The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP022426	Aeromonas salmonicida subsp. pectinolytica 34mel chromosome, complete genome	5012649	723058	782060	5012649	integrase,transposase,tRNA	Acidithiobacillus_phage(17.39%)	48	744843:744858	794315:794330
WP_021139193.1|723058_723970_-|tRNA	tRNA-modifying protein YgfZ	tRNA	NA	NA	NA	NA
WP_005318829.1|724083_724353_+	FAD assembly factor SdhE	NA	NA	NA	NA	NA
WP_021139194.1|724359_724749_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021139195.1|724944_726552_-	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_021139196.1|726734_727316_+	RNA polymerase sigma factor RpoE	NA	A0A0F6TH34	Sinorhizobium_phage	27.0	3.0e-07
WP_034523729.1|727337_727931_+	sigma-E factor negative regulatory protein	NA	NA	NA	NA	NA
WP_021139198.1|727952_728933_+	sigma-E factor regulatory protein RseB	NA	NA	NA	NA	NA
WP_005318845.1|729026_729488_+	SoxR reducing system RseC family protein	NA	NA	NA	NA	NA
WP_005318848.1|729606_731400_+	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	27.4	3.8e-24
WP_005318850.1|731403_732327_+	signal peptidase I	NA	NA	NA	NA	NA
WP_005318852.1|732327_732999_+	ribonuclease III	NA	A0A2P0VNZ5	Tetraselmis_virus	33.2	2.6e-18
WP_021139199.1|733057_733957_+	GTPase Era	NA	NA	NA	NA	NA
WP_005318856.1|733957_734665_+	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_021139200.1|734738_735476_+	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_034523730.1|735538_736360_-	N-acetylmuramoyl-L-alanine amidase	NA	NA	NA	NA	NA
WP_005318863.1|736459_736939_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	44.9	7.2e-31
WP_021139202.1|737069_739781_-	two-component sensor histidine kinase BarA	NA	A0A1V0SGX0	Hokovirus	30.0	7.7e-53
WP_021139203.1|739934_741257_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	E4ZFI6	Streptococcus_phage	27.9	2.7e-35
WP_021139204.1|741496_743707_+	GTP diphosphokinase	NA	NA	NA	NA	NA
WP_021139205.1|743803_744601_+	nucleoside triphosphate pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_005318871.1|744741_746379_+	CTP synthase (glutamine hydrolyzing)	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	51.0	4.3e-152
744843:744858	attL	GGATGTGACCATCATG	NA	NA	NA	NA
WP_005318874.1|746468_747770_+	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	59.6	1.9e-134
WP_005318876.1|747949_748267_+	cell division protein FtsB	NA	NA	NA	NA	NA
WP_021139206.1|748259_748949_+	2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_005318882.1|749082_749559_+	2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase	NA	NA	NA	NA	NA
WP_021139208.1|749558_750617_+|tRNA	tRNA pseudouridine(13) synthase TruD	tRNA	NA	NA	NA	NA
WP_021139209.1|750597_751344_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	52.0	1.7e-66
WP_005318888.1|751348_751966_+	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	46.4	9.0e-34
WP_021139210.1|751962_752544_+	DedA family protein	NA	NA	NA	NA	NA
WP_021139211.1|752553_753600_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A0A7NU10	Lactobacillus_phage	41.3	1.0e-13
WP_017411567.1|753647_754631_+	RNA polymerase sigma factor RpoS	NA	F4YCU2	Synechococcus_phage	34.1	9.9e-35
WP_021139212.1|754716_755730_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	58.0	6.9e-108
WP_005309452.1|755909_756125_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_021139213.1|756140_756584_+	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	47.9	7.6e-27
WP_021139214.1|756672_758460_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	41.1	2.6e-73
WP_080937890.1|758673_760533_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	32.6	1.1e-34
WP_145958002.1|761309_761579_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099368897.1|761851_762868_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.1	1.4e-185
WP_039272517.1|763126_764668_+|transposase	IS21-like element ISAs29 family transposase	transposase	K4I413	Acidithiobacillus_phage	47.6	3.4e-130
WP_039272515.1|764682_765438_+	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	50.6	1.3e-58
WP_034524582.1|766506_767808_-	outer membrane channel protein TolC	NA	NA	NA	NA	NA
WP_099368881.1|769578_770595_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.4	2.2e-186
WP_046400746.1|771827_773393_+|transposase	IS21-like element ISAs27 family transposase	transposase	K4I413	Acidithiobacillus_phage	45.8	2.9e-121
WP_043851824.1|773415_774171_+	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	45.0	2.4e-52
WP_042650619.1|776291_777125_-	thymidylate synthase	NA	E5DV96	Deep-sea_thermophilic_phage	61.0	3.2e-95
WP_021141269.1|777121_777604_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021141270.1|777600_779616_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_162516023.1|779612_782060_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
794315:794330	attR	CATGATGGTCACATCC	NA	NA	NA	NA
>prophage 2
NZ_CP022426	Aeromonas salmonicida subsp. pectinolytica 34mel chromosome, complete genome	5012649	1299937	1336064	5012649	transposase	Enterobacteria_phage(14.29%)	34	NA	NA
WP_099368915.1|1299937_1301266_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_021141201.1|1301384_1302557_-	prephenate dehydratase	NA	NA	NA	NA	NA
WP_021141200.1|1302888_1303485_+	HAD family phosphatase	NA	NA	NA	NA	NA
WP_021141199.1|1303516_1303795_+	hypothetical protein	NA	NA	NA	NA	NA
WP_034524561.1|1303839_1304712_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021141197.1|1304817_1305366_+	DUF3157 family protein	NA	NA	NA	NA	NA
WP_021141196.1|1305555_1306197_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021141195.1|1306371_1307316_+	DUF1722 domain-containing protein	NA	NA	NA	NA	NA
WP_021140938.1|1307687_1308587_+	MerR family transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	31.5	7.0e-19
WP_021140939.1|1308583_1310005_+	deoxyribodipyrimidine photo-lyase	NA	A0A1V0SCV6	Indivirus	29.6	1.4e-50
WP_021140940.1|1310006_1310435_+	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_021140941.1|1310431_1311166_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_021140942.1|1311162_1312422_+	NAD(P)-binding protein	NA	NA	NA	NA	NA
WP_021140943.1|1312418_1313171_+	DUF1365 domain-containing protein	NA	NA	NA	NA	NA
WP_021140944.1|1313292_1314549_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_021140945.1|1314551_1315031_+	DUF2878 domain-containing protein	NA	NA	NA	NA	NA
WP_021140946.1|1315027_1315246_+	TIGR02450 family Trp-rich protein	NA	NA	NA	NA	NA
WP_034524398.1|1315202_1315745_+	hypothetical protein	NA	NA	NA	NA	NA
WP_034524400.1|1315744_1316302_+	DUF3833 domain-containing protein	NA	NA	NA	NA	NA
WP_021140949.1|1316433_1316901_+	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	36.0	5.6e-20
WP_021140950.1|1317119_1318769_+	hydroxylamine reductase	NA	NA	NA	NA	NA
WP_021140951.1|1318901_1319921_+	hybrid-cluster NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_021140952.1|1320004_1321030_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	47.1	1.2e-83
WP_021140953.1|1321166_1321916_-	DsbA family protein	NA	NA	NA	NA	NA
WP_021140954.1|1322476_1322806_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_099368918.1|1323322_1324526_+|transposase	IS3-like element ISAs17 family transposase	transposase	Q9ZXG3	Shigella_phage	70.8	9.1e-115
WP_046400752.1|1324618_1326787_+	regulatory protein NosR	NA	NA	NA	NA	NA
WP_021141192.1|1326851_1328759_+	nitrous-oxide reductase	NA	NA	NA	NA	NA
WP_046400751.1|1328818_1330138_+	nitrous oxide reductase family maturation protein NosD	NA	NA	NA	NA	NA
WP_099368919.1|1330134_1331013_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	35.8	4.3e-29
WP_099368897.1|1331121_1332138_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.1	1.4e-185
WP_139723412.1|1332182_1332755_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011191341.1|1333066_1334341_-|transposase	IS4-like element ISApu2 family transposase	transposase	NA	NA	NA	NA
WP_010674210.1|1334450_1336064_+|transposase	IS1634-like element ISAs25 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP022426	Aeromonas salmonicida subsp. pectinolytica 34mel chromosome, complete genome	5012649	2076003	2245992	5012649	integrase,transposase	Acidithiobacillus_phage(21.43%)	113	2082566:2082585	2156399:2156418
WP_099368944.1|2076003_2077029_+|transposase	IS110-like element ISAs24 family transposase	transposase	NA	NA	NA	NA
WP_021140604.1|2077519_2078122_-	DUF924 domain-containing protein	NA	A0A1V0SIY0	Klosneuvirus	35.3	7.2e-20
WP_021140605.1|2078333_2079251_+	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_021140606.1|2079431_2081210_+	M3 family oligoendopeptidase	NA	A0A1X9I5X5	Streptococcus_phage	24.0	1.1e-12
WP_021140607.1|2081364_2083173_+	M3 family oligoendopeptidase	NA	A0A1X9I5X5	Streptococcus_phage	23.7	4.1e-10
2082566:2082585	attL	GCGATCTGCCGATGAGCCAG	NA	NA	NA	NA
WP_005310449.1|2083569_2084109_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_021140608.1|2084187_2085480_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_005310453.1|2085688_2086006_+	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_021140609.1|2086174_2086933_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_021140610.1|2087124_2088138_+	LD-carboxypeptidase	NA	NA	NA	NA	NA
WP_021140611.1|2088207_2090481_-	alkaline phosphatase family protein	NA	NA	NA	NA	NA
WP_021140612.1|2090733_2091822_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021140613.1|2091913_2093266_-	lysine-sensitive aspartokinase 3	NA	NA	NA	NA	NA
WP_017411372.1|2093688_2095017_-	amino-acid N-acetyltransferase	NA	NA	NA	NA	NA
WP_021140614.1|2095287_2095920_+	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_021140615.1|2096275_2096611_-	DUF3802 family protein	NA	NA	NA	NA	NA
WP_021140616.1|2096666_2097143_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_021140617.1|2097151_2097508_-	MmcQ/YjbR family DNA-binding protein	NA	NA	NA	NA	NA
WP_021140618.1|2097614_2098406_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_080937938.1|2098715_2099699_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_004576012.1|2099705_2101124_+|transposase	IS66-like element ISAs21 family transposase	transposase	NA	NA	NA	NA
WP_034524137.1|2102459_2102948_-	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	38.3	2.8e-14
WP_034524138.1|2103467_2104421_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021140302.1|2104615_2105683_-	carotenoid 1,2-hydratase	NA	NA	NA	NA	NA
WP_021140303.1|2105679_2108124_-	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_021140304.1|2108151_2108832_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.9	1.5e-29
WP_005310491.1|2109029_2109497_+	DUF4357 domain-containing protein	NA	NA	NA	NA	NA
WP_021140305.1|2109606_2111031_+	Na+/H+ antiporter NhaD	NA	NA	NA	NA	NA
WP_017412350.1|2111122_2112325_-	Bcr/CflA family multidrug efflux MFS transporter	NA	S4TR35	Salmonella_phage	25.1	1.8e-22
WP_021140307.1|2114206_2115481_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021140308.1|2115587_2116163_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021140309.1|2116399_2117824_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_021140310.1|2117910_2118750_-	hypothetical protein	NA	NA	NA	NA	NA
WP_034524141.1|2118749_2121755_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021140312.1|2121759_2122209_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021140313.1|2122330_2122816_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021140314.1|2123047_2123515_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021140315.1|2124446_2126183_+	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	24.7	3.4e-30
WP_021140316.1|2127121_2127640_+	type VI secretion system effector Hcp1	NA	NA	NA	NA	NA
WP_021140317.1|2127945_2129988_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	27.6	6.0e-34
WP_021140318.1|2129984_2130779_+	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_021140319.1|2130778_2132779_+	DUF2235 domain-containing protein	NA	NA	NA	NA	NA
WP_166507332.1|2132778_2133510_+	DUF2931 family protein	NA	Q6QLL3	Human_immunodeficiency_virus	97.3	6.1e-13
WP_099368897.1|2133547_2134564_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.1	1.4e-185
WP_021140693.1|2135565_2136264_+	DUF2931 family protein	NA	NA	NA	NA	NA
WP_021140692.1|2136358_2137060_+	DUF2931 family protein	NA	NA	NA	NA	NA
WP_034524298.1|2137317_2138676_+	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_021140688.1|2139830_2141141_-	type II toxin-antitoxin system HipA family toxin	NA	NA	NA	NA	NA
WP_005329233.1|2141140_2141395_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_010674978.1|2141896_2142145_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010674977.1|2142565_2142817_-	plasmid stabilization protein	NA	NA	NA	NA	NA
WP_024941318.1|2142895_2144254_-	cell division protein Fic	NA	NA	NA	NA	NA
WP_021140686.1|2144457_2144910_+	DUF2384 domain-containing protein	NA	NA	NA	NA	NA
WP_021140685.1|2145241_2145820_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099369130.1|2145842_2148191_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_005327392.1|2148175_2151484_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_010674971.1|2151974_2152175_-	helix-turn-helix transcriptional regulator	NA	A0A2H4JGT9	uncultured_Caudovirales_phage	36.9	1.5e-06
WP_010674970.1|2152300_2152516_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010674969.1|2152531_2153776_+|integrase	site-specific integrase	integrase	A0A1W6JTA0	Pseudomonas_phage	29.1	4.9e-39
WP_043851824.1|2154140_2154896_-	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	45.0	2.4e-52
WP_099368872.1|2154918_2156484_-|transposase	IS21-like element ISAs27 family transposase	transposase	K4I413	Acidithiobacillus_phage	45.8	2.9e-121
2156399:2156418	attR	GCGATCTGCCGATGAGCCAG	NA	NA	NA	NA
WP_021141233.1|2157679_2158084_-|transposase	IS200/IS605-like element ISAs26 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	54.8	8.8e-30
WP_021141234.1|2158141_2159368_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	O80301	Enterobacteria_phage	78.6	7.7e-154
WP_010674966.1|2159551_2160469_-	WYL domain-containing protein	NA	NA	NA	NA	NA
WP_010674965.1|2160570_2160717_+	DUF4258 domain-containing protein	NA	NA	NA	NA	NA
WP_099368947.1|2161077_2162164_+|transposase	IS3-like element ISKpn10 family transposase	transposase	NA	NA	NA	NA
WP_099368948.1|2162383_2163400_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.1	6.4e-186
WP_099368949.1|2163579_2165688_+	DUF1998 domain-containing protein	NA	NA	NA	NA	NA
WP_021140678.1|2168790_2173740_+	class I SAM-dependent DNA methyltransferase	NA	A0A1B1IUC6	uncultured_Mediterranean_phage	23.5	8.3e-13
WP_021140677.1|2173739_2180090_+	DEAD/DEAH box helicase	NA	A0A1B1IUF6	uncultured_Mediterranean_phage	22.7	2.3e-60
WP_021140676.1|2180086_2182225_+	ATP-dependent helicase	NA	G3MA40	Bacillus_virus	38.6	2.5e-06
WP_019706001.1|2183649_2184597_+|transposase	IS30-like element ISAs2 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.7	1.4e-41
WP_005342491.1|2185177_2186128_+|transposase	IS1595-like element ISKpn3 family transposase	transposase	NA	NA	NA	NA
WP_099369131.1|2187650_2187899_-	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_021141311.1|2188159_2189296_+|transposase	ISAs1-like element ISAs12 family transposase	transposase	NA	NA	NA	NA
WP_145958005.1|2189191_2190967_-	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_099368952.1|2191713_2193123_-	APC family permease	NA	NA	NA	NA	NA
WP_046400745.1|2193239_2194157_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_021140984.1|2194184_2194418_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021140988.1|2196082_2197339_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005330555.1|2197335_2197944_+	hypothetical protein	NA	NA	NA	NA	NA
WP_034524431.1|2197943_2200703_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021140990.1|2200699_2201572_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021140991.1|2201727_2202672_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005330548.1|2202981_2204805_+	DNA recombination protein RmuC	NA	NA	NA	NA	NA
WP_021141163.1|2207252_2208665_-	pyruvate kinase PykF	NA	NA	NA	NA	NA
WP_021141162.1|2208685_2209834_-	galactokinase	NA	NA	NA	NA	NA
WP_021141161.1|2209830_2210889_-	UDP-glucose--hexose-1-phosphate uridylyltransferase	NA	NA	NA	NA	NA
WP_021141160.1|2210949_2211963_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	46.2	1.0e-82
WP_021141159.1|2212164_2213172_+	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_102140864.1|2214373_2215458_-|transposase	IS3-like element ISKpn10 family transposase	transposase	NA	NA	NA	NA
WP_099368872.1|2215622_2217188_+|transposase	IS21-like element ISAs27 family transposase	transposase	K4I413	Acidithiobacillus_phage	45.8	2.9e-121
WP_043851824.1|2217210_2217966_+	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	45.0	2.4e-52
WP_021141280.1|2218497_2219496_+	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_034524610.1|2219569_2220205_+	maleylacetoacetate isomerase	NA	NA	NA	NA	NA
WP_001809438.1|2220723_2221755_+|transposase	IS630-like element ISAhy2 family transposase	transposase	NA	NA	NA	NA
WP_099368872.1|2222674_2224240_+|transposase	IS21-like element ISAs27 family transposase	transposase	K4I413	Acidithiobacillus_phage	45.8	2.9e-121
WP_099368954.1|2224262_2224964_+	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	44.4	6.2e-47
WP_099368955.1|2225029_2226448_+|transposase	IS66-like element ISUnCu16 family transposase	transposase	NA	NA	NA	NA
WP_021141125.1|2227010_2228660_-	DNA repair ATPase	NA	NA	NA	NA	NA
WP_017413053.1|2228860_2229823_-	autotransporter domain-containing protein	NA	NA	NA	NA	NA
WP_021141126.1|2230155_2230806_+	DedA family protein	NA	NA	NA	NA	NA
WP_017413054.1|2230920_2231454_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_005314664.1|2231728_2233024_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.0	1.1e-49
WP_021141127.1|2233163_2233808_+	DUF2913 family protein	NA	NA	NA	NA	NA
WP_034524516.1|2234187_2235228_+	peptidase M35	NA	NA	NA	NA	NA
WP_034524490.1|2235277_2235712_+	hypothetical protein	NA	NA	NA	NA	NA
WP_034524488.1|2235708_2236704_-	DUF4243 domain-containing protein	NA	NA	NA	NA	NA
WP_021141089.1|2236764_2237244_+	redox-sensitive transcriptional activator SoxR	NA	NA	NA	NA	NA
WP_034524486.1|2237473_2237884_+	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_021141086.1|2237977_2239393_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_021141085.1|2239405_2243863_-	glutamate synthase large subunit	NA	NA	NA	NA	NA
WP_099368918.1|2244787_2245992_-|transposase	IS3-like element ISAs17 family transposase	transposase	Q9ZXG3	Shigella_phage	70.8	9.1e-115
>prophage 4
NZ_CP022426	Aeromonas salmonicida subsp. pectinolytica 34mel chromosome, complete genome	5012649	2271508	2326207	5012649	transposase,tRNA	Escherichia_phage(18.18%)	53	NA	NA
WP_099368881.1|2271508_2272525_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.4	2.2e-186
WP_021140879.1|2272714_2273839_+	4-phosphoerythronate dehydrogenase	NA	NA	NA	NA	NA
WP_005310564.1|2274006_2275023_+	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_034524375.1|2275301_2277443_+	pilus assembly protein FimV	NA	NA	NA	NA	NA
WP_021140877.1|2277609_2278419_+|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_005310570.1|2278538_2279402_+	acetyl-CoA carboxylase carboxyltransferase subunit beta	NA	NA	NA	NA	NA
WP_034524374.1|2279404_2280664_+	bifunctional tetrahydrofolate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_034524373.1|2280864_2281635_+	cell division protein DedD	NA	NA	NA	NA	NA
WP_005310577.1|2281692_2282034_-	TusE/DsrC/DsvC family sulfur relay protein	NA	NA	NA	NA	NA
WP_021140874.1|2282060_2284214_-	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_011898838.1|2284378_2285035_-	Bax inhibitor-1/YccA family protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	53.1	4.0e-48
WP_021140873.1|2285504_2286173_-	UPF0149 family protein	NA	H9NBT7	Sphingomonas_phage	46.7	5.6e-05
WP_021140872.1|2286172_2289205_-	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	25.0	2.4e-23
WP_099368897.1|2289486_2290503_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.1	1.4e-185
WP_034524347.1|2290535_2291861_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_021140790.1|2291880_2294274_-	SAM-dependent DNA methyltransferase	NA	A0A220A2U4	Liberibacter_phage	28.2	2.8e-22
WP_021140791.1|2294643_2295051_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021140792.1|2295053_2295368_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021140793.1|2295461_2295809_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021140794.1|2295810_2296353_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021140795.1|2296432_2296795_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021140796.1|2296791_2297007_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021140797.1|2297006_2297513_-	hypothetical protein	NA	NA	NA	NA	NA
WP_034524350.1|2297629_2297878_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021140799.1|2297992_2298184_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021140800.1|2298180_2298678_-	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_021140801.1|2298768_2299071_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021140802.1|2299080_2299506_-	DUF2787 family protein	NA	NA	NA	NA	NA
WP_034524345.1|2299525_2300104_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021140804.1|2300192_2300633_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021140805.1|2300712_2301315_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021140806.1|2301415_2301976_-	recombinase family protein	NA	A0A1V0E035	Clostridioides_phage	46.1	1.3e-31
WP_021140807.1|2302568_2304059_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021140808.1|2304296_2304509_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_021140809.1|2304522_2305992_+	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_021140810.1|2306296_2306968_+	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_021140811.1|2307039_2307438_+	H-NS histone family protein	NA	NA	NA	NA	NA
WP_021141278.1|2308104_2309667_+|transposase	IS21-like element ISAs28 family transposase	transposase	K4I413	Acidithiobacillus_phage	46.0	9.6e-125
WP_021141277.1|2309690_2310446_+	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	45.4	2.4e-52
WP_080937960.1|2310541_2310991_+	LuxR family transcriptional regulator	NA	A0A1I9KF49	Aeromonas_phage	40.1	2.4e-20
WP_021141172.1|2311218_2311737_+	type VI secretion system effector Hcp1	NA	NA	NA	NA	NA
WP_021141173.1|2311921_2312209_+	type VI secretion system PAAR protein	NA	NA	NA	NA	NA
WP_021141174.1|2312220_2314314_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	26.5	4.9e-31
WP_021141175.1|2314316_2315057_+	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_021141176.1|2315339_2315822_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021141177.1|2315814_2316321_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_021141178.1|2316442_2316958_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010676219.1|2317419_2318517_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_099368957.1|2318612_2319287_+	replication initiation protein	NA	NA	NA	NA	NA
WP_021141248.1|2319336_2320215_+	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_080937966.1|2320228_2320807_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_088813959.1|2322400_2323961_+|transposase	IS3-like element ISAs20 family transposase	transposase	NA	NA	NA	NA
WP_004576012.1|2324788_2326207_+|transposase	IS66-like element ISAs21 family transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_CP022426	Aeromonas salmonicida subsp. pectinolytica 34mel chromosome, complete genome	5012649	2332804	2383533	5012649	bacteriocin,integrase,tRNA,transposase,protease	Acidithiobacillus_phage(11.11%)	38	2333919:2333978	2371921:2372016
WP_019706001.1|2332804_2333752_+|transposase	IS30-like element ISAs2 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.7	1.4e-41
2333919:2333978	attL	GGAAGGTGCGAATAAGCGGGGAAATTCTTCTCGGCTGACTCAGTCATTTCATTTCTTCAT	NA	NA	NA	NA
WP_021141029.1|2334452_2337098_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_021141028.1|2337225_2338434_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2D1GNR7	Pseudomonas_phage	32.1	1.1e-40
WP_021141027.1|2338829_2340383_+	methyl-accepting chemotaxis protein	NA	A0A1B0V854	Salmonella_phage	43.8	4.3e-32
WP_021141026.1|2340516_2342100_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_034524454.1|2342190_2342850_+	TIGR01621 family pseudouridine synthase	NA	NA	NA	NA	NA
WP_021141024.1|2342867_2343500_+	haloacid dehalogenase-like hydrolase	NA	NA	NA	NA	NA
WP_021141023.1|2343758_2344871_+	4-hydroxyphenylpyruvate dioxygenase	NA	NA	NA	NA	NA
WP_099368872.1|2345787_2347353_+|transposase	IS21-like element ISAs27 family transposase	transposase	K4I413	Acidithiobacillus_phage	45.8	2.9e-121
WP_043851824.1|2347375_2348131_+	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	45.0	2.4e-52
WP_021140576.1|2349961_2350981_-|transposase	IS110-like element ISAs16 family transposase	transposase	NA	NA	NA	NA
WP_133280087.1|2351593_2352832_+	MFS transporter	NA	NA	NA	NA	NA
WP_080937936.1|2352886_2355949_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	54.8	0.0e+00
WP_109422569.1|2356415_2356820_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021140580.1|2357131_2357716_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_034524274.1|2357724_2360283_+	DEAD/DEAH box helicase family protein	NA	A0A097BY72	Enterococcus_phage	30.5	3.2e-32
WP_021140582.1|2360391_2361609_-	J domain-containing protein	NA	NA	NA	NA	NA
WP_005310722.1|2362367_2363231_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	30.9	8.7e-27
WP_005300025.1|2363341_2363560_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	63.2	1.2e-17
WP_005310725.1|2363789_2364107_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	48.1	5.3e-14
WP_005310727.1|2364166_2366419_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	43.1	1.2e-168
WP_005300033.1|2366487_2366706_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_021140583.1|2366774_2367491_-	arginyltransferase	NA	NA	NA	NA	NA
WP_021140584.1|2367487_2368195_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_005310731.1|2368214_2368685_+	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_021140585.1|2368787_2370035_-	response regulator	NA	A0A127AWB9	Bacillus_phage	32.2	2.2e-15
WP_021140586.1|2370092_2371043_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	43.2	3.0e-60
WP_139723369.1|2371101_2371518_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099368958.1|2371755_2371914_-	alanine dehydrogenase	NA	NA	NA	NA	NA
WP_099368922.1|2372066_2373083_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.4	2.9e-186
2371921:2372016	attR	GGAAGGTGCGAATAAGCGGGGAAATTCTTCTCGGCTGACTCAGTCATTTCATTTCTTCATGTTTGAGCCGATTTTTTCTCCCGTAAATGCCTTGAA	NA	NA	NA	NA
WP_005300047.1|2373314_2373806_+	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_021139611.1|2374008_2376534_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	49.6	7.3e-90
WP_034523846.1|2376611_2377220_+	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_021139609.1|2377344_2378682_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	41.2	4.4e-78
WP_021139608.1|2379037_2380333_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	42.5	2.2e-90
WP_005310746.1|2380520_2381009_+|bacteriocin	bacteriocin production protein	bacteriocin	NA	NA	NA	NA
WP_005310748.1|2381030_2382551_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	42.4	1.2e-87
WP_021139607.1|2382774_2383533_+|tRNA	tRNA-(ms[2]io[6]A)-hydroxylase	tRNA	NA	NA	NA	NA
>prophage 6
NZ_CP022426	Aeromonas salmonicida subsp. pectinolytica 34mel chromosome, complete genome	5012649	2669703	2739697	5012649	integrase,transposase,tRNA	Catovirus(25.0%)	60	2693164:2693181	2747879:2747896
WP_099368974.1|2669703_2670846_+|transposase	IS4-like element ISAs18 family transposase	transposase	NA	NA	NA	NA
WP_010676219.1|2671792_2672890_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_088821966.1|2672941_2674029_-|transposase	IS3-like element ISAs22 family transposase	transposase	NA	NA	NA	NA
WP_034523647.1|2674516_2675587_+	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005311439.1|2675671_2676094_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_034523646.1|2676297_2680185_+	ATP-dependent RNA helicase HrpA	NA	A0A1V0SBU4	Catovirus	27.1	2.4e-55
WP_034523643.1|2680263_2681130_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005311442.1|2681236_2681524_+	50S ribosomal protein L25	NA	NA	NA	NA	NA
WP_021138925.1|2681666_2682311_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_021138924.1|2682340_2683456_-|tRNA	tRNA 2-selenouridine(34) synthase MnmH	tRNA	NA	NA	NA	NA
WP_021138923.1|2683514_2684552_-	selenide, water dikinase SelD	NA	NA	NA	NA	NA
WP_020379601.1|2684772_2685480_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_021138922.1|2685702_2686890_-	acyltransferase	NA	NA	NA	NA	NA
WP_021138921.1|2687228_2688419_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_021138920.1|2688533_2689964_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	32.0	2.5e-26
WP_021138919.1|2690050_2690323_+	acylphosphatase	NA	NA	NA	NA	NA
WP_021138918.1|2690392_2691028_-	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_021138917.1|2691219_2693253_-|tRNA	methionine--tRNA ligase	tRNA	NA	NA	NA	NA
2693164:2693181	attL	GATGTGTTCCAGCATGTG	NA	NA	NA	NA
WP_034523641.1|2693439_2694522_+	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_021138915.1|2694631_2695276_+	uridine kinase	NA	A0A1V0SAA3	Catovirus	39.0	2.1e-33
WP_005311470.1|2695339_2695921_+	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	40.5	1.6e-29
WP_021138914.1|2696347_2697820_+	inorganic phosphate transporter	NA	NA	NA	NA	NA
WP_034523639.1|2698565_2701766_-	ribonuclease E	NA	NA	NA	NA	NA
WP_034523638.1|2702140_2703124_+	23S rRNA pseudouridine(955/2504/2580) synthase RluC	NA	NA	NA	NA	NA
WP_021138911.1|2703123_2703771_+	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_021138910.1|2703858_2704440_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_005311491.1|2704742_2705264_+	23S rRNA accumulation protein YceD	NA	NA	NA	NA	NA
WP_005311492.1|2705283_2705451_+	50S ribosomal protein L32	NA	NA	NA	NA	NA
WP_011898705.1|2705460_2706480_+	phosphate acyltransferase PlsX	NA	NA	NA	NA	NA
WP_021138909.1|2706487_2707447_+	ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
WP_021138908.1|2707519_2708455_+	ACP S-malonyltransferase	NA	NA	NA	NA	NA
WP_021138907.1|2708468_2709203_+	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	34.0	2.2e-18
WP_005300909.1|2709360_2709597_+	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	47.1	1.7e-09
WP_021138906.1|2709679_2710921_+	beta-ketoacyl-ACP synthase II	NA	NA	NA	NA	NA
WP_034523636.1|2710936_2711797_+	aminodeoxychorismate lyase	NA	NA	NA	NA	NA
WP_021138904.1|2711786_2712788_+	endolytic transglycosylase MltG	NA	NA	NA	NA	NA
WP_021138903.1|2712787_2713429_+	dTMP kinase	NA	A0A1L2BX49	Bacteriophage	40.3	3.8e-27
WP_021138902.1|2713413_2714361_+	DNA polymerase III subunit delta'	NA	NA	NA	NA	NA
WP_034523634.1|2714386_2715166_+	YchF/TatD family DNA exonuclease	NA	NA	NA	NA	NA
WP_046400708.1|2715489_2716479_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_005311516.1|2716648_2716921_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021138898.1|2717113_2718544_-	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
WP_021138897.1|2718675_2721228_-	MCE family protein	NA	NA	NA	NA	NA
WP_005311518.1|2721330_2721939_-	paraquat-inducible protein A	NA	NA	NA	NA	NA
WP_005311519.1|2721916_2722549_-	paraquat-inducible protein A	NA	NA	NA	NA	NA
WP_021138896.1|2722696_2723584_+	methylisocitrate lyase	NA	NA	NA	NA	NA
WP_021138895.1|2723595_2724723_+	2-methylcitrate synthase	NA	NA	NA	NA	NA
WP_021138894.1|2724733_2726179_+	bifunctional 2-methylcitrate dehydratase/aconitate hydratase	NA	NA	NA	NA	NA
WP_005311522.1|2726254_2726998_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005311524.1|2727272_2727605_+	poly(3-hydroxybutyrate) depolymerase	NA	NA	NA	NA	NA
WP_021138893.1|2727911_2729342_+	wax ester/triacylglycerol synthase family O-acyltransferase	NA	NA	NA	NA	NA
WP_021138892.1|2729421_2730222_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021138891.1|2730235_2730904_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_021138890.1|2730905_2732090_-	patatin	NA	NA	NA	NA	NA
WP_021138889.1|2732183_2732762_-	phasin family protein	NA	NA	NA	NA	NA
WP_099368975.1|2733007_2734978_+	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	25.0	4.3e-05
WP_021138887.1|2735027_2735924_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_021138886.1|2736095_2736416_+	YebG family protein	NA	NA	NA	NA	NA
WP_034523649.1|2736716_2737994_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_021138884.1|2738344_2739697_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
2747879:2747896	attR	GATGTGTTCCAGCATGTG	NA	NA	NA	NA
>prophage 7
NZ_CP022426	Aeromonas salmonicida subsp. pectinolytica 34mel chromosome, complete genome	5012649	2833302	2901809	5012649	transposase,head,tail,capsid	Acidithiobacillus_phage(22.22%)	57	NA	NA
WP_099368981.1|2833302_2834631_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_021140533.1|2834684_2837489_-	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	G3M9Z5	Bacillus_virus	34.4	1.6e-106
WP_021140534.1|2837690_2838407_+	bifunctional 2-polyprenyl-6-hydroxyphenol methylase/3-demethylubiquinol 3-O-methyltransferase UbiG	NA	NA	NA	NA	NA
WP_021140535.1|2838406_2839093_+	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_021140536.1|2839648_2841916_+	ribonucleoside-diphosphate reductase subunit alpha	NA	I3UMG3	Colwellia_phage	66.1	1.9e-299
WP_021140537.1|2841996_2843130_+	ribonucleotide-diphosphate reductase subunit beta	NA	W6AT53	Erwinia_phage	74.0	4.9e-163
WP_021140539.1|2843282_2843603_+	2Fe-2S ferredoxin-like protein	NA	NA	NA	NA	NA
WP_021140540.1|2843806_2844958_-	murein transglycosylase A	NA	NA	NA	NA	NA
WP_005315494.1|2845108_2845360_+	DUF1289 domain-containing protein	NA	NA	NA	NA	NA
WP_021140541.1|2845460_2847185_-	PTS fructose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_021140542.1|2847181_2848177_-	1-phosphofructokinase	NA	NA	NA	NA	NA
WP_021140543.1|2848176_2849277_-	fused PTS fructose transporter subunit IIA/HPr protein	NA	NA	NA	NA	NA
WP_021140544.1|2849584_2850571_+	catabolite repressor/activator	NA	NA	NA	NA	NA
WP_021140545.1|2850903_2852097_+	tyrosine-specific transporter	NA	NA	NA	NA	NA
WP_005315478.1|2852365_2852770_+	DUF2384 domain-containing protein	NA	NA	NA	NA	NA
WP_021140546.1|2852769_2853459_+	RES family NAD+ phosphorylase	NA	NA	NA	NA	NA
WP_021140547.1|2853569_2854973_-	DEAD/DEAH box helicase	NA	A0A0N9Q9J4	Chrysochromulina_ericina_virus	30.5	3.4e-44
WP_080937935.1|2855131_2856139_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_021140549.1|2856260_2857349_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	45.6	7.5e-84
WP_021140550.1|2857361_2858297_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_021140551.1|2858379_2858904_+	endonuclease SmrB	NA	NA	NA	NA	NA
WP_099368947.1|2859754_2860842_-|transposase	IS3-like element ISKpn10 family transposase	transposase	NA	NA	NA	NA
WP_046400746.1|2861751_2863317_+|transposase	IS21-like element ISAs27 family transposase	transposase	K4I413	Acidithiobacillus_phage	45.8	2.9e-121
WP_043851824.1|2863339_2864095_+	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	45.0	2.4e-52
WP_010676219.1|2865180_2866278_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_021140049.1|2866882_2868076_-	methyltransferase	NA	NA	NA	NA	NA
WP_017412092.1|2868365_2868944_+	PhnA protein	NA	NA	NA	NA	NA
WP_021140048.1|2869129_2871280_-	fatty acid oxidation complex subunit alpha FadJ	NA	NA	NA	NA	NA
WP_005311309.1|2871279_2872590_-	acetyl-CoA C-acyltransferase FadI	NA	NA	NA	NA	NA
WP_021140047.1|2872772_2873723_+	MoxR family ATPase	NA	NA	NA	NA	NA
WP_034524020.1|2873730_2874630_+	DUF58 domain-containing protein	NA	NA	NA	NA	NA
WP_021140045.1|2874632_2875181_+	DUF4381 domain-containing protein	NA	NA	NA	NA	NA
WP_021140044.1|2875177_2876173_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_034524030.1|2876197_2877697_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_080937921.1|2877660_2879229_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021140041.1|2879265_2879856_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_021140040.1|2879848_2880592_+	DUF3379 domain-containing protein	NA	NA	NA	NA	NA
WP_021140039.1|2881000_2882287_+	long-chain fatty acid transporter 1	NA	NA	NA	NA	NA
WP_021140038.1|2882540_2883797_+	transporter	NA	NA	NA	NA	NA
WP_034524016.1|2883927_2885151_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_021140036.1|2885147_2886311_-	acetyl-CoA C-acyltransferase	NA	NA	NA	NA	NA
WP_021140035.1|2886443_2886860_+	MerR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_021140033.1|2887632_2889105_+	recombinase family protein	NA	NA	NA	NA	NA
WP_099368984.1|2889146_2889473_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080937919.1|2889803_2893175_-	hypothetical protein	NA	A0A219YC65	Aeromonas_phage	64.6	0.0e+00
WP_139723404.1|2893258_2893546_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021140030.1|2893562_2893826_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139723403.1|2893825_2894221_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021140029.1|2894275_2896831_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021140028.1|2896929_2897154_-	hypothetical protein	NA	NA	NA	NA	NA
WP_125606572.1|2897236_2897671_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021140026.1|2897697_2898027_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021140025.1|2898102_2898519_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021140024.1|2898536_2898941_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021140023.1|2898937_2899507_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021140021.1|2899842_2900385_-|head,tail	phage gp6-like head-tail connector protein	head,tail	NA	NA	NA	NA
WP_021140020.1|2900612_2901809_-|capsid	phage major capsid protein	capsid	A0A141GEW2	Brucella_phage	23.8	1.3e-09
>prophage 8
NZ_CP022426	Aeromonas salmonicida subsp. pectinolytica 34mel chromosome, complete genome	5012649	2961855	3014837	5012649	transposase,capsid	Acidithiobacillus_phage(28.57%)	42	NA	NA
WP_088813959.1|2961855_2963417_-|transposase	IS3-like element ISAs20 family transposase	transposase	NA	NA	NA	NA
WP_145958010.1|2963459_2963786_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021141106.1|2964434_2965460_-|capsid	minor capsid protein E	capsid	NA	NA	NA	NA
WP_021141107.1|2965518_2965854_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021141108.1|2965856_2966195_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021141109.1|2966695_2968483_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139723432.1|2968494_2968887_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021141110.1|2969027_2969381_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139723431.1|2969396_2969609_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080937959.1|2969685_2970444_-	HTH domain-containing protein	NA	NA	NA	NA	NA
WP_162516026.1|2970421_2970586_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021141112.1|2970588_2970789_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001809438.1|2972031_2973063_-|transposase	IS630-like element ISAhy2 family transposase	transposase	NA	NA	NA	NA
WP_139723430.1|2973258_2973519_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039272517.1|2975820_2977362_+|transposase	IS21-like element ISAs29 family transposase	transposase	K4I413	Acidithiobacillus_phage	47.6	3.4e-130
WP_039272515.1|2977376_2978132_+	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	50.6	1.3e-58
WP_021140248.1|2979664_2980453_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_021140247.1|2980545_2981982_-	arginine-ornithine antiporter	NA	NA	NA	NA	NA
WP_021140246.1|2982370_2983132_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	23.5	4.4e-06
WP_021140245.1|2983201_2984134_-	3-hydroxyisobutyrate dehydrogenase	NA	NA	NA	NA	NA
WP_021140244.1|2984211_2985324_-	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_021140243.1|2985316_2986114_-	enoyl-CoA hydratase	NA	NA	NA	NA	NA
WP_021140242.1|2986316_2987474_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_021140241.1|2987615_2989127_-	CoA-acylating methylmalonate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_021140240.1|2989379_2990528_+	isovaleryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_021140239.1|2990524_2992144_+	3-methylcrotonyl CoA carboxylase subunit beta	NA	A0A1B2ITV7	Pike_perch_iridovirus	52.4	4.3e-19
WP_021140238.1|2992154_2992994_+	enoyl-CoA hydratase	NA	NA	NA	NA	NA
WP_021140237.1|2993097_2995083_+	biotin/lipoyl-binding protein	NA	NA	NA	NA	NA
WP_021140236.1|2995097_2996036_+	hydroxymethylglutaryl-CoA lyase	NA	A0A1V0SKU2	Klosneuvirus	35.7	4.2e-43
WP_005315403.1|2996050_2996461_+	MerR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_034524109.1|2996498_2997260_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_005315399.1|3000880_3001477_+	hypothetical protein	NA	NA	NA	NA	NA
WP_034524108.1|3001558_3002374_-	zinc-dependent peptidase	NA	NA	NA	NA	NA
WP_021140233.1|3002392_3002830_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_021140232.1|3003130_3004630_+	alanine:cation symporter family protein	NA	NA	NA	NA	NA
WP_021140231.1|3004709_3005516_-	crotonase/enoyl-CoA hydratase family protein	NA	NA	NA	NA	NA
WP_021140230.1|3005619_3006261_-	3'-5' exonuclease	NA	NA	NA	NA	NA
WP_021140229.1|3006263_3008090_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_021140228.1|3008134_3009850_-	cation acetate symporter	NA	NA	NA	NA	NA
WP_021140227.1|3009858_3010125_-	DUF4212 domain-containing protein	NA	NA	NA	NA	NA
WP_001310555.1|3012448_3013465_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.7	9.8e-187
WP_099368897.1|3013820_3014837_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.1	1.4e-185
>prophage 9
NZ_CP022426	Aeromonas salmonicida subsp. pectinolytica 34mel chromosome, complete genome	5012649	3053070	3133511	5012649	transposase	Tupanvirus(21.43%)	58	NA	NA
WP_019706001.1|3053070_3054018_-|transposase	IS30-like element ISAs2 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.7	1.4e-41
WP_021141117.1|3054268_3054952_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021141118.1|3055473_3055746_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021141119.1|3056128_3057709_-	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_017412971.1|3057792_3059256_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	39.6	5.3e-93
WP_021141121.1|3060032_3060782_+	energy transducer TonB	NA	NA	NA	NA	NA
WP_034524514.1|3060784_3061537_+	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_021141123.1|3061536_3061959_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_010676219.1|3062526_3063624_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_021139138.1|3064354_3065725_+	exodeoxyribonuclease VII large subunit	NA	A0A2H4UVM9	Bodo_saltans_virus	36.9	1.4e-34
WP_021139139.1|3065786_3067154_-	heme anaerobic degradation radical SAM methyltransferase ChuW/HutW	NA	NA	NA	NA	NA
WP_021139140.1|3067416_3069012_+	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.8	1.2e-26
WP_021139141.1|3069105_3070161_-	3-deoxy-7-phosphoheptulonate synthase AroG	NA	S4W5F1	Pandoravirus	50.3	5.2e-82
WP_021139142.1|3070399_3071683_-	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_005315304.1|3071854_3072943_-	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	46.9	1.1e-87
WP_021139143.1|3073167_3074097_-	electron transfer flavoprotein alpha-subunit	NA	NA	NA	NA	NA
WP_021139144.1|3074191_3074944_-	electron transfer flavoprotein subunit beta/FixA family protein	NA	NA	NA	NA	NA
WP_021139145.1|3075070_3076720_+	electron transfer flavoprotein-ubiquinone oxidoreductase	NA	NA	NA	NA	NA
WP_005315297.1|3077212_3078160_+	magnesium/cobalt transporter CorA	NA	NA	NA	NA	NA
WP_021139146.1|3078323_3078785_+	DUF2919 domain-containing protein	NA	NA	NA	NA	NA
WP_021139147.1|3078800_3079553_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021139148.1|3079809_3081048_+	siderophore amonabactin export MFS transporter	NA	NA	NA	NA	NA
WP_021139149.1|3081105_3083079_+	siderophore amonabactin TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	35.6	8.4e-17
WP_021139150.1|3083149_3084166_+	amonabactin ABC transporter permease subunit 2	NA	NA	NA	NA	NA
WP_034523720.1|3084180_3085248_+	amonabactin ABC transporter permease subunit 1	NA	NA	NA	NA	NA
WP_021139152.1|3085247_3086051_+	amonabactin ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	25.8	7.9e-14
WP_021139153.1|3086120_3086846_-	amonabactin biosynthesis phosphopantetheinyl transferase AmoD	NA	NA	NA	NA	NA
WP_021139154.1|3087004_3087949_+	amonabactin ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_021139155.1|3088026_3089583_-	amino acid adenylation domain-containing protein	NA	A0A2K9L3I8	Tupanvirus	27.7	2.5e-40
WP_099368993.1|3089579_3095831_-	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	24.6	5.3e-73
WP_034523724.1|3095839_3096589_-	2,3-dihydro-2,3-dihydroxybenzoate dehydrogenase	NA	NA	NA	NA	NA
WP_021139159.1|3096609_3099699_-	non-ribosomal peptide synthetase	NA	A0A2K9L3I8	Tupanvirus	26.2	7.7e-41
WP_021139160.1|3099695_3100604_-	isochorismatase family protein	NA	NA	NA	NA	NA
WP_021139161.1|3100627_3102298_-	(2,3-dihydroxybenzoyl)adenylate synthase	NA	NA	NA	NA	NA
WP_034523722.1|3102294_3103488_-	isochorismate synthase	NA	NA	NA	NA	NA
WP_021139163.1|3103812_3104364_+	lipoprotein	NA	NA	NA	NA	NA
WP_021139164.1|3104510_3106511_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021139165.1|3106605_3107880_-	glucose-1-phosphate adenylyltransferase	NA	NA	NA	NA	NA
WP_021139166.1|3108067_3109711_+	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_005315253.1|3109673_3110168_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005315249.1|3110348_3110711_-	DUF2750 domain-containing protein	NA	NA	NA	NA	NA
WP_034523725.1|3110824_3112456_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	38.0	2.2e-23
WP_021139168.1|3112614_3113919_-	inosine/guanosine kinase	NA	NA	NA	NA	NA
WP_021139169.1|3114105_3114498_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021139170.1|3114569_3115544_-	ferrochelatase	NA	NA	NA	NA	NA
WP_021139171.1|3115649_3116294_-	adenylate kinase	NA	NA	NA	NA	NA
WP_005315220.1|3116340_3116535_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021139172.1|3116551_3118465_-	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	36.2	2.6e-116
WP_021139174.1|3118681_3119284_-	recombination protein RecR	NA	NA	NA	NA	NA
WP_034523723.1|3119480_3120314_-	formate dehydrogenase accessory sulfurtransferase FdhD	NA	NA	NA	NA	NA
WP_021139176.1|3120328_3122443_-	sigma 54-interacting transcriptional regulator	NA	NA	NA	NA	NA
WP_019706001.1|3122936_3123884_+|transposase	IS30-like element ISAs2 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.7	1.4e-41
WP_099368994.1|3124006_3125149_+|transposase	IS4-like element ISAs18 family transposase	transposase	NA	NA	NA	NA
WP_021141239.1|3125153_3125558_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021141238.1|3125640_3127785_-	formate dehydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_021141237.1|3127840_3128440_-	4Fe-4S dicluster domain-containing protein	NA	NA	NA	NA	NA
WP_021141311.1|3129577_3130714_+|transposase	ISAs1-like element ISAs12 family transposase	transposase	NA	NA	NA	NA
WP_088813959.1|3131950_3133511_+|transposase	IS3-like element ISAs20 family transposase	transposase	NA	NA	NA	NA
>prophage 10
NZ_CP022426	Aeromonas salmonicida subsp. pectinolytica 34mel chromosome, complete genome	5012649	3199214	3245515	5012649	integrase,transposase	Staphylococcus_phage(12.5%)	42	3221288:3221347	3251307:3252842
WP_076611830.1|3199214_3200543_+|transposase	IS4-like element ISAs30 family transposase	transposase	NA	NA	NA	NA
WP_005315043.1|3200589_3202260_-	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_021140654.1|3202354_3203047_-	(d)CMP kinase	NA	NA	NA	NA	NA
WP_021140653.1|3203295_3203889_+	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	46.5	8.6e-42
WP_005315034.1|3204035_3205010_-	HTH-type transcriptional regulator CysB	NA	NA	NA	NA	NA
WP_021140652.1|3205083_3205959_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_021140651.1|3206052_3207261_+	MFS transporter	NA	NA	NA	NA	NA
WP_021140650.1|3207302_3207857_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021140649.1|3207850_3208615_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021140648.1|3208804_3209530_-	oxygen-insensitive NADPH nitroreductase	NA	NA	NA	NA	NA
WP_021140647.1|3209623_3211561_-	EAL domain-containing protein	NA	G3MA91	Bacillus_virus	32.1	6.3e-17
WP_034524291.1|3211730_3212432_+	DUF2982 domain-containing protein	NA	NA	NA	NA	NA
WP_021140645.1|3212505_3213444_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_034524290.1|3213498_3214530_+	response regulator	NA	NA	NA	NA	NA
WP_021140643.1|3214539_3214971_+	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_021140642.1|3215034_3216051_-	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_021140641.1|3216638_3217577_+	universal stress protein	NA	NA	NA	NA	NA
WP_021140640.1|3217592_3220322_+	cation-transporting P-type ATPase	NA	M1IAU8	Acanthocystis_turfacea_Chlorella_virus	28.5	3.3e-72
WP_021140639.1|3220554_3221256_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
3221288:3221347	attL	AGGTAACGGTTCACCCAGACCAGTTGACAGGTAAAAAATGAGACGATCGTCCGGTGATCC	NA	NA	NA	NA
WP_005327996.1|3221393_3222812_+|transposase	IS66-like element ISUnCu16 family transposase	transposase	NA	NA	NA	NA
WP_005314974.1|3222883_3223291_-	hypothetical protein	NA	A0A1C6ZDG7	Pseudomonas_phage	45.7	7.3e-08
WP_021140891.1|3223399_3224299_+	aldo/keto reductase family oxidoreductase	NA	NA	NA	NA	NA
WP_011898630.1|3224367_3224646_-	RNA-binding protein	NA	NA	NA	NA	NA
WP_021140892.1|3224864_3225407_-	hypothetical protein	NA	NA	NA	NA	NA
WP_034524381.1|3225513_3226284_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.5	4.9e-29
WP_017411548.1|3226276_3227074_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_021140894.1|3227076_3227898_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_080937949.1|3227870_3228773_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_021140896.1|3228772_3229510_+	penicillin-insensitive murein endopeptidase	NA	NA	NA	NA	NA
WP_021140897.1|3229552_3230158_+	LemA family protein	NA	A0A1X9IGG1	Lactococcus_phage	33.9	1.4e-15
WP_021140898.1|3230154_3230889_+	TPM domain-containing protein	NA	NA	NA	NA	NA
WP_005314938.1|3230909_3231527_+	membrane protein	NA	NA	NA	NA	NA
WP_046400743.1|3232398_3233277_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_005346570.1|3233568_3234729_+|integrase	site-specific integrase	integrase	Q76UT6	Pseudomonas_virus	34.1	7.1e-32
WP_034524388.1|3235103_3235724_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080937950.1|3235714_3237424_+	relaxase/mobilization nuclease domain-containing protein	NA	NA	NA	NA	NA
WP_139723416.1|3238026_3238341_+	hypothetical protein	NA	NA	NA	NA	NA
WP_139723415.1|3238362_3238620_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099369000.1|3238991_3239288_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005327996.1|3239245_3240664_-|transposase	IS66-like element ISUnCu16 family transposase	transposase	NA	NA	NA	NA
WP_080937969.1|3240776_3241832_+	SEL1-like repeat protein	NA	NA	NA	NA	NA
WP_046400746.1|3243949_3245515_+|transposase	IS21-like element ISAs27 family transposase	transposase	K4I413	Acidithiobacillus_phage	45.8	2.9e-121
3251307:3252842	attR	GGATCACCGGACGATCGTCTCATTTTTTACCTGTCAACTGGTCTGGGTGAACCGTTACCTATGAACGGCCAACGGCCGCCCCGAAGGGGTGAGCCACGCAGTAGCGAATCATCCCTCCCTCACCGCCAAATCTGAAGCAGCCGACCTCAGGGTCGGTTTTTTGCTTTTGGGCCGGCCTATCCTCTGCTGCCGACTCTCCTTCCTCTACTCTTACCAAGATTGCATGCTGCAGTGTTGGCCACTCTCCCCTCTGCCCGACCAAACTCCCTTCATTCCCCTCTCGCTGTGTAAACCCGCCACCTTTGCCCATCTCTACGAAACACTGTTTTGCGGGCTTGTTCCAGCCGTTGAAAATCATTCTCAAATGGGAAAATTGACCCTTGTAGCAAAAAACGATTTTACCCCCATCGATTAATTATTAATCCCCTGAAATGACATGTAAATCAGTATGAAAGTGCCATAATGCGTAACATTATTGTTAAGTCACGTGATTAATTTGGTTAGGGAAAATCTCTATGTTTGCTGATATTGCTGTTCAACATTGGGCTTTTGCCATTTATGTCATTGCAGCCATCTGCCTCTGTCTGGTGATGATCGGCCTCGCCGCCCTGCTGGGTGGCCGCGCCCACGGCCGTGCCAAAAACAAGCCCTTCGAGTCTGGCGTCGATTCGGTGGGTAACGCCCGCCTGCGCTTCTCCGCCAAGTTCTATCTGGTTGCCATGTTCTTCGTCATCTTCGACGTGGAAGCACTTTACCTGTTTGCCTGGTCTGTTTCCGTTAGGGAAAGCGGCTGGGTCGGCTTCATCGAAGCCGCCATCTTTATCGGCTTGCTGCTGGTAGGACTCCTCTACTTGTGGCGTATCGGCGCCCTCGACTGGGCACCGAAAAAACGCGCCCTGACCGACAAGAAGCCTGACTGACTTACTGATTCTCTCTTTGAGGTTGCACCATGAAGTACACCCTGACCCGGATTGACCCGGATGCGCCCGTTGAGCGCTACCCACAGGAACAGAGCCAGACCGTCGATGACCCGCTGGCACAAGATGCGACGCGCGGCATCATGATGGGGCGTCTTGAGGAGGTGTTGCAAGACACCGTCAACTGGGGTCGCAAAAACTCCCTCTGGCCCTACAACTTCGGCATCTCCTGCTGCTATGTGGAGATGTGTACCGCGTTCACTTCCCCCCATGACGTGGCCCGCTTCGGTGCCGAAGTGATCCGGGCCTCGCCCCGTCAGGCGGATTTCATGGTGATCGCCGGTACCCCCTTCATCAAGATGGCGCCTGTCATCCAGCGACTGTATGAACAGTTGCTCGAGCCCAAGTGGGTCATTTCCATGGGCGCCTGCGCCAACTCAGGCGGCATGTATGACATCTATTCAGTGGTACAGGGGGTAGACAAGTTCCTGCCGGTCGACGTCTATATTCCGGGCTGCCCGCCCCGTCCCGAGGCCTTCCTGCAAGCCCTGATGCTGCTGCAGGACTCCATCGGCAAGGAACGCCGCCCCCTCTCCTGGGTCGTCGGCGATCAGGGGAT	NA	NA	NA	NA
>prophage 11
NZ_CP022426	Aeromonas salmonicida subsp. pectinolytica 34mel chromosome, complete genome	5012649	3355479	3422644	5012649	integrase,transposase,tRNA	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage(14.29%)	60	3406355:3406414	3422987:3423050
WP_076612160.1|3355479_3356520_-|transposase	IS481-like element ISAs19 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	42.1	1.7e-72
WP_046400734.1|3356756_3357926_-	DUF1615 domain-containing protein	NA	NA	NA	NA	NA
WP_021140151.1|3358142_3359801_-	2-isopropylmalate synthase	NA	NA	NA	NA	NA
WP_021140150.1|3360325_3363550_-	carbamoyl-phosphate synthase large subunit	NA	NA	NA	NA	NA
WP_021140149.1|3363566_3364718_-	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	33.2	1.1e-48
WP_021140148.1|3365394_3366207_-	4-hydroxy-tetrahydrodipicolinate reductase	NA	NA	NA	NA	NA
WP_021140147.1|3366454_3367423_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_021140146.1|3367841_3369176_+	Na+/H+ antiporter NhaC family protein	NA	NA	NA	NA	NA
WP_021140145.1|3369329_3369938_+	5-formyltetrahydrofolate cyclo-ligase	NA	NA	NA	NA	NA
WP_021140144.1|3370193_3370847_+	ribose-5-phosphate isomerase RpiA	NA	NA	NA	NA	NA
WP_005314621.1|3371075_3372308_+	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	48.9	6.9e-110
WP_005314618.1|3372550_3372931_-	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_021140143.1|3373085_3374147_+	3-deoxy-7-phosphoheptulonate synthase	NA	S4W5F1	Pandoravirus	49.3	9.2e-87
WP_021140142.1|3374263_3375073_-	ATP-binding cassette domain-containing protein	NA	A0A1M7XV31	Cedratvirus	30.6	2.8e-11
WP_021140141.1|3375132_3376140_-	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
WP_021140140.1|3376243_3376975_-	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005314602.1|3377086_3377443_+	DMT family protein	NA	NA	NA	NA	NA
WP_011898593.1|3377502_3378642_+	PilT/PilU family type 4a pilus ATPase	NA	NA	NA	NA	NA
WP_021140139.1|3378914_3380186_+	glucose-1-phosphate adenylyltransferase	NA	NA	NA	NA	NA
WP_021140138.1|3380332_3380812_+	WbuC family cupin fold metalloprotein	NA	NA	NA	NA	NA
WP_021140137.1|3380907_3381150_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021140136.1|3381146_3383417_-	Fe(2+) transporter permease subunit FeoB	NA	NA	NA	NA	NA
WP_005314583.1|3383413_3383641_-	ferrous iron transport protein A	NA	NA	NA	NA	NA
WP_005314581.1|3383760_3384090_+	translation initiation factor	NA	NA	NA	NA	NA
WP_005314579.1|3384334_3384892_+	TMEM165/GDT1 family protein	NA	NA	NA	NA	NA
WP_021140135.1|3385144_3386083_+	DUF2157 domain-containing protein	NA	NA	NA	NA	NA
WP_021140134.1|3386119_3387127_+	DUF4401 domain-containing protein	NA	NA	NA	NA	NA
WP_021140133.1|3387123_3387627_+	GDYXXLXY domain-containing protein	NA	NA	NA	NA	NA
WP_034524070.1|3387700_3388447_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_034524069.1|3388562_3389309_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_021140130.1|3389500_3390514_-	GGDEF domain-containing protein	NA	G3MA91	Bacillus_virus	29.8	3.8e-13
WP_021140129.1|3391207_3391516_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011191342.1|3392535_3393804_+|transposase	IS4-like element ISApu1 family transposase	transposase	NA	NA	NA	NA
WP_099369012.1|3394085_3395102_-|transposase	IS5 family transposase	transposase	Q38213	Escherichia_phage	98.8	1.9e-185
WP_076612160.1|3395174_3396215_-|transposase	IS481-like element ISAs19 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	42.1	1.7e-72
WP_021141043.1|3396988_3398365_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	33.5	8.7e-45
WP_005314539.1|3398556_3399054_+	peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_021141042.1|3399043_3399754_+	DUF4269 domain-containing protein	NA	NA	NA	NA	NA
WP_021141041.1|3399750_3400515_+	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_017413027.1|3400595_3400844_+	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_005314534.1|3400979_3401156_+	DUF3606 domain-containing protein	NA	NA	NA	NA	NA
WP_034524459.1|3401294_3402068_-	glucose 1-dehydrogenase	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.3	6.6e-18
WP_021141038.1|3402150_3403083_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_125729364.1|3403714_3403999_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021141035.1|3404205_3404937_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021141034.1|3405584_3405869_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_005320072.1|3405870_3406203_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
3406355:3406414	attL	ATTTTAATGGTGCCCGAGGCCGGAATCGAACCGGCACGACGCGAACGTCGAGGGATTTTA	NA	NA	NA	NA
WP_021141032.1|3406625_3407633_+	Fic family protein	NA	D7RWK9	Brochothrix_phage	24.4	3.4e-06
WP_041206012.1|3409350_3410913_+|transposase	IS21-like element ISAs28 family transposase	transposase	K4I413	Acidithiobacillus_phage	46.2	3.3e-125
WP_099369014.1|3410936_3411692_+	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	45.4	2.4e-52
WP_099369015.1|3413650_3414382_-	macrodomain Ori organization protein MaoP	NA	NA	NA	NA	NA
WP_080937902.1|3414832_3416275_-	DUF2971 domain-containing protein	NA	NA	NA	NA	NA
WP_139723383.1|3416792_3417200_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046400722.1|3417289_3417871_-	SLATT domain-containing protein	NA	NA	NA	NA	NA
WP_021139614.1|3417848_3418730_-	nucleotidyltransferase	NA	NA	NA	NA	NA
WP_021139615.1|3419431_3419851_-	DUF2787 family protein	NA	NA	NA	NA	NA
WP_021139616.1|3419911_3420517_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021139617.1|3420639_3420942_-	DUF1232 domain-containing protein	NA	NA	NA	NA	NA
WP_021139618.1|3420934_3421303_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021139619.1|3421438_3422644_-|integrase	site-specific integrase	integrase	Q19US1	Mannheimia_phage	34.6	6.5e-12
3422987:3423050	attR	ATTTTAATGGTGCCCGAGGCCGGAATCGAACCGGCACGACGCGAACGTCGAGGGATTTTAAATC	NA	NA	NA	NA
>prophage 12
NZ_CP022426	Aeromonas salmonicida subsp. pectinolytica 34mel chromosome, complete genome	5012649	4158847	4237577	5012649	integrase,tRNA,holin,transposase,protease	Bacillus_phage(23.08%)	57	4161295:4161354	4180481:4180543
WP_034524326.1|4158847_4161124_+|protease	M6 family metalloprotease domain-containing protein	protease	NA	NA	NA	NA
4161295:4161354	attL	AAAGGGTTTAATGCGCGCCGTTGCCCAGATAGCTCAGTCGGTAGAGCAGGGGATTGAAAA	NA	NA	NA	NA
WP_080937944.1|4162706_4162970_+	hypothetical protein	NA	NA	NA	NA	NA
WP_034524328.1|4163119_4163635_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099369048.1|4163795_4164812_+|transposase	IS5 family transposase	transposase	Q38213	Escherichia_phage	98.5	3.5e-184
WP_021139679.1|4165147_4166269_+	polysaccharide export protein	NA	NA	NA	NA	NA
WP_021139678.1|4166332_4166761_+	protein-tyrosine-phosphatase	NA	NA	NA	NA	NA
WP_034523866.1|4166816_4169000_+	polysaccharide biosynthesis tyrosine autokinase	NA	NA	NA	NA	NA
WP_162516014.1|4169178_4170057_+	sensor domain-containing diguanylate cyclase	NA	NA	NA	NA	NA
WP_021139675.1|4170783_4171332_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021139674.1|4171328_4171631_+	DUF1232 domain-containing protein	NA	A0A2I7S9Z5	Vibrio_phage	39.2	1.2e-07
WP_021139673.1|4171653_4172274_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021139672.1|4172270_4172705_+	DUF2787 family protein	NA	NA	NA	NA	NA
WP_021139670.1|4173195_4174437_+|integrase	site-specific integrase	integrase	A0A221SAN4	Ralstonia_phage	30.9	1.9e-27
WP_021139669.1|4174722_4175616_+	WYL domain-containing protein	NA	A0A0R6PH67	Moraxella_phage	28.8	1.1e-32
WP_034523865.1|4175742_4175922_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161797136.1|4176348_4178181_-	DUF927 domain-containing protein	NA	NA	NA	NA	NA
WP_021139667.1|4178624_4179779_-|integrase	site-specific integrase	integrase	A0A0M3LRG1	Mannheimia_phage	25.4	1.7e-09
WP_021139665.1|4181088_4182306_-	BCCT family transporter	NA	NA	NA	NA	NA
4180481:4180543	attR	AAAGGGTTTAATGCGCGCCGTTGCCCAGATAGCTCAGTCGGTAGAGCAGGGGATTGAAAATCC	NA	NA	NA	NA
WP_021139664.1|4182549_4184229_-|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	28.2	6.4e-50
WP_021139663.1|4184238_4185702_-	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_021139662.1|4186530_4187808_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_021139661.1|4187907_4191468_+	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	23.3	5.6e-11
WP_021139660.1|4191521_4191731_-	YgdI/YgdR family lipoprotein	NA	NA	NA	NA	NA
WP_021139659.1|4191929_4193225_-	sulfurtransferase	NA	NA	NA	NA	NA
WP_021139658.1|4193254_4194175_-	glutaminase B	NA	NA	NA	NA	NA
WP_005317987.1|4194304_4194637_-	YggL family protein	NA	NA	NA	NA	NA
WP_021139657.1|4194668_4195382_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_021139656.1|4195687_4196755_+	M20/M25/M40 family metallo-hydrolase	NA	NA	NA	NA	NA
WP_021139655.1|4196971_4198153_+	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_034523862.1|4198238_4199768_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_021139653.1|4200092_4200998_+	TIGR01777 family protein	NA	NA	NA	NA	NA
WP_021139652.1|4201081_4203529_-	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_005318003.1|4203583_4204282_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.4	1.5e-32
WP_021139651.1|4204280_4204880_+	arylesterase	NA	NA	NA	NA	NA
WP_021139650.1|4204969_4205914_-	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	30.2	1.5e-32
WP_099369051.1|4206240_4214775_-	retention module-containing protein	NA	NA	NA	NA	NA
WP_021140621.1|4215001_4216663_-	putative transporter	NA	NA	NA	NA	NA
WP_021140622.1|4216780_4217416_-	hemolysin III family protein	NA	NA	NA	NA	NA
WP_021140623.1|4217640_4219176_+	aminotransferase class V-fold PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_005318063.1|4219261_4219813_+	septation protein A	NA	NA	NA	NA	NA
WP_005318066.1|4219839_4220136_+	YciI family protein	NA	NA	NA	NA	NA
WP_021140624.1|4220217_4220988_-	3'(2'),5'-bisphosphate nucleotidase CysQ	NA	NA	NA	NA	NA
WP_021140625.1|4221154_4221475_+	ComEA family DNA-binding protein	NA	NA	NA	NA	NA
WP_021140626.1|4221569_4222481_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	47.0	6.8e-62
WP_017412884.1|4222694_4224092_+	peptide MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	38.8	7.6e-81
WP_034524283.1|4224167_4225139_-	response regulator	NA	NA	NA	NA	NA
WP_021140629.1|4225234_4225708_-	response regulator	NA	NA	NA	NA	NA
WP_021140630.1|4225676_4227020_-	cyclic nucleotide-binding domain-containing protein	NA	NA	NA	NA	NA
WP_021140631.1|4227016_4228432_-	SLC13/DASS family transporter	NA	NA	NA	NA	NA
WP_021140632.1|4228641_4229340_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021140633.1|4229411_4230266_+	ATP-binding protein	NA	A0A1B1P8D0	Bacillus_phage	28.4	2.4e-08
WP_021140634.1|4230401_4231037_+	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_021140635.1|4231098_4232262_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_034524285.1|4232255_4233401_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_080937939.1|4233400_4234405_-	biotin/lipoyl-binding protein	NA	NA	NA	NA	NA
WP_021140638.1|4234401_4235808_-	TolC family protein	NA	NA	NA	NA	NA
WP_046400746.1|4236011_4237577_+|transposase	IS21-like element ISAs27 family transposase	transposase	K4I413	Acidithiobacillus_phage	45.8	2.9e-121
>prophage 13
NZ_CP022426	Aeromonas salmonicida subsp. pectinolytica 34mel chromosome, complete genome	5012649	4283954	4329492	5012649	transposase	Acidithiobacillus_phage(18.18%)	39	NA	NA
WP_046400746.1|4283954_4285520_-|transposase	IS21-like element ISAs27 family transposase	transposase	K4I413	Acidithiobacillus_phage	45.8	2.9e-121
WP_021140572.1|4286634_4287738_+	HDOD domain-containing protein	NA	NA	NA	NA	NA
WP_021140571.1|4287803_4288394_+	beta-phosphoglucomutase family hydrolase	NA	NA	NA	NA	NA
WP_005313994.1|4288530_4288890_-	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_034524269.1|4289065_4290343_+	paraquat-inducible protein A	NA	NA	NA	NA	NA
WP_021140569.1|4290335_4291982_+	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_021140568.1|4291981_4292551_+	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_021140567.1|4292626_4293658_-	porin OmpA	NA	NA	NA	NA	NA
WP_021140566.1|4293891_4294626_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_034524267.1|4294685_4295693_-	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_005313975.1|4295932_4296313_+	YgiW/YdeI family stress tolerance OB fold protein	NA	NA	NA	NA	NA
WP_034524271.1|4296381_4297482_-	membrane-bound lytic murein transglycosylase MltC	NA	NA	NA	NA	NA
WP_005313967.1|4297571_4297844_-	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_021140563.1|4297852_4298914_-	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_021140562.1|4299015_4299696_-	GspB family T2SS assembly factor variant ExeB	NA	NA	NA	NA	NA
WP_021140561.1|4299695_4301339_-	AAA family ATPase	NA	Q6QIE1	Burkholderia_phage	26.5	6.6e-07
WP_021140560.1|4301629_4302871_+	multifunctional CCA addition/repair protein	NA	A0A0S1S197	Klebsiella_phage	44.2	2.5e-83
WP_021140559.1|4302936_4304202_-	inorganic phosphate transporter	NA	M4QMY4	Ostreococcus_lucimarinus_virus	37.1	1.9e-62
WP_021140558.1|4304227_4304908_-	TIGR00153 family protein	NA	NA	NA	NA	NA
WP_034524265.1|4305077_4306046_+	CYTH domain-containing protein	NA	NA	NA	NA	NA
WP_021140556.1|4306140_4306608_-	TonB domain-containing protein	NA	NA	NA	NA	NA
WP_021140555.1|4306762_4307686_-	LpxL/LpxP family Kdo(2)-lipid IV(A) lauroyl/palmitoleoyl acyltransferase	NA	A0A1W6JP29	Morganella_phage	39.0	2.4e-54
WP_021140554.1|4307982_4309410_+	bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE	NA	E3SJ88	Synechococcus_phage	39.8	3.2e-18
WP_099369056.1|4309513_4310539_+|transposase	IS110-like element ISAs24 family transposase	transposase	NA	NA	NA	NA
WP_011898310.1|4310963_4312289_-	outer membrane channel protein TolC	NA	NA	NA	NA	NA
WP_021141264.1|4312595_4313237_+	ADP-ribose diphosphatase	NA	A0A1S6L1P8	Vibrio_phage	36.0	5.7e-23
WP_021141263.1|4313345_4313792_+	DUF1249 domain-containing protein	NA	NA	NA	NA	NA
WP_099368897.1|4313938_4314955_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.1	1.4e-185
WP_034524527.1|4315017_4315836_+	3',5'-cyclic-AMP phosphodiesterase	NA	NA	NA	NA	NA
WP_021141151.1|4315848_4316436_+	esterase	NA	NA	NA	NA	NA
WP_034524528.1|4316438_4317062_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_021141153.1|4317099_4317501_+	GFA family protein	NA	NA	NA	NA	NA
WP_021141154.1|4317729_4319625_+	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	36.0	1.0e-91
WP_021141155.1|4319709_4322004_+	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	36.3	9.6e-89
WP_021141156.1|4322061_4322709_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021141311.1|4322864_4324001_-|transposase	ISAs1-like element ISAs12 family transposase	transposase	NA	NA	NA	NA
WP_001809438.1|4325546_4326578_+|transposase	IS630-like element ISAhy2 family transposase	transposase	NA	NA	NA	NA
WP_021141317.1|4326593_4327322_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046400746.1|4327926_4329492_+|transposase	IS21-like element ISAs27 family transposase	transposase	K4I413	Acidithiobacillus_phage	45.8	2.9e-121
>prophage 14
NZ_CP022426	Aeromonas salmonicida subsp. pectinolytica 34mel chromosome, complete genome	5012649	4390627	4401009	5012649	transposase	uncultured_Caudovirales_phage(33.33%)	7	NA	NA
WP_021139025.1|4390627_4392886_-	patatin-like phospholipase domain-containing protein	NA	A0A1V0SFX9	Hokovirus	27.4	2.0e-06
WP_021139026.1|4393144_4395055_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	30.3	6.0e-20
WP_021139027.1|4395218_4396865_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	33.0	2.8e-18
WP_017411943.1|4397000_4397174_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021139028.1|4397170_4398127_-	sensor domain-containing diguanylate cyclase	NA	G3MA91	Bacillus_virus	29.7	7.2e-14
WP_099369062.1|4398248_4399468_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	34.2	5.7e-16
WP_021139031.1|4399581_4401009_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.3	1.1e-42
>prophage 15
NZ_CP022426	Aeromonas salmonicida subsp. pectinolytica 34mel chromosome, complete genome	5012649	4443050	4506200	5012649	integrase,transposase,protease	uncultured_Mediterranean_phage(25.0%)	59	4473153:4473167	4513684:4513698
WP_017412546.1|4443050_4443476_-|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	46.3	9.5e-27
WP_005314352.1|4443472_4444102_-	stringent starvation protein A	NA	NA	NA	NA	NA
WP_021140225.1|4444189_4444924_-	cytochrome c1	NA	NA	NA	NA	NA
WP_005314360.1|4444920_4446138_-	cytochrome bc complex cytochrome b subunit	NA	NA	NA	NA	NA
WP_005314362.1|4446140_4446734_-	ubiquinol-cytochrome c reductase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_005314365.1|4447029_4447422_-	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_005314367.1|4447437_4447866_-	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_021140224.1|4448132_4449227_-	cell division protein ZapE	NA	NA	NA	NA	NA
WP_021140223.1|4449367_4449748_+	YhcB family protein	NA	NA	NA	NA	NA
WP_021140222.1|4449829_4451191_+	Do family serine endopeptidase	NA	A0A1B1IT49	uncultured_Mediterranean_phage	28.0	6.6e-21
WP_021140221.1|4451280_4452411_+	outer membrane-stress sensor serine endopeptidase DegS	NA	A0A1B1IT49	uncultured_Mediterranean_phage	26.6	2.7e-20
WP_021140220.1|4452727_4453087_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_021140219.1|4453104_4453470_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_021140218.1|4453469_4453766_+	DUF4312 family protein	NA	NA	NA	NA	NA
WP_021140217.1|4453806_4454583_+	DUF4311 domain-containing protein	NA	NA	NA	NA	NA
WP_021140216.1|4454594_4455245_+	DUF4310 family protein	NA	NA	NA	NA	NA
WP_021140215.1|4455287_4456427_+	amidohydrolase/deacetylase family metallohydrolase	NA	NA	NA	NA	NA
WP_021140214.1|4456410_4457526_+	DgaE family pyridoxal phosphate-dependent ammonia lyase	NA	NA	NA	NA	NA
WP_021140213.1|4457525_4458266_+	KDGP aldolase family protein	NA	NA	NA	NA	NA
WP_021140212.1|4458369_4460274_+	BglG family transcription antiterminator	NA	NA	NA	NA	NA
WP_005314403.1|4460292_4460565_-	PTS phosphocarrier protein NPr	NA	NA	NA	NA	NA
WP_021140211.1|4460585_4461452_-	RNase adapter RapZ	NA	A0A1P8D5W0	Corynebacterium_phage	33.6	1.6e-12
WP_021140210.1|4461494_4461941_-	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
WP_005305957.1|4461943_4462231_-	ribosome hibernation promoting factor	NA	NA	NA	NA	NA
WP_021140209.1|4462252_4463692_-	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_005314412.1|4463757_4464483_-	LPS export ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.9	3.5e-21
WP_005314414.1|4464486_4465014_-	lipopolysaccharide transport periplasmic protein LptA	NA	NA	NA	NA	NA
WP_021140208.1|4465000_4465561_-	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_005314419.1|4465557_4466112_-	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	60.7	1.7e-39
WP_034524103.1|4466111_4467107_-	KpsF/GutQ family sugar-phosphate isomerase	NA	A0A2P0VNK5	Tetraselmis_virus	36.1	7.2e-41
WP_011898278.1|4467314_4468115_+	phospholipid ABC transporter ATP-binding protein MlaF	NA	G3M9Y6	Bacillus_virus	31.5	4.3e-20
WP_005314426.1|4468114_4468894_+	lipid asymmetry maintenance ABC transporter permease subunit MlaE	NA	NA	NA	NA	NA
WP_005314428.1|4468901_4469393_+	outer membrane lipid asymmetry maintenance protein MlaD	NA	NA	NA	NA	NA
WP_021140206.1|4469402_4470035_+	phospholipid-binding protein MlaC	NA	NA	NA	NA	NA
WP_021140205.1|4470031_4470304_+	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_005306001.1|4470303_4470561_+	BolA family transcriptional regulator	NA	NA	NA	NA	NA
WP_021140204.1|4470576_4471833_+	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_005314438.1|4471924_4473268_-|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
4473153:4473167	attL	TTGCTGATGGAGACT	NA	NA	NA	NA
WP_021140203.1|4473380_4473905_+	ribosome-associated protein	NA	NA	NA	NA	NA
WP_021140202.1|4473995_4477079_-	penicillin-binding protein	NA	NA	NA	NA	NA
WP_088821966.1|4477183_4478271_-|transposase	IS3-like element ISAs22 family transposase	transposase	NA	NA	NA	NA
WP_005314445.1|4478498_4478816_-	DUF496 family protein	NA	NA	NA	NA	NA
WP_021140727.1|4484907_4486104_+	NnrS family protein	NA	NA	NA	NA	NA
WP_021140728.1|4486114_4486690_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_021140729.1|4486811_4487963_+	benzoate/H(+) symporter BenE family transporter	NA	NA	NA	NA	NA
WP_021140730.1|4488112_4489177_+	DUF3103 family protein	NA	NA	NA	NA	NA
WP_021140731.1|4489245_4490142_-	methylenetetrahydrofolate reductase	NA	NA	NA	NA	NA
WP_021140732.1|4490471_4491272_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_021140733.1|4491336_4492917_-	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_021140734.1|4492925_4494905_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	27.1	3.0e-22
WP_021140735.1|4495124_4495736_-	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_021140736.1|4496180_4497866_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	32.1	1.1e-17
WP_021140737.1|4498009_4500838_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	56.3	0.0e+00
WP_021140738.1|4500933_4501596_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005316531.1|4502117_4502708_+	single-stranded DNA-binding protein	NA	R9TR60	Vibrio_phage	59.5	1.0e-55
WP_139723364.1|4502873_4503227_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001809438.1|4503414_4504446_+|transposase	IS630-like element ISAhy2 family transposase	transposase	NA	NA	NA	NA
WP_145958012.1|4504521_4504929_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_011191341.1|4504925_4506200_-|transposase	IS4-like element ISApu2 family transposase	transposase	NA	NA	NA	NA
4513684:4513698	attR	TTGCTGATGGAGACT	NA	NA	NA	NA
>prophage 16
NZ_CP022426	Aeromonas salmonicida subsp. pectinolytica 34mel chromosome, complete genome	5012649	4532294	4545887	5012649	transposase	Bacillus_phage(28.57%)	9	NA	NA
WP_021141047.1|4532294_4534289_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	45.3	5.7e-29
WP_021141048.1|4534351_4534771_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021141049.1|4534937_4535939_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	31.8	1.2e-14
WP_021141050.1|4536434_4536773_+	P-II family nitrogen regulator	NA	NA	NA	NA	NA
WP_021141051.1|4536798_4538040_+	ammonium transporter	NA	H8ZJB2	Ostreococcus_tauri_virus	36.3	3.2e-54
WP_099368897.1|4538722_4539739_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.1	1.4e-185
WP_139723420.1|4539776_4540154_-	5'-nucleotidase	NA	Q6QLL3	Human_immunodeficiency_virus	85.4	1.6e-12
WP_021139928.1|4540206_4542270_-	exodeoxyribonuclease V subunit alpha	NA	A0A1P8DII4	Virus_Rctr197k	28.0	1.7e-28
WP_021139927.1|4542266_4545887_-	exodeoxyribonuclease V subunit beta	NA	A7KV33	Bacillus_phage	22.8	1.1e-11
>prophage 17
NZ_CP022426	Aeromonas salmonicida subsp. pectinolytica 34mel chromosome, complete genome	5012649	4945762	5002467	5012649	transposase	Salmonella_phage(25.0%)	54	NA	NA
WP_099368897.1|4945762_4946779_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.1	1.4e-185
WP_021141099.1|4948367_4949690_-	putative histamine N-monooxygenase	NA	NA	NA	NA	NA
WP_034524495.1|4949752_4954126_-	amino acid adenylation domain-containing protein	NA	A0A2K9L3I8	Tupanvirus	23.9	2.4e-32
WP_005319564.1|4954461_4954713_+	isochorismatase	NA	NA	NA	NA	NA
WP_034524496.1|4954894_4956025_+	histidine decarboxylase	NA	M1HEU9	Acanthocystis_turfacea_Chlorella_virus	36.0	4.2e-53
WP_099369089.1|4956040_4957072_-|transposase	IS630-like element ISAhy2 family transposase	transposase	NA	NA	NA	NA
WP_021140475.1|4957663_4958983_-	type II toxin-antitoxin system HipA family toxin	NA	NA	NA	NA	NA
WP_021140474.1|4958982_4959237_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_034524237.1|4960144_4960768_+	recombinase family protein	NA	NA	NA	NA	NA
WP_003100847.1|4963360_4963918_-	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	63.2	3.3e-59
WP_003100853.1|4963911_4964283_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003100856.1|4964279_4964780_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003100858.1|4964776_4965103_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003465043.1|4965357_4965714_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_003100872.1|4965950_4966337_-	DUF86 domain-containing protein	NA	NA	NA	NA	NA
WP_001247892.1|4966333_4966624_-	nucleotidyltransferase	NA	NA	NA	NA	NA
WP_001173919.1|4966758_4967334_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	52.7	5.6e-46
WP_021140470.1|4967460_4967889_-	type II toxin-antitoxin system mRNA interferase toxin, RelE/StbE family	NA	NA	NA	NA	NA
WP_004099027.1|4968488_4968977_+	DUF417 family protein	NA	NA	NA	NA	NA
WP_004357657.1|4969035_4969218_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026227539.1|4969453_4970029_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004357654.1|4970425_4971451_-	zinc-binding alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_025760400.1|4971450_4972044_-	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_004357650.1|4972046_4973279_-	OsmC family protein	NA	NA	NA	NA	NA
WP_018716209.1|4973423_4974383_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004099035.1|4974529_4974973_+	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_004099036.1|4974974_4975514_+	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_004099038.1|4975646_4976351_+	glutathione S-transferase	NA	NA	NA	NA	NA
WP_011191347.1|4976347_4977316_+	magnesium and cobalt transport protein CorA	NA	NA	NA	NA	NA
WP_004099040.1|4977407_4977980_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004099042.1|4978067_4978517_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004099044.1|4978623_4979025_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004357638.1|4979055_4980327_-	MFS transporter	NA	NA	NA	NA	NA
WP_004357637.1|4980314_4980827_-	DM13 domain-containing protein	NA	NA	NA	NA	NA
WP_011191345.1|4980830_4981301_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011191344.1|4981452_4981743_-	DUF1330 domain-containing protein	NA	NA	NA	NA	NA
WP_004357630.1|4981805_4982237_-	heme-binding protein	NA	NA	NA	NA	NA
WP_011191343.1|4982310_4983321_-	zinc-binding alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_011191342.1|4983930_4985199_-|transposase	IS4-like element ISApu1 family transposase	transposase	NA	NA	NA	NA
WP_004099020.1|4985516_4985888_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011191341.1|4986044_4987319_+|transposase	IS4-like element ISApu2 family transposase	transposase	NA	NA	NA	NA
WP_060415506.1|4987299_4990227_-|transposase	Tn3-like element TnAs1 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	99.4	0.0e+00
WP_001161490.1|4990230_4990791_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	100.0	1.1e-59
WP_001323888.1|4990779_4990947_+	hypothetical protein	NA	A0A1B0V7I9	Salmonella_phage	98.2	2.3e-24
WP_004574805.1|4991077_4991644_-	OsmC family protein	NA	NA	NA	NA	NA
WP_004574804.1|4991658_4992435_-	SDR family oxidoreductase	NA	A0A0M4JSW6	Mollivirus	28.2	2.0e-14
WP_004574803.1|4992494_4993079_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004574802.1|4993075_4993756_-	cupin	NA	NA	NA	NA	NA
WP_021140980.1|4994151_4996617_+	DEAD/DEAH box helicase family protein	NA	A0A2I5ARD8	Synechococcus_phage	24.6	1.5e-10
WP_021140979.1|4996737_4998240_+	type I restriction-modification system subunit M	NA	J7I0U9	Acinetobacter_phage	28.0	9.8e-34
WP_021140978.1|4998239_4999988_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_021140977.1|5000115_5001102_+	hypothetical protein	NA	NA	NA	NA	NA
WP_139723422.1|5001158_5001452_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001310555.1|5001450_5002467_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.7	9.8e-187
