The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP020742	Bartonella henselae strain Houston-I chromosome, complete genome	1955425	361622	452410	1955425	tail,terminase,tRNA,capsid,head,integrase,portal,plate	Haemophilus_phage(14.55%)	105	394775:394793	449091:449109
WP_011180208.1|361622_364538_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A2I2L3Y0	Orpheovirus	24.8	8.8e-63
WP_011180209.1|364733_365327_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011180210.1|365389_365836_-	nucleoside deaminase	NA	NA	NA	NA	NA
WP_011180211.1|366111_367509_+	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_011180212.1|367489_368059_+	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
WP_011180213.1|370913_372245_+	TldD/PmbA family protein	NA	NA	NA	NA	NA
WP_034447481.1|372231_373035_+	3'(2'),5'-bisphosphate nucleotidase CysQ	NA	NA	NA	NA	NA
WP_011180215.1|373080_373326_+	DUF4170 domain-containing protein	NA	K4JVU0	Caulobacter_phage	37.9	2.0e-05
WP_011180216.1|374149_375472_+	3-deoxy-D-manno-octulosonic acid transferase	NA	NA	NA	NA	NA
WP_011180217.1|375461_376481_+	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_011180218.1|376525_376762_-	DUF2093 domain-containing protein	NA	NA	NA	NA	NA
WP_011180219.1|376882_378721_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	39.9	7.1e-111
WP_034447477.1|379018_380107_+	2'-deoxycytidine 5'-triphosphate deaminase	NA	NA	NA	NA	NA
WP_011180221.1|380942_382094_+	FMN-dependent L-lactate dehydrogenase LldD	NA	NA	NA	NA	NA
WP_011180223.1|384581_384902_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011180224.1|385082_386510_+	amino acid permease	NA	NA	NA	NA	NA
WP_011180225.1|386551_387232_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.9	7.9e-15
WP_011180226.1|387228_387867_+	energy-coupling factor transporter transmembrane protein EcfT	NA	NA	NA	NA	NA
WP_011180227.1|387880_388435_+	biotin transporter BioY	NA	NA	NA	NA	NA
WP_157774293.1|392536_392914_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075320654.1|392942_393128_+	hypothetical protein	NA	A0A141GEY9	Brucella_phage	50.8	3.9e-09
WP_034447472.1|393603_393831_+	hypothetical protein	NA	NA	NA	NA	NA
WP_034447468.1|393962_394181_+	hypothetical protein	NA	NA	NA	NA	NA
394775:394793	attL	AAGTGGTGCCCAGACGCGG	NA	NA	NA	NA
WP_011180232.1|394991_396149_+|integrase	site-specific integrase	integrase	A0A1X9HVL9	Ruegeria_phage	40.8	8.0e-76
WP_011180234.1|396420_397011_+	hypothetical protein	NA	Q7Y5W2	Haemophilus_phage	49.6	6.2e-24
WP_011180235.1|397130_397406_+	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	NA	NA	NA	NA
WP_011180236.1|397418_397709_+	type II toxin-antitoxin system YafQ family toxin	NA	NA	NA	NA	NA
WP_034447463.1|397831_398044_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011180238.1|398172_398400_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011180239.1|398396_399059_-	glycoside hydrolase family protein	NA	A0A141GEY9	Brucella_phage	61.5	2.6e-47
WP_011180240.1|399218_399521_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A141GEX6	Brucella_phage	45.8	5.4e-16
WP_011180241.1|399507_399828_+	putative addiction module antidote protein	NA	A0A141GEX5	Brucella_phage	46.2	3.3e-16
WP_011180242.1|399871_400150_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011180243.1|400146_400878_-	phage antirepressor Ant	NA	Q7Y5W2	Haemophilus_phage	40.7	1.4e-46
WP_011180244.1|401129_401702_-	hypothetical protein	NA	Q7Y5W2	Haemophilus_phage	40.7	8.9e-28
WP_011180245.1|401729_402278_-	phage antirepressor Ant	NA	A0A0N6WET9	Escherichia_phage	52.6	5.9e-21
WP_011180246.1|402589_403897_-	phage late control protein	NA	K4HZC6	Acidithiobacillus_phage	39.8	1.6e-69
WP_011180247.1|403893_404118_-|tail	phage tail protein	tail	A0A2H4J946	uncultured_Caudovirales_phage	53.1	8.3e-06
WP_011180248.1|404114_404495_-|tail	tail protein	tail	D5LGY3	Escherichia_phage	43.1	5.7e-23
WP_011180249.1|404500_406801_-|tail	tail protein	tail	A0A0E3U2N9	Fusobacterium_phage	26.7	5.4e-15
WP_075320635.1|406797_406914_-|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_011180250.1|406910_407195_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_011180251.1|407196_407703_-|tail	phage major tail tube protein	tail	K4I1G5	Acidithiobacillus_phage	42.2	2.6e-31
WP_011180252.1|407702_408935_-|tail	tail protein	tail	A0A088FVH5	Escherichia_phage	52.2	1.9e-128
WP_011180253.1|409404_409926_+	Rha family transcriptional regulator	NA	A0A159B6D5	Gordonia_phage	57.1	3.8e-25
WP_011180254.1|409971_410301_-	HigA family addiction module antidote protein	NA	NA	NA	NA	NA
WP_011180255.1|410388_410568_+	hypothetical protein	NA	A0A222YXG1	Escherichia_phage	62.5	4.3e-13
WP_075320634.1|410514_410721_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011180256.1|410863_412189_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011180257.1|412203_415347_-	DUF4815 domain-containing protein	NA	K4ICQ5	Acidithiobacillus_phage	34.9	6.2e-155
WP_034447459.1|415348_416455_-	phage protein	NA	K4I1F8	Acidithiobacillus_phage	36.4	5.0e-19
WP_011180259.1|416454_417282_-	hypothetical protein	NA	A0A219VH98	Ochrobactrum_phage	34.9	1.7e-40
WP_034447457.1|417278_417620_-|plate	baseplate assembly protein W	plate	Q75QM0	Wolbachia_phage	59.6	1.3e-31
WP_011180261.1|417616_418306_-|plate	phage baseplate assembly protein V	plate	V5YUM9	Pseudomonas_phage	34.5	4.1e-19
WP_011180262.1|418286_418829_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011180263.1|418880_419153_+	toxin HicA	NA	A0A2P1A0R7	Gordonia_phage	60.0	1.0e-05
WP_004856761.1|419142_419460_+	type II toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_011180264.1|419700_419979_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011180265.1|419975_420734_-	phage antirepressor Ant	NA	Q7Y5W2	Haemophilus_phage	38.3	1.7e-42
WP_011180266.1|420752_421307_-	phage antirepressor Ant	NA	Q7Y5W2	Haemophilus_phage	56.2	2.4e-22
WP_011180267.1|421691_422765_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011180268.1|422800_423154_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011180269.1|423155_424232_-|capsid	major capsid protein	capsid	A0A0A8ILA9	Aurantimonas_phage	35.2	3.8e-56
WP_011180270.1|424244_424613_-|head	head decoration protein	head	A0A0A8IL52	Aurantimonas_phage	46.1	5.7e-12
WP_049784565.1|424609_424930_-	hypothetical protein	NA	NA	NA	NA	NA
WP_034454126.1|424872_425916_-	S49 family peptidase	NA	K4HZZ6	Acidithiobacillus_phage	46.6	8.3e-64
WP_011180273.1|425905_427462_-|portal	phage portal protein	portal	Q75QM9	Wolbachia_phage	35.5	3.5e-74
WP_011180274.1|427461_427710_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011180275.1|427713_429642_-|terminase	phage terminase large subunit family protein	terminase	K4I3Y9	Acidithiobacillus_phage	52.4	1.8e-165
WP_011180276.1|429634_430216_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011180277.1|430278_430593_+	Killer protein	NA	A0A222YWE2	Escherichia_phage	39.8	1.6e-10
WP_011180278.1|430609_430906_+	HigA family addiction module antidote protein	NA	M9MUN2	Rhodococcus_phage	49.4	6.4e-14
WP_011180279.1|431017_431191_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011180280.1|431315_431579_+	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	NA	NA	NA	NA
WP_011180281.1|431565_431847_+	type II toxin-antitoxin system YafQ family toxin	NA	NA	NA	NA	NA
WP_011180242.1|431889_432168_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011180282.1|432164_432923_-	phage antirepressor Ant	NA	Q7Y5W2	Haemophilus_phage	40.7	3.0e-47
WP_011180283.1|432982_433498_-	phage antirepressor Ant	NA	Q7Y5W2	Haemophilus_phage	55.6	7.8e-23
WP_011180285.1|434385_434928_-	phage antirepressor Ant	NA	A0A0P0ZG08	Escherichia_phage	46.9	1.6e-18
WP_011180287.1|435524_436103_-	hypothetical protein	NA	A0A0A8IL87	Aurantimonas_phage	35.0	3.8e-10
WP_011180288.1|436106_436427_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011180290.1|436899_437295_-	CopG family transcriptional regulator	NA	A0A0U4ISP5	Pseudomonas_phage	31.1	1.7e-06
WP_034447446.1|437291_437492_-	type II toxin-antitoxin system HicA family toxin	NA	A0A1L2JY37	Aeribacillus_phage	49.1	1.6e-08
WP_034447444.1|437556_438093_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011180293.1|438103_438550_-	single-stranded DNA-binding protein	NA	A0A0K1LLZ9	Caulobacter_phage	55.7	6.7e-31
WP_011180826.1|438740_439022_+	Killer protein	NA	A0A0M3LQB1	Mannheimia_phage	47.3	1.1e-18
WP_034447441.1|439038_439332_+	HigA family addiction module antidote protein	NA	A0A0M3LPV0	Mannheimia_phage	46.6	6.0e-12
WP_034447437.1|439373_439700_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038525124.1|439864_440284_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011180297.1|440276_441389_-	DUF1376 domain-containing protein	NA	A0A218M9P5	Mycobacterium_phage	51.5	1.6e-12
WP_011180298.1|441378_441726_-	DUF1376 domain-containing protein	NA	A0A076GD06	Sinorhizobium_phage	44.1	1.6e-16
WP_011180299.1|441718_442195_-	hypothetical protein	NA	K4ICN3	Acidithiobacillus_phage	63.8	3.7e-51
WP_011180300.1|442322_443099_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099358257.1|443107_443473_-	hypothetical protein	NA	NA	NA	NA	NA
WP_034447428.1|443572_443932_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011180303.1|444015_444633_+	transcriptional regulator	NA	K7PH71	Enterobacterial_phage	27.1	1.4e-05
WP_011180304.1|444874_445249_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011180305.1|445313_445706_+	Rha family transcriptional regulator	NA	B5AX29	Iodobacteriophage	49.5	2.5e-21
WP_038525127.1|445715_446474_+	antirepressor	NA	Q7Y5W2	Haemophilus_phage	38.2	6.0e-40
WP_034452685.1|446486_446870_+	hypothetical protein	NA	K4Q356	Edwardsiella_phage	57.9	1.0e-11
WP_038525129.1|447312_448092_+	recombinase	NA	K4NWX3	Pseudomonas_phage	31.5	2.4e-15
WP_011180604.1|448093_448717_+	exonuclease	NA	A0A0U2BXF3	Paracoccus_phage	43.6	7.4e-44
WP_011180314.1|448789_448993_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_011180315.1|449568_450732_+	phosphoserine transaminase	NA	NA	NA	NA	NA
449091:449109	attR	AAGTGGTGCCCAGACGCGG	NA	NA	NA	NA
WP_011180316.1|451120_452410_+	adenylosuccinate synthase	NA	A0A285PX35	Cedratvirus	31.8	4.3e-54
>prophage 2
NZ_CP020742	Bartonella henselae strain Houston-I chromosome, complete genome	1955425	1013994	1044339	1955425	terminase,tail,capsid,integrase,portal	Sulfitobacter_phage(10.53%)	39	1010035:1010094	1044550:1044669
1010035:1010094	attL	CCCACCCCCTCCGCCACAGCACTTTTATCACGCTATAACTTATTGATTTTATGTATGTTT	NA	NA	NA	NA
WP_034447842.1|1013994_1014975_-|tail	tail fiber protein	tail	A0A291LA10	Bordetella_phage	30.7	6.2e-13
WP_011180812.1|1014967_1015891_-	transglycosylase SLT domain-containing protein	NA	L7TQZ1	Rhizobium_phage	45.0	3.0e-25
WP_011180813.1|1015890_1018110_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011180814.1|1018102_1019926_-	hypothetical protein	NA	C8CLJ2	Xylella_phage	25.9	5.6e-07
WP_011180815.1|1019925_1020981_-|tail	tail fiber domain-containing protein	tail	NA	NA	NA	NA
WP_034447844.1|1020982_1021366_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011180817.1|1021407_1022865_-	hypothetical protein	NA	D6PEY0	uncultured_phage	27.3	3.2e-37
WP_011180818.1|1022864_1023563_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011180819.1|1023638_1024061_-	hypothetical protein	NA	NA	NA	NA	NA
WP_034447849.1|1024080_1025226_-|capsid	N4-gp56 family major capsid protein	capsid	A0A248SKT9	Klebsiella_phage	30.8	3.7e-33
WP_011180821.1|1025322_1026219_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011180822.1|1026230_1028285_-|portal	phage portal protein	portal	C5IHN8	Burkholderia_virus	23.8	1.2e-29
WP_011180823.1|1028269_1029595_-|terminase	terminase	terminase	A0A088F6U9	Sulfitobacter_phage	57.1	6.0e-144
WP_011180626.1|1029575_1029902_-	hypothetical protein	NA	A0A088FAU1	Sulfitobacter_phage	40.2	1.7e-07
WP_011180624.1|1030200_1030659_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075320637.1|1030754_1031147_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011180622.1|1031176_1031446_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A1S5SB46	Streptococcus_phage	43.9	8.5e-13
WP_007346764.1|1031429_1031657_-	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
WP_011180620.1|1031764_1032097_-	type II toxin-antitoxin system PemK/MazF family toxin	NA	NA	NA	NA	NA
WP_034448603.1|1032096_1032354_-	antitoxin	NA	NA	NA	NA	NA
WP_059443338.1|1032434_1032929_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011180617.1|1032982_1033429_-	single-stranded DNA-binding protein	NA	A0A0K1LLZ9	Caulobacter_phage	54.8	2.0e-30
WP_011180616.1|1033640_1033931_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011180615.1|1033927_1034200_+	type II toxin-antitoxin system mRNA interferase toxin, RelE/StbE family	NA	NA	NA	NA	NA
WP_082246570.1|1034889_1035276_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011180612.1|1035259_1036510_-	DUF1376 domain-containing protein	NA	A0A218M9P5	Mycobacterium_phage	52.9	5.5e-14
WP_011180611.1|1036499_1036979_-	hypothetical protein	NA	K4ICN3	Acidithiobacillus_phage	64.0	1.4e-50
WP_011180610.1|1037115_1037475_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099358259.1|1037993_1038263_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011180607.1|1038501_1038876_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011180606.1|1038939_1039296_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011180605.1|1039310_1040042_+	phage regulatory protein/antirepressor Ant	NA	B5AX29	Iodobacteriophage	41.3	5.1e-28
WP_011180308.1|1040054_1040438_+	hypothetical protein	NA	K4Q356	Edwardsiella_phage	57.9	1.0e-11
WP_011180311.1|1040879_1041659_+	recombinase	NA	K4NWX3	Pseudomonas_phage	31.5	2.4e-15
WP_011180604.1|1041660_1042284_+	exonuclease	NA	A0A0U2BXF3	Paracoccus_phage	43.6	7.4e-44
WP_034448587.1|1042394_1042643_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011180602.1|1042645_1043683_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A291AUF0	Sinorhizobium_phage	30.3	4.1e-31
WP_011180601.1|1043739_1044039_-	HigA family addiction module antidote protein	NA	A0A0M3LPV0	Mannheimia_phage	47.7	2.8e-17
WP_011180600.1|1044057_1044339_-	protein killer suppression protein	NA	A0A0M3LQB1	Mannheimia_phage	45.1	1.1e-15
1044550:1044669	attR	CCCACCCCCTCCGCCACAGCACTTTTATCACGCTATAACTTATTGATTTTATGTATGTTTTTTTAAGGTGCGGGATGTATAAATAAAGGTGCGGGAATAGGATTTTCCAACATGCCTGTA	NA	NA	NA	NA
>prophage 3
NZ_CP020742	Bartonella henselae strain Houston-I chromosome, complete genome	1955425	1139556	1150281	1955425	tRNA	uncultured_Mediterranean_phage(71.43%)	7	NA	NA
WP_011180873.1|1139556_1140675_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	52.1	1.0e-96
WP_011180874.1|1141838_1142351_-	peptidylprolyl isomerase	NA	A0A1B1IVS0	uncultured_Mediterranean_phage	59.6	1.2e-47
WP_011180875.1|1142373_1142946_-	peptidylprolyl isomerase	NA	A0A1B1IVS0	uncultured_Mediterranean_phage	54.7	1.2e-43
WP_034448154.1|1142935_1143454_-	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	37.0	7.1e-24
WP_011180877.1|1143478_1146274_-	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	33.7	7.0e-102
WP_011180878.1|1146506_1147025_-	single-stranded DNA-binding protein	NA	A0A0K1LLZ9	Caulobacter_phage	59.3	1.1e-45
WP_011180879.1|1147365_1150281_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	60.5	0.0e+00
