799730_-	oligoendopeptidase F	NA	A0A1X9I5X5	Streptococcus_phage	39.4	2.4e-119
WP_099476758.1|800331_802500_+	DNA mismatch repair protein MutS	NA	F2QAG1	Chrysochromulina_ericina_virus	28.7	6.6e-15
>prophage 52
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	807840	820793	6593819	protease	Bacillus_phage(50.0%)	9	NA	NA
WP_099476761.1|807840_810300_-	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	34.2	7.8e-105
WP_077565502.1|810311_812291_-	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	44.2	6.5e-134
WP_077565501.1|812523_813513_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_099476762.1|813505_814474_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	37.9	7.2e-38
WP_099476763.1|814522_815419_-	lysophospholipase	NA	NA	NA	NA	NA
WP_099476764.1|815567_816317_-|protease	serine protease	protease	U5Q1E2	Bacillus_phage	56.4	5.2e-36
WP_007129902.1|816548_817010_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_099476765.1|817152_819018_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	33.0	1.3e-64
WP_077565496.1|819014_820793_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.7	1.3e-53
>prophage 53
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	830482	834333	6593819		uncultured_Caudovirales_phage(50.0%)	3	NA	NA
WP_099476768.1|830482_831862_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A2H4JCM7	uncultured_Caudovirales_phage	45.4	1.4e-31
WP_099476769.1|832064_832778_-	GerMN domain-containing protein	NA	NA	NA	NA	NA
WP_099476770.1|832905_834333_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A067ZJB6	Vibrio_phage	39.8	1.5e-23
>prophage 54
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	838250	843309	6593819		Streptococcus_phage(66.67%)	4	NA	NA
WP_099476774.1|838250_839063_-	carbon-nitrogen family hydrolase	NA	A7K8C9	Acanthocystis_turfacea_chlorella_virus	28.5	1.6e-14
WP_099476775.1|839342_840533_+	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_099476776.1|840909_842013_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	46.8	1.9e-82
WP_077565481.1|842061_843309_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	51.4	2.1e-106
>prophage 55
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	855639	861494	6593819	tRNA	Bacillus_phage(33.33%)	5	NA	NA
WP_099476785.1|855639_856386_-	DnaD domain-containing protein	NA	A0A0N7AE27	Bacillus_phage	52.2	1.7e-18
WP_077565467.1|856404_857700_-|tRNA	asparagine--tRNA ligase	tRNA	L7RCX2	Acanthamoeba_polyphaga_moumouvirus	31.4	6.9e-60
WP_077565466.1|857729_858938_-	acetate kinase	NA	NA	NA	NA	NA
WP_077565465.1|858934_859807_-	NAD-binding protein	NA	NA	NA	NA	NA
WP_007129866.1|859991_861494_-	AAA family ATPase	NA	E5EQU5	Bathycoccus_sp._RCC1105_virus	44.1	2.2e-78
>prophage 56
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	864831	867699	6593819		Bacillus_phage(100.0%)	1	NA	NA
WP_099480459.1|864831_867699_-	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	32.3	6.6e-87
>prophage 57
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	872089	873388	6593819	tRNA	unidentified_phage(100.0%)	1	NA	NA
WP_099476791.1|872089_873388_-|tRNA	CCA tRNA nucleotidyltransferase	tRNA	H7BUW3	unidentified_phage	32.3	4.1e-44
>prophage 58
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	877745	878615	6593819		Streptococcus_phage(100.0%)	1	NA	NA
WP_099476794.1|877745_878615_+	YitT family protein	NA	M1Q1P6	Streptococcus_phage	47.0	1.2e-60
>prophage 59
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	888714	894413	6593819		Acinetobacter_phage(66.67%)	6	NA	NA
WP_099476799.1|888714_889812_-	histidinol-phosphate transaminase	NA	A0A1X6WGT4	Pacmanvirus	26.7	1.7e-19
WP_077565439.1|889866_890694_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_099476800.1|890690_891890_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_099476801.1|891886_892561_-	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
WP_099476802.1|892576_893383_-	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	45.7	3.1e-50
WP_099476803.1|893372_894413_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	39.9	3.6e-67
>prophage 60
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	897835	900555	6593819		Pandoravirus(50.0%)	3	NA	NA
WP_077565432.1|897835_899005_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	34.4	5.3e-43
WP_099476805.1|899256_900057_-	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_077568921.1|900111_900555_-	nucleoside-diphosphate kinase	NA	D2E8E1	Anguillid_herpesvirus	42.8	1.6e-24
>prophage 61
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	906445	908581	6593819	transposase	Streptococcus_phage(50.0%)	3	NA	NA
WP_099476806.1|906445_907805_+|transposase	IS1182 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	41.2	6.3e-88
WP_077565424.1|907998_908223_-	trp RNA-binding attenuation protein MtrB	NA	NA	NA	NA	NA
WP_007129815.1|908308_908581_-	HU family DNA-binding protein	NA	A7KV42	Bacillus_phage	71.1	1.9e-28
>prophage 62
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	927951	931787	6593819		Bacillus_phage(66.67%)	3	NA	NA
WP_077565406.1|927951_929544_+	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	33.1	4.8e-47
WP_099476814.1|929638_931069_-	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	35.1	9.7e-31
WP_077565405.1|931070_931787_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	44.4	2.1e-50
>prophage 63
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	938089	947904	6593819		Staphylococcus_phage(50.0%)	12	NA	NA
WP_099476816.1|938089_939271_-	D-alanyl-D-alanine carboxypeptidase	NA	A0A1P8VVG5	Erythrobacter_phage	33.7	2.0e-10
WP_099476817.1|939387_939837_-	GerW family sporulation protein	NA	NA	NA	NA	NA
WP_077565396.1|939809_940499_-	DUF2953 domain-containing protein	NA	NA	NA	NA	NA
WP_099476818.1|940763_941366_-	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	30.4	1.2e-14
WP_077565394.1|941334_942126_-	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	32.0	4.9e-08
WP_007129777.1|942195_942663_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	61.6	2.7e-46
WP_157929272.1|942993_943185_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077565393.1|943212_944454_-	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	53.8	7.4e-120
WP_077565392.1|944504_945170_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	40.9	1.0e-38
WP_077565391.1|945197_946301_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	39.8	8.5e-59
WP_099480465.1|946925_947330_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_007129770.1|947472_947904_-	peptidylprolyl isomerase	NA	A0A1B1IVS0	uncultured_Mediterranean_phage	42.8	1.4e-20
>prophage 64
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	952573	957384	6593819		Bacillus_phage(33.33%)	6	NA	NA
WP_077565385.1|952573_953329_-	RNA polymerase sporulation sigma factor SigF	NA	A0A0Y0AU18	Bacillus_phage	57.0	1.4e-65
WP_077565384.1|953340_953799_-	anti-sigma F factor	NA	NA	NA	NA	NA
WP_007129763.1|953795_954149_-	anti-sigma F factor antagonist	NA	NA	NA	NA	NA
WP_099476822.1|954240_955428_-	D-alanyl-D-alanine carboxypeptidase	NA	NA	NA	NA	NA
WP_077565382.1|955609_956434_-	purine-nucleoside phosphorylase	NA	Q5YBA4	Grouper_iridovirus	44.9	7.0e-66
WP_099476823.1|956499_957384_-	site-specific tyrosine recombinase XerD	NA	A0A1B1IQT7	uncultured_Mediterranean_phage	26.6	6.9e-19
>prophage 65
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	968498	969920	6593819		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_099476830.1|968498_969920_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	29.6	3.0e-48
>prophage 66
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	987042	989272	6593819		Gordonia_phage(50.0%)	2	NA	NA
WP_099476842.1|987042_988410_-	exodeoxyribonuclease VII large subunit	NA	A0A1B3AYB4	Gordonia_phage	31.7	2.7e-30
WP_077565352.1|988411_989272_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	42.0	2.3e-43
>prophage 67
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	1005661	1006588	6593819		Klosneuvirus(100.0%)	1	NA	NA
WP_077565333.1|1005661_1006588_-	patatin-like phospholipase family protein	NA	A0A1V0SKV5	Klosneuvirus	27.8	1.0e-20
>prophage 68
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	1010596	1015529	6593819	tRNA	Bacillus_virus(33.33%)	5	NA	NA
WP_077565329.1|1010596_1011346_-	metal ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	27.9	1.9e-17
WP_099476847.1|1011450_1012542_-	zinc ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_099476848.1|1012737_1014726_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SHR2	Klosneuvirus	36.6	8.0e-92
WP_157929273.1|1014865_1015015_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077565326.1|1015277_1015529_-	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	56.3	6.2e-18
>prophage 69
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	1021784	1023644	6593819		Enterobacteria_phage(100.0%)	1	NA	NA
WP_077565322.1|1021784_1023644_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	30.7	2.8e-22
>prophage 70
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	1027032	1030185	6593819		Citrobacter_phage(50.0%)	2	NA	NA
WP_099476853.1|1027032_1027752_-	pyruvate formate lyase-activating protein	NA	A0A2H4YFL4	Citrobacter_phage	39.0	1.5e-11
WP_099476854.1|1027938_1030185_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	45.3	6.7e-188
>prophage 71
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	1061303	1066681	6593819		Tupanvirus(33.33%)	4	NA	NA
WP_099476871.1|1061303_1062758_-	polysaccharide deacetylase family protein	NA	A0A2K9LAZ4	Tupanvirus	27.3	2.9e-06
WP_167392958.1|1063389_1064298_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077568914.1|1064317_1065679_-	nucleotide sugar dehydrogenase	NA	M1HEP0	Acanthocystis_turfacea_Chlorella_virus	30.9	6.4e-40
WP_099476873.1|1065886_1066681_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	31.6	7.3e-12
>prophage 72
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	1094920	1117382	6593819		Klosneuvirus(22.22%)	20	NA	NA
WP_099476893.1|1094920_1096402_-	sugar ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	29.3	9.7e-18
WP_077565254.1|1096417_1096816_-	D-ribose pyranase	NA	NA	NA	NA	NA
WP_099476894.1|1096812_1097697_-	ribokinase	NA	NA	NA	NA	NA
WP_077565250.1|1097696_1098680_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_099476895.1|1099352_1100261_+	arginase	NA	A0A1V0SJM8	Klosneuvirus	31.3	5.8e-21
WP_099476896.1|1100355_1101558_+	ornithine--oxo-acid transaminase	NA	A0A1V0SKB7	Klosneuvirus	26.5	4.9e-28
WP_099476897.1|1101768_1102689_+	TIGR01777 family protein	NA	NA	NA	NA	NA
WP_099476899.1|1102818_1104303_+	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	22.3	2.0e-18
WP_007129672.1|1104441_1104630_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099476900.1|1104961_1106728_-	dihydroxyacetone kinase subunit DhaK	NA	NA	NA	NA	NA
WP_099476901.1|1106889_1108383_-	arylsulfatase	NA	A0A2K9L1A5	Tupanvirus	26.6	2.1e-20
WP_099476902.1|1108824_1109415_-	YdhK family protein	NA	NA	NA	NA	NA
WP_077565234.1|1109570_1109909_-	YolD-like family protein	NA	NA	NA	NA	NA
WP_077565232.1|1109905_1111177_-	DNA polymerase IV	NA	O64031	Bacillus_phage	36.3	3.1e-57
WP_077565230.1|1111173_1111557_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077565228.1|1111773_1113075_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	33.9	3.4e-51
WP_077565226.1|1113205_1113916_+	SOS response-associated peptidase	NA	A0A1P8CX02	Bacillus_phage	50.0	4.2e-35
WP_077565224.1|1114025_1114313_-	stage VI sporulation protein F	NA	NA	NA	NA	NA
WP_077565223.1|1114454_1116506_-	ATP-dependent DNA helicase RecG	NA	NA	NA	NA	NA
WP_099476903.1|1116524_1117382_-	DegV family protein	NA	A0A0N9SI50	Staphylococcus_phage	45.2	6.0e-20
>prophage 73
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	1122224	1124411	6593819		Salmon_gill_poxvirus(100.0%)	1	NA	NA
WP_099476906.1|1122224_1124411_-	Stk1 family PASTA domain-containing Ser/Thr kinase	NA	A0A0H4Y184	Salmon_gill_poxvirus	32.8	3.5e-24
>prophage 74
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	1127750	1133997	6593819	tRNA	Synechococcus_phage(50.0%)	6	NA	NA
WP_099476909.1|1127750_1128692_-|tRNA	methionyl-tRNA formyltransferase	tRNA	M4QRX9	Synechococcus_phage	33.6	1.0e-12
WP_077565204.1|1128688_1129183_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	47.1	1.6e-20
WP_077565203.1|1129226_1131755_-	primosomal protein N'	NA	NA	NA	NA	NA
WP_099476910.1|1131754_1133038_-	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	34.1	2.0e-43
WP_007129648.1|1133164_1133365_-	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_077565199.1|1133424_1133997_-	guanylate kinase	NA	A0A143DIC6	Abalone_herpesvirus	32.6	6.6e-23
>prophage 75
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	1138233	1141023	6593819		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_099476913.1|1138233_1141023_-	calcium-translocating P-type ATPase, SERCA-type	NA	M1HX51	Paramecium_bursaria_Chlorella_virus	29.5	4.6e-85
>prophage 76
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	1148495	1150316	6593819		Acidianus_filamentous_virus(100.0%)	1	NA	NA
WP_099476916.1|1148495_1150316_-	DEAD/DEAH box helicase	NA	B2CRJ8	Acidianus_filamentous_virus	21.5	4.3e-15
>prophage 77
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	1158970	1160947	6593819		Bacillus_phage(100.0%)	1	NA	NA
WP_099476919.1|1158970_1160947_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	35.4	3.4e-18
>prophage 78
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	1166168	1167893	6593819		Staphylococcus_phage(100.0%)	1	NA	NA
WP_099476922.1|1166168_1167893_-	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	69.7	5.0e-199
>prophage 79
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	1172817	1176461	6593819		Hokovirus(50.0%)	2	NA	NA
WP_077565159.1|1172817_1174581_-	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	28.4	3.2e-15
WP_007129613.1|1174577_1176461_-	PTS transporter subunit EIIC	NA	A0A2I7SAJ6	Vibrio_phage	44.3	4.6e-12
>prophage 80
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	1180138	1181560	6593819		Synechococcus_phage(100.0%)	1	NA	NA
WP_007129607.1|1180138_1181560_-	NADP-dependent phosphogluconate dehydrogenase	NA	A0A222YX62	Synechococcus_phage	31.4	7.1e-34
>prophage 81
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	1187438	1188566	6593819		Bacillus_phage(50.0%)	2	NA	NA
WP_077565141.1|1187438_1188176_+	ribonuclease Z	NA	A0A0A0RUN7	Bacillus_phage	39.2	5.1e-44
WP_077568907.1|1188332_1188566_+	DUF3892 domain-containing protein	NA	G3MB34	Bacillus_virus	44.3	2.4e-08
>prophage 82
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	1192590	1193151	6593819		Paenibacillus_phage(100.0%)	1	NA	NA
WP_099476939.1|1192590_1193151_-	accessory gene regulator B family protein	NA	A0A0K2CZ30	Paenibacillus_phage	35.1	1.4e-14
>prophage 83
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	1222371	1224364	6593819		Equid_gammaherpesvirus(50.0%)	2	NA	NA
WP_077568905.1|1222371_1223058_-	uracil-DNA glycosylase	NA	A0A0B4Q626	Equid_gammaherpesvirus	52.5	5.8e-50
WP_099476959.1|1223482_1224364_-	glycoside hydrolase family 25 protein	NA	D0R7H8	Paenibacillus_phage	50.9	7.0e-56
>prophage 84
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	1234441	1235083	6593819		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_099476972.1|1234441_1235083_-	orotate phosphoribosyltransferase	NA	Q58MW1	Prochlorococcus_phage	28.7	9.7e-07
>prophage 85
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	1239043	1253768	6593819	tRNA	Bodo_saltans_virus(40.0%)	12	NA	NA
WP_077565071.1|1239043_1240180_-	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	37.4	4.8e-57
WP_099476976.1|1240240_1241539_-	dihydroorotase	NA	NA	NA	NA	NA
WP_167392960.1|1241662_1242577_-	aspartate carbamoyltransferase catalytic subunit	NA	A0A1J0F9B8	Only_Syngen_Nebraska_virus	38.8	9.5e-32
WP_099476978.1|1242578_1243139_-	bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR	NA	NA	NA	NA	NA
WP_077565066.1|1243474_1244728_-	LL-diaminopimelate aminotransferase	NA	NA	NA	NA	NA
WP_099476980.1|1244855_1246820_-	ATP-binding cassette domain-containing protein	NA	A0A2H4UUX5	Bodo_saltans_virus	26.9	3.2e-48
WP_167392961.1|1246972_1247125_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099476981.1|1247367_1248336_-	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	27.8	6.4e-10
WP_099476983.1|1248335_1248836_-	signal peptidase II	NA	NA	NA	NA	NA
WP_077565060.1|1249056_1249797_+	TraR/DksA C4-type zinc finger protein	NA	NA	NA	NA	NA
WP_077565058.1|1249935_1250277_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099476985.1|1250678_1253768_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A2I2L3Y0	Orpheovirus	34.2	1.9e-156
>prophage 86
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	1258645	1260228	6593819		Bacillus_phage(50.0%)	2	NA	NA
WP_007129476.1|1258645_1259428_-	RNA polymerase sporulation sigma factor SigG	NA	A0A0Y0AU18	Bacillus_phage	42.7	6.4e-45
WP_077565046.1|1259505_1260228_-	RNA polymerase sporulation sigma factor SigE	NA	A0A2H4JC68	uncultured_Caudovirales_phage	42.9	1.7e-20
>prophage 87
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	1281707	1286754	6593819		Pandoravirus(33.33%)	4	NA	NA
WP_077565016.1|1281707_1282976_-	adenosylhomocysteinase	NA	S4W1G4	Pandoravirus	38.2	1.0e-71
WP_099476993.1|1283019_1284651_-	bacillithiol biosynthesis cysteine-adding enzyme BshC	NA	NA	NA	NA	NA
WP_007129455.1|1284823_1285762_-	ATP-binding cassette domain-containing protein	NA	Q6GZ03	Mycoplasma_phage	34.1	2.8e-10
WP_007129454.1|1285758_1286754_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.0	3.2e-17
>prophage 88
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	1296644	1297976	6593819		Vibrio_phage(100.0%)	1	NA	NA
WP_040738501.1|1296644_1297976_-	PhoH family protein	NA	A0A2I7SAD7	Vibrio_phage	34.1	1.7e-61
>prophage 89
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	1303554	1318761	6593819	tRNA	Pseudomonas_phage(25.0%)	14	NA	NA
WP_099477000.1|1303554_1304220_-	TerC family protein	NA	A0A0S4KZH7	Pseudomonas_phage	39.9	2.3e-27
WP_077564988.1|1304350_1305037_+	TerC family protein	NA	W8EBD0	Pseudomonas_phage	36.5	4.2e-24
WP_099477001.1|1305246_1306485_-|tRNA	tRNA 4-thiouridine(8) synthase ThiI	tRNA	NA	NA	NA	NA
WP_099477002.1|1306481_1307642_-	cysteine desulfurase	NA	A0A141ZJV0	Faustovirus	33.0	2.7e-31
WP_099477003.1|1307803_1308499_-	lytic transglycosylase domain-containing protein	NA	A0A0H3V0Q1	Geobacillus_virus	58.3	5.9e-26
WP_099477004.1|1308656_1309019_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007129431.1|1309115_1309340_-	DUF1540 domain-containing protein	NA	NA	NA	NA	NA
WP_007129430.1|1309638_1310145_-	YpuI family protein	NA	NA	NA	NA	NA
WP_077564980.1|1310402_1312328_+	peptidase S8	NA	A0A1B0T6A2	Bacillus_phage	34.7	8.4e-54
WP_099477005.1|1312476_1312755_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077564977.1|1313542_1314658_-	Nif3-like dinuclear metal center hexameric protein	NA	A0A1E1EXH0	Acanthamoeba_castellanii_mimivirus	41.8	9.9e-15
WP_077564975.1|1314633_1315395_-|tRNA	tRNA (adenine(22)-N(1))-methyltransferase TrmK	tRNA	NA	NA	NA	NA
WP_077564973.1|1315771_1316902_-	RNA polymerase sigma factor RpoD	NA	F4YCU2	Synechococcus_phage	37.6	2.2e-38
WP_077564971.1|1316943_1318761_-	DNA primase	NA	A0A1S5REW9	Helicobacter_phage	33.1	4.8e-43
>prophage 90
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	1328650	1329622	6593819		Pseudomonas_phage(100.0%)	1	NA	NA
WP_077564957.1|1328650_1329622_-	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	46.7	8.5e-47
>prophage 91
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	1334707	1345183	6593819		Xanthomonas_phage(33.33%)	6	NA	NA
WP_007129405.1|1334707_1335148_-	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	34.9	1.2e-16
WP_005547957.1|1335164_1335338_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_099477014.1|1335518_1335878_-	histidine triad nucleotide-binding protein	NA	NA	NA	NA	NA
WP_099477015.1|1336185_1339638_-	AAA family ATPase	NA	A0A0E3FDE1	Synechococcus_phage	29.0	2.3e-09
WP_099477016.1|1339634_1340816_-	exonuclease SbcCD subunit D	NA	NA	NA	NA	NA
WP_167393009.1|1340986_1345183_-	helicase-exonuclease AddAB subunit AddA	NA	A0A068EQC7	Bacillus_phage	28.9	5.8e-07
>prophage 92
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	1349014	1351926	6593819		Streptococcus_phage(50.0%)	3	NA	NA
WP_099477019.1|1349014_1350388_-	class I SAM-dependent rRNA methyltransferase	NA	W6LLI2	Streptococcus_phage	21.5	1.4e-18
WP_099477020.1|1350506_1351481_+	Na/Pi cotransporter family protein	NA	NA	NA	NA	NA
WP_077564940.1|1351470_1351926_-	NUDIX domain-containing protein	NA	A0A1S5R1B7	Pseudomonas_phage	31.6	4.9e-05
>prophage 93
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	1357021	1362423	6593819		Catovirus(33.33%)	4	NA	NA
WP_007129390.1|1357021_1358140_-	molecular chaperone DnaJ	NA	A0A1V0SBY2	Catovirus	31.9	3.2e-29
WP_077564931.1|1358234_1360073_-	molecular chaperone DnaK	NA	G8DDB7	Micromonas_pusilla_virus	48.5	7.5e-145
WP_099477025.1|1360163_1360787_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_077564928.1|1360887_1362423_-	TCP-1/cpn60 chaperonin family protein	NA	A0A240F7G0	uncultured_virus	24.3	6.7e-30
>prophage 94
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	1365475	1367293	6593819		Streptococcus_phage(100.0%)	1	NA	NA
WP_099477027.1|1365475_1367293_-	elongation factor 4	NA	A0A1B0RXH7	Streptococcus_phage	24.2	3.0e-21
>prophage 95
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	1374525	1382055	6593819	tRNA	Clostridium_botulinum_C_phage(33.33%)	5	NA	NA
WP_099477032.1|1374525_1377258_-	ComEC/Rec2 family competence protein	NA	Q332B9	Clostridium_botulinum_C_phage	29.5	1.1e-25
WP_099477033.1|1377388_1377907_-	cytidine/deoxycytidylate deaminase family protein	NA	A0A222YXY3	Mycobacterium_phage	44.4	1.3e-22
WP_099477034.1|1377956_1378613_-	helix-hairpin-helix domain-containing protein	NA	NA	NA	NA	NA
WP_099477035.1|1378790_1379633_+	late competence protein ComER	NA	NA	NA	NA	NA
WP_099477036.1|1379613_1382055_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	73.0	0.0e+00
>prophage 96
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	1412492	1413191	6593819		Bacillus_phage(100.0%)	1	NA	NA
WP_007129338.1|1412492_1413191_-	RNA polymerase sporulation sigma factor SigK	NA	S6ANS0	Bacillus_phage	28.5	8.9e-14
>prophage 97
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	1417714	1418740	6593819		Staphylococcus_phage(100.0%)	1	NA	NA
WP_099477060.1|1417714_1418740_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	33.2	8.8e-26
>prophage 98
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	1455323	1457138	6593819		Enterobacteria_phage(100.0%)	1	NA	NA
WP_099477073.1|1455323_1457138_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	36.1	2.0e-20
>prophage 99
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	1480306	1481056	6593819		Escherichia_phage(100.0%)	1	NA	NA
WP_077569146.1|1480306_1481056_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	32.6	1.4e-17
>prophage 100
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	1492557	1494078	6593819		Orpheovirus(100.0%)	1	NA	NA
WP_007129278.1|1492557_1494078_-	flotillin family protein	NA	A0A2I2L4B2	Orpheovirus	25.7	1.4e-06
>prophage 101
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	1497958	1498948	6593819		Tupanvirus(100.0%)	1	NA	NA
WP_077569155.1|1497958_1498948_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	39.0	6.6e-55
>prophage 102
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	1502445	1503204	6593819		Bacillus_phage(100.0%)	1	NA	NA
WP_099477092.1|1502445_1503204_-	NAD-dependent protein deacylase	NA	A0A068EPD4	Bacillus_phage	32.8	4.8e-29
>prophage 103
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	1511582	1525290	6593819	tRNA	Phage_TP(40.0%)	13	NA	NA
WP_099477097.1|1511582_1513769_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	38.3	2.1e-13
WP_077569167.1|1513995_1515339_-	U32 family peptidase	NA	Q6DW11	Phage_TP	33.2	2.9e-45
WP_077569168.1|1515351_1516284_-	U32 family peptidase	NA	Q6DW11	Phage_TP	29.1	2.9e-20
WP_099477098.1|1516297_1517344_-	endolytic transglycosylase MltG	NA	NA	NA	NA	NA
WP_077569170.1|1517449_1517761_-	DUF1292 domain-containing protein	NA	NA	NA	NA	NA
WP_007129258.1|1517760_1518063_-	DUF1292 domain-containing protein	NA	NA	NA	NA	NA
WP_077569171.1|1518075_1518489_-	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_007129256.1|1518500_1518761_-	IreB family regulatory phosphoprotein	NA	NA	NA	NA	NA
WP_099480502.1|1518962_1521590_-|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	35.0	1.8e-67
WP_077569172.1|1522020_1523088_-	AI-2E family transporter	NA	NA	NA	NA	NA
WP_007129253.1|1523258_1523468_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077569173.1|1523479_1524001_-	PRC-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_099477099.1|1524144_1525290_-	cysteine desulfurase	NA	A0A1X6WFP1	Pacmanvirus	29.4	2.3e-43
>prophage 104
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	1529142	1537604	6593819		Vibrio_phage(25.0%)	7	NA	NA
WP_099477102.1|1529142_1529643_-	anaerobic ribonucleoside-triphosphate reductase activating protein	NA	A0A2D0YYZ1	Vibrio_phage	41.7	4.1e-29
WP_099477103.1|1529639_1531865_-	anaerobic ribonucleoside triphosphate reductase	NA	A0A0A8WEK0	Clostridium_phage	39.0	4.4e-147
WP_099477104.1|1532210_1532747_-	PCYCGC domain-containing protein	NA	NA	NA	NA	NA
WP_099477105.1|1532830_1534138_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	49.4	3.5e-104
WP_157929275.1|1534379_1534538_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099477106.1|1534631_1534907_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099477107.1|1535432_1537604_-	UvrD-helicase domain-containing protein	NA	A0A1V0SG90	Hokovirus	23.8	6.0e-08
>prophage 105
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	1542924	1553621	6593819	tRNA	Yellowstone_lake_phycodnavirus(16.67%)	9	NA	NA
WP_077569188.1|1542924_1543431_-	type 1 glutamine amidotransferase	NA	A0A0N7KVR4	Yellowstone_lake_phycodnavirus	35.0	1.8e-16
WP_157929276.1|1543647_1543815_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099477110.1|1543922_1544369_-|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_077569190.1|1544484_1546665_-	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	J9Q7H7	Salmonella_phage	40.0	4.5e-11
WP_099477111.1|1546999_1548301_+	uracil permease	NA	Q9KX94	Enterobacteria_phage	38.4	2.9e-66
WP_007133175.1|1548630_1549146_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	41.2	4.3e-29
WP_077569192.1|1549172_1551572_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	33.7	3.8e-88
WP_099477112.1|1551632_1552601_-	cation diffusion facilitator family transporter	NA	NA	NA	NA	NA
WP_077569194.1|1552700_1553621_-	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	31.8	1.3e-28
>prophage 106
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	1559144	1564487	6593819	tRNA	uncultured_Mediterranean_phage(33.33%)	4	NA	NA
WP_099477114.1|1559144_1560284_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	46.4	6.2e-89
WP_099477115.1|1560301_1561333_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_099477116.1|1561339_1563421_-	SpoIID/LytB domain-containing protein	NA	Q2XU88	Pseudomonas_phage	30.9	3.4e-08
WP_099477117.1|1563479_1564487_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	30.1	1.2e-06
>prophage 107
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	1573863	1575552	6593819		Bacillus_amyloliquefaciens_phage(100.0%)	1	NA	NA
WP_099477119.1|1573863_1575552_-	LysM peptidoglycan-binding domain-containing protein	NA	Q94ML9	Bacillus_amyloliquefaciens_phage	30.1	5.2e-07
>prophage 108
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	1603398	1609226	6593819	tRNA	Klosneuvirus(50.0%)	3	NA	NA
WP_099477132.1|1603398_1606068_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	41.9	4.6e-167
WP_099477133.1|1606689_1608084_-	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_099477134.1|1608320_1609226_-	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	29.9	2.8e-07
>prophage 109
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	1617552	1628118	6593819	protease	Moraxella_phage(40.0%)	8	NA	NA
WP_007130744.1|1617552_1617951_-	adenosylmethionine decarboxylase	NA	A0A222YVV4	Synechococcus_phage	37.9	6.9e-19
WP_099477138.1|1618258_1618849_-	non-ribosomal peptide synthetase module	NA	NA	NA	NA	NA
WP_099477139.1|1619064_1619760_-	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_099477140.1|1619778_1622115_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	44.0	3.6e-176
WP_099477141.1|1622199_1623930_-|protease	ATP-dependent protease LonB	protease	A0A0R6PGP8	Moraxella_phage	39.1	9.3e-20
WP_007130749.1|1625019_1626129_-	flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase	NA	NA	NA	NA	NA
WP_007130750.1|1626244_1627513_-|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	66.3	2.4e-150
WP_007130751.1|1627527_1628118_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	56.0	1.2e-54
>prophage 110
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	1638637	1649950	6593819		uncultured_Caudovirales_phage(25.0%)	10	NA	NA
WP_077569251.1|1638637_1638934_+	DUF4870 domain-containing protein	NA	A0A2H4JDX0	uncultured_Caudovirales_phage	37.9	1.1e-05
WP_099477147.1|1639014_1640496_-	copper amine oxidase	NA	NA	NA	NA	NA
WP_028406789.1|1640856_1641222_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077569254.1|1641281_1641593_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099477148.1|1641757_1643602_+	asparagine synthase (glutamine-hydrolyzing)	NA	L7RC73	Acanthamoeba_polyphaga_moumouvirus	26.0	7.8e-33
WP_099477149.1|1643670_1644303_-	XTP/dITP diphosphatase	NA	NA	NA	NA	NA
WP_077569257.1|1644307_1645066_-	ribonuclease PH	NA	NA	NA	NA	NA
WP_077569258.1|1645190_1646246_-	GerMN domain-containing protein	NA	NA	NA	NA	NA
WP_077569259.1|1646503_1647067_+	phosphatidylglycerophosphatase A	NA	G3MBC5	Bacillus_virus	51.6	2.0e-40
WP_099477150.1|1647517_1649950_-	glycogen/starch/alpha-glucan phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	39.1	4.2e-10
>prophage 111
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	1664570	1665707	6593819		Synechococcus_phage(100.0%)	1	NA	NA
WP_099477160.1|1664570_1665707_-	glutathione-dependent formaldehyde dehydrogenase	NA	E3SJ82	Synechococcus_phage	25.7	5.4e-16
>prophage 112
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	1668740	1668974	6593819		Caldibacillus_phage(100.0%)	1	NA	NA
WP_085978413.1|1668740_1668974_-	response regulator transcription factor	NA	A0A290GJH9	Caldibacillus_phage	65.6	4.3e-13
>prophage 113
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	1674334	1677229	6593819		Powai_lake_megavirus(33.33%)	3	NA	NA
WP_077569286.1|1674334_1675162_-	SDR family oxidoreductase	NA	A0A167RG57	Powai_lake_megavirus	32.6	5.8e-28
WP_077569287.1|1675158_1676145_-	polysaccharide biosynthesis protein	NA	A0A1V0SAI8	Catovirus	32.0	2.8e-37
WP_077569288.1|1676134_1677229_-	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A2P1ELS7	Moumouvirus	45.0	1.1e-90
>prophage 114
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	1683478	1684210	6593819		Bacillus_virus(100.0%)	1	NA	NA
WP_077569297.1|1683478_1684210_-	NTP transferase domain-containing protein	NA	G3MA50	Bacillus_virus	43.3	9.3e-46
>prophage 115
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	1698533	1703153	6593819		uncultured_Caudovirales_phage(20.0%)	6	NA	NA
WP_099477179.1|1698533_1699214_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	57.3	1.7e-65
WP_077569311.1|1699210_1699702_+	6-carboxytetrahydropterin synthase QueD	NA	J9PV91	Bacillus_phage	69.8	3.8e-59
WP_099477180.1|1699694_1700489_+	7-carboxy-7-deazaguanine synthase QueE	NA	A0A1U9WRB6	Streptococcus_virus	45.8	1.8e-58
WP_077569313.1|1700567_1701065_+	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	E7DN65	Pneumococcus_phage	63.6	7.7e-52
WP_099477181.1|1701533_1702439_-	EcsC family protein	NA	NA	NA	NA	NA
WP_099477182.1|1702661_1703153_-	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	51.0	1.8e-37
>prophage 116
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	1711241	1719086	6593819		uncultured_Caudovirales_phage(33.33%)	7	NA	NA
WP_099477188.1|1711241_1712693_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	52.3	8.6e-128
WP_099477189.1|1713041_1713767_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099477190.1|1714087_1714276_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099477191.1|1714398_1714791_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099477192.1|1714987_1715743_+	peptidylprolyl isomerase	NA	A0A1V0SCU1	Indivirus	49.2	6.9e-20
WP_099477193.1|1715914_1718068_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_077569325.1|1718366_1719086_+	3-ketoacyl-ACP reductase	NA	W8CYX9	Bacillus_phage	61.8	2.7e-37
>prophage 117
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	1722751	1728787	6593819		Staphylococcus_phage(66.67%)	7	NA	NA
WP_099477196.1|1722751_1723354_+	M15 family metallopeptidase	NA	A0A127AWA8	Bacillus_phage	55.5	2.2e-37
WP_099477197.1|1723500_1723776_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099480508.1|1723987_1724374_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_099477198.1|1724363_1725242_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.0	1.2e-12
WP_099477199.1|1725238_1725949_+	Tat pathway signal protein	NA	NA	NA	NA	NA
WP_077569333.1|1726085_1727252_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_099477200.1|1727254_1728787_-	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.5	1.6e-15
>prophage 118
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	1738443	1738962	6593819		Sinorhizobium_phage(100.0%)	1	NA	NA
WP_077569342.1|1738443_1738962_+	sigma-70 family RNA polymerase sigma factor	NA	A0A0F6TH34	Sinorhizobium_phage	29.4	3.9e-06
>prophage 119
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	1746188	1748186	6593819		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_077569349.1|1746188_1748186_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	60.9	2.4e-11
>prophage 120
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	1751998	1753796	6593819		Bacillus_virus(50.0%)	2	NA	NA
WP_099477209.1|1751998_1752799_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.0	2.8e-19
WP_077570607.1|1752785_1753796_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.7	3.5e-11
>prophage 121
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	1775091	1775841	6593819		Planktothrix_phage(100.0%)	1	NA	NA
WP_099477216.1|1775091_1775841_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	39.6	5.8e-35
>prophage 122
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	1779002	1779995	6593819		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_077569364.1|1779002_1779995_-	ATP-binding cassette domain-containing protein	NA	A0A2R8FG22	Brazilian_cedratvirus	30.6	8.8e-23
>prophage 123
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	1786346	1789935	6593819		Bacillus_phage(100.0%)	2	NA	NA
WP_099477220.1|1786346_1788209_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	32.6	2.0e-60
WP_099480526.1|1788189_1789935_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.7	4.2e-44
>prophage 124
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	1793635	1794373	6593819		Bacillus_phage(100.0%)	1	NA	NA
WP_099477224.1|1793635_1794373_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	34.2	4.1e-33
>prophage 125
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	1799635	1806298	6593819	protease	Hokovirus(33.33%)	7	NA	NA
WP_099477228.1|1799635_1801582_-	PAS domain S-box protein	NA	A0A1V0SGX0	Hokovirus	31.3	1.1e-58
WP_099477229.1|1801666_1802554_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099477230.1|1802584_1803337_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	28.9	2.3e-07
WP_099480528.1|1803333_1803711_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_077569377.1|1803842_1804520_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_077569378.1|1804715_1805591_-	23S ribosomal RNA methyltransferase Erm	NA	NA	NA	NA	NA
WP_077569379.1|1805980_1806298_-	thioredoxin family protein	NA	A0A0A7CHH9	Dinoroseobacter_phage	28.4	4.8e-07
>prophage 126
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	1816848	1818887	6593819		Bacillus_phage(100.0%)	2	NA	NA
WP_099477239.1|1816848_1818216_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	44.9	1.4e-63
WP_099477240.1|1818212_1818887_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	60.1	2.2e-70
>prophage 127
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	1822046	1823678	6593819		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_099477242.1|1822046_1823678_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	36.7	4.9e-87
>prophage 128
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	1834946	1836149	6593819		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_099477249.1|1834946_1836149_-	acyltransferase	NA	A0A2H4IZR3	uncultured_Caudovirales_phage	40.0	1.1e-72
>prophage 129
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	1841451	1842468	6593819		Streptococcus_phage(100.0%)	1	NA	NA
WP_077569409.1|1841451_1842468_-	YafY family transcriptional regulator	NA	A0A1B0RXM1	Streptococcus_phage	29.2	2.9e-13
>prophage 130
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	1850357	1856462	6593819		Escherichia_phage(100.0%)	1	NA	NA
WP_099477259.1|1850357_1856462_-	phosphodiester glycosidase family protein	NA	A0A291LB83	Escherichia_phage	40.6	4.0e-09
>prophage 131
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	1882139	1884095	6593819		Bacillus_phage(100.0%)	2	NA	NA
WP_099477274.1|1882139_1883381_-	HAMP domain-containing sensor histidine kinase	NA	W8CYF6	Bacillus_phage	31.2	3.1e-25
WP_099477275.1|1883402_1884095_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.9	1.6e-39
>prophage 132
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	1890842	1891925	6593819		Catovirus(100.0%)	1	NA	NA
WP_099477279.1|1890842_1891925_-	fatty acid desaturase	NA	A0A1V0SAL5	Catovirus	31.5	5.1e-32
>prophage 133
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	1895032	1896523	6593819		Staphylococcus_phage(100.0%)	1	NA	NA
WP_167393013.1|1895032_1896523_-	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	31.6	9.2e-16
>prophage 134
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	1899816	1901559	6593819		Planktothrix_phage(100.0%)	1	NA	NA
WP_077569446.1|1899816_1901559_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.6	1.1e-23
>prophage 135
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	1909794	1911273	6593819		Streptococcus_phage(100.0%)	1	NA	NA
WP_099477292.1|1909794_1911273_-	Lsa family ABC-F type ribosomal protection protein	NA	Q6DMX7	Streptococcus_phage	26.5	3.3e-34
>prophage 136
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	1948232	1950098	6593819		Enterobacteria_phage(100.0%)	1	NA	NA
WP_099477318.1|1948232_1950098_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	27.3	9.7e-15
>prophage 137
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	1957378	1964022	6593819		uncultured_Mediterranean_phage(50.0%)	3	NA	NA
WP_099477325.1|1957378_1959256_-	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	35.9	4.4e-92
WP_099477326.1|1959624_1960866_-	MFS transporter	NA	NA	NA	NA	NA
WP_099477327.1|1960923_1964022_-	DUF4981 domain-containing protein	NA	L0N6M2	Herpes_simplex_virus	35.6	6.3e-176
>prophage 138
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	1968473	1970219	6593819		Enterobacteria_phage(100.0%)	1	NA	NA
WP_099477332.1|1968473_1970219_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	29.0	6.5e-21
>prophage 139
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	1985270	1986767	6593819		Staphylococcus_phage(100.0%)	1	NA	NA
WP_099477338.1|1985270_1986767_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.3	3.4e-18
>prophage 140
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	1994192	1995790	6593819		Aeromonas_phage(50.0%)	3	NA	NA
WP_077569511.1|1994192_1994696_-	adenylate cyclase	NA	I6YXR6	Aeromonas_phage	33.5	8.7e-11
WP_077570638.1|1994828_1995296_-	DinB family protein	NA	NA	NA	NA	NA
WP_028405404.1|1995472_1995790_-	hypothetical protein	NA	I6PBV2	Leuconostoc_phage	44.6	6.0e-10
>prophage 141
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	1999230	2003424	6593819		Pseudomonas_phage(50.0%)	4	NA	NA
WP_099477346.1|1999230_2000316_-	glycosyltransferase	NA	S5WBE2	Pseudomonas_phage	22.3	2.5e-10
WP_099477347.1|2000445_2001225_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_099477348.1|2001393_2002809_+	pyruvate kinase	NA	NA	NA	NA	NA
WP_077569518.1|2003112_2003424_-	YbjQ family protein	NA	M4STD1	Rhodobacter_phage	39.8	1.8e-14
>prophage 142
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	2007686	2010431	6593819		Emiliania_huxleyi_virus(100.0%)	1	NA	NA
WP_157929281.1|2007686_2010431_-	exo-alpha-sialidase	NA	G4YAS3	Emiliania_huxleyi_virus	28.2	8.4e-23
>prophage 143
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	2031123	2031975	6593819		Anomala_cuprea_entomopoxvirus(100.0%)	1	NA	NA
WP_099477364.1|2031123_2031975_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	24.3	6.2e-09
>prophage 144
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	2039791	2041684	6593819		Enterobacteria_phage(100.0%)	1	NA	NA
WP_099477371.1|2039791_2041684_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	26.2	1.2e-17
>prophage 145
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	2051596	2055276	6593819		Cronobacter_phage(50.0%)	3	NA	NA
WP_099477380.1|2051596_2052823_-	RtcB family protein	NA	K4F7X0	Cronobacter_phage	31.0	1.8e-33
WP_099477381.1|2052878_2054474_-	limonene hydroxylase	NA	NA	NA	NA	NA
WP_099477382.1|2054457_2055276_-	nucleotidyltransferase domain-containing protein	NA	A0A2D1GQQ2	Pseudomonas_phage	40.3	1.4e-42
>prophage 146
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	2060733	2061408	6593819		Canid_alphaherpesvirus(100.0%)	1	NA	NA
WP_099477388.1|2060733_2061408_-	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	45.9	2.5e-45
>prophage 147
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	2070210	2071323	6593819		Bacillus_virus(100.0%)	1	NA	NA
WP_099477394.1|2070210_2071323_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.1	4.1e-29
>prophage 148
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	2080578	2083932	6593819		Enterococcus_phage(100.0%)	1	NA	NA
WP_099477401.1|2080578_2083932_-	S-layer homology domain-containing protein	NA	A0A0C5KL53	Enterococcus_phage	47.8	7.6e-10
>prophage 149
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	2098115	2101609	6593819		Pseudomonas_phage(50.0%)	3	NA	NA
WP_099477410.1|2098115_2098625_-	DUF4241 domain-containing protein	NA	A0A2H4P7A7	Pseudomonas_phage	34.4	1.7e-06
WP_099477411.1|2098848_2100213_+	guanine deaminase	NA	NA	NA	NA	NA
WP_099477412.1|2100256_2101609_+	purine/pyrimidine permease	NA	Q9KX94	Enterobacteria_phage	26.6	1.4e-26
>prophage 150
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	2105797	2106343	6593819		Clostridioides_phage(100.0%)	1	NA	NA
WP_077569600.1|2105797_2106343_-	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	38.7	5.3e-14
>prophage 151
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	2113067	2113865	6593819		Bacillus_virus(100.0%)	1	NA	NA
WP_099477422.1|2113067_2113865_+	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	36.6	1.5e-28
>prophage 152
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	2118353	2120153	6593819		Vaccinia_virus(100.0%)	1	NA	NA
WP_099477427.1|2118353_2120153_-	beta-glucuronidase	NA	B9U1V4	Vaccinia_virus	47.3	1.4e-151
>prophage 153
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	2123530	2125321	6593819		Enterobacteria_phage(100.0%)	1	NA	NA
WP_099477430.1|2123530_2125321_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	29.1	1.1e-15
>prophage 154
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	2152049	2153292	6593819		Bacillus_phage(50.0%)	2	NA	NA
WP_099477448.1|2152049_2152439_-	hypothetical protein	NA	A0A076G6N0	Bacillus_phage	41.0	3.3e-18
WP_157929358.1|2152521_2153292_-	hypothetical protein	NA	A0A2D1GAB7	Mycobacterium_phage	36.0	2.2e-29
>prophage 155
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	2157604	2162740	6593819		Bacillus_phage(100.0%)	1	NA	NA
WP_099477452.1|2157604_2162740_-	DNA translocase FtsK	NA	R4JMR0	Bacillus_phage	36.0	1.7e-40
>prophage 156
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	2168235	2171535	6593819		Bacillus_virus(100.0%)	1	NA	NA
WP_099477457.1|2168235_2171535_-	UvrD-helicase domain-containing protein	NA	G3MA40	Bacillus_virus	30.4	1.3e-06
>prophage 157
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	2190150	2190900	6593819		Anomala_cuprea_entomopoxvirus(100.0%)	1	NA	NA
WP_007131067.1|2190150_2190900_-	superoxide dismutase family protein	NA	W6JIT4	Anomala_cuprea_entomopoxvirus	36.6	5.1e-15
>prophage 158
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	2205345	2206506	6593819		uncultured_virus(100.0%)	1	NA	NA
WP_099477476.1|2205345_2206506_-	cobalamin-independent methionine synthase II family protein	NA	A0A218MNE0	uncultured_virus	31.8	5.4e-48
>prophage 159
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	2209774	2210479	6593819		Pithovirus(100.0%)	1	NA	NA
WP_099477479.1|2209774_2210479_-	ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	31.3	1.3e-15
>prophage 160
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	2214614	2219497	6593819		Pseudomonas_phage(50.0%)	5	NA	NA
WP_077569682.1|2214614_2215808_+	MBOAT family protein	NA	A0A125RNP0	Pseudomonas_phage	39.1	5.0e-57
WP_099477483.1|2215853_2217014_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077569684.1|2216994_2217177_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077569685.1|2217327_2218035_-	DNA alkylation repair protein	NA	NA	NA	NA	NA
WP_099477484.1|2218156_2219497_-	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	38.0	7.9e-67
>prophage 161
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	2227861	2228566	6593819		Bacillus_phage(100.0%)	1	NA	NA
WP_099477493.1|2227861_2228566_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	35.4	1.2e-39
>prophage 162
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	2233421	2238019	6593819	transposase	Streptococcus_phage(33.33%)	3	NA	NA
WP_099476497.1|2233421_2234782_-|transposase	IS1182 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	40.7	2.4e-87
WP_099477499.1|2234937_2236653_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	49.9	1.0e-95
WP_099477501.1|2237137_2238019_-	diacylglycerol kinase	NA	A0A1V0SBJ0	Catovirus	28.9	1.1e-24
>prophage 163
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	2253283	2254225	6593819		Salmonella_phage(100.0%)	1	NA	NA
WP_099477512.1|2253283_2254225_-	class A beta-lactamase	NA	A0A1B0VBP7	Salmonella_phage	43.7	1.2e-53
>prophage 164
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	2269434	2271516	6593819		Enterobacteria_phage(100.0%)	1	NA	NA
WP_099477521.1|2269434_2271516_-	histidine kinase	NA	Q9EYF3	Enterobacteria_phage	28.8	1.4e-14
>prophage 165
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	2289403	2306887	6593819		Synechococcus_phage(30.0%)	15	NA	NA
WP_099477531.1|2289403_2290951_-	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	52.3	9.1e-75
WP_099477532.1|2291678_2292311_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	34.3	2.9e-19
WP_099477533.1|2292310_2293351_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	44.5	1.6e-70
WP_099477534.1|2293571_2295050_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	33.1	7.9e-52
WP_099477535.1|2295034_2297278_-	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	43.2	3.6e-165
WP_099477536.1|2297255_2297945_-	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_007132730.1|2297949_2298195_-	phosphoribosylformylglycinamidine synthase subunit PurS	NA	A0A0E3FJ99	Synechococcus_phage	36.4	1.1e-06
WP_099477537.1|2298246_2299137_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0M4JBD3	Mollivirus	33.1	2.4e-35
WP_077569753.1|2299560_2300856_-	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	33.3	7.0e-20
WP_099477538.1|2300859_2302047_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_077570667.1|2302043_2302529_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	42.0	4.4e-20
WP_077569755.1|2303326_2303761_-	universal stress protein	NA	NA	NA	NA	NA
WP_028406383.1|2303900_2304164_-	DUF1294 domain-containing protein	NA	NA	NA	NA	NA
WP_007132738.1|2304506_2304644_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099477539.1|2304748_2306887_-	DNA topoisomerase III	NA	A0A0G2Y787	Acanthamoeba_polyphaga_mimivirus	25.2	3.1e-25
>prophage 166
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	2309964	2310735	6593819		Aureococcus_anophage(100.0%)	1	NA	NA
WP_077569760.1|2309964_2310735_-	ABC transporter ATP-binding protein	NA	A0A076FI99	Aureococcus_anophage	26.9	1.1e-09
>prophage 167
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	2320608	2322330	6593819		Enterobacteria_phage(100.0%)	1	NA	NA
WP_099477548.1|2320608_2322330_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	29.2	1.5e-22
>prophage 168
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	2335811	2339306	6593819		Moraxella_phage(50.0%)	2	NA	NA
WP_007133020.1|2335811_2337182_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	34.1	1.2e-46
WP_077569779.1|2337767_2339306_-	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	30.5	1.8e-19
>prophage 169
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	2349148	2350924	6593819		Enterobacteria_phage(100.0%)	1	NA	NA
WP_099477559.1|2349148_2350924_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	31.9	4.9e-24
>prophage 170
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	2358472	2359345	6593819		Streptococcus_phage(100.0%)	1	NA	NA
WP_099477561.1|2358472_2359345_+	aminoglycoside 6-adenylyltransferase	NA	E4ZFP8	Streptococcus_phage	54.2	2.8e-81
>prophage 171
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	2364954	2365956	6593819		Tupanvirus(100.0%)	1	NA	NA
WP_099477567.1|2364954_2365956_-	UV DNA damage repair endonuclease UvsE	NA	A0A2K9L4G2	Tupanvirus	28.6	1.7e-26
>prophage 172
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	2374154	2378419	6593819		Bacillus_thuringiensis_phage(50.0%)	5	NA	NA
WP_099477570.1|2374154_2375369_+	DUF2935 domain-containing protein	NA	Q56AR7	Bacillus_thuringiensis_phage	43.3	2.0e-40
WP_099477571.1|2375753_2376050_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099477572.1|2376073_2377348_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077569809.1|2377383_2377656_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007133056.1|2377825_2378419_-	GTP cyclohydrolase I FolE	NA	E7DN69	Pneumococcus_phage	53.6	1.4e-47
>prophage 173
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	2390081	2390690	6593819		Bacillus_thuringiensis_phage(100.0%)	1	NA	NA
WP_099477575.1|2390081_2390690_+	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	67.0	4.2e-76
>prophage 174
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	2394243	2405621	6593819		Bacillus_virus(40.0%)	9	NA	NA
WP_077569819.1|2394243_2395053_-	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	45.5	2.5e-52
WP_007132426.1|2395165_2395600_-	BrxA/BrxB family bacilliredoxin	NA	NA	NA	NA	NA
WP_099477578.1|2395922_2397650_-	PAS domain-containing protein	NA	Q8QKV7	Ectocarpus_siliculosus_virus	23.6	3.3e-09
WP_099477579.1|2397860_2399129_+	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2H4PQX1	Staphylococcus_phage	59.4	1.7e-26
WP_099477580.1|2399302_2400595_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_099480561.1|2400612_2401341_-	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	26.6	1.0e-15
WP_077569824.1|2401657_2402125_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_099477581.1|2402315_2403836_-	MFS transporter	NA	NA	NA	NA	NA
WP_099477582.1|2403992_2405621_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	26.6	9.1e-09
>prophage 175
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	2414029	2419044	6593819		Bacillus_phage(50.0%)	5	NA	NA
WP_099477588.1|2414029_2414716_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.2	3.7e-36
WP_099477589.1|2414712_2416275_+	HAMP domain-containing sensor histidine kinase	NA	A0A1V0SGX0	Hokovirus	28.6	3.7e-15
WP_077569838.1|2416480_2417182_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_099477590.1|2417178_2418174_+	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	24.9	7.2e-09
WP_099477591.1|2418273_2419044_+	ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	29.7	6.0e-11
>prophage 176
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	2423583	2431471	6593819		Erwinia_phage(33.33%)	6	NA	NA
WP_162292785.1|2423583_2425812_+	cadherin-like beta sandwich domain-containing protein	NA	G0YPJ0	Erwinia_phage	60.0	2.4e-12
WP_099477595.1|2426096_2426417_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099477596.1|2426521_2427427_-	helix-turn-helix transcriptional regulator	NA	A0A291LAM3	Bordetella_phage	39.7	1.3e-09
WP_099477597.1|2427664_2428651_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_099477598.1|2428647_2429646_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_099477599.1|2430007_2431471_+	carboxylesterase/lipase family protein	NA	G5CSV8	Megavirus	38.9	1.3e-35
>prophage 177
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	2436012	2437977	6593819		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_077569852.1|2436012_2437977_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	34.9	4.3e-13
>prophage 178
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	2441019	2441784	6593819		Enterococcus_phage(100.0%)	1	NA	NA
WP_099477604.1|2441019_2441784_-	glycerophosphodiester phosphodiesterase	NA	A0A0S2MYI4	Enterococcus_phage	34.3	2.2e-13
>prophage 179
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	2445000	2448503	6593819		Planktothrix_phage(50.0%)	3	NA	NA
WP_077569859.1|2445000_2446056_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.8	1.0e-24
WP_007132472.1|2446413_2447175_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_099477607.1|2447465_2448503_-	lytic polysaccharide monooxygenase	NA	A0A0K1Y848	Apis_mellifera_filamentous_virus	38.5	9.8e-25
>prophage 180
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	2465949	2466627	6593819		Klosneuvirus(100.0%)	1	NA	NA
WP_099477619.1|2465949_2466627_+	deoxyribonuclease V	NA	A0A1V0SJW5	Klosneuvirus	30.0	2.6e-18
>prophage 181
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	2495774	2497597	6593819		Staphylococcus_phage(50.0%)	2	NA	NA
WP_077569903.1|2495774_2496677_-	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	31.7	1.8e-27
WP_077569904.1|2496694_2497597_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	26.5	5.0e-17
>prophage 182
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	2520788	2523890	6593819		Hyphantria_cunea_nuclear_polyhedrosis_virus(100.0%)	1	NA	NA
WP_099477651.1|2520788_2523890_-	DEAD/DEAH box helicase	NA	Q2NP48	Hyphantria_cunea_nuclear_polyhedrosis_virus	29.2	2.4e-42
>prophage 183
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	2527776	2529558	6593819		Enterobacteria_phage(100.0%)	1	NA	NA
WP_099477654.1|2527776_2529558_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	31.7	9.0e-18
>prophage 184
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	2547780	2555710	6593819	holin	uncultured_Mediterranean_phage(33.33%)	6	NA	NA
WP_099477664.1|2547780_2550030_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	35.1	1.2e-147
WP_007130451.1|2550212_2550767_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007130452.1|2550785_2551016_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099477665.1|2551367_2551643_-|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_099477666.1|2552153_2553968_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.1	4.5e-09
WP_077569945.1|2553964_2555710_-	ABC transporter ATP-binding protein	NA	F2Y352	Organic_Lake_phycodnavirus	28.5	4.4e-17
>prophage 185
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	2572621	2577092	6593819		Bacillus_phage(100.0%)	2	NA	NA
WP_099477678.1|2572621_2574955_+	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A0Y0AS84	Bacillus_phage	63.5	3.5e-264
WP_007130468.1|2576060_2577092_+	ribonucleotide-diphosphate reductase subunit beta	NA	A0A127AVZ3	Bacillus_phage	46.4	7.3e-89
>prophage 186
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	2584167	2585076	6593819		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
WP_077569973.1|2584167_2585076_+	SDR family oxidoreductase	NA	A0A2N9QUX2	Trichoplusia_ni_ascovirus	40.1	5.4e-43
>prophage 187
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	2595358	2596018	6593819		Bacillus_phage(100.0%)	1	NA	NA
WP_077570704.1|2595358_2596018_+	spore cortex-lytic enzyme	NA	A0A172JHR8	Bacillus_phage	29.9	2.1e-20
>prophage 188
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	2602606	2603332	6593819		Streptococcus_phage(100.0%)	1	NA	NA
WP_099477694.1|2602606_2603332_+	MBL fold metallo-hydrolase	NA	A0A1X9I5D3	Streptococcus_phage	33.1	1.2e-08
>prophage 189
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	2608550	2609306	6593819		Mycobacterium_phage(100.0%)	1	NA	NA
WP_099477697.1|2608550_2609306_+	alpha/beta hydrolase	NA	G1BRG0	Mycobacterium_phage	27.3	6.5e-10
>prophage 190
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	2615275	2616190	6593819		Staphylococcus_phage(100.0%)	1	NA	NA
WP_077570002.1|2615275_2616190_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	43.0	4.9e-44
>prophage 191
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	2620929	2623209	6593819		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_162292798.1|2620929_2623209_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	32.5	5.5e-129
>prophage 192
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	2626855	2627515	6593819		Synechococcus_phage(100.0%)	1	NA	NA
WP_099477706.1|2626855_2627515_+	beta-phosphoglucomutase	NA	A0A1D8KPI1	Synechococcus_phage	29.0	3.4e-15
>prophage 193
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	2636475	2637306	6593819		Bacillus_virus(100.0%)	1	NA	NA
WP_099477711.1|2636475_2637306_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	40.9	7.3e-31
>prophage 194
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	2647964	2655227	6593819		Bacillus_virus(100.0%)	6	NA	NA
WP_077570028.1|2647964_2649821_+	HD-GYP domain-containing protein	NA	G3MA91	Bacillus_virus	31.0	3.2e-10
WP_077570030.1|2649932_2650163_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077570031.1|2650318_2651446_+	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
WP_099477716.1|2651707_2652334_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099477717.1|2652365_2652545_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099480582.1|2652737_2655227_+	UvrD-helicase domain-containing protein	NA	G3MA40	Bacillus_virus	33.1	5.7e-79
>prophage 195
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	2665246	2666077	6593819		Staphylococcus_phage(100.0%)	1	NA	NA
WP_099477724.1|2665246_2666077_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	48.0	8.9e-69
>prophage 196
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	2675515	2677012	6593819		Bacillus_phage(100.0%)	1	NA	NA
WP_099477731.1|2675515_2677012_-	sucrose-6-phosphate hydrolase	NA	F8WPR5	Bacillus_phage	26.6	1.3e-25
>prophage 197
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	2683876	2685847	6593819		Enterobacteria_phage(100.0%)	1	NA	NA
WP_099480586.1|2683876_2685847_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	26.9	1.1e-21
>prophage 198
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	2690795	2697457	6593819		Lactococcus_phage(25.0%)	7	NA	NA
WP_006207896.1|2690795_2690996_-	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	69.2	6.9e-20
WP_099477738.1|2691326_2691791_-	pyridoxamine 5'-phosphate oxidase family protein	NA	NA	NA	NA	NA
WP_077570086.1|2691813_2693445_-	cellulase family glycosylhydrolase	NA	A0A1Y0T2M7	Pseudomonas_phage	26.6	3.3e-11
WP_099480590.1|2693755_2694289_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_077570090.1|2694441_2695629_-	acyltransferase	NA	NA	NA	NA	NA
WP_077570719.1|2695821_2696550_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.8	5.3e-33
WP_034272895.1|2696647_2697457_+	ABC transporter substrate-binding protein	NA	A0A1B1IT51	uncultured_Mediterranean_phage	26.7	2.0e-12
>prophage 199
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	2713369	2715772	6593819		Alphaproteobacteria_virus(100.0%)	1	NA	NA
WP_099477747.1|2713369_2715772_-	family 43 glycosylhydrolase	NA	Q5DN17	Alphaproteobacteria_virus	25.2	1.9e-10
>prophage 200
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	2743328	2744051	6593819		Bacillus_phage(100.0%)	1	NA	NA
WP_099477757.1|2743328_2744051_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.2	1.6e-34
>prophage 201
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	2750260	2750980	6593819		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_077570175.1|2750260_2750980_-	glycerophosphodiester phosphodiesterase	NA	M1HU85	Paramecium_bursaria_Chlorella_virus	31.8	8.3e-23
>prophage 202
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	2755639	2757265	6593819		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_099477761.1|2755639_2757265_+	thiamine pyrophosphate-binding protein	NA	H8ZJ31	Ostreococcus_tauri_virus	23.3	4.1e-17
>prophage 203
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	2764508	2765183	6593819		Synechococcus_phage(100.0%)	1	NA	NA
WP_099477767.1|2764508_2765183_+	beta-phosphoglucomutase	NA	A0A1D8KNV9	Synechococcus_phage	26.4	2.9e-09
>prophage 204
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	2785768	2788729	6593819		Bombyx_mandarina_nucleopolyhedrovirus(100.0%)	1	NA	NA
WP_099477778.1|2785768_2788729_+	DEAD/DEAH box helicase	NA	C3VNU0	Bombyx_mandarina_nucleopolyhedrovirus	25.6	1.2e-38
>prophage 205
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	2799426	2800062	6593819		Catovirus(100.0%)	1	NA	NA
WP_007130673.1|2799426_2800062_+	uridine kinase	NA	A0A1V0SAA3	Catovirus	41.1	6.2e-38
>prophage 206
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	2803256	2805290	6593819		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_099477788.1|2803256_2805290_-	potassium-transporting ATPase subunit KdpB	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	26.7	5.4e-27
>prophage 207
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	2808606	2811327	6593819		Staphylococcus_phage(50.0%)	2	NA	NA
WP_099477791.1|2808606_2809527_-	proline dehydrogenase family protein	NA	A0A2H4PQT6	Staphylococcus_phage	37.8	1.3e-52
WP_099477792.1|2809887_2811327_-	serine hydrolase	NA	A0A1V0SLG8	Klosneuvirus	24.7	5.4e-05
>prophage 208
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	2815570	2816530	6593819		Enterobacteria_phage(100.0%)	1	NA	NA
WP_099477794.1|2815570_2816530_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	27.2	4.1e-17
>prophage 209
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	2824513	2825527	6593819		Planktothrix_phage(100.0%)	1	NA	NA
WP_077570280.1|2824513_2825527_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.0	1.5e-14
>prophage 210
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	2857659	2859186	6593819		Amsacta_moorei_entomopoxvirus(100.0%)	1	NA	NA
WP_099477807.1|2857659_2859186_-	ABC transporter ATP-binding protein	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	28.1	7.4e-13
>prophage 211
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	2865967	2867773	6593819		Bacillus_phage(100.0%)	1	NA	NA
WP_099477814.1|2865967_2867773_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.0	4.3e-28
>prophage 212
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	2877437	2878328	6593819		Bacillus_phage(100.0%)	1	NA	NA
WP_099477823.1|2877437_2878328_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	53.6	4.3e-77
>prophage 213
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	2886041	2887067	6593819		Clostridium_botulinum_C_phage(100.0%)	1	NA	NA
WP_099477828.1|2886041_2887067_+	MBL fold metallo-hydrolase	NA	Q332C0	Clostridium_botulinum_C_phage	30.6	2.5e-28
>prophage 214
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	2891987	2893700	6593819		Staphylococcus_phage(50.0%)	2	NA	NA
WP_099477830.1|2891987_2892830_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	41.1	2.1e-49
WP_099477831.1|2892941_2893700_-	ABC transporter ATP-binding protein	NA	A0A285PWH2	Cedratvirus	27.2	1.8e-15
>prophage 215
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	2897180	2898734	6593819		Phormidium_phage(100.0%)	1	NA	NA
WP_099477834.1|2897180_2898734_-	AAA family ATPase	NA	U5XGM6	Phormidium_phage	34.9	1.4e-54
>prophage 216
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	2907346	2921563	6593819		Lactococcus_phage(33.33%)	14	NA	NA
WP_099477842.1|2907346_2908180_+	nickel import ATP-binding protein NikD	NA	G9BWD6	Planktothrix_phage	28.5	2.1e-17
WP_077570408.1|2908223_2909024_+	nickel import ATP-binding protein NikE	NA	NA	NA	NA	NA
WP_077570410.1|2909094_2909886_-	sensor domain-containing protein	NA	NA	NA	NA	NA
WP_077570412.1|2910212_2910425_-	cold-shock protein	NA	NA	NA	NA	NA
WP_077570416.1|2910505_2910706_-	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	72.3	4.1e-20
WP_099477843.1|2911494_2911947_-	HNH endonuclease	NA	A0A2H4JGM1	uncultured_Caudovirales_phage	44.8	1.2e-08
WP_099477844.1|2912266_2912875_-	zf-HC2 domain-containing protein	NA	NA	NA	NA	NA
WP_099477845.1|2912871_2913354_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_099477846.1|2913916_2914114_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007132695.1|2914842_2915322_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	54.5	9.1e-42
WP_099477847.1|2915613_2918256_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	39.4	2.8e-84
WP_007132909.1|2918447_2918678_-	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
WP_077570425.1|2919101_2919551_-	PaaI family thioesterase	NA	NA	NA	NA	NA
WP_099477848.1|2919883_2921563_-	long-chain fatty acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	28.2	3.3e-38
>prophage 217
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	2934683	2935262	6593819		Catovirus(100.0%)	1	NA	NA
WP_077570445.1|2934683_2935262_+	TIGR00730 family Rossman fold protein	NA	A0A1V0S9E9	Catovirus	24.6	2.9e-10
>prophage 218
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	2950729	2951482	6593819		Bacillus_virus(100.0%)	1	NA	NA
WP_099477862.1|2950729_2951482_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.3	3.5e-24
>prophage 219
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	2955292	2956372	6593819		Bacillus_virus(100.0%)	1	NA	NA
WP_099480604.1|2955292_2956372_+	helix-turn-helix domain-containing protein	NA	G3M9Z3	Bacillus_virus	34.3	2.2e-19
>prophage 220
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	2963488	2964790	6593819		Escherichia_phage(100.0%)	1	NA	NA
WP_099480606.1|2963488_2964790_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	25.2	8.3e-21
>prophage 221
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	2986531	2987821	6593819		Streptococcus_phage(100.0%)	1	NA	NA
WP_007133019.1|2986531_2987821_-	phosphopyruvate hydratase	NA	W6LP63	Streptococcus_phage	72.8	1.3e-175
>prophage 222
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	2994307	2994904	6593819		Agrobacterium_phage(100.0%)	1	NA	NA
WP_077570510.1|2994307_2994904_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	56.5	8.9e-55
>prophage 223
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	2999170	3020055	6593819		Bacillus_phage(36.36%)	19	NA	NA
WP_007133008.1|2999170_3000019_-	ABC transporter permease	NA	Q6GZ02	Mycoplasma_phage	24.8	5.0e-11
WP_077570741.1|3000015_3000987_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	33.2	7.5e-27
WP_099477886.1|3001441_3002203_-	SIMPL domain-containing protein	NA	NA	NA	NA	NA
WP_099477887.1|3002476_3003925_+	amino acid ABC transporter substrate-binding protein/permease	NA	NA	NA	NA	NA
WP_099477888.1|3003917_3004646_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.6	3.1e-33
WP_099477889.1|3004777_3005848_-	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	48.8	1.0e-85
WP_099480612.1|3005847_3006525_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	66.1	1.0e-78
WP_007133000.1|3008609_3008879_-	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_028406089.1|3008979_3009909_-	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	39.2	3.3e-56
WP_077570526.1|3009914_3010895_-	YvcK family protein	NA	A1IMD5	Streptococcus_phage	37.4	2.4e-57
WP_077570528.1|3010913_3011822_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	31.2	1.1e-08
WP_077570530.1|3011865_3012816_-	ROK family glucokinase	NA	NA	NA	NA	NA
WP_099477890.1|3013072_3013999_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	29.5	2.7e-18
WP_099477891.1|3014000_3014747_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_099477892.1|3014768_3015983_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_077570538.1|3015909_3016515_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_099477893.1|3016611_3018189_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.9	2.0e-45
WP_162292778.1|3018076_3018319_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077570542.1|3018315_3020055_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.4	8.1e-48
>prophage 224
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	3026141	3031325	6593819	coat	Lactobacillus_phage(33.33%)	5	NA	NA
WP_077570553.1|3026141_3026594_+	GNAT family N-acetyltransferase	NA	E9LUK4	Lactobacillus_phage	42.0	2.6e-30
WP_077570555.1|3026685_3027168_+|coat	spore coat protein	coat	NA	NA	NA	NA
WP_007132977.1|3027467_3028421_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	48.6	7.8e-69
WP_077570557.1|3028547_3030293_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_077570559.1|3030374_3031325_-	ribose-phosphate pyrophosphokinase	NA	A0A1V0SHF7	Hokovirus	35.7	5.2e-49
>prophage 225
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	3044887	3046012	6593819		Bacillus_virus(100.0%)	1	NA	NA
WP_077570584.1|3044887_3046012_-	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G3M9Y6	Bacillus_virus	34.1	6.2e-25
>prophage 226
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	3056202	3057930	6593819		Streptococcus_virus(100.0%)	1	NA	NA
WP_077571024.1|3056202_3057930_-	DNA polymerase III subunit gamma/tau	NA	A0A1U9WR94	Streptococcus_virus	35.6	1.3e-50
>prophage 227
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	3065151	3069396	6593819		Only_Syngen_Nebraska_virus(50.0%)	3	NA	NA
WP_077571036.1|3065151_3066753_-	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	50.1	9.2e-147
WP_099477909.1|3067329_3067887_-	DNA-directed RNA polymerase subunit delta	NA	NA	NA	NA	NA
WP_099477910.1|3068250_3069396_+	S8 family peptidase	NA	A0A217EQY2	Bacillus_phage	41.8	4.5e-47
>prophage 228
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	3073328	3074186	6593819		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_077571049.1|3073328_3074186_-	carbon-nitrogen hydrolase family protein	NA	M1IKC7	Paramecium_bursaria_Chlorella_virus	24.5	1.7e-06
>prophage 229
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	3077422	3079495	6593819		Mycobacterium_phage(100.0%)	1	NA	NA
WP_099477916.1|3077422_3079495_+	serine hydrolase	NA	A0A2P1JR59	Mycobacterium_phage	28.6	7.5e-08
>prophage 230
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	3103465	3106099	6593819		Streptococcus_phage(100.0%)	2	NA	NA
WP_077571082.1|3103465_3103852_+	helix-turn-helix transcriptional regulator	NA	E4ZFI8	Streptococcus_phage	43.8	1.0e-19
WP_099477926.1|3103852_3106099_+	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	43.8	5.4e-161
>prophage 231
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	3111578	3112052	6593819		Clostridium_phage(100.0%)	1	NA	NA
WP_077571093.1|3111578_3112052_+	C40 family peptidase	NA	A0A0K2SUC1	Clostridium_phage	44.3	6.0e-22
>prophage 232
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	3122544	3128717	6593819	tRNA	uncultured_Mediterranean_phage(33.33%)	5	NA	NA
WP_099477931.1|3122544_3123834_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	53.0	8.6e-95
WP_007133229.1|3124029_3124614_-	pyridoxal 5'-phosphate synthase glutaminase subunit PdxT	NA	NA	NA	NA	NA
WP_007133228.1|3124630_3125512_-	pyridoxal 5'-phosphate synthase lyase subunit PdxS	NA	NA	NA	NA	NA
WP_077571003.1|3125684_3127097_-	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	32.7	5.4e-34
WP_077571001.1|3127259_3128717_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	42.3	2.5e-106
>prophage 233
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	3135167	3136679	6593819	tRNA	Catovirus(100.0%)	1	NA	NA
WP_077570999.1|3135167_3136679_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	40.3	3.2e-93
>prophage 234
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	3140098	3145225	6593819		Pandoravirus(50.0%)	5	NA	NA
WP_099477934.1|3140098_3140959_-	dihydropteroate synthase	NA	A0A0B5J4J5	Pandoravirus	32.5	2.8e-25
WP_099477935.1|3140955_3141843_-	aminotransferase class IV	NA	NA	NA	NA	NA
WP_028406001.1|3141839_3142421_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	59.5	2.4e-68
WP_099477936.1|3142425_3144084_-	anthranilate synthase component I family protein	NA	S4VT78	Pandoravirus	37.6	4.3e-38
WP_099477937.1|3144286_3145225_-	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	60.6	1.2e-101
>prophage 235
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	3151964	3154662	6593819	protease	Ostreococcus_tauri_virus(50.0%)	2	NA	NA
WP_077570968.1|3151964_3154022_-|protease	ATP-dependent zinc metalloprotease FtsH	protease	C7U047	Ostreococcus_tauri_virus	47.8	5.9e-114
WP_077570966.1|3154122_3154662_-	hypoxanthine phosphoribosyltransferase	NA	A0A2K9L634	Tupanvirus	29.7	9.0e-14
>prophage 236
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	3163228	3163501	6593819		Bacillus_phage(100.0%)	1	NA	NA
WP_007132879.1|3163228_3163501_-	HU family DNA-binding protein	NA	A7KV42	Bacillus_phage	61.1	1.6e-22
>prophage 237
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	3167210	3167753	6593819		Paenibacillus_phage(100.0%)	1	NA	NA
WP_028406014.1|3167210_3167753_-	stage V sporulation protein T	NA	A0A2I7SC16	Paenibacillus_phage	70.6	4.2e-11
>prophage 238
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	3174279	3176707	6593819		Hokovirus(50.0%)	2	NA	NA
WP_007132870.1|3174279_3175233_-	ribose-phosphate diphosphokinase	NA	A0A1V0SHF7	Hokovirus	35.0	6.6e-44
WP_077570937.1|3175312_3176707_-	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A0N7G7I9	Chrysochromulina_ericina_virus	39.1	3.1e-34
>prophage 239
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	3183106	3194319	6593819	tRNA	Streptococcus_phage(50.0%)	12	NA	NA
WP_099477953.1|3183106_3184297_-	3D domain-containing protein	NA	A0A217EQL1	Bacillus_phage	42.9	1.4e-11
WP_077570925.1|3184999_3185767_-	TatD family hydrolase	NA	NA	NA	NA	NA
WP_077570924.1|3185927_3187217_-	HD domain-containing protein	NA	A0A1B1ISR1	uncultured_Mediterranean_phage	32.9	5.3e-28
WP_006207408.1|3187540_3187795_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	A0A2I7SC16	Paenibacillus_phage	69.2	3.8e-23
WP_099477954.1|3188084_3188975_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	42.3	1.3e-54
WP_077570920.1|3188971_3189736_-|tRNA	tRNA1(Val) (adenine(37)-N6)-methyltransferase	tRNA	NA	NA	NA	NA
WP_077570918.1|3189896_3190268_-	DNA replication initiation control protein YabA	NA	NA	NA	NA	NA
WP_007132855.1|3190300_3191101_-	stage 0 sporulation family protein	NA	NA	NA	NA	NA
WP_099477955.1|3191157_3192144_-	DNA polymerase III subunit delta'	NA	M1NSC1	Streptococcus_phage	36.9	3.5e-24
WP_099477956.1|3192335_3192779_-	YaaR family protein	NA	NA	NA	NA	NA
WP_006207400.1|3193282_3193612_-	cyclic-di-AMP receptor	NA	NA	NA	NA	NA
WP_077570912.1|3193674_3194319_-	dTMP kinase	NA	M1PSC7	Streptococcus_phage	49.0	5.5e-50
>prophage 240
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	3204915	3213830	6593819		Bacillus_virus(66.67%)	7	NA	NA
WP_099477960.1|3204915_3207411_-	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	36.8	9.0e-117
WP_077570903.1|3207881_3208685_+	YheC/YheD family protein	NA	NA	NA	NA	NA
WP_077570901.1|3209010_3210921_-	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	49.7	1.6e-158
WP_007129241.1|3210947_3211199_-	DUF370 domain-containing protein	NA	NA	NA	NA	NA
WP_077570900.1|3211211_3212324_-	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_028406533.1|3212373_3212589_-	S4 domain-containing protein YaaA	NA	NA	NA	NA	NA
WP_077570898.1|3212687_3213830_-	DNA polymerase III subunit beta	NA	D0R7I4	Paenibacillus_phage	35.3	1.6e-20
>prophage 241
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	3220950	3221850	6593819		Synechococcus_phage(100.0%)	1	NA	NA
WP_099477963.1|3220950_3221850_-	decarboxylating 6-phosphogluconate dehydrogenase	NA	A0A222YX62	Synechococcus_phage	37.7	5.5e-56
>prophage 242
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	3231021	3236585	6593819	protease	Leptospira_phage(50.0%)	6	NA	NA
WP_077570885.1|3231021_3231840_+	nucleoid occlusion protein	NA	S5VSZ7	Leptospira_phage	35.1	1.3e-16
WP_007129223.1|3232326_3233088_+	ParA family protein	NA	Q8JL10	Natrialba_phage	28.5	2.6e-22
WP_099477967.1|3233080_3233920_+	ParB/RepB/Spo0J family partition protein	NA	S5VSZ7	Leptospira_phage	33.2	2.6e-15
WP_077570878.1|3234317_3235466_+	aminotransferase class V-fold PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_077570876.1|3235504_3236005_+	DUF4446 family protein	NA	NA	NA	NA	NA
WP_077570875.1|3235979_3236585_-|protease	spore protease YyaC	protease	G3M9W0	Bacillus_virus	35.5	3.4e-17
>prophage 243
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	3240185	3240662	6593819		Paenibacillus_phage(100.0%)	1	NA	NA
WP_077570870.1|3240185_3240662_+	single-stranded DNA-binding protein	NA	A0A0K2CYR2	Paenibacillus_phage	64.2	6.4e-48
>prophage 244
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	3247114	3249054	6593819		Anomala_cuprea_entomopoxvirus(50.0%)	2	NA	NA
WP_099477973.1|3247114_3248089_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	27.3	1.2e-16
WP_099477974.1|3248088_3249054_+	dipeptide ABC transporter ATP-binding protein	NA	M1HS04	Acanthocystis_turfacea_Chlorella_virus	25.1	9.2e-09
>prophage 245
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	3256283	3274317	6593819		Bacillus_phage(25.0%)	14	NA	NA
WP_007129199.1|3256283_3257648_+	replicative DNA helicase	NA	A0A1P8VVQ6	Streptococcus_phage	48.9	3.1e-111
WP_077570845.1|3257882_3259169_+	adenylosuccinate synthase	NA	A0A160ER07	Powai_lake_megavirus	38.9	4.1e-73
WP_099477976.1|3259373_3259568_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077570841.1|3259661_3261605_-	glycosyltransferase	NA	A0A0F7L2F7	uncultured_marine_virus	35.5	5.9e-07
WP_099480621.1|3261928_3262627_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099477977.1|3262905_3264474_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A292GJG6	Xanthomonas_phage	47.8	6.5e-20
WP_162292786.1|3264825_3265461_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099477979.1|3265507_3266239_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	37.9	4.2e-38
WP_099477980.1|3266238_3268068_+	cell wall metabolism sensor histidine kinase WalK	NA	W8CYF6	Bacillus_phage	33.7	2.7e-33
WP_099477981.1|3268064_3269342_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099477982.1|3269786_3270536_+	two-component system regulatory protein YycI	NA	NA	NA	NA	NA
WP_077570825.1|3270543_3271347_+	MBL fold metallo-hydrolase	NA	A0A2I7SDH3	Paenibacillus_phage	37.7	6.4e-40
WP_034273886.1|3271899_3272121_-	alpha/beta-type small acid-soluble spore protein	NA	NA	NA	NA	NA
WP_077570823.1|3272943_3274317_+	trypsin-like peptidase domain-containing protein	NA	A0A1B1IRD3	uncultured_Mediterranean_phage	30.6	1.1e-12
>prophage 246
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	3297803	3300442	6593819		Serratia_phage(50.0%)	2	NA	NA
WP_099478006.1|3297803_3298481_+	nicotinamide mononucleotide transporter	NA	A0A1S6UAV8	Serratia_phage	37.2	1.6e-31
WP_099478007.1|3299557_3300442_+	NUDIX hydrolase	NA	G3MA14	Bacillus_virus	36.7	8.6e-38
>prophage 247
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	3305111	3306023	6593819		Streptococcus_phage(100.0%)	1	NA	NA
WP_099478010.1|3305111_3306023_-	YafY family transcriptional regulator	NA	A0A1B0RXM1	Streptococcus_phage	31.4	3.8e-12
>prophage 248
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	3311149	3312178	6593819		Mycoplasma_phage(100.0%)	1	NA	NA
WP_077568885.1|3311149_3312178_+	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	51.1	8.0e-19
>prophage 249
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	3347672	3353023	6593819		Bacillus_phage(66.67%)	3	NA	NA
WP_099478024.1|3347672_3348434_+	AAC(3) family N-acetyltransferase	NA	O64018	Bacillus_phage	28.2	2.1e-16
WP_099478025.1|3348500_3351614_+	response regulator	NA	Q8QKV7	Ectocarpus_siliculosus_virus	28.8	1.4e-34
WP_099478026.1|3351685_3353023_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	31.9	2.9e-29
>prophage 250
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	3356194	3367331	6593819		Bacillus_phage(40.0%)	9	NA	NA
WP_099478029.1|3356194_3358834_-	family 16 glycosylhydrolase	NA	M1HRU7	Paramecium_bursaria_Chlorella_virus	35.9	5.7e-37
WP_099478030.1|3359023_3359935_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_099478031.1|3359956_3360628_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	30.8	2.1e-28
WP_099478032.1|3360638_3361418_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_099478033.1|3361410_3362328_-	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	45.6	4.1e-43
WP_167393020.1|3362688_3363249_+	uracil-DNA glycosylase	NA	NA	NA	NA	NA
WP_099478035.1|3363374_3363767_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099478036.1|3363918_3365784_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	25.6	1.4e-18
WP_099478037.1|3365780_3367331_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	26.5	9.6e-08
>prophage 251
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	3410377	3411850	6593819		Microcystis_phage(100.0%)	1	NA	NA
WP_099478055.1|3410377_3411850_+	YdiU family protein	NA	A0A075BSJ0	Microcystis_phage	32.9	3.2e-53
>prophage 252
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	3415840	3419008	6593819		Ectocarpus_siliculosus_virus(100.0%)	1	NA	NA
WP_099478062.1|3415840_3419008_-	response regulator	NA	Q8QKV7	Ectocarpus_siliculosus_virus	30.0	4.9e-35
>prophage 253
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	3432121	3433006	6593819	transposase	Bacillus_phage(100.0%)	1	NA	NA
WP_157929306.1|3432121_3433006_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	39.6	2.7e-47
>prophage 254
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	3456154	3463696	6593819		Planktothrix_phage(33.33%)	9	NA	NA
WP_077568733.1|3456154_3456916_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.3	4.2e-33
WP_099478086.1|3457143_3458148_-	sensor histidine kinase	NA	NA	NA	NA	NA
WP_099478087.1|3458144_3458834_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_099478088.1|3459088_3459334_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_077568727.1|3459338_3459860_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	38.7	3.0e-14
WP_099478089.1|3460084_3461062_+	ring-cleaving dioxygenase	NA	NA	NA	NA	NA
WP_099478090.1|3461132_3461555_-	DUF4440 domain-containing protein	NA	NA	NA	NA	NA
WP_099478091.1|3461677_3462019_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_099478092.1|3462142_3463696_+	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	25.9	4.0e-22
>prophage 255
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	3466771	3469025	6593819		Klosneuvirus(50.0%)	2	NA	NA
WP_077568716.1|3466771_3467644_-	ABC transporter ATP-binding protein	NA	A0A1V0SJ29	Klosneuvirus	25.5	1.2e-10
WP_077568714.1|3467975_3469025_+	NAD(P)/FAD-dependent oxidoreductase	NA	G3MA85	Bacillus_virus	26.2	9.0e-18
>prophage 256
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	3480460	3481231	6593819		Planktothrix_phage(100.0%)	1	NA	NA
WP_099478105.1|3480460_3481231_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.3	8.3e-29
>prophage 257
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	3495134	3495908	6593819		Escherichia_phage(100.0%)	1	NA	NA
WP_099478115.1|3495134_3495908_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	33.9	1.9e-25
>prophage 258
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	3507490	3508549	6593819		Acinetobacter_phage(100.0%)	1	NA	NA
WP_099478122.1|3507490_3508549_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	25.1	2.7e-14
>prophage 259
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	3524779	3530294	6593819		uncultured_virus(33.33%)	5	NA	NA
WP_077568633.1|3524779_3527212_+	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	39.1	1.8e-114
WP_099478134.1|3527290_3527932_+	nitrite reductase	NA	NA	NA	NA	NA
WP_077568629.1|3528172_3528598_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_077568627.1|3528619_3529372_+	glucose 1-dehydrogenase	NA	Q06VL0	Trichoplusia_ni_ascovirus	36.5	5.8e-27
WP_099478135.1|3529535_3530294_+	SDR family oxidoreductase	NA	A0A0M4JSW6	Mollivirus	28.5	3.5e-11
>prophage 260
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	3533423	3539583	6593819	tRNA	uncultured_Mediterranean_phage(33.33%)	7	NA	NA
WP_099478138.1|3533423_3534734_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	33.9	1.2e-51
WP_099478139.1|3535071_3535845_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_099480642.1|3535931_3536651_-	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	32.9	3.3e-19
WP_099478140.1|3536750_3537275_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_099478141.1|3537632_3538388_+	threonine/serine exporter family protein	NA	NA	NA	NA	NA
WP_007128941.1|3538450_3538894_+	threonine/serine exporter family protein	NA	NA	NA	NA	NA
WP_099478142.1|3538950_3539583_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	34.0	4.0e-05
>prophage 261
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	3543949	3545719	6593819		Enterobacteria_phage(100.0%)	1	NA	NA
WP_099478146.1|3543949_3545719_+	histidine kinase	NA	Q9EYF3	Enterobacteria_phage	29.0	4.7e-51
>prophage 262
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	3550599	3551751	6593819		Streptococcus_phage(100.0%)	1	NA	NA
WP_099480646.1|3550599_3551751_+	glycerate kinase	NA	W6LM47	Streptococcus_phage	38.6	7.8e-47
>prophage 263
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	3563731	3566273	6593819	transposase	Lactobacillus_phage(50.0%)	2	NA	NA
WP_099478157.1|3563731_3564622_+	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	23.5	2.2e-12
WP_099476806.1|3564912_3566273_-|transposase	IS1182 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	41.2	6.3e-88
>prophage 264
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	3579031	3580063	6593819		Epinotia_aporema_granulovirus(100.0%)	1	NA	NA
WP_099478162.1|3579031_3580063_+	glycoside hydrolase family 18 protein	NA	K4EQD9	Epinotia_aporema_granulovirus	32.8	4.8e-32
>prophage 265
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	3586771	3587689	6593819		Streptococcus_phage(100.0%)	1	NA	NA
WP_099478165.1|3586771_3587689_+	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	53.3	3.4e-85
>prophage 266
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	3592983	3593703	6593819		Bacillus_phage(100.0%)	1	NA	NA
WP_077568551.1|3592983_3593703_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.7	5.6e-35
>prophage 267
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	3602042	3606136	6593819		Bodo_saltans_virus(50.0%)	2	NA	NA
WP_099478172.1|3602042_3604139_+	ABC transporter ATP-binding protein/permease	NA	A0A2H4UU96	Bodo_saltans_virus	29.7	5.2e-17
WP_099478173.1|3604135_3606136_+	ATP-binding cassette domain-containing protein	NA	A0A1V0SE00	Indivirus	30.9	9.1e-19
>prophage 268
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	3612592	3614296	6593819		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_099478178.1|3612592_3614296_-	molecular chaperone HscC	NA	F2Y0P3	Organic_Lake_phycodnavirus	37.3	2.8e-85
>prophage 269
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	3618557	3635332	6593819	holin,lysis	Bacillus_phage(50.0%)	12	NA	NA
WP_099478180.1|3618557_3620414_-	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	28.0	4.6e-49
WP_077568522.1|3620736_3621426_-|lysis	CidB/LrgB family autolysis modulator	lysis	NA	NA	NA	NA
WP_077568521.1|3621422_3621794_-|holin	CidA/LrgA family holin-like protein	holin	NA	NA	NA	NA
WP_099478181.1|3621922_3622813_+	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	27.0	1.9e-21
WP_099480652.1|3622979_3624605_+	catalase	NA	A0A2K9L572	Tupanvirus	47.0	1.4e-105
WP_077568516.1|3624810_3625854_+	oxidoreductase	NA	NA	NA	NA	NA
WP_077568514.1|3626025_3626826_+	delta-lactam-biosynthetic de-N-acetylase	NA	NA	NA	NA	NA
WP_099478182.1|3627143_3629432_+	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	34.7	6.3e-08
WP_099480654.1|3630040_3631000_+	ribosome small subunit-dependent GTPase A	NA	NA	NA	NA	NA
WP_077568509.1|3631169_3631709_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_077568507.1|3631733_3633461_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.5	2.1e-48
WP_099478183.1|3633457_3635332_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	30.4	1.3e-51
>prophage 270
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	3642512	3665865	6593819		Bacillus_phage(44.44%)	22	NA	NA
WP_099478190.1|3642512_3643625_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	35.6	7.1e-21
WP_077568497.1|3643746_3644844_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	28.9	2.6e-28
WP_099478191.1|3644836_3645532_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	39.2	8.3e-44
WP_099478192.1|3645743_3646754_-	D-alanyl-D-alanine carboxypeptidase	NA	NA	NA	NA	NA
WP_077568494.1|3646958_3647354_+	transcriptional repressor	NA	NA	NA	NA	NA
WP_077568493.1|3647329_3648145_+	winged helix family transcriptional regulator	NA	NA	NA	NA	NA
WP_099478193.1|3648343_3649813_+	catalase	NA	A0A2K9L0T1	Tupanvirus	53.7	1.0e-120
WP_099478194.1|3650314_3652300_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	36.9	2.9e-09
WP_099478195.1|3652502_3653321_+	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
WP_077568489.1|3653431_3654070_+	ThuA domain-containing protein	NA	NA	NA	NA	NA
WP_077568488.1|3654102_3654804_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_099478196.1|3654800_3656162_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	25.7	9.2e-23
WP_099478197.1|3656252_3656948_+	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_099478198.1|3657182_3657878_+	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_028404109.1|3658150_3658468_+	phasin family protein	NA	NA	NA	NA	NA
WP_099478199.1|3658468_3660139_+	AarF/ABC1/UbiB kinase family protein	NA	E5ERK4	Ostreococcus_lucimarinus_virus	29.9	4.7e-53
WP_099478200.1|3660162_3660726_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099478201.1|3660849_3662427_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	34.7	2.7e-58
WP_077568482.1|3662504_3662846_+	DUF3243 domain-containing protein	NA	NA	NA	NA	NA
WP_099480656.1|3663181_3664429_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077568481.1|3664553_3665084_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099478202.1|3665382_3665865_+	glutathione peroxidase	NA	A0A1S7DLQ4	Molluscum_contagiosum_virus	35.0	3.1e-13
>prophage 271
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	3685384	3686659	6593819		Staphylococcus_phage(100.0%)	1	NA	NA
WP_099478213.1|3685384_3686659_+	MFS transporter	NA	A0A2H4PQR6	Staphylococcus_phage	29.2	9.8e-35
>prophage 272
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	3698586	3699501	6593819		Mycobacterium_phage(100.0%)	1	NA	NA
WP_077568466.1|3698586_3699501_+	serine hydrolase	NA	Q19Y16	Mycobacterium_phage	26.2	2.1e-07
>prophage 273
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	3702529	3704263	6593819	tRNA	Escherichia_phage(100.0%)	1	NA	NA
WP_077568463.1|3702529_3704263_+|tRNA	glutamine--tRNA ligase/YqeY domain fusion protein	tRNA	A0A222YZ70	Escherichia_phage	53.3	3.4e-163
>prophage 274
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	3709352	3712685	6593819		Leptospira_phage(100.0%)	1	NA	NA
WP_099478223.1|3709352_3712685_-	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	25.7	5.0e-46
>prophage 275
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	3725050	3726223	6593819		Pandoravirus(100.0%)	1	NA	NA
WP_099478229.1|3725050_3726223_+	threonylcarbamoyl-AMP synthase	NA	A0A291ATS8	Pandoravirus	43.2	3.7e-52
>prophage 276
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	3729395	3732839	6593819		Aeromonas_phage(50.0%)	3	NA	NA
WP_099478234.1|3729395_3730646_+	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	52.6	1.5e-96
WP_007128785.1|3730960_3731590_+	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_077568446.1|3731681_3732839_+	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A0N9R0B2	Chrysochromulina_ericina_virus	30.5	1.2e-23
>prophage 277
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	3744635	3747559	6593819		Pseudomonas_phage(50.0%)	3	NA	NA
WP_099480662.1|3744635_3745841_+	stage II sporulation protein D	NA	Q2XU88	Pseudomonas_phage	43.0	6.0e-42
WP_099478240.1|3746118_3746856_+	M23 family metallopeptidase	NA	NA	NA	NA	NA
WP_009594246.1|3747274_3747559_+	sporulation transcriptional regulator SpoIIID	NA	M9Q261	Clostridium_phage	45.3	6.8e-13
>prophage 278
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	3751957	3753676	6593819		Streptococcus_phage(100.0%)	1	NA	NA
WP_099478242.1|3751957_3753676_+	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	46.7	7.8e-144
>prophage 279
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	3767774	3769655	6593819		Bacillus_phage(50.0%)	2	NA	NA
WP_099478247.1|3767774_3768062_+	alpha/beta-type small acid-soluble spore protein	NA	A0A1P8CX76	Bacillus_phage	41.8	6.7e-08
WP_099478248.1|3768449_3769655_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	72.7	2.4e-163
>prophage 280
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	3773901	3777490	6593819		Bacillus_phage(50.0%)	3	NA	NA
WP_007133256.1|3773901_3774624_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	27.5	6.0e-05
WP_099478250.1|3774814_3775237_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099478251.1|3775600_3777490_+	DEAD/DEAH box helicase family protein	NA	A0A1X9I5S6	Streptococcus_phage	42.3	7.7e-60
>prophage 281
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	3783399	3783636	6593819		Vibrio_phage(100.0%)	1	NA	NA
WP_099478257.1|3783399_3783636_+	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	51.0	1.6e-07
>prophage 282
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	3792493	3794365	6593819		Pseudomonas_phage(100.0%)	1	NA	NA
WP_099478265.1|3792493_3794365_+	glycosyltransferase	NA	S5WBE2	Pseudomonas_phage	24.4	3.0e-08
>prophage 283
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	3797578	3797776	6593819		Lactococcus_phage(100.0%)	1	NA	NA
WP_009225364.1|3797578_3797776_+	cold shock domain-containing protein	NA	Q9AZD3	Lactococcus_phage	66.1	3.7e-18
>prophage 284
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	3802484	3803597	6593819		Pseudomonas_phage(100.0%)	1	NA	NA
WP_099480668.1|3802484_3803597_+	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	38.7	7.1e-05
>prophage 285
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	3808854	3811102	6593819		Klosneuvirus(50.0%)	2	NA	NA
WP_099478271.1|3808854_3810093_+	acetylornithine transaminase	NA	A0A1V0SKB7	Klosneuvirus	30.2	1.0e-28
WP_077568393.1|3810145_3811102_+	ornithine carbamoyltransferase	NA	M1I6M4	Paramecium_bursaria_Chlorella_virus	28.8	1.3e-23
>prophage 286
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	3817900	3822382	6593819		Planktothrix_phage(33.33%)	4	NA	NA
WP_007132274.1|3817900_3818587_+	cell division ATP-binding protein FtsE	NA	G9BWD6	Planktothrix_phage	34.3	2.2e-25
WP_099478277.1|3818576_3819485_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_099478278.1|3819512_3820787_+	M23 family metallopeptidase	NA	Q8SBN9	Clostridium_phage	47.9	2.8e-21
WP_077568385.1|3820912_3822382_+	S41 family peptidase	NA	A0A0R6PIZ1	Moraxella_phage	31.1	4.5e-23
>prophage 287
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	3827198	3828146	6593819		Staphylococcus_phage(100.0%)	1	NA	NA
WP_077568381.1|3827198_3828146_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	31.6	1.0e-28
>prophage 288
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	3834784	3844089	6593819		uncultured_Mediterranean_phage(66.67%)	5	NA	NA
WP_099478288.1|3834784_3837652_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	58.1	0.0e+00
WP_077568374.1|3838090_3838297_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077568373.1|3838665_3839751_+	trypsin-like peptidase domain-containing protein	NA	A0A1B1IT49	uncultured_Mediterranean_phage	26.8	8.2e-14
WP_099478289.1|3839747_3841679_+	copper amine oxidase N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_099478291.1|3842133_3844089_+	TetM/TetW/TetO/TetS family tetracycline resistance ribosomal protection protein	NA	E4ZFJ7	Streptococcus_phage	30.0	2.5e-69
>prophage 289
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	3847246	3849760	6593819		Phage_TP(100.0%)	1	NA	NA
WP_099478292.1|3847246_3849760_+	U32 family peptidase	NA	Q6DW11	Phage_TP	33.3	4.6e-28
>prophage 290
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	3860563	3862429	6593819		Yellowstone_lake_phycodnavirus(100.0%)	1	NA	NA
WP_099478297.1|3860563_3862429_+	3D-(3,5/4)-trihydroxycyclohexane-1,2-dione acylhydrolase (decyclizing)	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	22.5	8.0e-17
>prophage 291
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	3868884	3883340	6593819		Catovirus(33.33%)	11	NA	NA
WP_099480674.1|3868884_3869889_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	33.0	2.0e-35
WP_099478303.1|3870464_3871502_-	acyltransferase family protein	NA	NA	NA	NA	NA
WP_099478304.1|3872070_3872943_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	53.0	2.4e-77
WP_099478305.1|3873019_3875479_-	O-antigen ligase family protein	NA	NA	NA	NA	NA
WP_099478306.1|3875593_3876523_+	NAD-dependent epimerase/dehydratase family protein	NA	A0A2K9L0I7	Tupanvirus	38.0	9.3e-51
WP_099478307.1|3876540_3877317_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_099478308.1|3877330_3878062_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.9	5.9e-16
WP_099478309.1|3878083_3878953_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_099478310.1|3878937_3880632_+	glycosyltransferase	NA	A0A1V0SAH6	Catovirus	42.9	3.1e-12
WP_099478311.1|3880651_3881641_+	methyltransferase	NA	NA	NA	NA	NA
WP_099478312.1|3881657_3883340_+	glycosyltransferase	NA	A0A1V0SAH6	Catovirus	42.9	3.1e-12
>prophage 292
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	3887668	3890011	6593819		Escherichia_phage(66.67%)	3	NA	NA
WP_099478317.1|3887668_3888412_+	NTP transferase domain-containing protein	NA	G3MA50	Bacillus_virus	46.2	6.7e-52
WP_099478318.1|3888428_3888977_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	50.0	1.6e-42
WP_099478319.1|3888988_3890011_+	dTDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	45.3	1.9e-76
>prophage 293
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	3897733	3907178	6593819		Bacillus_phage(66.67%)	3	NA	NA
WP_099478326.1|3897733_3900064_+	DNA helicase PcrA	NA	A7KV33	Bacillus_phage	41.0	6.7e-130
WP_099478327.1|3900194_3902210_+	NAD-dependent DNA ligase LigA	NA	Q332J4	Clostridium_botulinum_C_phage	34.6	6.4e-97
WP_157929360.1|3902750_3907178_+	S8 family serine peptidase	NA	A0A217EQY2	Bacillus_phage	37.5	1.3e-20
>prophage 294
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	3915265	3918096	6593819		Staphylococcus_phage(100.0%)	4	NA	NA
WP_099478331.1|3915265_3916207_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	35.6	6.6e-36
WP_077568329.1|3916199_3916955_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_007132620.1|3917006_3917372_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_099478332.1|3917397_3918096_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	3.5e-18
>prophage 295
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	3947753	3950210	6593819	protease	Cronobacter_phage(100.0%)	1	NA	NA
WP_077568307.1|3947753_3950210_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	K4FB40	Cronobacter_phage	40.8	2.0e-132
>prophage 296
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	3960076	3961483	6593819	tRNA	Moumouvirus(100.0%)	1	NA	NA
WP_099478348.1|3960076_3961483_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	28.8	2.9e-48
>prophage 297
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	3965086	3965620	6593819		Bacillus_virus(100.0%)	1	NA	NA
WP_007132581.1|3965086_3965620_+	transcription termination/antitermination protein NusG	NA	G3MAW2	Bacillus_virus	34.2	1.5e-13
>prophage 298
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	3969418	3981643	6593819		uncultured_Mediterranean_phage(25.0%)	7	NA	NA
WP_077568293.1|3969418_3972964_+	DNA-directed RNA polymerase subunit beta	NA	A0A1B1ISA9	uncultured_Mediterranean_phage	23.8	5.5e-51
WP_077568292.1|3973058_3976673_+	DNA-directed RNA polymerase subunit beta'	NA	R4TQM7	Phaeocystis_globosa_virus	24.7	2.9e-63
WP_077568291.1|3976845_3977094_+	ribosomal L7Ae/L30e/S12e/Gadd45 family protein	NA	NA	NA	NA	NA
WP_006212930.1|3977236_3977656_+	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_007132572.1|3977709_3978180_+	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_099478352.1|3978225_3980304_+	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	28.5	4.8e-63
WP_077568289.1|3980452_3981643_+	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	25.7	1.1e-14
>prophage 299
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	4003122	4005138	6593819		Moumouvirus(50.0%)	2	NA	NA
WP_099478357.1|4003122_4004292_+	sulfate adenylyltransferase	NA	A0A2P1ELS9	Moumouvirus	30.5	8.2e-44
WP_077568277.1|4004364_4005138_+	N-acetylmuramoyl-L-alanine amidase CwlD	NA	M4ZRP4	Bacillus_phage	27.8	2.3e-10
>prophage 300
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	4026474	4028307	6593819		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_099478365.1|4026474_4028307_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	M1HVL7	Paramecium_bursaria_Chlorella_virus	41.0	2.9e-112
>prophage 301
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	4032584	4034843	6593819		Bacillus_virus(100.0%)	1	NA	NA
WP_099478368.1|4032584_4034843_-	EAL domain-containing protein	NA	G3MA91	Bacillus_virus	39.5	4.2e-28
>prophage 302
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	4037844	4038741	6593819		Streptococcus_phage(100.0%)	1	NA	NA
WP_099478371.1|4037844_4038741_+	AraC family transcriptional regulator	NA	A0A1B0RXG1	Streptococcus_phage	38.9	1.7e-20
>prophage 303
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	4041911	4049032	6593819		uncultured_Caudovirales_phage(50.0%)	4	NA	NA
WP_099478373.1|4041911_4043144_-	sodium:proton antiporter	NA	A0A2H4J178	uncultured_Caudovirales_phage	34.8	3.9e-28
WP_099478374.1|4043339_4043966_+	DUF421 domain-containing protein	NA	NA	NA	NA	NA
WP_077568255.1|4044293_4044662_+	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_099480680.1|4045282_4049032_+	S-layer homology domain-containing protein	NA	A0A2K9L3D4	Tupanvirus	32.2	1.1e-41
>prophage 304
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	4055314	4062157	6593819		Mollivirus(25.0%)	9	NA	NA
WP_077568247.1|4055314_4056058_+	SDR family oxidoreductase	NA	A0A0M4JSW6	Mollivirus	28.6	1.9e-14
WP_099480682.1|4056136_4056943_-	bclB domain-containing protein	NA	A0A285PXU9	Cedratvirus	63.9	1.9e-47
WP_157929315.1|4057477_4057627_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099478382.1|4057890_4058421_+	DUF2179 domain-containing protein	NA	NA	NA	NA	NA
WP_099478383.1|4058623_4059157_-	DinB family protein	NA	NA	NA	NA	NA
WP_077568242.1|4059240_4060188_-	YafY family transcriptional regulator	NA	A0A1B0RXM1	Streptococcus_phage	27.1	6.2e-10
WP_167392980.1|4060436_4060652_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099478384.1|4060690_4061347_+	ribonuclease H family protein	NA	NA	NA	NA	NA
WP_099478385.1|4061374_4062157_+	Cof-type HAD-IIB family hydrolase	NA	Q0GXW5	Lactococcus_phage	24.1	6.3e-08
>prophage 305
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	4071238	4072540	6593819		Geobacillus_virus(100.0%)	1	NA	NA
WP_099478390.1|4071238_4072540_+	pyrimidine-nucleoside phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	61.9	5.2e-140
>prophage 306
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	4082006	4083113	6593819		Planktothrix_phage(100.0%)	1	NA	NA
WP_077568226.1|4082006_4083113_+	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	33.3	5.0e-19
>prophage 307
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	4099781	4101572	6593819		Enterobacteria_phage(100.0%)	1	NA	NA
WP_099478397.1|4099781_4101572_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	28.2	8.7e-21
>prophage 308
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	4113921	4115748	6593819		Enterobacteria_phage(100.0%)	1	NA	NA
WP_077569106.1|4113921_4115748_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	29.0	2.3e-13
>prophage 309
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	4119089	4120442	6593819		Pandoravirus(100.0%)	1	NA	NA
WP_077568203.1|4119089_4120442_+	beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	35.4	1.1e-73
>prophage 310
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	4128245	4130429	6593819		Klosneuvirus(50.0%)	2	NA	NA
WP_099478405.1|4128245_4129151_+	aldo/keto reductase	NA	A0A1V0SKP9	Klosneuvirus	30.9	1.1e-06
WP_077568197.1|4129562_4130429_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	33.8	1.4e-21
>prophage 311
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	4136643	4144516	6593819		Pandoravirus(25.0%)	5	NA	NA
WP_077569104.1|4136643_4137945_+	homocysteine synthase	NA	A0A0B5JD48	Pandoravirus	26.9	1.5e-17
WP_099478408.1|4138183_4139317_+	PEP-utilizing enzyme, TIM barrel domain protein	NA	NA	NA	NA	NA
WP_099478409.1|4139740_4141780_+	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	40.0	3.1e-115
WP_099478410.1|4143283_4144225_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	48.1	1.4e-70
WP_007131704.1|4144279_4144516_+	glutaredoxin family protein	NA	A0A1B1P8E0	Bacillus_phage	50.9	5.0e-09
>prophage 312
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	4161888	4163520	6593819		Tupanvirus(100.0%)	1	NA	NA
WP_007131689.1|4161888_4163520_+	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	27.6	9.3e-54
>prophage 313
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	4170880	4180083	6593819		Bacillus_phage(50.0%)	7	NA	NA
WP_077568167.1|4170880_4172056_+	SpoIIE family protein phosphatase	NA	W8CYM9	Bacillus_phage	30.8	9.1e-11
WP_099478421.1|4172052_4175712_+	response regulator	NA	A0A1V0SGX0	Hokovirus	31.7	4.0e-36
WP_077568165.1|4175812_4176679_+	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_077568164.1|4176699_4178382_+	response regulator	NA	A0A1V0SGX0	Hokovirus	40.2	4.4e-67
WP_077568163.1|4178512_4178836_+	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_077568162.1|4178866_4179316_+	anti-sigma B factor RsbW	NA	NA	NA	NA	NA
WP_077568161.1|4179312_4180083_+	sigma-70 family RNA polymerase sigma factor	NA	A0A0Y0AU18	Bacillus_phage	28.2	2.3e-15
>prophage 314
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	4185241	4186685	6593819	protease	Bacillus_virus(50.0%)	2	NA	NA
WP_077568154.1|4185241_4185781_+|protease	spore protease YyaC	protease	G3M9W0	Bacillus_virus	35.4	2.4e-19
WP_077568153.1|4185887_4186685_+	alpha/beta hydrolase	NA	W8ECL9	Mycobacterium_phage	25.9	5.6e-12
>prophage 315
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	4197160	4198084	6593819		Staphylococcus_phage(100.0%)	1	NA	NA
WP_099478426.1|4197160_4198084_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	33.5	6.3e-23
>prophage 316
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	4203662	4204376	6593819		Bacillus_virus(100.0%)	1	NA	NA
WP_099478428.1|4203662_4204376_+	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	43.8	6.1e-18
>prophage 317
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	4224131	4227378	6593819		Synechococcus_phage(50.0%)	2	NA	NA
WP_077568122.1|4224131_4225682_+	glucose-6-phosphate dehydrogenase	NA	M1UG55	Synechococcus_phage	36.3	1.1e-83
WP_077568121.1|4225797_4227378_+	peptide chain release factor 3	NA	A0A2K9L6L3	Tupanvirus	32.8	2.2e-12
>prophage 318
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	4232199	4233288	6593819		Microcystis_virus(100.0%)	1	NA	NA
WP_099478436.1|4232199_4233288_-	M23 family metallopeptidase	NA	A0A7K9	Microcystis_virus	35.8	6.7e-08
>prophage 319
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	4241953	4242175	6593819		Bacillus_phage(100.0%)	1	NA	NA
WP_007131961.1|4241953_4242175_-	alpha/beta-type small acid-soluble spore protein	NA	A0A1P8CX76	Bacillus_phage	52.1	1.0e-08
>prophage 320
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	4245247	4245475	6593819		Bacillus_phage(100.0%)	1	NA	NA
WP_077568103.1|4245247_4245475_+	alpha/beta-type small acid-soluble spore protein	NA	Q77YX0	Bacillus_phage	52.1	4.0e-08
>prophage 321
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	4263576	4267222	6593819		Organic_Lake_phycodnavirus(50.0%)	4	NA	NA
WP_077568090.1|4263576_4264593_+	methionine ABC transporter ATP-binding protein	NA	F2Y165	Organic_Lake_phycodnavirus	23.1	1.7e-05
WP_099478453.1|4264592_4265261_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_099478454.1|4265326_4266169_+	MetQ/NlpA family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_077568086.1|4266448_4267222_+	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	27.0	1.5e-09
>prophage 322
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	4270686	4273996	6593819		Lake_Baikal_phage(50.0%)	5	NA	NA
WP_007131990.1|4270686_4271046_+	iron-sulfur cluster assembly accessory protein	NA	A0A2H4N7M3	Lake_Baikal_phage	41.7	3.5e-14
WP_028404799.1|4271249_4271459_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077568081.1|4271680_4272343_+	YheC/YheD family protein	NA	NA	NA	NA	NA
WP_028404801.1|4272627_4272771_+	sporulation histidine kinase inhibitor Sda	NA	NA	NA	NA	NA
WP_099478456.1|4272994_4273996_-	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2K9L162	Tupanvirus	31.9	1.7e-26
>prophage 323
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	4279408	4351738	6593819	protease,portal,plate,holin,tail	Bacillus_phage(25.71%)	77	NA	NA
WP_099478458.1|4279408_4280362_+	primosomal protein DnaI	NA	S5MU12	Brevibacillus_phage	35.8	5.4e-46
WP_007132001.1|4280459_4280615_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007132002.1|4280865_4281183_+	thioredoxin	NA	A0A1X9I9P5	Staphylococcus_phage	45.7	8.1e-23
WP_157929317.1|4281163_4281340_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099478459.1|4281482_4283600_+	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
WP_099478460.1|4283571_4285260_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_099478461.1|4285761_4287102_+	Trk family potassium uptake protein	NA	NA	NA	NA	NA
WP_077568072.1|4287118_4287793_+	TrkA family potassium uptake protein	NA	NA	NA	NA	NA
WP_077568071.1|4287815_4288742_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_099478462.1|4289013_4289682_+	succinate dehydrogenase cytochrome b558 subunit	NA	NA	NA	NA	NA
WP_077568069.1|4289957_4291703_+	succinate dehydrogenase flavoprotein subunit	NA	NA	NA	NA	NA
WP_077568068.1|4291718_4292483_+	succinate dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_099478463.1|4292602_4293403_+	AAC(3) family N-acetyltransferase	NA	O64018	Bacillus_phage	45.1	2.2e-56
WP_099478464.1|4293530_4294226_+	two pore domain potassium channel family protein	NA	NA	NA	NA	NA
WP_099478465.1|4294431_4295811_-	aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_099478466.1|4295974_4296883_+	metallophosphoesterase	NA	NA	NA	NA	NA
WP_077568063.1|4297186_4297996_-	histidinol-phosphatase	NA	NA	NA	NA	NA
WP_007132016.1|4298068_4298971_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_099478467.1|4299381_4299840_+	chemotaxis protein CheX	NA	NA	NA	NA	NA
WP_099480693.1|4299901_4300714_+	SDR family oxidoreductase	NA	W8CYX9	Bacillus_phage	42.7	7.7e-09
WP_099478468.1|4300722_4301556_-	nucleotidyltransferase domain-containing protein	NA	A0A1X9I6C9	Streptococcus_phage	45.8	6.2e-70
WP_099478469.1|4301744_4303085_+	DEAD/DEAH box helicase	NA	A0A1V0SBR7	Catovirus	31.9	1.0e-45
WP_099478470.1|4303236_4303989_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.7	1.0e-23
WP_099478471.1|4303985_4305206_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_077568058.1|4305347_4305473_-	sporulation protein YjcZ	NA	NA	NA	NA	NA
WP_099478472.1|4305603_4306902_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_077568056.1|4307029_4307644_-	pyridoxamine 5'-phosphate oxidase family protein	NA	NA	NA	NA	NA
WP_099478473.1|4307768_4309268_+	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	22.6	1.9e-16
WP_077568054.1|4309288_4310074_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_167393027.1|4310717_4311584_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_077568053.1|4311616_4312462_-	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
WP_077569098.1|4312840_4313470_+	ECF transporter S component	NA	NA	NA	NA	NA
WP_077568052.1|4313462_4315292_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	29.0	1.2e-12
WP_077568051.1|4315288_4316095_+	energy-coupling factor transporter transmembrane protein EcfT	NA	NA	NA	NA	NA
WP_077568050.1|4316531_4317101_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_077568049.1|4317105_4317474_+	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_077568048.1|4317599_4318196_+	LysE family transporter	NA	NA	NA	NA	NA
WP_099478474.1|4318202_4318982_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_077568046.1|4319316_4320054_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077569097.1|4320556_4320976_+	YvaD family protein	NA	NA	NA	NA	NA
WP_077568045.1|4320972_4321533_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_007132039.1|4321714_4322140_-	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_077568044.1|4322216_4322636_-	transcriptional regulator	NA	S6C481	Thermus_phage	40.4	1.3e-20
WP_077568043.1|4322934_4323444_+	transcriptional regulator	NA	A0A0C5AN03	Paenibacillus_phage	67.9	1.0e-46
WP_077568042.1|4323778_4324576_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_077568041.1|4324846_4325803_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_099478475.1|4326132_4326987_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099478476.1|4326999_4327209_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099478477.1|4327211_4328681_+|tail	phage tail sheath family protein	tail	A0A0N7AEC6	Bacillus_phage	36.5	6.6e-75
WP_007132045.1|4328824_4329232_+|tail	phage tail tube protein	tail	A0A2H4J032	uncultured_Caudovirales_phage	60.3	2.9e-41
WP_007132046.1|4329408_4329843_+	hypothetical protein	NA	A0A2H4J883	uncultured_Caudovirales_phage	40.6	3.0e-20
WP_099478478.1|4330015_4331782_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099478479.1|4331846_4332482_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A0N7ACF7	Bacillus_phage	48.4	5.1e-40
WP_099478480.1|4332478_4333456_+|portal	phage portal protein	portal	A0A0N6W8H4	Bacillus_phage	48.6	4.1e-81
WP_099478481.1|4333448_4333838_+	hypothetical protein	NA	A0A0N7ACD3	Bacillus_phage	32.2	8.2e-09
WP_099478482.1|4333830_4334292_+	DUF2634 domain-containing protein	NA	A0A0N7ACH4	Bacillus_phage	40.0	4.8e-24
WP_099478483.1|4334291_4335446_+|plate	baseplate J/gp47 family protein	plate	S6AVU3	Thermus_phage	34.2	7.8e-39
WP_099478484.1|4335438_4336005_+	YmfQ family protein	NA	A0A0A7RUW8	Clostridium_phage	42.1	7.5e-27
WP_099478485.1|4336006_4337383_+	hypothetical protein	NA	S6B1J7	Thermus_phage	53.3	2.3e-21
WP_157929318.1|4337464_4337680_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099478487.1|4337962_4338400_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007132056.1|4338396_4338570_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099478488.1|4338570_4339890_+|tail	phage tail sheath family protein	tail	S5MNC1	Brevibacillus_phage	50.1	2.5e-118
WP_007132058.1|4339891_4340350_+|tail	phage tail tube protein	tail	A0A0K2CNG3	Brevibacillus_phage	55.0	4.2e-44
WP_007132059.1|4340377_4340800_+|portal	phage portal protein	portal	A0A0A7RTY8	Clostridium_phage	37.0	4.6e-13
WP_077568037.1|4340994_4342827_+	hypothetical protein	NA	A0A0K2CP22	Brevibacillus_phage	25.0	4.6e-33
WP_077568036.1|4342828_4343545_+	LysM peptidoglycan-binding domain-containing protein	NA	S6BFJ4	Thermus_phage	39.4	4.4e-40
WP_099478489.1|4343558_4344524_+	hypothetical protein	NA	S5MA66	Brevibacillus_phage	51.6	3.0e-92
WP_099480697.1|4344530_4344827_+	DUF2577 domain-containing protein	NA	A0A0A7RTJ2	Clostridium_phage	44.2	4.3e-18
WP_077568034.1|4344823_4345237_+	DUF2634 domain-containing protein	NA	A0A0A7RTU4	Clostridium_phage	44.0	1.1e-27
WP_099478490.1|4345229_4346288_+|plate	baseplate J/gp47 family protein	plate	S6AVU3	Thermus_phage	45.3	1.2e-78
WP_099478491.1|4346284_4346830_+	YmfQ family protein	NA	A0A0A7RUW8	Clostridium_phage	33.1	7.7e-21
WP_099478492.1|4346830_4349407_+	hypothetical protein	NA	U5PTP8	Bacillus_phage	33.6	3.3e-21
WP_099478493.1|4349419_4350031_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077568029.1|4350023_4350161_+	XkdX family protein	NA	A0A142F1G4	Bacillus_phage	55.0	7.3e-05
WP_099478494.1|4350513_4350966_+|holin	phage holin family protein	holin	R9TMD4	Paenibacillus_phage	65.2	4.8e-45
WP_099478495.1|4350952_4351738_+	glucosaminidase domain-containing protein	NA	S5M633	Brevibacillus_phage	65.1	1.3e-50
>prophage 324
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	4356570	4359198	6593819		Acanthocystis_turfacea_Chlorella_virus(50.0%)	3	NA	NA
WP_099478498.1|4356570_4357524_-	D-2-hydroxyacid dehydrogenase	NA	M1I636	Acanthocystis_turfacea_Chlorella_virus	23.9	5.0e-15
WP_167393028.1|4357667_4358225_+	RNA 2',3'-cyclic phosphodiesterase	NA	NA	NA	NA	NA
WP_077568018.1|4358322_4359198_+	cell wall hydrolase	NA	A0A141HRV8	Bacillus_phage	49.1	1.8e-16
>prophage 325
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	4370358	4392804	6593819	tRNA	Bacillus_virus(18.18%)	24	NA	NA
WP_007132316.1|4370358_4370727_-	helix-turn-helix domain-containing protein	NA	D2XQ11	Bacillus_virus	39.4	2.8e-14
WP_077568012.1|4370995_4371358_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077568011.1|4371734_4372676_+	LCP family protein	NA	NA	NA	NA	NA
WP_007132319.1|4372860_4373055_-	helix-turn-helix transcriptional regulator	NA	D2XQ11	Bacillus_virus	48.4	5.7e-11
WP_077568010.1|4373635_4374553_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	37.6	3.8e-36
WP_077568009.1|4374542_4375319_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_077568008.1|4375576_4375990_-	polymer-forming cytoskeletal protein	NA	NA	NA	NA	NA
WP_077568007.1|4376029_4377004_-	M23 family metallopeptidase	NA	V5R8R0	Arthrobacter_phage	47.7	9.9e-19
WP_099478502.1|4377294_4378725_+	cardiolipin synthase	NA	NA	NA	NA	NA
WP_099480701.1|4378957_4379845_+	YitT family protein	NA	M1Q1P6	Streptococcus_phage	28.9	1.2e-31
WP_099478503.1|4379975_4381031_-	serine hydrolase	NA	G1DB24	Mycobacterium_phage	27.2	2.9e-08
WP_077568003.1|4381142_4381718_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_077568002.1|4381932_4383081_+	radical SAM protein	NA	A0A1C9EG49	Acidianus_two-tailed_virus	27.0	1.2e-10
WP_077568001.1|4383063_4383981_-	DNA polymerase domain-containing protein	NA	NA	NA	NA	NA
WP_077568000.1|4383986_4384892_-	DNA ligase	NA	A0A068CDF3	Rhizobium_phage	27.8	6.1e-23
WP_099478504.1|4384897_4385821_-	Ku protein	NA	A0A0A1EPK3	Mycobacterium_phage	36.6	3.0e-41
WP_099478505.1|4386004_4386292_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077567998.1|4386295_4386478_+	H-type small acid-soluble spore protein	NA	NA	NA	NA	NA
WP_077569095.1|4386810_4387272_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_099478506.1|4387268_4388057_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_077567996.1|4388074_4388602_+	ribosomal protein S18-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_099478507.1|4388598_4389642_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	40.7	6.3e-64
WP_157929319.1|4389797_4390001_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077567993.1|4390851_4392804_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	30.9	2.2e-62
>prophage 326
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	4396531	4398510	6593819		uncultured_virus(100.0%)	2	NA	NA
WP_007132345.1|4396531_4396813_+	co-chaperone GroES	NA	A0A221S3C8	uncultured_virus	52.2	7.5e-20
WP_028405904.1|4396875_4398510_+	chaperonin GroEL	NA	A0A219YK78	uncultured_virus	57.1	1.3e-159
>prophage 327
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	4409519	4410281	6593819		Anomala_cuprea_entomopoxvirus(100.0%)	1	NA	NA
WP_099478514.1|4409519_4410281_+	ATP-binding cassette domain-containing protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	33.3	5.0e-26
>prophage 328
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	4416174	4417377	6593819		Bacillus_virus(100.0%)	1	NA	NA
WP_077567975.1|4416174_4417377_-	glycine betaine/L-proline ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.4	1.6e-31
>prophage 329
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	4424145	4426203	6593819		Yellowstone_lake_mimivirus(50.0%)	3	NA	NA
WP_099478521.1|4424145_4425333_+	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	30.3	8.3e-36
WP_028406492.1|4425567_4425849_+	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
WP_006212388.1|4425852_4426203_+	type II toxin-antitoxin system PemK/MazF family toxin	NA	A0A2P0ZKX3	Lactobacillus_phage	38.6	2.0e-14
>prophage 330
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	4444653	4445538	6593819		Bacillus_phage(100.0%)	1	NA	NA
WP_099478528.1|4444653_4445538_-	thermonuclease family protein	NA	A0A1P8CWK6	Bacillus_phage	53.9	1.2e-36
>prophage 331
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	4457040	4458162	6593819		Bodo_saltans_virus(100.0%)	1	NA	NA
WP_007132415.1|4457040_4458162_+	deoxyribonuclease IV	NA	A0A2H4UU70	Bodo_saltans_virus	33.8	7.6e-23
>prophage 332
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	4462332	4463262	6593819		Bacillus_phage(100.0%)	1	NA	NA
WP_077567939.1|4462332_4463262_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	30.8	1.5e-11
>prophage 333
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	4479347	4487306	6593819		Streptococcus_phage(33.33%)	9	NA	NA
WP_099478543.1|4479347_4479980_+	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	48.0	9.2e-34
WP_077567928.1|4479986_4480580_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_077567927.1|4480732_4481134_-	YjbQ family protein	NA	NA	NA	NA	NA
WP_077567926.1|4481330_4482146_+	sulfate ABC transporter permease subunit CysT	NA	NA	NA	NA	NA
WP_077567925.1|4482142_4482940_+	sulfate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_099478544.1|4482941_4484006_+	sulfate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	29.0	3.1e-26
WP_077567923.1|4484037_4485093_+	sulfate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_077567922.1|4485382_4485979_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_099478545.1|4486166_4487306_+	serpin family protein	NA	Q08FY2	Deerpox_virus	23.4	5.4e-16
>prophage 334
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	4508772	4509558	6593819		Planktothrix_phage(100.0%)	1	NA	NA
WP_099480709.1|4508772_4509558_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.1	2.9e-13
>prophage 335
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	4527563	4529444	6593819		Acanthamoeba_polyphaga_lentillevirus(100.0%)	1	NA	NA
WP_099478564.1|4527563_4529444_+	DNA helicase RecQ	NA	J2YAJ8	Acanthamoeba_polyphaga_lentillevirus	36.0	6.9e-77
>prophage 336
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	4537130	4538084	6593819		Staphylococcus_phage(100.0%)	1	NA	NA
WP_077567879.1|4537130_4538084_-	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	64.7	1.5e-48
>prophage 337
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	4542998	4547445	6593819		Agrobacterium_phage(50.0%)	6	NA	NA
WP_007127238.1|4542998_4543493_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	38.2	4.7e-17
WP_007127239.1|4543519_4543720_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_007127240.1|4543750_4544110_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_099478571.1|4544315_4544642_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077567875.1|4544644_4545091_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_007127243.1|4545702_4547445_+	biosynthetic-type acetolactate synthase large subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	33.2	9.6e-65
>prophage 338
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	4556132	4562714	6593819	tRNA	Tupanvirus(66.67%)	4	NA	NA
WP_077567867.1|4556132_4557281_+	PAS-domain containing protein	NA	Q8QKW6	Ectocarpus_siliculosus_virus	28.7	2.6e-10
WP_007127252.1|4557451_4558417_+	aldolase catalytic domain-containing protein	NA	NA	NA	NA	NA
WP_099478575.1|4559346_4561212_+	ABC-F type ribosomal protection protein	NA	A0A2K9L3Z8	Tupanvirus	28.9	1.6e-49
WP_099478576.1|4561679_4562714_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	35.8	5.4e-31
>prophage 339
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	4568664	4571034	6593819		Lactobacillus_phage(100.0%)	1	NA	NA
WP_099478579.1|4568664_4571034_+	endonuclease MutS2	NA	Q94M10	Lactobacillus_phage	39.2	1.2e-09
>prophage 340
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	4579931	4581570	6593819		Streptococcus_phage(50.0%)	2	NA	NA
WP_099478583.1|4579931_4580294_+	arsenate reductase family protein	NA	M1PLC0	Streptococcus_phage	45.8	1.6e-19
WP_099478584.1|4580679_4581570_+	flap endonuclease	NA	F8WQ40	Bacillus_phage	28.1	2.1e-23
>prophage 341
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	4588033	4596181	6593819	tRNA	Pandoravirus(25.0%)	6	NA	NA
WP_077567848.1|4588033_4589218_+	aminotransferase class V-fold PLP-dependent enzyme	NA	A0A0B5JD48	Pandoravirus	27.1	2.7e-18
WP_099480717.1|4589238_4590435_+	aminotransferase class V-fold PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_007127282.1|4590633_4591767_+	dehypoxanthine futalosine cyclase	NA	A9ZMK9	Mamastrovirus	43.2	2.6e-23
WP_077567846.1|4591973_4592879_+	putative sporulation protein YtxC	NA	NA	NA	NA	NA
WP_099478587.1|4593339_4595277_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.1	2.3e-123
WP_077567844.1|4595416_4596181_+	3D domain-containing protein	NA	A0A142F1E5	Bacillus_phage	39.8	1.2e-11
>prophage 342
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	4600075	4603992	6593819		Bacillus_phage(66.67%)	3	NA	NA
WP_099478588.1|4600075_4601725_+	trypsin-like peptidase domain-containing protein	NA	A0A1B1IT49	uncultured_Mediterranean_phage	27.3	3.0e-20
WP_077567839.1|4601857_4602544_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	41.6	3.9e-38
WP_077567838.1|4602546_4603992_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	29.8	5.4e-29
>prophage 343
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	4610793	4626992	6593819	tRNA	Enterobacteria_phage(12.5%)	14	NA	NA
WP_099478591.1|4610793_4612581_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	26.3	5.3e-18
WP_077567832.1|4612778_4613834_+	3-deoxy-7-phosphoheptulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	27.0	7.4e-12
WP_007127300.1|4614166_4615591_+	type I glutamate--ammonia ligase	NA	NA	NA	NA	NA
WP_099478592.1|4615771_4616857_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	47.3	2.0e-89
WP_077567830.1|4616997_4617462_+|tRNA	tRNA (uridine(34)/cytosine(34)/5- carboxymethylaminomethyluridine(34)-2'-O)- methyltransferase TrmL	tRNA	NA	NA	NA	NA
WP_007127303.1|4617647_4617902_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	A0A2I7SC16	Paenibacillus_phage	44.9	5.5e-14
WP_099478593.1|4618196_4619282_-	phosphodiester glycosidase family protein	NA	O64042	Bacillus_phage	27.3	8.2e-06
WP_077569078.1|4619278_4619686_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099478594.1|4620055_4620712_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_077567827.1|4620825_4622055_+	PLP-dependent aminotransferase family protein	NA	A0A1X6WGT4	Pacmanvirus	24.0	3.5e-05
WP_099478595.1|4622489_4623314_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007127310.1|4623579_4625475_+	PrkA family serine protein kinase	NA	A0MN77	Thermus_phage	36.7	1.1e-103
WP_099478596.1|4625582_4625783_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077569077.1|4625921_4626992_+	globin-coupled sensor protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	32.2	1.5e-07
>prophage 344
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	4639240	4639990	6593819		Escherichia_phage(100.0%)	1	NA	NA
WP_007127323.1|4639240_4639990_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	34.1	1.6e-24
>prophage 345
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	4644218	4644824	6593819		Streptococcus_phage(100.0%)	1	NA	NA
WP_077569075.1|4644218_4644824_+	YitT family protein	NA	M1Q1P6	Streptococcus_phage	29.2	5.9e-14
>prophage 346
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	4654675	4655443	6593819		Cafeteria_roenbergensis_virus(100.0%)	1	NA	NA
WP_099478615.1|4654675_4655443_+	exodeoxyribonuclease III	NA	E3T4M6	Cafeteria_roenbergensis_virus	44.4	5.5e-57
>prophage 347
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	4663410	4671280	6593819		Streptococcus_phage(25.0%)	6	NA	NA
WP_077567794.1|4663410_4664247_-	YitT family protein	NA	M1Q1P6	Streptococcus_phage	35.0	1.3e-40
WP_099480723.1|4664494_4665259_+	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.7	4.7e-24
WP_099478619.1|4665558_4665897_-	VOC family protein	NA	NA	NA	NA	NA
WP_099478620.1|4666320_4667157_-	sulfurtransferase	NA	NA	NA	NA	NA
WP_099478621.1|4667342_4669598_-	acyltransferase family protein	NA	B5WZU0	Pseudomonas_phage	33.0	1.9e-41
WP_077567790.1|4670119_4671280_-	sporulation protein YhbH	NA	A0A1I9S5U5	Bacillus_phage	31.2	3.9e-14
>prophage 348
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	4676386	4681165	6593819		Clostridium_phage(25.0%)	5	NA	NA
WP_077567783.1|4676386_4676863_+	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	53.5	4.2e-39
WP_007127362.1|4677429_4678212_+	Fe-S cluster assembly ATPase SufC	NA	A0A285PWH2	Cedratvirus	25.7	7.0e-07
WP_077567782.1|4678234_4679539_+	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_099478627.1|4679535_4680756_+	cysteine desulfurase	NA	Q2XUY6	environmental_halophage	44.9	2.0e-109
WP_099478628.1|4680745_4681165_+	SUF system NifU family Fe-S cluster assembly protein	NA	A0A2H4N7M4	Lake_Baikal_phage	43.0	1.5e-11
>prophage 349
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	4696033	4698081	6593819		Bacillus_phage(100.0%)	2	NA	NA
WP_099478636.1|4696033_4697398_-	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	28.9	4.9e-32
WP_099478637.1|4697394_4698081_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.0	1.1e-32
>prophage 350
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	4712400	4716788	6593819		Saccharomonospora_phage(50.0%)	2	NA	NA
WP_099478646.1|4712400_4716138_+	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	38.3	1.1e-214
WP_077567752.1|4716290_4716788_+	phosphatidylglycerophosphatase A	NA	G3MBC5	Bacillus_virus	53.4	3.7e-38
>prophage 351
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	4724716	4746327	6593819		Bacillus_phage(45.45%)	19	NA	NA
WP_099478650.1|4724716_4726009_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	74.1	8.8e-15
WP_077567742.1|4726023_4726965_+	malate dehydrogenase	NA	NA	NA	NA	NA
WP_077567741.1|4727118_4727544_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077567740.1|4728098_4728965_+	glucose 1-dehydrogenase	NA	A0A2N9QUX2	Trichoplusia_ni_ascovirus	44.4	5.3e-56
WP_099478651.1|4729468_4731022_+	fumarate hydratase	NA	NA	NA	NA	NA
WP_077567737.1|4731205_4733014_+	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	35.9	3.7e-43
WP_077567736.1|4733083_4733815_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	34.2	7.9e-37
WP_099478652.1|4734060_4735428_+	chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	42.5	2.1e-06
WP_099478653.1|4735553_4736564_+	PstS family phosphate ABC transporter substrate-binding protein	NA	A0A1B1IWY0	uncultured_Mediterranean_phage	32.8	6.0e-19
WP_077567733.1|4736604_4737537_+	phosphate ABC transporter permease subunit PstC	NA	NA	NA	NA	NA
WP_077567732.1|4737537_4738413_+	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_077567731.1|4738470_4739226_+	phosphate ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	33.5	1.6e-16
WP_077567730.1|4739271_4739931_+	phosphate signaling complex protein PhoU	NA	NA	NA	NA	NA
WP_099478654.1|4740154_4742812_+	DNA polymerase I	NA	A0A1B1IST8	uncultured_Mediterranean_phage	33.7	2.1e-47
WP_099478655.1|4743139_4743973_+	DNA-formamidopyrimidine glycosylase	NA	A0A127AWE5	Bacillus_phage	29.5	1.2e-20
WP_099478656.1|4744106_4744847_+	MntP/YtaF family protein	NA	NA	NA	NA	NA
WP_099478657.1|4744859_4745459_+	dephospho-CoA kinase	NA	NA	NA	NA	NA
WP_077567725.1|4745455_4746022_+	lytic transglycosylase domain-containing protein	NA	A0A0H3V0Q1	Geobacillus_virus	39.7	5.0e-15
WP_007127426.1|4746099_4746327_-	alpha/beta-type small acid-soluble spore protein	NA	A0A1P8CX76	Bacillus_phage	54.1	1.0e-11
>prophage 352
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	4750704	4752486	6593819		Enterobacteria_phage(100.0%)	1	NA	NA
WP_099478660.1|4750704_4752486_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	29.1	6.9e-18
>prophage 353
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	4779662	4780631	6593819		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_099478675.1|4779662_4780631_+	phosphoglycerate dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	34.5	3.8e-31
>prophage 354
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	4801696	4803514	6593819		Enterobacteria_phage(100.0%)	1	NA	NA
WP_099480730.1|4801696_4803514_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	27.1	4.9e-19
>prophage 355
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	4816057	4821136	6593819		Pandoravirus(100.0%)	1	NA	NA
WP_099478689.1|4816057_4821136_+	choice-of-anchor I family protein	NA	S4W5J5	Pandoravirus	26.2	3.0e-26
>prophage 356
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	4824752	4827421	6593819	tRNA	Cronobacter_phage(50.0%)	2	NA	NA
WP_099478691.1|4824752_4826012_+|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	41.4	7.1e-86
WP_077567676.1|4826383_4827421_+	ATP-binding cassette domain-containing protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	28.6	4.3e-20
>prophage 357
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	4833508	4837153	6593819		Vaccinia_virus(100.0%)	2	NA	NA
WP_099478693.1|4833508_4835356_+	glycoside hydrolase family 2	NA	B9U1V4	Vaccinia_virus	25.9	2.1e-33
WP_077567670.1|4835404_4837153_+	beta-galactosidase	NA	B9U1V4	Vaccinia_virus	26.6	3.8e-37
>prophage 358
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	4840566	4841927	6593819	transposase	Streptococcus_phage(100.0%)	1	NA	NA
WP_099476806.1|4840566_4841927_-|transposase	IS1182 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	41.2	6.3e-88
>prophage 359
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	4846492	4847596	6593819		Bacillus_virus(100.0%)	1	NA	NA
WP_077567665.1|4846492_4847596_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.8	1.6e-28
>prophage 360
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	4852322	4853243	6593819		Staphylococcus_phage(100.0%)	1	NA	NA
WP_099478699.1|4852322_4853243_-	proline dehydrogenase family protein	NA	A0A2H4PQT6	Staphylococcus_phage	38.8	2.2e-52
>prophage 361
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	4866003	4866702	6593819		Bacillus_phage(100.0%)	1	NA	NA
WP_099478709.1|4866003_4866702_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.0	1.2e-31
>prophage 362
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	4906002	4913810	6593819		Bacillus_phage(66.67%)	5	NA	NA
WP_099478724.1|4906002_4907778_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.8	2.3e-42
WP_099478725.1|4907761_4909612_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.0	7.1e-42
WP_077567624.1|4909930_4910611_+	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_099478726.1|4910654_4911887_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_099478727.1|4912037_4913810_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	27.8	6.4e-16
>prophage 363
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	4928418	4932945	6593819		Chrysochromulina_ericina_virus(50.0%)	5	NA	NA
WP_099480740.1|4928418_4929204_-	glucose-1-dehydrogenase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	25.0	2.9e-13
WP_099478737.1|4929555_4929903_+	VOC family protein	NA	NA	NA	NA	NA
WP_099478738.1|4930112_4930970_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_099478739.1|4931272_4932064_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_099478740.1|4932060_4932945_-	ATP-binding cassette domain-containing protein	NA	A0A2R8FG22	Brazilian_cedratvirus	33.8	1.6e-20
>prophage 364
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	4938340	4939480	6593819		Acanthamoeba_polyphaga_mimivirus(100.0%)	1	NA	NA
WP_077567599.1|4938340_4939480_-	glutathione-dependent formaldehyde dehydrogenase	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	29.8	4.3e-13
>prophage 365
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	4952829	4956003	6593819		Ectocarpus_siliculosus_virus(100.0%)	1	NA	NA
WP_099478750.1|4952829_4956003_-	response regulator	NA	Q8QKV7	Ectocarpus_siliculosus_virus	25.6	9.7e-31
>prophage 366
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	4965080	4978142	6593819		uncultured_Mediterranean_phage(20.0%)	8	NA	NA
WP_077567581.1|4965080_4967582_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	39.7	5.4e-186
WP_099478753.1|4967603_4969385_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	50.6	4.8e-136
WP_099478754.1|4969473_4971588_-	multicopper oxidase family protein	NA	NA	NA	NA	NA
WP_077567578.1|4971744_4972431_+	response regulator transcription factor	NA	A0A220YL79	Alteromonas_virus	22.2	3.3e-05
WP_099478755.1|4972427_4973510_+	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_077567576.1|4973620_4975168_-	hypothetical protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	24.3	2.0e-13
WP_077567575.1|4975437_4976340_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_099478756.1|4976951_4978142_+	glycine C-acetyltransferase	NA	D2TEZ5	Emiliania_huxleyi_virus	30.7	1.1e-43
>prophage 367
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	5006014	5006728	6593819		Bacillus_virus(100.0%)	1	NA	NA
WP_077567554.1|5006014_5006728_+	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	41.3	6.5e-20
>prophage 368
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	5011838	5012594	6593819		Bacillus_virus(100.0%)	1	NA	NA
WP_077567549.1|5011838_5012594_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	27.3	9.3e-17
>prophage 369
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	5032218	5039335	6593819		Arthrobacter_phage(33.33%)	8	NA	NA
WP_077569062.1|5032218_5033421_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A0A7HER1	Arthrobacter_phage	36.8	6.9e-06
WP_077567530.1|5033654_5033924_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077567529.1|5034070_5034373_+	heme biosynthesis protein HemY	NA	NA	NA	NA	NA
WP_007127675.1|5034400_5034622_+	DUF1450 domain-containing protein	NA	NA	NA	NA	NA
WP_077567528.1|5034748_5035015_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099478771.1|5035200_5037192_-	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	26.7	2.0e-50
WP_099478772.1|5037374_5038535_-	class I SAM-dependent RNA methyltransferase	NA	NA	NA	NA	NA
WP_077567525.1|5038702_5039335_+	O-methyltransferase	NA	S5YRC3	Mycobacterium_phage	34.8	1.1e-23
>prophage 370
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	5044458	5053229	6593819		Acanthocystis_turfacea_Chlorella_virus(25.0%)	10	NA	NA
WP_007127684.1|5044458_5045232_+	glycerophosphoryl diester phosphodiesterase	NA	M1HZ90	Acanthocystis_turfacea_Chlorella_virus	29.3	6.4e-21
WP_077567520.1|5045236_5045860_+	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_099478776.1|5045893_5046703_+	DUF92 domain-containing protein	NA	NA	NA	NA	NA
WP_099478777.1|5046765_5048736_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	27.8	2.1e-44
WP_077567517.1|5048848_5049883_-	M42 family metallopeptidase	NA	NA	NA	NA	NA
WP_077567516.1|5049973_5050312_-	DUF1049 domain-containing protein	NA	NA	NA	NA	NA
WP_099480742.1|5050423_5052214_-	oligoendopeptidase F	NA	A0A1X9I5X5	Streptococcus_phage	27.6	9.5e-60
WP_007127691.1|5052415_5052598_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077567515.1|5052601_5052835_-	hypothetical protein	NA	NA	NA	NA	NA
WP_028405178.1|5053031_5053229_+	cold shock domain-containing protein	NA	Q9AZD3	Lactococcus_phage	67.7	7.5e-19
>prophage 371
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	5059439	5062161	6593819		Streptococcus_phage(50.0%)	2	NA	NA
WP_099478781.1|5059439_5060261_-	YitT family protein	NA	M1Q1P6	Streptococcus_phage	31.3	1.8e-29
WP_099478782.1|5060550_5062161_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	38.3	4.2e-67
>prophage 372
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	5068222	5076529	6593819		Ostreococcus_tauri_virus(20.0%)	8	NA	NA
WP_099478786.1|5068222_5069662_+	ammonium transporter	NA	H8ZJB2	Ostreococcus_tauri_virus	37.3	1.5e-63
WP_099478787.1|5069707_5070796_+	signal transduction protein	NA	NA	NA	NA	NA
WP_099478788.1|5070792_5071533_+	DNA polymerase III subunit epsilon	NA	A0A0K2SUJ2	Clostridium_phage	29.3	2.3e-12
WP_157929327.1|5071609_5072104_-	M67 family metallopeptidase	NA	A0A1P8DTI6	Proteus_phage	28.8	2.3e-08
WP_099478790.1|5072252_5072810_+	TlpA family protein disulfide reductase	NA	NA	NA	NA	NA
WP_099478791.1|5072878_5074495_-	citramalate synthase	NA	NA	NA	NA	NA
WP_099478792.1|5074841_5076143_+	DNA polymerase IV	NA	A0A290GHP0	Caldibacillus_phage	28.9	1.5e-22
WP_007127715.1|5076289_5076529_+	ferredoxin	NA	A0A127AYY7	Bacillus_phage	49.4	6.1e-15
>prophage 373
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	5118730	5120371	6593819		Enterobacteria_phage(100.0%)	1	NA	NA
WP_099480744.1|5118730_5120371_+	histidine kinase	NA	Q9EYF3	Enterobacteria_phage	33.8	5.3e-25
>prophage 374
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	5128344	5129151	6593819		Bacillus_phage(100.0%)	1	NA	NA
WP_099478818.1|5128344_5129151_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A142F1B8	Bacillus_phage	29.5	1.1e-07
>prophage 375
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	5132528	5137543	6593819		uncultured_Caudovirales_phage(50.0%)	2	NA	NA
WP_007127762.1|5132528_5134286_-	DEAD/DEAH box helicase family protein	NA	A0A2H4J643	uncultured_Caudovirales_phage	30.6	6.7e-58
WP_099478821.1|5134888_5137543_+	adenosylcobalamin-dependent ribonucleoside-diphosphate reductase	NA	A0A0K2CP92	Brevibacillus_phage	47.0	4.4e-170
>prophage 376
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	5151887	5152370	6593819		Caulobacter_phage(100.0%)	1	NA	NA
WP_099478829.1|5151887_5152370_+	DUF1643 domain-containing protein	NA	A0A1V0EBT6	Caulobacter_phage	39.2	1.0e-21
>prophage 377
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	5174184	5174610	6593819		Paenibacillus_phage(100.0%)	1	NA	NA
WP_099478854.1|5174184_5174610_+	NUDIX hydrolase	NA	D0R7I2	Paenibacillus_phage	32.1	5.4e-06
>prophage 378
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	5179598	5180762	6593819	holin	Bacillus_virus(100.0%)	1	NA	NA
WP_099478859.1|5179598_5180762_-|holin	betaine/proline/choline family ABC transporter ATP-binding protein	holin	G3M9Y6	Bacillus_virus	34.1	4.8e-28
>prophage 379
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	5196096	5200676	6593819		Mycobacterium_phage(50.0%)	3	NA	NA
WP_099478876.1|5196096_5197095_+	serine hydrolase	NA	A0A2P0ZZM8	Mycobacterium_phage	25.4	3.5e-19
WP_099478877.1|5197288_5198833_+	response regulator	NA	NA	NA	NA	NA
WP_077567383.1|5198855_5200676_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	27.5	2.4e-18
>prophage 380
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	5219264	5223396	6593819		Cedratvirus(33.33%)	5	NA	NA
WP_077567369.1|5219264_5220080_+	ABC transporter ATP-binding protein	NA	A0A1M7XV31	Cedratvirus	28.5	6.8e-13
WP_077567368.1|5220330_5221518_+	GTP-binding protein	NA	NA	NA	NA	NA
WP_099478884.1|5221552_5222368_+	ATP-binding protein	NA	A0A2K9R7H3	Dishui_lake_phycodnavirus	30.5	2.8e-19
WP_007127873.1|5222461_5222611_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_099478885.1|5222688_5223396_+	metal ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.6	4.1e-22
>prophage 381
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	5239084	5239873	6593819		Planktothrix_phage(100.0%)	1	NA	NA
WP_099478909.1|5239084_5239873_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.7	2.2e-21
>prophage 382
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	5262253	5262757	6593819		Lactococcus_phage(100.0%)	1	NA	NA
WP_099478955.1|5262253_5262757_+	GNAT family N-acetyltransferase	NA	Q9AZG4	Lactococcus_phage	42.9	9.9e-31
>prophage 383
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	5288948	5289761	6593819		Cedratvirus(100.0%)	1	NA	NA
WP_099478989.1|5288948_5289761_-	lipase family protein	NA	A0A285PYI9	Cedratvirus	29.4	2.4e-10
>prophage 384
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	5297174	5303371	6593819		Staphylococcus_phage(50.0%)	6	NA	NA
WP_099479006.1|5297174_5297924_+	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	42.9	1.3e-31
WP_099480764.1|5297941_5299102_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	35.7	4.3e-53
WP_077567303.1|5299495_5300002_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077567302.1|5300116_5301061_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_099479008.1|5301155_5301851_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.4	1.4e-35
WP_077567300.1|5301847_5303371_+	HAMP domain-containing histidine kinase	NA	A0A2K9L0Z8	Tupanvirus	26.4	1.3e-09
>prophage 385
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	5315082	5315421	6593819		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_077567290.1|5315082_5315421_-	helix-turn-helix transcriptional regulator	NA	A0A2H4J145	uncultured_Caudovirales_phage	35.4	1.6e-05
>prophage 386
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	5325485	5326274	6593819		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_077567282.1|5325485_5326274_+	ABC transporter ATP-binding protein	NA	F2Y302	Organic_Lake_phycodnavirus	25.4	7.5e-09
>prophage 387
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	5340023	5342736	6593819		Agrobacterium_phage(50.0%)	4	NA	NA
WP_007127988.1|5340023_5340605_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	53.9	2.4e-49
WP_099479056.1|5340784_5341522_+	RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_099479058.1|5341693_5342197_+	8-oxo-dGTP diphosphatase	NA	NA	NA	NA	NA
WP_099479060.1|5342313_5342736_+	metallothiol transferase FosB	NA	Q2LI91	Bacillus_phage	57.8	1.0e-33
>prophage 388
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	5349322	5352658	6593819		Gordonia_phage(100.0%)	1	NA	NA
WP_099479073.1|5349322_5352658_+	DEAD/DEAH box helicase	NA	A0A160DHD3	Gordonia_phage	30.1	1.7e-41
>prophage 389
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	5362301	5364035	6593819		Enterobacteria_phage(100.0%)	1	NA	NA
WP_077567247.1|5362301_5364035_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	30.8	8.7e-26
>prophage 390
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	5387375	5388626	6593819		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_077567224.1|5387375_5388626_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	62.7	1.7e-07
>prophage 391
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	5392807	5395453	6593819		uncultured_Caudovirales_phage(50.0%)	3	NA	NA
WP_007132170.1|5392807_5393761_+	ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	52.2	1.8e-86
WP_077567218.1|5393750_5394698_+	iron chelate uptake ABC transporter family permease subunit	NA	NA	NA	NA	NA
WP_099479113.1|5394694_5395453_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	30.0	9.1e-20
>prophage 392
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	5421448	5425704	6593819		Klosneuvirus(50.0%)	2	NA	NA
WP_099479139.1|5421448_5423782_+	UvrD-helicase domain-containing protein	NA	A0A1V0SIN4	Klosneuvirus	25.6	3.5e-06
WP_099479141.1|5424000_5425704_+	CHASE3 domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	25.6	8.0e-24
>prophage 393
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	5429046	5433061	6593819		Escherichia_phage(50.0%)	5	NA	NA
WP_099479147.1|5429046_5429784_+	glycerophosphodiester phosphodiesterase	NA	A0A2H4PGQ5	Escherichia_phage	35.6	1.2e-16
WP_099479149.1|5429788_5430997_+	SLC45 family MFS transporter	NA	NA	NA	NA	NA
WP_099479151.1|5431299_5431923_+	conjugal transfer protein TraX	NA	NA	NA	NA	NA
WP_077567195.1|5431986_5432406_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099479153.1|5432485_5433061_+	macro domain-containing protein	NA	A0A0K1L687	Scale_drop_disease_virus	44.4	1.3e-31
>prophage 394
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	5440104	5440620	6593819		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_077567183.1|5440104_5440620_+	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	42.0	4.0e-27
>prophage 395
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	5448894	5452102	6593819		Trichoplusia_ni_ascovirus(33.33%)	4	NA	NA
WP_077567176.1|5448894_5449644_+	3-oxoacyl-[acyl-carrier-protein] reductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	36.0	6.6e-23
WP_007132116.1|5449757_5449991_+	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	39.4	3.5e-07
WP_099479172.1|5450152_5451391_+	beta-ketoacyl-ACP synthase II	NA	NA	NA	NA	NA
WP_077567174.1|5451403_5452102_+	ribonuclease III	NA	L7RCJ8	Acanthamoeba_polyphaga_moumouvirus	33.6	4.9e-28
>prophage 396
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	5461180	5462296	6593819		Catovirus(100.0%)	1	NA	NA
WP_077567166.1|5461180_5462296_+	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	25.5	1.1e-26
>prophage 397
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	5478963	5485753	6593819		Bacillus_phage(50.0%)	3	NA	NA
WP_099479192.1|5478963_5482782_+	GH32 C-terminal domain-containing protein	NA	F8WPR5	Bacillus_phage	33.4	3.2e-57
WP_077567153.1|5482936_5483506_+	YdcF family protein	NA	NA	NA	NA	NA
WP_077567151.1|5485135_5485753_+	ribonuclease HII	NA	A0A0N9QYD4	Chrysochromulina_ericina_virus	38.3	7.4e-20
>prophage 398
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	5509546	5516230	6593819	protease,tRNA	Thermus_phage(33.33%)	5	NA	NA
WP_099480787.1|5509546_5510722_+	DNA-protecting protein DprA	NA	S6BFL3	Thermus_phage	43.7	3.2e-32
WP_099479215.1|5510757_5512857_+	type I DNA topoisomerase	NA	A0A0G2Y787	Acanthamoeba_polyphaga_mimivirus	40.9	1.8e-105
WP_099479217.1|5512877_5514206_+|tRNA	FADH(2)-oxidizing methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))- methyltransferase TrmFO	tRNA	NA	NA	NA	NA
WP_099479219.1|5514234_5514777_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_099479221.1|5514826_5516230_+|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A2H5BJT2	Erwinia_phage	30.1	4.4e-44
>prophage 399
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	5551731	5570426	6593819	protease,tRNA	Tupanvirus(33.33%)	15	NA	NA
WP_077567094.1|5551731_5552499_+	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	39.6	1.8e-23
WP_099479268.1|5552519_5553320_+	phosphatidate cytidylyltransferase	NA	A0A2K9L268	Tupanvirus	38.3	1.1e-07
WP_099479270.1|5553340_5554480_+	1-deoxy-D-xylulose-5-phosphate reductoisomerase	NA	NA	NA	NA	NA
WP_099479272.1|5554610_5555885_+|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
WP_077567090.1|5556148_5557606_+|tRNA	proline--tRNA ligase	tRNA	A0A2K9L3R9	Tupanvirus	39.6	5.0e-107
WP_099479274.1|5557818_5562135_+	PolC-type DNA polymerase III	NA	A0A0A7RWA3	Clostridium_phage	32.4	7.5e-26
WP_007128714.1|5562330_5562792_+	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_007128713.1|5562824_5563922_+	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_028405665.1|5563950_5564262_+	YlxR family protein	NA	NA	NA	NA	NA
WP_077567088.1|5564218_5564578_+	YlxQ family RNA-binding protein	NA	NA	NA	NA	NA
WP_099479276.1|5564570_5567147_+	translation initiation factor IF-2	NA	E3T4N3	Cafeteria_roenbergensis_virus	24.0	2.8e-20
WP_077567086.1|5567165_5567516_+	30S ribosome-binding factor RbfA	NA	NA	NA	NA	NA
WP_077567085.1|5567548_5568526_+	bifunctional oligoribonuclease/PAP phosphatase NrnA	NA	NA	NA	NA	NA
WP_077567084.1|5568522_5569437_+|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
WP_099479279.1|5569472_5570426_+	bifunctional riboflavin kinase/FAD synthetase	NA	A0A1V0SD03	Indivirus	32.6	6.9e-09
>prophage 400
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	5574722	5576412	6593819		Bacillus_virus(50.0%)	2	NA	NA
WP_099479281.1|5574722_5575991_+	insulinase family protein	NA	G3MBJ8	Bacillus_virus	31.5	3.8e-47
WP_077569028.1|5575968_5576412_+	dUTP diphosphatase	NA	V5L6Y7	Insectomime_virus	53.2	7.6e-35
>prophage 401
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	5583933	5586573	6593819		Mycobacterium_phage(100.0%)	1	NA	NA
WP_099479291.1|5583933_5586573_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	49.0	7.6e-90
>prophage 402
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	5593770	5597288	6593819		Bacillus_phage(33.33%)	3	NA	NA
WP_099479304.1|5593770_5594598_+	spore cortex-lytic enzyme	NA	A0A172JHR8	Bacillus_phage	40.2	1.5e-20
WP_099479306.1|5594723_5596004_+	insulinase family protein	NA	A0A1X9I714	Streptococcus_phage	26.8	6.6e-39
WP_099479308.1|5596007_5597288_+	insulinase family protein	NA	A0A2H4UVM3	Bodo_saltans_virus	31.5	4.9e-10
>prophage 403
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	5603956	5605018	6593819		Bacillus_phage(100.0%)	1	NA	NA
WP_077567059.1|5603956_5605018_+	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	69.6	1.0e-130
>prophage 404
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	5608843	5609104	6593819		Bacillus_phage(100.0%)	1	NA	NA
WP_006211249.1|5608843_5609104_+	stage V sporulation protein S	NA	J9PTX7	Bacillus_phage	42.2	6.5e-10
>prophage 405
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	5613448	5616356	6593819		Bacillus_virus(100.0%)	3	NA	NA
WP_007128669.1|5613448_5614234_+	NUDIX hydrolase	NA	G3MA14	Bacillus_virus	49.6	3.8e-53
WP_077567051.1|5614297_5614846_+	cysteine hydrolase	NA	G3MA16	Bacillus_virus	40.7	2.1e-26
WP_077567050.1|5614904_5616356_+	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	44.2	1.3e-107
>prophage 406
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	5624960	5636203	6593819		Bacillus_phage(60.0%)	10	NA	NA
WP_077567042.1|5624960_5625848_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.3	1.4e-11
WP_099479331.1|5625851_5626586_+	hypothetical protein	NA	NA	NA	NA	NA
WP_028405569.1|5626667_5627132_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099479334.1|5627196_5628123_+	S-layer homology domain-containing protein	NA	NA	NA	NA	NA
WP_077567039.1|5628325_5630431_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.4	1.9e-46
WP_077567038.1|5630431_5632189_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.5	1.3e-40
WP_077567037.1|5632771_5633077_+	HesB/YadR/YfhF family protein	NA	NA	NA	NA	NA
WP_077567036.1|5633126_5633585_+	NUDIX domain-containing protein	NA	D0R7J3	Paenibacillus_phage	37.7	5.5e-20
WP_077567035.1|5633821_5634325_-	ADP-heptose synthase	NA	NA	NA	NA	NA
WP_077567034.1|5634457_5636203_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	32.2	6.4e-61
>prophage 407
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	5646180	5650173	6593819		Mycobacterium_phage(100.0%)	1	NA	NA
WP_077567021.1|5646180_5650173_+	type VII secretion protein EssC	NA	V5UPA0	Mycobacterium_phage	22.1	2.0e-41
>prophage 408
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	5658872	5661386	6593819		Bodo_saltans_virus(100.0%)	1	NA	NA
WP_099479354.1|5658872_5661386_+	ATP-dependent helicase HrpB	NA	A0A2H4UU36	Bodo_saltans_virus	29.6	5.3e-32
>prophage 409
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	5670194	5672879	6593819		Hokovirus(100.0%)	1	NA	NA
WP_099479364.1|5670194_5672879_+	CHASE3 domain-containing protein	NA	A0A1V0SGX0	Hokovirus	31.8	2.6e-37
>prophage 410
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	5695753	5696653	6593819		Kaumoebavirus(100.0%)	1	NA	NA
WP_077566985.1|5695753_5696653_+	DUF72 domain-containing protein	NA	A0A1V0CNL1	Kaumoebavirus	34.5	4.0e-14
>prophage 411
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	5708213	5709008	6593819		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_077566976.1|5708213_5709008_+	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	29.1	3.5e-14
>prophage 412
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	5719328	5720261	6593819		Lactococcus_phage(100.0%)	1	NA	NA
WP_077566969.1|5719328_5720261_+	NAD(P)/FAD-dependent oxidoreductase	NA	A0A1W6JK46	Lactococcus_phage	22.0	2.4e-06
>prophage 413
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	5730835	5731684	6593819		Staphylococcus_phage(100.0%)	1	NA	NA
WP_099479412.1|5730835_5731684_-	S9 family peptidase	NA	A0A2H4PQM6	Staphylococcus_phage	41.6	2.8e-30
>prophage 414
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	5749857	5750808	6593819		Cyanophage(100.0%)	1	NA	NA
WP_007128541.1|5749857_5750808_+	RNA polymerase sigma factor RpoD	NA	M4SMP8	Cyanophage	37.8	3.4e-40
>prophage 415
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	5756674	5757421	6593819		Planktothrix_phage(100.0%)	1	NA	NA
WP_077566932.1|5756674_5757421_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	41.3	7.0e-33
>prophage 416
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	5766323	5767367	6593819		Enterobacteria_phage(100.0%)	1	NA	NA
WP_099480796.1|5766323_5767367_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	26.8	1.5e-20
>prophage 417
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	5799691	5801551	6593819		Geobacillus_phage(50.0%)	2	NA	NA
WP_099479494.1|5799691_5800492_-	N-acetylmuramoyl-L-alanine amidase	NA	Q0H257	Geobacillus_phage	53.0	1.9e-44
WP_099480803.1|5800702_5801551_-	SDR family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	38.2	1.0e-43
>prophage 418
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	5813014	5819172	6593819		Planktothrix_phage(33.33%)	6	NA	NA
WP_028407239.1|5813014_5814019_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.6	2.3e-18
WP_077566900.1|5814015_5815005_+	dipeptide ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_077566899.1|5815060_5816539_+	leucyl aminopeptidase family protein	NA	Q6GYZ8	Mycoplasma_phage	34.7	1.8e-40
WP_077566898.1|5816544_5817231_+	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_077566897.1|5817267_5818221_+	ROK family protein	NA	NA	NA	NA	NA
WP_077566896.1|5818644_5819172_-	hypothetical protein	NA	L0L915	Bacillus_phage	35.2	7.7e-18
>prophage 419
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	5837252	5843702	6593819		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_099479526.1|5837252_5842835_+	hypothetical protein	NA	A0A1B1IPS8	uncultured_Mediterranean_phage	37.4	4.4e-47
WP_077566883.1|5843225_5843702_+	C40 family peptidase	NA	A0A2H5BMT3	Streptomyces_phage	40.0	1.2e-17
>prophage 420
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	5855218	5855752	6593819		Bacillus_virus(100.0%)	1	NA	NA
WP_077566873.1|5855218_5855752_+	hypothetical protein	NA	G3MBB4	Bacillus_virus	40.6	9.5e-24
>prophage 421
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	5869689	5876390	6593819		Lactobacillus_phage(33.33%)	5	NA	NA
WP_099479555.1|5869689_5870232_+	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL77	Lactobacillus_phage	37.5	4.0e-30
WP_099479557.1|5870350_5871970_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_099479559.1|5871966_5873763_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	28.7	2.1e-22
WP_099479561.1|5873759_5874743_+	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_077566859.1|5874890_5876390_+	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.7	8.3e-17
>prophage 422
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	5886476	5888401	6593819		Enterococcus_phage(50.0%)	2	NA	NA
WP_099479574.1|5886476_5887325_+	bifunctional 5,10-methylene-tetrahydrofolate dehydrogenase/5,10-methylene-tetrahydrofolate cyclohydrolase	NA	A0A249XZQ2	Enterococcus_phage	33.7	8.9e-24
WP_099479576.1|5887600_5888401_+	Cof-type HAD-IIB family hydrolase	NA	Q0GXW5	Lactococcus_phage	35.2	3.0e-05
>prophage 423
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	5913701	5917802	6593819	protease	Streptococcus_phage(50.0%)	5	NA	NA
WP_077566833.1|5913701_5914337_-	TVP38/TMEM64 family protein	NA	M1Q152	Streptococcus_phage	23.4	1.9e-07
WP_099479609.1|5914669_5915659_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_099479611.1|5916014_5916881_+	YitT family protein	NA	NA	NA	NA	NA
WP_099479613.1|5916949_5917162_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077569013.1|5917223_5917802_-	thymidine kinase	NA	A0A249XZX5	Enterococcus_phage	51.1	1.2e-48
>prophage 424
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	5931607	5932870	6593819		Tupanvirus(100.0%)	1	NA	NA
WP_099479626.1|5931607_5932870_+	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	A0A2K9L0G1	Tupanvirus	30.3	1.8e-36
>prophage 425
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	5946440	5947325	6593819	transposase	Bacillus_phage(100.0%)	1	NA	NA
WP_157929306.1|5946440_5947325_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	39.6	2.7e-47
>prophage 426
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	5954482	5955214	6593819		Halovirus(100.0%)	1	NA	NA
WP_099479636.1|5954482_5955214_+	metallophosphoesterase family protein	NA	R4T9B5	Halovirus	24.9	5.9e-08
>prophage 427
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	5962135	5965241	6593819		Anomala_cuprea_entomopoxvirus(50.0%)	3	NA	NA
WP_099479648.1|5962135_5963023_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	28.1	2.4e-16
WP_077566794.1|5963022_5963706_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099479650.1|5963912_5965241_-	voltage-gated chloride channel family protein	NA	A0A1X9I5Z9	Streptococcus_phage	34.6	1.2e-46
>prophage 428
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	5971634	5973395	6593819		Staphylococcus_phage(50.0%)	2	NA	NA
WP_099479660.1|5971634_5972480_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	56.7	1.2e-84
WP_099479662.1|5972600_5973395_+	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.6	7.0e-15
>prophage 429
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	5985425	5986157	6593819		Mycobacterium_phage(100.0%)	1	NA	NA
WP_077566775.1|5985425_5986157_+	alpha/beta hydrolase	NA	A0A1D8EVD1	Mycobacterium_phage	29.4	1.6e-05
>prophage 430
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	5992712	5993531	6593819		Acidianus_two-tailed_virus(100.0%)	1	NA	NA
WP_099479689.1|5992712_5993531_+	radical SAM protein	NA	A0A1C9EG49	Acidianus_two-tailed_virus	31.4	4.4e-12
>prophage 431
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	6000231	6006023	6593819		Bacillus_phage(66.67%)	6	NA	NA
WP_077566761.1|6000231_6001575_-	arsenic transporter	NA	A0A2H4PQU3	Staphylococcus_phage	30.8	2.9e-53
WP_157929341.1|6001615_6001771_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099479697.1|6002007_6002889_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_077566759.1|6003187_6003670_+	nucleoside deaminase	NA	NA	NA	NA	NA
WP_099479699.1|6003850_6005359_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	32.6	7.6e-26
WP_099479701.1|6005327_6006023_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	37.3	6.3e-36
>prophage 432
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	6010889	6011345	6593819		Bacillus_phage(100.0%)	1	NA	NA
WP_099479709.1|6010889_6011345_-	GyrI-like domain-containing protein	NA	A0A1P8CX48	Bacillus_phage	44.2	2.4e-31
>prophage 433
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	6016676	6018434	6593819		Enterobacteria_phage(100.0%)	1	NA	NA
WP_099479718.1|6016676_6018434_+	histidine kinase	NA	Q9EYF3	Enterobacteria_phage	30.1	2.6e-70
>prophage 434
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	6063916	6068975	6593819		Bacillus_phage(100.0%)	3	NA	NA
WP_099480822.1|6063916_6066214_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.6	1.4e-50
WP_099479777.1|6066210_6066738_+	DUF1854 domain-containing protein	NA	NA	NA	NA	NA
WP_099479779.1|6066761_6068975_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	30.4	3.4e-51
>prophage 435
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	6095442	6095970	6593819		Paenibacillus_phage(100.0%)	1	NA	NA
WP_077569005.1|6095442_6095970_+	putative metal-dependent hydrolase	NA	D0R7I3	Paenibacillus_phage	41.6	3.5e-18
>prophage 436
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	6112914	6126148	6593819	integrase	Herpes_simplex_virus(16.67%)	10	6112970:6112985	6123370:6123385
WP_099479828.1|6112914_6116037_+	DUF4981 domain-containing protein	NA	L0N6M2	Herpes_simplex_virus	35.9	4.4e-177
6112970:6112985	attL	ATAATAACCCTGAAAT	NA	NA	NA	NA
WP_028407082.1|6116714_6117434_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_099479831.1|6117644_6118556_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B1IQT7	uncultured_Mediterranean_phage	32.3	6.8e-22
WP_099479833.1|6118634_6119510_+	ATP-dependent DNA ligase	NA	A0A2H4JD86	uncultured_Caudovirales_phage	27.2	1.6e-20
WP_099479835.1|6119621_6119849_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099479837.1|6120141_6120339_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_099479839.1|6120335_6121916_+	hypothetical protein	NA	A0A0K2FLF6	Brevibacillus_phage	39.8	2.0e-05
WP_099479841.1|6122268_6123258_+	hypothetical protein	NA	A0A0H3V0V6	Geobacillus_virus	43.1	9.3e-57
WP_099479843.1|6123593_6124385_+	hypothetical protein	NA	NA	NA	NA	NA
6123370:6123385	attR	ATAATAACCCTGAAAT	NA	NA	NA	NA
WP_099479845.1|6124642_6126148_+	ATP-binding protein	NA	K7PHD1	Enterobacteria_phage	24.6	1.5e-34
>prophage 437
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	6133769	6134684	6593819		Lactobacillus_phage(100.0%)	1	NA	NA
WP_099479856.1|6133769_6134684_+	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	24.5	2.8e-07
>prophage 438
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	6141933	6143379	6593819		Ectocarpus_siliculosus_virus(100.0%)	1	NA	NA
WP_077566675.1|6141933_6143379_-	PAS domain S-box protein	NA	Q8QKV7	Ectocarpus_siliculosus_virus	27.8	1.6e-09
>prophage 439
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	6146701	6152538	6593819		Bacillus_phage(66.67%)	5	NA	NA
WP_099479866.1|6146701_6147397_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	43.5	1.8e-46
WP_099479868.1|6147393_6148479_+	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	28.4	3.1e-29
WP_077566670.1|6148662_6149556_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_099479871.1|6149793_6150834_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_099479873.1|6150858_6152538_+	beta-glucuronidase	NA	L0N6M2	Herpes_simplex_virus	26.6	1.1e-30
>prophage 440
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	6161092	6174589	6593819		Bacillus_phage(33.33%)	10	NA	NA
WP_077566658.1|6161092_6162880_+	ABC transporter ATP-binding protein	NA	F2Y165	Organic_Lake_phycodnavirus	28.8	7.1e-15
WP_099479885.1|6162876_6164754_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	23.0	1.6e-17
WP_077566656.1|6164907_6165762_-	chemotaxis protein	NA	NA	NA	NA	NA
WP_077566655.1|6165942_6167649_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.5	1.5e-54
WP_077566654.1|6167730_6168060_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099479887.1|6168357_6168837_+	nucleoside deaminase	NA	S4VYZ2	Pandoravirus	41.7	6.8e-21
WP_077566652.1|6169021_6169816_-	arylamine N-acetyltransferase	NA	NA	NA	NA	NA
WP_077566651.1|6169937_6171545_+	DUF4901 domain-containing protein	NA	NA	NA	NA	NA
WP_077566650.1|6171785_6173243_-	aminomethyl-transferring glycine dehydrogenase subunit GcvPB	NA	E3ST28	Prochlorococcus_phage	41.0	1.5e-87
WP_077566649.1|6173239_6174589_-	aminomethyl-transferring glycine dehydrogenase subunit GcvPA	NA	E3ST28	Prochlorococcus_phage	36.9	2.1e-51
>prophage 441
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	6180143	6182201	6593819		Tupanvirus(100.0%)	1	NA	NA
WP_099479892.1|6180143_6182201_+	catalase	NA	A0A2K9L572	Tupanvirus	53.3	6.7e-158
>prophage 442
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	6187626	6188355	6593819		Streptococcus_phage(100.0%)	1	NA	NA
WP_099479900.1|6187626_6188355_+	class I SAM-dependent methyltransferase	NA	A0A1X9I6N4	Streptococcus_phage	45.3	2.3e-57
>prophage 443
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	6193745	6195035	6593819		Faustovirus(100.0%)	1	NA	NA
WP_077566635.1|6193745_6195035_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	A0A0H3TLT9	Faustovirus	28.6	5.7e-06
>prophage 444
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	6203598	6204375	6593819		Bacillus_virus(100.0%)	1	NA	NA
WP_099479910.1|6203598_6204375_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.5	6.9e-31
>prophage 445
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	6214741	6215470	6593819		Pithovirus(100.0%)	1	NA	NA
WP_099479922.1|6214741_6215470_+	metal ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	28.1	3.4e-16
>prophage 446
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	6233151	6237432	6593819		Bacillus_phage(100.0%)	3	NA	NA
WP_099479945.1|6233151_6235188_+	bifunctional diguanylate cyclase/phosphodiesterase	NA	A0A127AWB9	Bacillus_phage	33.9	2.3e-17
WP_099479947.1|6235414_6236092_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_099480830.1|6236109_6237432_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	25.3	2.1e-11
>prophage 447
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	6254835	6255432	6593819		Bacillus_phage(100.0%)	1	NA	NA
WP_077566586.1|6254835_6255432_-	class I SAM-dependent methyltransferase	NA	U5Q0X6	Bacillus_phage	31.0	2.9e-05
>prophage 448
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	6266566	6271920	6593819		Microcystis_phage(33.33%)	6	NA	NA
WP_099480833.1|6266566_6267493_+	formylglycine-generating enzyme family protein	NA	A0A075BSL8	Microcystis_phage	30.2	4.5e-21
WP_077566577.1|6267568_6268144_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_099479974.1|6268406_6269270_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_077566575.1|6269396_6270320_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_077566574.1|6270451_6270883_-	N-acetyltransferase	NA	A0A1X9I6I8	Streptococcus_phage	42.0	1.0e-23
WP_077566573.1|6271164_6271920_+	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	23.8	1.0e-10
>prophage 449
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	6275832	6291104	6593819		Bacillus_phage(25.0%)	14	NA	NA
WP_099479980.1|6275832_6276609_+	TerC family protein	NA	A0A068EP98	Bacillus_phage	36.9	3.6e-24
WP_099479982.1|6276884_6277478_+	YdeI/OmpD-associated family protein	NA	NA	NA	NA	NA
WP_099479984.1|6277610_6279866_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	35.0	1.4e-140
WP_099479987.1|6280070_6280976_-	NAD(P)-dependent oxidoreductase	NA	A0A2K9L0I7	Tupanvirus	25.0	3.4e-05
WP_099479989.1|6281200_6281698_+	DinB family protein	NA	NA	NA	NA	NA
WP_099479991.1|6281766_6282093_+	YjdF family protein	NA	NA	NA	NA	NA
WP_099479993.1|6282244_6282976_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_099480835.1|6282987_6283692_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_099479995.1|6283742_6284681_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	44.0	1.5e-43
WP_099479997.1|6284818_6285532_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	41.5	5.7e-40
WP_099479998.1|6285531_6286926_+	HAMP domain-containing histidine kinase	NA	A0A1V0SGX0	Hokovirus	26.8	7.0e-10
WP_099480001.1|6286983_6287889_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_077566559.1|6288074_6288812_+	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.0	3.0e-28
WP_099480018.1|6289064_6291104_+	serine hydrolase	NA	S5Z991	Mycobacterium_phage	27.2	2.3e-09
>prophage 450
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	6295585	6296464	6593819		Bacillus_virus(100.0%)	1	NA	NA
WP_099480029.1|6295585_6296464_+	ADP-ribosylglycohydrolase family protein	NA	G3M9X5	Bacillus_virus	46.9	5.5e-77
>prophage 451
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	6299524	6300934	6593819		Orpheovirus(100.0%)	1	NA	NA
WP_099480037.1|6299524_6300934_-	cytochrome P450	NA	A0A2I2L481	Orpheovirus	30.7	2.0e-41
>prophage 452
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	6308712	6309615	6593819		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_099480043.1|6308712_6309615_-	LysR family transcriptional regulator	NA	A0A2H4J8I9	uncultured_Caudovirales_phage	36.9	7.5e-05
>prophage 453
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	6336722	6338069	6593819		Faustovirus(100.0%)	1	NA	NA
WP_077568992.1|6336722_6338069_-	hypothetical protein	NA	A0A1X7BZ68	Faustovirus	38.0	1.6e-06
>prophage 454
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	6341150	6349845	6593819		Hokovirus(50.0%)	8	NA	NA
WP_099480067.1|6341150_6341888_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	36.9	9.1e-41
WP_099480070.1|6341884_6342658_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_099480072.1|6342809_6343511_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	35.7	4.4e-37
WP_099480074.1|6343507_6344575_+	HAMP domain-containing histidine kinase	NA	A0A1V0SGX0	Hokovirus	26.5	3.4e-20
WP_099480076.1|6344622_6345582_-	HTH domain-containing protein	NA	NA	NA	NA	NA
WP_077566516.1|6345692_6346172_+	effector binding domain-containing protein	NA	NA	NA	NA	NA
WP_077566515.1|6346253_6346970_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_099480078.1|6347205_6349845_+	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	36.2	1.2e-47
>prophage 455
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	6353422	6355330	6593819	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_099480084.1|6353422_6355330_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	40.8	9.9e-148
>prophage 456
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	6364783	6367460	6593819		Cedratvirus(50.0%)	3	NA	NA
WP_099480100.1|6364783_6365557_+	ABC transporter ATP-binding protein	NA	A0A1M7XV31	Cedratvirus	31.1	3.1e-15
WP_099480102.1|6365597_6366449_+	sulfurtransferase	NA	NA	NA	NA	NA
WP_099480845.1|6366830_6367460_+	streptogramin A O-acetyltransferase Vat(I)	NA	M1HKK6	Paramecium_bursaria_Chlorella_virus	41.8	7.8e-25
>prophage 457
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	6380193	6382665	6593819	tRNA	Tupanvirus(100.0%)	2	NA	NA
WP_099480119.1|6380193_6381468_+|tRNA	histidine--tRNA ligase	tRNA	A0A2K9L0H9	Tupanvirus	33.2	3.3e-54
WP_099480121.1|6381624_6382665_-	NAD(P)-dependent alcohol dehydrogenase	NA	A0A2K9L339	Tupanvirus	44.5	2.0e-73
>prophage 458
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	6404212	6405442	6593819		Enterobacteria_phage(100.0%)	1	NA	NA
WP_167392998.1|6404212_6405442_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	34.0	1.1e-46
>prophage 459
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	6413370	6414138	6593819		Planktothrix_phage(100.0%)	1	NA	NA
WP_099480164.1|6413370_6414138_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.4	5.7e-30
>prophage 460
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	6418831	6420960	6593819		Bacillus_phage(100.0%)	2	NA	NA
WP_099480170.1|6418831_6419545_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	37.2	8.2e-39
WP_099480172.1|6419541_6420960_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	24.7	3.4e-20
>prophage 461
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	6424294	6425248	6593819		Anomala_cuprea_entomopoxvirus(100.0%)	1	NA	NA
WP_099480182.1|6424294_6425248_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	31.0	3.2e-22
>prophage 462
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	6447055	6456668	6593819		Staphylococcus_phage(60.0%)	10	NA	NA
WP_077566432.1|6447055_6447475_-	arsenate reductase (thioredoxin)	NA	A0A2H4PQT9	Staphylococcus_phage	66.4	1.2e-45
WP_077566431.1|6447500_6448796_-	arsenic transporter	NA	A0A2H4PQU3	Staphylococcus_phage	65.6	2.2e-154
WP_149917119.1|6448922_6449231_-	metalloregulator ArsR/SmtB family transcription factor	NA	NA	NA	NA	NA
WP_077566429.1|6449414_6449864_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_099480216.1|6449918_6450989_+	NAD(P)-binding domain-containing protein	NA	V9VEY6	Lactococcus_phage	28.2	7.3e-07
WP_099480218.1|6451213_6452026_+	arsenite methyltransferase	NA	NA	NA	NA	NA
WP_099480220.1|6452093_6452945_-	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	34.7	1.4e-08
WP_099480223.1|6453073_6454063_+	zinc-binding dehydrogenase	NA	NA	NA	NA	NA
WP_099480225.1|6454149_6455763_-	tetronasin resistance protein	NA	NA	NA	NA	NA
WP_099480227.1|6455786_6456668_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.1	3.6e-20
>prophage 463
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	6479393	6483896	6593819	transposase	Phaeocystis_globosa_virus(50.0%)	4	NA	NA
WP_099480264.1|6479393_6480353_+	ATP-binding protein	NA	R4TQL5	Phaeocystis_globosa_virus	40.8	3.0e-36
WP_099480266.1|6480375_6481248_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099480851.1|6481776_6482418_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_099476497.1|6482535_6483896_-|transposase	IS1182 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	40.7	2.4e-87
>prophage 464
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	6515144	6518094	6593819		Bacillus_phage(66.67%)	3	NA	NA
WP_099480304.1|6515144_6516257_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	30.6	3.2e-29
WP_077566375.1|6516246_6516936_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	39.1	4.5e-42
WP_099480306.1|6517356_6518094_-	SDR family oxidoreductase	NA	A0A2P0VP75	Tetraselmis_virus	26.4	1.5e-06
>prophage 465
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	6532739	6533621	6593819		Bacillus_phage(100.0%)	1	NA	NA
WP_099480311.1|6532739_6533621_+	serine/threonine protein phosphatase	NA	A0A127AVW0	Bacillus_phage	41.2	4.6e-39
>prophage 466
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	6536857	6537790	6593819		Anomala_cuprea_entomopoxvirus(100.0%)	1	NA	NA
WP_099480319.1|6536857_6537790_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	26.2	3.0e-25
>prophage 467
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	6541146	6541767	6593819		Ectocarpus_siliculosus_virus(100.0%)	1	NA	NA
WP_099480327.1|6541146_6541767_+	response regulator transcription factor	NA	Q8QKV7	Ectocarpus_siliculosus_virus	31.6	8.0e-06
>prophage 468
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	6554142	6556164	6593819		Clostridium_phage(100.0%)	1	NA	NA
WP_077566354.1|6554142_6556164_+	5'-nucleotidase C-terminal domain-containing protein	NA	A0A0A7RVP5	Clostridium_phage	40.4	2.1e-10
>prophage 469
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	6563803	6565516	6593819		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_167393045.1|6563803_6565516_+	biosynthetic-type acetolactate synthase large subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	31.1	8.8e-63
>prophage 470
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	6572046	6572718	6593819		Bacillus_phage(100.0%)	1	NA	NA
WP_077566343.1|6572046_6572718_+	O-methyltransferase	NA	W8CYT3	Bacillus_phage	58.0	2.7e-36
>prophage 471
NZ_CP016809	Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome	6593819	6585527	6586379	6593819		Staphylococcus_phage(100.0%)	1	NA	NA
WP_077566333.1|6585527_6586379_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	43.8	5.9e-52
