The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP015244	Escherichia coli O91 str. RM7190 chromosome, complete genome	4903701	560444	626617	4903701	protease,tRNA,terminase,lysis,transposase,tail,head,capsid,portal,integrase	Enterobacteria_phage(54.39%)	77	570606:570652	618092:618138
WP_000912345.1|560444_561830_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.9e-45
WP_001143541.1|561865_562387_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000190288.1|562494_562707_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_000729154.1|562708_563575_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
WP_001367720.1|564055_564598_+	type 1 fimbrial protein subunit FimA	NA	NA	NA	NA	NA
WP_000988366.1|564817_565510_+	type 1 fimbria chaperone FimC	NA	NA	NA	NA	NA
WP_001356128.1|565540_568150_+	fimbrial biogenesis usher protein	NA	NA	NA	NA	NA
WP_000691050.1|568162_569170_+	type 1 fimbrin D-mannose specific adhesin FimH	NA	NA	NA	NA	NA
WP_001250422.1|569180_569696_+	fimbria assembly protein	NA	NA	NA	NA	NA
WP_000805435.1|569698_570331_-	fimbria biosynthesis transcriptional regulator FimZ	NA	NA	NA	NA	NA
570606:570652	attL	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
WP_001299447.1|570665_571829_-|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.3	3.4e-199
WP_000446905.1|571684_572056_-	helix-turn-helix domain-containing protein	NA	M1FJ59	Enterobacteria_phage	81.0	2.1e-46
WP_000488407.1|572027_572306_-	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	97.8	4.9e-48
WP_000763385.1|572353_572572_-	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	100.0	7.5e-36
WP_001386642.1|572670_572952_-	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	98.9	5.5e-47
WP_000129285.1|572962_573520_-	phage N-6-adenine-methyltransferase	NA	E5AGF8	Erwinia_phage	62.3	2.0e-61
WP_000682319.1|573512_573674_-	DUF1317 family protein	NA	A0A0P0ZAS9	Stx2-converting_phage	100.0	9.1e-23
WP_000186811.1|573670_574351_-	YqaJ viral recombinase family protein	NA	A0A0N6WET1	Escherichia_phage	99.6	4.6e-132
WP_000100847.1|574347_575133_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000995439.1|575138_575435_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
WP_122993299.1|575510_575801_-	hypothetical protein	NA	K7P6H3	Enterobacteria_phage	82.4	3.2e-26
WP_000340376.1|576194_577058_-	hypothetical protein	NA	M9NYX6	Enterobacteria_phage	62.1	1.8e-93
WP_000858975.1|577124_577814_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	75.0	2.8e-92
WP_001067458.1|577918_578149_+	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	68.0	1.5e-21
WP_001182891.1|578218_578758_+	hypothetical protein	NA	K7PJT7	Enterobacteria_phage	67.6	6.8e-62
WP_001376316.1|578844_579774_+	replication protein	NA	A0A0K2FJ31	Enterobacteria_phage	68.4	6.1e-111
WP_000788797.1|579770_580472_+	hypothetical protein	NA	M1FJ72	Enterobacteria_phage	98.3	3.2e-128
WP_000145915.1|580468_580771_+	protein ren	NA	A0A0N6WES4	Escherichia_phage	95.7	1.1e-42
WP_001089797.1|580838_581171_+	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_032252941.1|581262_581370_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000709083.1|581427_582954_+	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	27.8	7.9e-31
WP_000338662.1|583065_583389_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099205817.1|583563_584346_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072097297.1|584440_584542_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001053027.1|584538_584994_+	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	67.5	2.2e-61
WP_000224914.1|584993_585164_+	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	69.8	2.4e-13
WP_000774499.1|585156_585447_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	91.7	6.3e-46
WP_001099712.1|585443_585806_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
WP_000971068.1|585802_585943_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	67.4	5.5e-08
WP_001204791.1|586028_586412_+	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	83.3	4.4e-55
WP_000737283.1|586601_587699_-	porin	NA	Q1MVN1	Enterobacteria_phage	76.3	4.8e-155
WP_000839596.1|588287_588503_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_001135277.1|588502_589000_+	lysozyme	NA	M1FJA0	Enterobacteria_phage	97.0	5.4e-90
WP_001228695.1|589216_589399_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_000738421.1|589489_589783_-	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	90.7	5.9e-44
WP_001415975.1|590142_590337_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	96.9	4.3e-27
WP_000453566.1|590725_591271_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	4.0e-94
WP_001027292.1|591245_593171_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	100.0	0.0e+00
WP_000198149.1|593167_593374_+|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_001367714.1|593370_594972_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.4	1.0e-310
WP_000123339.1|594952_596272_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.4	5.3e-233
WP_001355467.1|596281_596614_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	1.4e-54
WP_000063254.1|596669_597695_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.2	2.8e-189
WP_000158875.1|597736_598132_+	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	95.5	1.1e-58
WP_000785280.1|598143_598497_+|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	97.4	6.4e-61
WP_099205819.1|598508_599087_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	96.9	1.1e-78
WP_000683128.1|599083_599479_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	99.2	6.5e-70
WP_001367716.1|599486_600227_+|tail	phage tail protein	tail	A0A2I6TC77	Escherichia_phage	98.8	5.6e-131
WP_000479142.1|600242_600665_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	1.1e-70
WP_000459458.1|600646_601081_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	99.2	1.5e-64
WP_000840260.1|601073_603635_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	89.3	0.0e+00
WP_000847362.1|603631_603961_+|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	98.2	1.4e-57
WP_001152652.1|603960_604659_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.3	1.1e-131
WP_000194779.1|604664_605408_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.0e-149
WP_000090915.1|605344_605977_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.0	7.6e-97
WP_000515165.1|606037_609436_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	90.3	0.0e+00
WP_001230375.1|609502_610102_+	Ail/Lom family protein	NA	A0A291AWV3	Escherichia_phage	98.5	5.7e-110
WP_024177291.1|610166_613193_+|tail	tail protein	tail	U5N099	Enterobacteria_phage	81.4	3.6e-67
WP_000885570.1|613192_613777_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.8	6.6e-103
WP_000239881.1|613831_614500_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000937500.1|614556_614862_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	76.5	2.8e-12
WP_001226374.1|615044_616529_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001201825.1|616715_617669_-|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_001224602.1|619124_620015_-	DUF4434 family protein	NA	NA	NA	NA	NA
618092:618138	attR	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
WP_000662373.1|620015_622988_-	bacteriophage adsorption protein NfrA	NA	NA	NA	NA	NA
WP_000383951.1|622974_625212_-	phage adsorption protein NrfB	NA	NA	NA	NA	NA
WP_000420935.1|625480_626617_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP015244	Escherichia coli O91 str. RM7190 chromosome, complete genome	4903701	1224359	1325977	4903701	protease,tRNA,plate,terminase,lysis,holin,tail,head,capsid,portal,integrase	Escherichia_phage(33.01%)	134	1222227:1222244	1324030:1324047
1222227:1222244	attL	TGCAGAAATAACGAGCAA	NA	NA	NA	NA
WP_099205840.1|1224359_1225478_-|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z04	Phage_21	43.6	1.9e-82
WP_000003742.1|1225446_1225716_-	excisionase	NA	NA	NA	NA	NA
WP_099205842.1|1225777_1228180_-	exonuclease	NA	V5UQJ3	Shigella_phage	58.6	4.9e-176
WP_000092783.1|1228272_1228461_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000450221.1|1228457_1228646_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_000559919.1|1229174_1229690_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000380318.1|1229803_1229956_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	6.6e-07
WP_032211256.1|1230233_1230521_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001367155.1|1230521_1230713_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033815696.1|1230681_1231143_-	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	55.4	1.2e-09
WP_000448216.1|1231162_1231534_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021577226.1|1231636_1231918_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000693827.1|1231921_1232347_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_052909572.1|1232415_1233447_+	phage replisome organizer	NA	A0A0U2RT81	Escherichia_phage	69.1	8.4e-85
WP_001379651.1|1233478_1233901_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	90.0	5.7e-72
WP_047082289.1|1233934_1234651_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.1	8.7e-73
WP_000017341.1|1234647_1234965_+	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	75.0	1.4e-35
WP_053294093.1|1234961_1235267_+	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	92.1	1.7e-49
WP_022581296.1|1235414_1235597_+	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	93.3	3.8e-25
WP_099205844.1|1235762_1236278_+	hypothetical protein	NA	A0A076GCN9	Escherichia_phage	78.6	1.1e-37
WP_001398985.1|1236511_1236724_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	67.1	6.4e-16
WP_001341173.1|1236890_1237163_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	50.8	1.9e-12
WP_032284906.1|1237164_1238214_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	7.7e-110
WP_000904388.1|1238226_1238601_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.6	3.8e-35
WP_000762903.1|1238597_1239419_+	hypothetical protein	NA	K7P7B9	Enterobacteria_phage	59.7	2.9e-80
WP_000917741.1|1239645_1239843_+	hypothetical protein	NA	A0A0P0ZDH6	Stx2-converting_phage	100.0	8.0e-29
WP_064579151.1|1239993_1241052_+	site-specific DNA-methyltransferase	NA	A0A0N7KZF8	Stx2-converting_phage	99.7	2.1e-208
WP_001365055.1|1241434_1242394_+	Shiga toxin Stx2d subunit A	NA	Q6DWN9	Enterobacteria_phage	100.0	1.6e-175
WP_000738072.1|1242405_1242675_+	Shiga toxin Stx2a subunit B	NA	Q6DWN4	Enterobacteria_phage	100.0	1.2e-43
WP_099205848.1|1243539_1245477_+	SASA family carbohydrate esterase	NA	S5MDQ7	Escherichia_phage	94.3	0.0e+00
WP_000143458.1|1245614_1245794_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_001290230.1|1245834_1246080_+	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	100.0	8.8e-17
WP_000284510.1|1246157_1246373_+|holin	holin	holin	G9L6J5	Escherichia_phage	100.0	9.0e-34
WP_001457151.1|1246376_1246862_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053294090.1|1247373_1247907_+	lysozyme	NA	Q6H9V6	Enterobacteria_phage	91.5	2.3e-94
WP_053294089.1|1248180_1248876_+	hypothetical protein	NA	Q5MBW0	Stx1-converting_phage	98.7	1.8e-123
WP_001280928.1|1248970_1249102_+	hypothetical protein	NA	A0A0P0ZG36	Escherichia_phage	95.3	4.5e-12
WP_071974579.1|1249324_1249531_+	hypothetical protein	NA	H6WRZ6	Salmonella_phage	63.2	4.6e-11
WP_000735655.1|1249595_1249820_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001405844.1|1250307_1250814_+	DNA-packaging protein	NA	O64316	Escherichia_phage	48.5	1.6e-33
WP_001499025.1|1250785_1252714_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.7	3.7e-259
WP_000259002.1|1252697_1252904_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_024175322.1|1252900_1254493_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.6	9.0e-187
WP_099205850.1|1254482_1255988_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	52.6	4.6e-100
WP_033811013.1|1256024_1256372_+|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.0e-22
WP_099205852.1|1256429_1257458_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.9	1.1e-113
WP_047081403.1|1257509_1257893_+	DNA-packaging protein FI	NA	NA	NA	NA	NA
WP_001204531.1|1257885_1258239_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	69.2	2.8e-40
WP_000974993.1|1258254_1258830_+|tail	tail protein	tail	A0A2R9YJK4	Escherichia_phage	57.8	2.9e-50
WP_000683075.1|1258826_1259222_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	80.9	2.2e-57
WP_052903742.1|1259229_1259979_+|tail	phage tail protein	tail	S5M7Q5	Escherichia_phage	93.2	3.1e-129
WP_001299690.1|1259994_1260426_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	67.4	2.4e-41
WP_072032653.1|1260452_1260866_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	83.8	1.6e-42
WP_099205854.1|1260846_1263426_+|tail	phage tail tape measure protein	tail	S5MBY3	Escherichia_phage	85.8	0.0e+00
WP_000847280.1|1263422_1263752_+|tail	phage tail protein	tail	S5MW28	Escherichia_phage	99.1	1.2e-58
WP_047083320.1|1263751_1264450_+|tail	phage minor tail protein L	tail	S5M7Q4	Escherichia_phage	97.8	5.2e-131
WP_099205856.1|1264460_1265204_+|tail	phage tail protein	tail	S5MQI8	Escherichia_phage	94.3	7.0e-142
WP_122994293.1|1265149_1265782_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	91.0	8.7e-101
WP_099205858.1|1266022_1269709_+	DUF1983 domain-containing protein	NA	S5MW25	Escherichia_phage	87.9	0.0e+00
WP_000078853.1|1269907_1270048_+	Hok/Gef family protein	NA	S5M7Q0	Escherichia_phage	95.7	2.9e-17
WP_099205860.1|1270192_1271851_+|tail	phage tail protein	tail	S5MDN9	Escherichia_phage	53.6	2.0e-72
WP_000438829.1|1271860_1272073_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064579209.1|1272084_1272759_+	DUF4376 domain-containing protein	NA	S5MBX6	Escherichia_phage	89.7	5.6e-114
WP_022581964.1|1272922_1273252_-	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_000799399.1|1273417_1274281_-	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000531594.1|1274264_1275401_-	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
WP_000359460.1|1275650_1276880_+	peptidase T	NA	NA	NA	NA	NA
WP_000456506.1|1277025_1278147_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_000735412.1|1278222_1279683_-	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_001265481.1|1279682_1280354_-	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000423729.1|1280521_1281892_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	4.2e-108
WP_001297479.1|1281895_1282537_-	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_001297484.1|1282572_1283679_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_000476089.1|1283732_1284194_-	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001248691.1|1284203_1284857_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000444487.1|1285028_1286279_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_021519677.1|1286404_1287055_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001095712.1|1287063_1288116_-	DUF262 domain-containing protein	NA	A0A0M4RT01	Citrobacter_phage	24.8	3.9e-05
WP_000741313.1|1288215_1289346_-|integrase	tyrosine-type recombinase/integrase	integrase	O21925	Phage_21	61.0	1.3e-123
WP_001527050.1|1289326_1289572_-	phage excisionase	NA	NA	NA	NA	NA
WP_000008253.1|1289627_1290164_-	HD family hydrolase	NA	Q8SBG0	Shigella_phage	93.8	4.8e-92
WP_000081267.1|1290291_1291116_-	DUF2303 family protein	NA	U5P439	Shigella_phage	99.6	2.3e-149
WP_000135682.1|1291181_1291544_-	hypothetical protein	NA	U5P4J6	Shigella_phage	100.0	3.3e-60
WP_001307125.1|1291823_1292165_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001005199.1|1292102_1292411_-	hypothetical protein	NA	I6PDF6	Cronobacter_phage	80.0	5.0e-09
WP_000389078.1|1292616_1293507_+	hypothetical protein	NA	U3PB51	Vibrio_phage	31.6	4.5e-34
WP_000853320.1|1293489_1294176_-	helix-turn-helix transcriptional regulator	NA	A0A0N7C1P9	Escherichia_phage	42.0	2.7e-39
WP_000187185.1|1294311_1294560_+	chaperone TorD	NA	NA	NA	NA	NA
WP_000515829.1|1294582_1295140_+	protein YmfL	NA	S5FXP0	Shigella_phage	96.2	1.1e-96
WP_001250266.1|1295315_1295495_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	4.6e-15
WP_000104949.1|1295484_1296426_+	helix-turn-helix domain-containing protein	NA	S5FM81	Shigella_phage	99.7	3.3e-144
WP_001307127.1|1296422_1296917_+	PerC family transcriptional regulator	NA	U5P0U0	Shigella_phage	97.0	5.6e-87
WP_001367868.1|1296916_1297570_+	phage N-6-adenine-methyltransferase	NA	K7PGU4	Enterobacteria_phage	98.2	4.7e-126
WP_000210174.1|1297566_1297893_+	LexA family transcriptional regulator	NA	A0A291AWY9	Escherichia_phage	99.1	3.5e-53
WP_000767113.1|1297889_1298279_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	100.0	7.1e-69
WP_001061385.1|1298298_1299108_+	KilA-N domain-containing protein	NA	Q8SBE6	Shigella_phage	98.1	6.9e-151
WP_001307130.1|1299115_1300105_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.4	1.1e-193
WP_001047125.1|1300118_1300871_+	antitermination protein	NA	Q8SBE4	Shigella_phage	98.0	2.2e-135
WP_023154804.1|1301074_1301254_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000544528.1|1301477_1301783_+|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	87.6	7.0e-40
WP_001180495.1|1301769_1302246_+	glycoside hydrolase family protein	NA	K7PKX1	Enterobacterial_phage	96.2	1.7e-85
WP_001307131.1|1302242_1302680_+|lysis	lysis protein	lysis	K7PJY1	Enterobacterial_phage	98.6	6.5e-71
WP_000520336.1|1303438_1303819_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000958719.1|1303835_1304414_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001135206.1|1304553_1304904_+	HNH endonuclease	NA	M1FQV2	Enterobacteria_phage	100.0	5.0e-66
WP_000929175.1|1305029_1305524_+|terminase	phage terminase small subunit P27 family	terminase	U5P067	Shigella_phage	99.4	3.9e-88
WP_122993597.1|1305757_1307254_+|terminase	terminase large subunit	terminase	A0A1C9IIA1	Salmonella_phage	99.8	4.3e-300
WP_001056733.1|1307265_1307448_+	hypothetical protein	NA	S5FXQ9	Shigella_phage	98.3	2.9e-25
WP_000466236.1|1307447_1308689_+|portal	phage portal protein	portal	U5P411	Shigella_phage	99.0	5.0e-241
WP_001193631.1|1308666_1309317_+|head,protease	HK97 family phage prohead protease	head,protease	U5P4H2	Shigella_phage	100.0	2.5e-119
WP_000257507.1|1309331_1310537_+|capsid	phage major capsid protein	capsid	M1FPN2	Enterobacteria_phage	100.0	1.8e-224
WP_000601357.1|1310585_1310786_+	hypothetical protein	NA	S5FNU1	Shigella_phage	95.5	1.4e-25
WP_000927720.1|1310788_1311112_+|head,tail	phage gp6-like head-tail connector protein	head,tail	U5P072	Shigella_phage	98.1	7.4e-56
WP_000702388.1|1311108_1311519_+|head	phage head closure protein	head	M1FJ87	Enterobacteria_phage	97.8	5.9e-74
WP_000213502.1|1311493_1312000_+	hypothetical protein	NA	M1FPE2	Enterobacteria_phage	100.0	1.7e-91
WP_000779292.1|1311996_1312557_+	hypothetical protein	NA	M1FQV7	Enterobacteria_phage	100.0	1.0e-105
WP_000497751.1|1312565_1312736_+	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	100.0	9.3e-26
WP_000155712.1|1312719_1314216_+|tail	tail sheath protein	tail	M1FN90	Enterobacteria_phage	99.0	7.7e-273
WP_000090998.1|1314215_1314572_+	hypothetical protein	NA	U5P076	Shigella_phage	100.0	5.3e-63
WP_000661052.1|1314571_1314847_+|tail	phage tail assembly protein	tail	M1FPE4	Enterobacteria_phage	98.8	7.5e-41
WP_000807185.1|1314981_1316817_+|tail	phage tail tape measure protein	tail	Q8SBG9	Shigella_phage	98.2	5.9e-307
WP_001307133.1|1316877_1318206_+	DNA circularization protein	NA	Q8SBG8	Shigella_phage	99.1	1.1e-246
WP_000999517.1|1318202_1319282_+	hypothetical protein	NA	Q8SBG7	Shigella_phage	99.2	2.6e-206
WP_001259079.1|1319281_1319830_+|plate	phage baseplate assembly protein	plate	Q8SBG6	Shigella_phage	100.0	2.3e-97
WP_000424732.1|1319829_1320255_+	hypothetical protein	NA	U5P0R9	Shigella_phage	100.0	2.3e-81
WP_000785334.1|1320241_1321300_+|plate	baseplate J/gp47 family protein	plate	M1FQW3	Enterobacteria_phage	97.4	2.0e-198
WP_000383561.1|1321290_1321875_+	YmfQ family protein	NA	O22003	Shigella_phage	98.5	5.9e-112
WP_099205862.1|1322249_1322516_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000416464.1|1322518_1322950_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	73.7	9.6e-43
WP_001057698.1|1322921_1323524_-|tail	tail fiber assembly protein	tail	A0A0F7LDQ5	Escherichia_phage	87.5	7.5e-94
WP_044721967.1|1323523_1324054_-|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	96.6	4.4e-98
1324030:1324047	attR	TGCAGAAATAACGAGCAA	NA	NA	NA	NA
WP_000905000.1|1324083_1324638_+	site-specific DNA recombinase	NA	A0A1S6L009	Salmonella_phage	88.9	4.4e-88
WP_000557907.1|1324744_1325578_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_000943926.1|1325812_1325977_+	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-24
>prophage 3
NZ_CP015244	Escherichia coli O91 str. RM7190 chromosome, complete genome	4903701	1427652	1495545	4903701	protease,terminase,lysis,holin,tail,head,capsid,integrase	Escherichia_phage(26.0%)	74	1427489:1427516	1481740:1481767
1427489:1427516	attL	CAGTGTGGTACATGGATATCGATACCAC	NA	NA	NA	NA
WP_099205867.1|1427652_1428783_-|integrase	tyrosine-type recombinase/integrase	integrase	O21940	Phage_21	51.7	1.8e-104
WP_000113183.1|1428760_1429009_-	excisionase	NA	NA	NA	NA	NA
WP_099205869.1|1429073_1431545_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.0	1.7e-54
WP_099205871.1|1431640_1431829_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000450222.1|1431825_1432014_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_001365839.1|1432798_1433167_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000380317.1|1433178_1433331_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	5.1e-07
WP_001003380.1|1433520_1433928_-	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	45.4	5.5e-24
WP_000476991.1|1434005_1434233_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000705131.1|1434216_1434738_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033811891.1|1434718_1435708_+	phage O protein family	NA	U5P0A0	Shigella_phage	61.2	3.9e-55
WP_047083545.1|1435714_1436455_+	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	82.3	1.2e-112
WP_099205874.1|1436484_1437246_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	61.9	2.2e-74
WP_000215512.1|1437305_1437491_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000211993.1|1437842_1438394_+	ORF6N domain-containing protein	NA	A0A0N7C203	Escherichia_phage	53.3	5.5e-43
WP_000882662.1|1438608_1438821_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	95.7	2.5e-28
WP_000042395.1|1438923_1439241_-	DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_052327139.1|1439829_1440057_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032347855.1|1440110_1440380_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	50.8	3.6e-11
WP_001265189.1|1440381_1441431_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.3	3.4e-110
WP_000904136.1|1441443_1441806_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	61.9	2.4e-34
WP_001064918.1|1441798_1442464_+	antiterminator	NA	I6PDF8	Cronobacter_phage	52.0	1.6e-60
WP_000342738.1|1442717_1443431_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000917733.1|1443604_1443802_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	6.8e-28
WP_032308170.1|1443953_1445012_+	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	99.1	4.0e-207
WP_000271629.1|1445491_1445920_+	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
WP_000382065.1|1446616_1447342_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_099205876.1|1449204_1451169_+	SASA family carbohydrate esterase	NA	A0A0P0ZBH7	Stx2-converting_phage	79.2	3.5e-297
WP_000143459.1|1451303_1451483_+	DUF1378 family protein	NA	A0A088CBQ0	Shigella_phage	100.0	2.2e-25
WP_001290208.1|1451523_1451769_+	DUF826 domain-containing protein	NA	A0A088CE63	Shigella_phage	100.0	8.5e-20
WP_000284490.1|1451846_1452062_+|holin	holin	holin	Q9ZWW2	Enterobacteria_phage	98.6	2.0e-33
WP_001041949.1|1452065_1452857_+	DUF1327 domain-containing protein	NA	Q08JA0	Stx2-converting_phage	85.5	5.7e-33
WP_001092875.1|1453368_1453902_+	lysozyme	NA	Q08J98	Stx2-converting_phage	95.5	1.1e-99
WP_072024677.1|1454058_1454241_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024210595.1|1454389_1454857_+|lysis	lysis protein	lysis	A0A0H4IT10	Shigella_phage	87.7	3.6e-67
WP_000881332.1|1454968_1455583_+	Rha family transcriptional regulator	NA	A0A0P0ZFJ1	Escherichia_phage	68.6	1.1e-63
WP_000828070.1|1455919_1456246_+	TonB family protein	NA	H6WZK5	Escherichia_phage	98.1	6.3e-55
WP_000095744.1|1456377_1456578_-	YlcI/YnfO family protein	NA	H6WZK6	Escherichia_phage	97.0	1.3e-29
WP_047083313.1|1456619_1456985_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	95.0	5.1e-61
WP_000958387.1|1457273_1457837_+|terminase	terminase small subunit	terminase	A0A0N7KZJ8	Stx2-converting_phage	100.0	8.1e-90
WP_001376400.1|1457833_1459495_+|terminase	terminase large subunit	terminase	A0A0P0ZEI4	Stx2-converting_phage	99.8	0.0e+00
WP_000172990.1|1459558_1461496_+|capsid	phage major capsid protein	capsid	Q6H9U8	Enterobacteria_phage	99.7	0.0e+00
WP_001063099.1|1461540_1461762_+	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000125990.1|1464288_1464615_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZBH1	Stx2-converting_phage	100.0	9.2e-54
WP_001029274.1|1464624_1464975_+|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	99.1	6.0e-59
WP_000573358.1|1464971_1465418_+	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	99.3	2.0e-75
WP_000133383.1|1465414_1465759_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	99.1	4.2e-57
WP_001275432.1|1465825_1466542_+|tail	tail protein	tail	A0A0P0ZDV1	Stx2-converting_phage	99.6	6.2e-127
WP_000710934.1|1466556_1466931_+|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	99.2	7.8e-65
WP_122993267.1|1467026_1467236_+	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	98.6	1.5e-33
WP_000212965.1|1467283_1470526_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	89.2	0.0e+00
WP_000343411.1|1470518_1470860_+|tail	phage tail protein	tail	A0A0P0ZDL9	Stx2-converting_phage	82.3	6.9e-52
WP_001367880.1|1470859_1471558_+|tail	phage minor tail protein L	tail	S5M7Q4	Escherichia_phage	97.0	3.4e-130
WP_032308177.1|1471568_1472312_+|tail	phage tail protein	tail	S5MQI8	Escherichia_phage	96.4	1.9e-147
WP_000246333.1|1472209_1472854_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	73.9	1.3e-88
WP_099205878.1|1473764_1477460_+	DUF1983 domain-containing protein	NA	Q6H9T2	Enterobacteria_phage	84.9	0.0e+00
WP_001270056.1|1477528_1478152_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A1U8QHD6	Enterobacteria_phage	59.9	2.0e-65
WP_000216448.1|1478301_1479570_+|tail	phage tail protein	tail	S5MDN9	Escherichia_phage	99.1	6.5e-55
WP_001049910.1|1479638_1480310_+	DUF4376 domain-containing protein	NA	S5MBX6	Escherichia_phage	82.5	8.1e-105
WP_001079509.1|1481917_1482424_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
1481740:1481767	attR	CAGTGTGGTACATGGATATCGATACCAC	NA	NA	NA	NA
WP_001056491.1|1482469_1482970_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000807651.1|1483055_1483235_-	general stress protein	NA	NA	NA	NA	NA
WP_000443056.1|1483615_1484422_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000209520.1|1484421_1485615_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_001297118.1|1485626_1486985_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.7	8.6e-37
WP_000763511.1|1486988_1488584_-	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	3.8e-52
WP_001194591.1|1488583_1490146_-	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_001700591.1|1490237_1490282_-	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001285661.1|1490419_1491301_+	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001295575.1|1491297_1491918_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001291216.1|1492018_1492891_+	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001278904.1|1492930_1493521_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_000559283.1|1493517_1494276_-	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.4	8.8e-07
WP_000422039.1|1494495_1495545_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
>prophage 4
NZ_CP015244	Escherichia coli O91 str. RM7190 chromosome, complete genome	4903701	2048628	2146437	4903701	protease,tRNA,terminase,transposase,holin,tail,portal,integrase	Escherichia_phage(35.38%)	104	2068501:2068516	2142128:2142143
WP_000984517.1|2048628_2049510_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_001055776.1|2049701_2051750_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.4	4.4e-85
WP_000431367.1|2051769_2052468_-	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_001043882.1|2052564_2053062_-	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_001207283.1|2053191_2054475_+	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
WP_001297532.1|2054443_2057077_+	lipid-binding membrane homeostasis protein YebT	NA	NA	NA	NA	NA
WP_000057022.1|2057156_2058596_+	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
WP_001295499.1|2058713_2058950_+	DUF1480 family protein	NA	NA	NA	NA	NA
WP_001296140.1|2059054_2059246_+	YebW family protein	NA	NA	NA	NA	NA
WP_000812724.1|2059246_2059903_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	50.2	3.1e-56
WP_000976492.1|2060298_2060640_-	YebY family protein	NA	NA	NA	NA	NA
WP_000879280.1|2060652_2061525_-	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000204699.1|2061528_2061903_-	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000916763.1|2062041_2062272_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	1.3e-14
WP_000011658.1|2062373_2063030_+	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_000944256.1|2063053_2063716_+	exodeoxyribonuclease X	NA	Q6UAU3	Klebsiella_phage	41.6	2.0e-07
WP_000936923.1|2063712_2065773_-	oligopeptidase B	NA	NA	NA	NA	NA
WP_000024745.1|2065981_2066641_-	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_001295500.1|2066967_2067324_-	protein YebF	NA	NA	NA	NA	NA
WP_000257738.1|2067390_2067681_-	DNA damage-inducible protein YebG	NA	NA	NA	NA	NA
WP_000173474.1|2067814_2068993_+	formate-dependent phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
2068501:2068516	attL	CTACCGTGAATCCTGG	NA	NA	NA	NA
WP_000800512.1|2069048_2069690_-	bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase	NA	NA	NA	NA	NA
WP_001069469.1|2069726_2071538_-	phosphogluconate dehydratase	NA	NA	NA	NA	NA
WP_000301730.1|2071772_2073248_-	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	37.5	5.8e-79
WP_001056706.1|2073585_2074455_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000091148.1|2074582_2076025_+	pyruvate kinase	NA	NA	NA	NA	NA
WP_000448381.1|2076155_2077127_-	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
WP_001184045.1|2077246_2078569_-	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	40.9	1.2e-14
WP_001342995.1|2078584_2079517_-	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_000202996.1|2079595_2080351_+	zinc ABC transporter ATP-binding protein ZnuC	NA	G3M9Y6	Bacillus_virus	28.3	1.3e-18
WP_000571479.1|2080347_2081133_+	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_000568519.1|2081279_2082290_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.5	5.6e-09
WP_000580328.1|2082298_2082910_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_001386853.1|2083048_2083114_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001024917.1|2083184_2083787_+	YebB family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_001295503.1|2083788_2084310_-	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.0e-10
WP_000907234.1|2084344_2085085_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_001300367.1|2085113_2085566_-	dihydroneopterin triphosphate diphosphatase	NA	NA	NA	NA	NA
WP_001258662.1|2085683_2087456_-|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000891620.1|2087765_2088332_+	hydrolase	NA	NA	NA	NA	NA
WP_001261926.1|2088649_2088898_+	DinI-like family protein	NA	S5MQI1	Escherichia_phage	86.6	1.4e-33
WP_000216450.1|2089272_2091231_-|tail	tail protein	tail	S5MDN9	Escherichia_phage	97.8	4.1e-173
WP_001270059.1|2091382_2092006_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A1U8QHD6	Enterobacteria_phage	59.9	9.0e-66
WP_099205896.1|2092074_2095770_-	DUF1983 domain-containing protein	NA	S5MW25	Escherichia_phage	81.5	0.0e+00
WP_128972693.1|2096685_2097318_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	89.5	3.7e-99
WP_001367886.1|2097263_2098007_-|tail	phage tail protein	tail	S5MQI8	Escherichia_phage	98.0	9.2e-150
WP_001370900.1|2098017_2098716_-|tail	phage minor tail protein L	tail	S5M7Q4	Escherichia_phage	97.8	3.1e-131
WP_000847280.1|2098715_2099045_-|tail	phage tail protein	tail	S5MW28	Escherichia_phage	99.1	1.2e-58
WP_064577958.1|2099041_2101648_-|tail	phage tail tape measure protein	tail	S5MBY3	Escherichia_phage	87.1	0.0e+00
WP_047090811.1|2101637_2102042_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	77.5	4.5e-42
WP_000479069.1|2102068_2102500_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	65.7	6.9e-41
WP_000235128.1|2102519_2103269_-|tail	phage tail protein	tail	S5M7Q5	Escherichia_phage	94.4	3.6e-130
WP_000682716.1|2103276_2103675_-|tail	tail protein	tail	Q9EYD7	Enterobacteria_phage	100.0	5.9e-71
WP_047082262.1|2103687_2104311_-|tail	tail protein	tail	Q8VNN3	Enterobacteria_phage	99.0	7.5e-105
WP_001281346.1|2104313_2104595_-	DNA breaking-rejoining protein	NA	S5MDP9	Escherichia_phage	97.8	7.9e-46
WP_001097065.1|2104587_2104914_-	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	100.0	6.1e-50
WP_157774855.1|2105001_2106981_-|protease	Clp protease ClpP	protease	S5M7Q8	Escherichia_phage	99.1	0.0e+00
WP_000974549.1|2106970_2108473_-|portal	phage portal protein	portal	Q8VNN6	Enterobacteria_phage	99.6	1.7e-288
WP_000102416.1|2108472_2108685_-	hypothetical protein	NA	S5MBY8	Escherichia_phage	97.1	8.6e-29
WP_047090813.1|2108681_2110805_-|terminase	phage terminase large subunit family protein	terminase	Q9EYD1	Enterobacteria_phage	99.9	0.0e+00
WP_000348565.1|2110801_2111278_-	DUF1441 family protein	NA	Q9EYD0	Enterobacteria_phage	100.0	2.1e-83
WP_012816791.1|2111793_2111979_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000675931.1|2112200_2112314_-	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	100.0	6.6e-12
WP_001092905.1|2112535_2113069_-	lysozyme	NA	G9L6J6	Escherichia_phage	96.0	6.2e-100
WP_001367839.1|2113105_2113663_-	hypothetical protein	NA	Q08JA0	Stx2-converting_phage	83.5	2.1e-50
WP_000284510.1|2113666_2113882_-|holin	holin	holin	G9L6J5	Escherichia_phage	100.0	9.0e-34
WP_099205898.1|2114377_2116351_-	DUF1737 domain-containing protein	NA	S5MDQ7	Escherichia_phage	78.5	1.5e-300
WP_001398907.1|2116594_2116918_+	anti-adapter protein IraM	NA	Q20GJ2	Phage_258-320	100.0	2.0e-61
WP_000738080.1|2117215_2117485_-	Shiga toxin Stx2c subunit B	NA	Q5TJL5	Enterobacteria_phage	100.0	2.1e-43
WP_001376437.1|2117496_2118456_-	Shiga toxin Stx2d subunit A	NA	Q6DWN9	Enterobacteria_phage	99.7	3.6e-175
WP_000024334.1|2118838_2119897_-	site-specific DNA-methyltransferase	NA	A0A0N7KZF8	Stx2-converting_phage	98.6	2.0e-206
WP_000917741.1|2120047_2120245_-	hypothetical protein	NA	A0A0P0ZDH6	Stx2-converting_phage	100.0	8.0e-29
WP_001204809.1|2120460_2120841_-	antitermination protein Q	NA	S5M7R9	Escherichia_phage	99.2	1.4e-66
WP_001202275.1|2120858_2121848_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	98.8	4.7e-194
WP_001065348.1|2121899_2122157_-	hypothetical protein	NA	Q8W639	Enterobacteria_phage	69.7	6.2e-21
WP_000203854.1|2122153_2123554_-	replicative DNA helicase	NA	Q8W640	Enterobacteria_phage	92.4	2.9e-245
WP_000988196.1|2123550_2124429_-	ATP-binding protein	NA	Q8W641	Enterobacteria_phage	96.0	2.0e-140
WP_000095569.1|2124439_2125366_-	helix-turn-helix domain-containing protein	NA	Q8W642	Enterobacteria_phage	93.2	4.3e-157
WP_000618002.1|2125362_2125587_-	hypothetical protein	NA	A0A1C9II64	Salmonella_phage	52.1	9.8e-15
WP_000636504.1|2125583_2126435_-	peptidase	NA	K7PLX4	Enterobacteria_phage	83.6	1.3e-123
WP_000794367.1|2126431_2127256_-	transporter	NA	Q8W644	Enterobacteria_phage	99.6	1.0e-157
WP_001090263.1|2127308_2128016_-	DNA-binding protein	NA	Q8W645	Enterobacteria_phage	83.8	5.7e-109
WP_000944728.1|2128097_2128331_-	Cro/Cl family transcriptional regulator	NA	A0A1B5FPK9	Escherichia_phage	77.0	1.2e-28
WP_000800141.1|2128487_2129177_+	helix-turn-helix transcriptional regulator	NA	A0A1B5FPF4	Escherichia_phage	88.6	4.0e-115
WP_000387833.1|2129324_2130017_+	helix-turn-helix domain-containing protein	NA	A0A1B5FPB8	Escherichia_phage	63.6	1.0e-38
WP_000147367.1|2130022_2130223_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000553977.1|2130420_2130603_+	hypothetical protein	NA	Q8W652	Enterobacteria_phage	52.7	2.9e-09
WP_001367862.1|2130608_2131181_+	hypothetical protein	NA	Q8W653	Enterobacteria_phage	68.1	3.3e-75
WP_000720013.1|2131550_2132378_+	hypothetical protein	NA	Q8W654	Enterobacteria_phage	99.6	1.6e-131
WP_001367902.1|2132418_2132790_+	DUF5406 family protein	NA	Q8W655	Enterobacteria_phage	95.9	4.2e-63
WP_000459914.1|2132821_2133064_+	DUF4222 domain-containing protein	NA	Q8W656	Enterobacteria_phage	93.8	2.4e-35
WP_001030141.1|2133067_2133202_+	hypothetical protein	NA	A0A1B5FPC2	Escherichia_phage	90.9	6.0e-20
WP_001193437.1|2133220_2133475_+	DUF1233 family excisionase	NA	Q859D3	Escherichia_coli_phage	100.0	3.0e-44
WP_000063652.1|2133508_2134795_+|integrase	site-specific integrase	integrase	Q20GI2	Phage_258-320	97.0	8.2e-247
WP_096096185.1|2134811_2135576_+	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	99.2	6.0e-72
WP_000252980.1|2135628_2136024_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000019588.1|2136064_2136808_+	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	4.6e-24
WP_000564742.1|2136804_2137776_+|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_000399589.1|2137969_2138950_-|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
WP_000176841.1|2139219_2141649_-	trimethylamine N-oxide reductase TorZ	NA	NA	NA	NA	NA
WP_001214304.1|2141673_2142774_-	cytochrome c	NA	NA	NA	NA	NA
2142128:2142143	attR	CCAGGATTCACGGTAG	NA	NA	NA	NA
WP_001185741.1|2143161_2143908_-	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_001300190.1|2143921_2144488_-	VOC family protein	NA	NA	NA	NA	NA
WP_001025326.1|2144703_2146437_+|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.7	8.8e-87
>prophage 5
NZ_CP015244	Escherichia coli O91 str. RM7190 chromosome, complete genome	4903701	2379782	2389224	4903701		Enterobacteria_phage(85.71%)	10	NA	NA
WP_001292774.1|2379782_2380919_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.7	1.1e-162
WP_001326004.1|2380915_2382916_+	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	95.8	0.0e+00
WP_001295429.1|2383040_2383502_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001295430.1|2383542_2384013_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_000598641.1|2384059_2384779_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295431.1|2384775_2386461_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_001240401.1|2386682_2387414_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001216961.1|2387473_2387581_+	protein YohO	NA	NA	NA	NA	NA
WP_000783120.1|2387561_2388293_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_000569325.1|2388297_2389224_-	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	2.8e-23
>prophage 6
NZ_CP015244	Escherichia coli O91 str. RM7190 chromosome, complete genome	4903701	2925338	3024674	4903701	protease,tRNA,plate,terminase,lysis,holin,tail,head,capsid,portal,integrase	Enterobacteria_phage(54.0%)	97	2990414:2990460	3021886:3021932
WP_000187025.1|2925338_2926439_+|tRNA	tRNA (uridine(54)-C5)-methyltransferase TrmA	tRNA	NA	NA	NA	NA
WP_000806411.1|2926478_2926838_-	YijD family membrane protein	NA	NA	NA	NA	NA
WP_001309117.1|2926837_2927488_-	HTH-type transcriptional repressor FabR	NA	NA	NA	NA	NA
WP_001120810.1|2927818_2929219_+	Si-specific NAD(P)(+) transhydrogenase	NA	NA	NA	NA	NA
WP_001025939.1|2929201_2930119_-	DNA-binding transcriptional regulator OxyR	NA	NA	NA	NA	NA
WP_000382183.1|2930370_2931654_-	MFS transporter	NA	NA	NA	NA	NA
WP_000690934.1|2931720_2932935_-	D-galactonate dehydratase family protein	NA	Q6A202	Oenococcus_phage	28.6	5.9e-45
WP_001230081.1|2933433_2934807_-	argininosuccinate lyase	NA	NA	NA	NA	NA
WP_001302318.1|2934867_2935644_-	acetylglutamate kinase	NA	NA	NA	NA	NA
WP_000935370.1|2935651_2936656_-	N-acetyl-gamma-glutamyl-phosphate reductase	NA	NA	NA	NA	NA
WP_001295506.1|2936809_2937961_+	acetylornithine deacetylase	NA	NA	NA	NA	NA
WP_001005579.1|2938312_2940964_+	phosphoenolpyruvate carboxylase	NA	NA	NA	NA	NA
WP_099205925.1|2941146_2942880_+	phosphoethanolamine transferase CptA	NA	NA	NA	NA	NA
WP_000274608.1|2943094_2943946_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000323849.1|2943932_2944274_-	PTS fructose-like transporter subunit IIB	NA	NA	NA	NA	NA
WP_000204101.1|2944275_2945154_-	[formate-C-acetyltransferase]-activating enzyme	NA	NA	NA	NA	NA
WP_000184883.1|2945119_2947417_-	formate C-acetyltransferase	NA	A0A1S6UAD4	Serratia_phage	48.1	4.6e-06
WP_000161265.1|2947467_2947788_-	PTS fructose-like transporter subunit IIB	NA	NA	NA	NA	NA
WP_001004446.1|2947802_2948882_-	PTS fructose transporter subunit EIIC	NA	NA	NA	NA	NA
WP_001174095.1|2949190_2951692_+	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	26.9	1.0e-11
WP_000424838.1|2951703_2952366_+	fructose-6-phosphate aldolase	NA	A0A0E3F0E2	Synechococcus_phage	34.6	5.5e-29
WP_000374004.1|2952376_2953480_+	bifunctional L-1,2-propanediol dehydrogenase/glycerol dehydrogenase	NA	NA	NA	NA	NA
WP_000647882.1|2953754_2954372_+	DUF1287 domain-containing protein	NA	NA	NA	NA	NA
WP_001297632.1|2954398_2955304_-	cystine transporter YijE	NA	NA	NA	NA	NA
WP_001297636.1|2955397_2957578_-	catalase/peroxidase HPI	NA	NA	NA	NA	NA
WP_000007523.1|2957906_2958797_-	methylenetetrahydrofolate reductase	NA	NA	NA	NA	NA
WP_000110772.1|2959145_2961578_-	bifunctional aspartate kinase/homoserine dehydrogenase II	NA	NA	NA	NA	NA
WP_001352864.1|2961580_2962741_-	cystathionine gamma-synthase	NA	NA	NA	NA	NA
WP_000852812.1|2963017_2963335_+	met regulon transcriptional regulator MetJ	NA	NA	NA	NA	NA
WP_000702307.1|2963394_2964003_+	YiiX family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_099205927.1|2965234_2969419_-	RHS repeat protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	32.5	4.7e-25
WP_000710769.1|2969578_2969791_-	50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_001298972.1|2969993_2972192_+	primosomal protein N'	NA	NA	NA	NA	NA
WP_000644904.1|2972347_2973373_+	DNA-binding transcriptional regulator CytR	NA	NA	NA	NA	NA
WP_000068834.1|2973464_2974424_+	cell division protein FtsN	NA	NA	NA	NA	NA
WP_000208242.1|2974516_2975047_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_001293343.1|2975056_2976388_+	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	29.9	1.7e-45
WP_001307494.1|2976454_2977381_+	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_000872908.1|2977473_2977959_+	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_001296623.1|2978043_2978289_-	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
WP_000084268.1|2978714_2979560_+	glycerol uptake facilitator protein GlpF	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.0	4.4e-15
WP_000136788.1|2979582_2981091_+	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_001250644.1|2981225_2982236_+	class II fructose-bisphosphatase	NA	NA	NA	NA	NA
WP_000796320.1|2982332_2983079_+	ferredoxin--NADP(+) reductase	NA	NA	NA	NA	NA
WP_000323556.1|2983083_2983512_-	universal stress protein UspD	NA	NA	NA	NA	NA
WP_000655986.1|2983538_2983838_-	DUF406 domain-containing protein	NA	NA	NA	NA	NA
WP_000155254.1|2984049_2984490_-	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_000802233.1|2984590_2985190_+	YiiQ family protein	NA	NA	NA	NA	NA
WP_001216325.1|2985297_2986065_+	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_000708998.1|2986119_2986875_-	CDP-diacylglycerol diphosphatase	NA	NA	NA	NA	NA
WP_001045689.1|2986981_2987971_-	sulfate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000591795.1|2988289_2989252_-	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_001076742.1|2989432_2990335_-	CDF family cation-efflux transporter FieF	NA	NA	NA	NA	NA
2990414:2990460	attL	GATAAAAAAAACCCCCACATCATGTGGGGGAAGACAGGGATGGTGTC	NA	NA	NA	NA
WP_000468308.1|2990570_2990789_-	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_000882969.1|2990869_2992033_-	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	100.0	2.8e-206
WP_000978923.1|2992032_2992512_-|tail	phage tail protein	tail	U5N3F6	Enterobacteria_phage	100.0	3.9e-85
WP_000069913.1|2992526_2994974_-|tail	phage tail tape measure protein	tail	U5N0T4	Enterobacteria_phage	100.0	0.0e+00
WP_000785970.1|2994966_2995086_-|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_001031311.1|2995118_2995394_-|tail	phage tail assembly protein	tail	U5N0A4	Enterobacteria_phage	100.0	4.4e-41
WP_001251408.1|2995450_2995969_-|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_001286731.1|2995981_2997172_-|tail	phage tail sheath protein	tail	U5N3V0	Enterobacteria_phage	100.0	2.8e-225
WP_000382496.1|2997473_2998580_+	hypothetical protein	NA	U5N3F3	Enterobacteria_phage	100.0	2.1e-211
WP_001164103.1|2998679_2999207_-|tail	tail fiber assembly protein	tail	U5N0T1	Enterobacteria_phage	100.0	6.0e-95
WP_000104689.1|2999210_3001289_-|tail	phage tail protein	tail	U5N099	Enterobacteria_phage	100.0	0.0e+00
WP_001285325.1|3001299_3001830_-|tail	phage tail protein I	tail	U5N0U8	Enterobacteria_phage	100.0	2.3e-102
WP_001121497.1|3001822_3002731_-|plate	baseplate assembly protein	plate	U5N3T9	Enterobacteria_phage	100.0	1.5e-162
WP_000127164.1|3002735_3003083_-|plate	baseplate assembly protein	plate	A0A0F7LDQ1	Escherichia_phage	100.0	1.3e-58
WP_001093710.1|3003079_3003715_-|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	100.0	4.1e-114
WP_001001786.1|3003781_3004234_-	phage virion morphogenesis protein	NA	A0A0F7LDR6	Escherichia_phage	100.0	8.2e-77
WP_000917166.1|3004226_3004694_-|tail	phage tail protein	tail	U5N0S7	Enterobacteria_phage	100.0	1.0e-82
WP_072146842.1|3004656_3004830_-|lysis	phage lysis protein	lysis	Q7Y4E1	Escherichia_virus	93.0	2.6e-23
WP_000040681.1|3004801_3005227_-|lysis	LysB family phage lysis regulatory protein	lysis	U5N3W5	Enterobacteria_phage	100.0	1.0e-68
WP_000736580.1|3005214_3005640_-	hypothetical protein	NA	U5N096	Enterobacteria_phage	100.0	1.6e-61
WP_099205929.1|3005654_3006152_-	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	99.4	2.0e-92
WP_000123124.1|3006151_3006433_-|holin	holin	holin	A0A0F7LDF8	Escherichia_phage	100.0	3.7e-43
WP_000846399.1|3006436_3006640_-|tail	tail protein X	tail	U5N3E7	Enterobacteria_phage	100.0	4.0e-31
WP_000988633.1|3006639_3007149_-|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	100.0	1.1e-90
WP_000203437.1|3007248_3007992_-|terminase	terminase endonuclease subunit	terminase	U5N091	Enterobacteria_phage	100.0	8.3e-127
WP_001248540.1|3007995_3009069_-|capsid	phage major capsid protein, P2 family	capsid	U5N3E4	Enterobacteria_phage	100.0	5.1e-202
WP_001085979.1|3009127_3009982_-|capsid	GPO family capsid scaffolding protein	capsid	Q94MI4	Enterobacteria_phage	97.5	2.5e-135
WP_000156872.1|3010155_3011928_+|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCK3	Escherichia_phage	100.0	0.0e+00
WP_000038198.1|3011927_3012962_+|portal	phage portal protein	portal	U5N087	Enterobacteria_phage	100.0	4.9e-202
WP_001284793.1|3013740_3014517_+	cytolethal distending toxin type V subunit CdtA	NA	G1BEM3	Escherichia_phage	100.0	7.9e-136
WP_000759934.1|3014513_3015323_+	cytolethal distending toxin type III/V nuclease subunit CdtB	NA	G1BEM4	Escherichia_phage	100.0	4.0e-151
WP_000825552.1|3015337_3015883_+	cytolethal distending toxin type V subunit CdtC	NA	G1BEM5	Escherichia_phage	100.0	4.9e-100
WP_099205931.1|3015958_3018256_-	replication endonuclease	NA	U5N0W3	Enterobacteria_phage	99.9	0.0e+00
WP_000027664.1|3018245_3018521_-	DUF5405 family protein	NA	U5N3W1	Enterobacteria_phage	100.0	3.8e-45
WP_001113264.1|3018517_3018742_-	TraR/DksA family transcriptional regulator	NA	S4TRY6	Salmonella_phage	100.0	2.9e-35
WP_001277965.1|3018741_3019044_-	DUF5405 family protein	NA	U5N0U2	Enterobacteria_phage	100.0	3.5e-47
WP_000557703.1|3019043_3019268_-	DUF2732 family protein	NA	S4TP68	Salmonella_phage	100.0	4.7e-33
WP_000217674.1|3019331_3019832_-	hypothetical protein	NA	U5N0V9	Enterobacteria_phage	100.0	2.0e-92
WP_000453534.1|3020001_3020274_-	hypothetical protein	NA	Q1JS44	Enterobacteria_phage	100.0	1.5e-46
WP_001192857.1|3020426_3020720_+	helix-turn-helix domain-containing protein	NA	Q1JS45	Enterobacteria_phage	100.0	1.0e-48
WP_000023384.1|3020789_3021770_+|integrase	tyrosine-type recombinase/integrase	integrase	U5N0A8	Enterobacteria_phage	100.0	4.7e-186
WP_001223800.1|3021955_3022456_-	cell-envelope stress modulator CpxP	NA	NA	NA	NA	NA
3021886:3021932	attR	GATAAAAAAAACCCCCACATCATGTGGGGGAAGACAGGGATGGTGTC	NA	NA	NA	NA
WP_001033722.1|3022605_3023304_+	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
WP_000580417.1|3023300_3024674_+	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.9	3.8e-16
>prophage 7
NZ_CP015244	Escherichia coli O91 str. RM7190 chromosome, complete genome	4903701	4387965	4395105	4903701		Escherichia_phage(83.33%)	6	NA	NA
WP_001278994.1|4387965_4388604_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_000590392.1|4388600_4389863_-	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	1.3e-135
WP_000847985.1|4389859_4390768_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_001297141.1|4390963_4391731_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	3.3e-70
WP_001141330.1|4391781_4392438_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.7	4.3e-50
WP_001272898.1|4392543_4395105_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.3e-30
>prophage 8
NZ_CP015244	Escherichia coli O91 str. RM7190 chromosome, complete genome	4903701	4688087	4745960	4903701	transposase,protease	Pectobacterium_phage(11.11%)	59	NA	NA
WP_000312488.1|4688087_4689347_+|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
WP_001232412.1|4689349_4690354_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_001089295.1|4690435_4690633_+	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_000527955.1|4690736_4692035_+	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.9	2.2e-66
WP_001177644.1|4692239_4692665_+	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_000076316.1|4692703_4695145_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.1	6.4e-67
WP_001293282.1|4695324_4696056_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_000220137.1|4696182_4696584_+	DUF2170 family protein	NA	NA	NA	NA	NA
WP_000511955.1|4696602_4697301_+	PspA/IM30 family protein	NA	NA	NA	NA	NA
WP_000012553.1|4697351_4698011_+	YjfK family protein	NA	NA	NA	NA	NA
WP_000547760.1|4698028_4698427_+	DUF350 domain-containing protein	NA	NA	NA	NA	NA
WP_000101644.1|4698436_4699075_+	DUF1190 domain-containing protein	NA	NA	NA	NA	NA
WP_000943976.1|4699077_4700241_+	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.5	1.3e-81
WP_001339483.1|4700324_4701950_+	isovaleryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000811566.1|4702066_4702342_-|protease	protease activator YjfN	protease	NA	NA	NA	NA
WP_000254636.1|4702490_4702820_-	biofilm peroxide resistance protein BsmA	NA	NA	NA	NA	NA
WP_000569708.1|4703001_4703751_+	esterase	NA	NA	NA	NA	NA
WP_000133631.1|4703747_4704503_-	HTH-type transcriptional regulator UlaR	NA	NA	NA	NA	NA
WP_001295191.1|4704610_4705675_-	L-ascorbate 6-phosphate lactonase	NA	NA	NA	NA	NA
WP_001300695.1|4706029_4707427_+	PTS ascorbate transporter subunit IIC	NA	NA	NA	NA	NA
WP_000218360.1|4707442_4707748_+	PTS ascorbate transporter subunit IIB	NA	NA	NA	NA	NA
WP_000776505.1|4707757_4708222_+	PTS ascorbate transporter subunit IIA	NA	NA	NA	NA	NA
WP_000056760.1|4708235_4708886_+	3-keto-L-gulonate-6-phosphate decarboxylase UlaD	NA	NA	NA	NA	NA
WP_000949539.1|4708895_4709750_+	L-ribulose-5-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_001170812.1|4709749_4710436_+	L-ribulose-5-phosphate 4-epimerase	NA	NA	NA	NA	NA
WP_000996728.1|4710532_4711084_+	DUF1440 domain-containing protein	NA	NA	NA	NA	NA
WP_000492914.1|4711158_4711434_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001216676.1|4711760_4712156_+	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_001296681.1|4712162_4712477_+	primosomal replication protein N	NA	NA	NA	NA	NA
WP_000135199.1|4712481_4712709_+	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_001196062.1|4712750_4713200_+	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_001351393.1|4713270_4714065_-	DUF2686 family protein	NA	NA	NA	NA	NA
WP_000604912.1|4714687_4715119_-|transposase	IS200/IS605-like element IS609 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	60.6	1.9e-43
WP_001367946.1|4715126_4716335_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.0	9.2e-208
WP_001119478.1|4716469_4717108_-	cell division protein YtfB	NA	NA	NA	NA	NA
WP_000211225.1|4717326_4717947_+	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_000228346.1|4718255_4719668_+	D-serine/D-alanine/glycine transporter	NA	NA	NA	NA	NA
WP_000331456.1|4719712_4720375_-	iron-sulfur cluster repair protein YtfE	NA	NA	NA	NA	NA
WP_001351395.1|4720482_4721448_-	DMT family transporter	NA	NA	NA	NA	NA
WP_000560552.1|4721556_4722417_-	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_000084622.1|4722505_4722886_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000589460.1|4723014_4724958_-	2',3'-cyclic-nucleotide 2'-phosphodiesterase	NA	NA	NA	NA	NA
WP_000886909.1|4725147_4725888_+	3'(2'),5'-bisphosphate nucleotidase CysQ	NA	NA	NA	NA	NA
WP_000175289.1|4725877_4726435_-	YtfJ family protein	NA	NA	NA	NA	NA
WP_000689228.1|4726759_4726966_+	DUF1107 domain-containing protein	NA	NA	NA	NA	NA
WP_000935042.1|4727027_4728371_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001295196.1|4728693_4729332_-	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_001269327.1|4729537_4731271_+	autotransporter assembly complex protein TamA	NA	NA	NA	NA	NA
WP_000060936.1|4731267_4735047_+	autotransporter assembly complex protein TamB	NA	NA	NA	NA	NA
WP_001219160.1|4735049_4735391_+	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_000055072.1|4735770_4736301_-	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.9	9.4e-56
WP_000265912.1|4736610_4737567_+	galactofuranose ABC transporter substrate-binding protein YtfQ	NA	NA	NA	NA	NA
WP_000205794.1|4737706_4739209_+	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.3	1.1e-11
WP_001367906.1|4739222_4740245_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000596016.1|4740231_4741227_+	sugar ABC transporter permease YjfF	NA	NA	NA	NA	NA
WP_000853753.1|4741259_4742258_-	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.7	5.7e-70
WP_001219791.1|4742433_4743807_+	UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl- meso-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_000166270.1|4743962_4744514_-	ribosome-associated protein	NA	NA	NA	NA	NA
WP_001162171.1|4744607_4745960_+|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
>prophage 9
NZ_CP015244	Escherichia coli O91 str. RM7190 chromosome, complete genome	4903701	4777954	4788871	4903701	integrase	Enterobacteria_phage(88.89%)	14	4773030:4773045	4801090:4801105
4773030:4773045	attL	GTGCTGTTCATCGAAA	NA	NA	NA	NA
WP_000776997.1|4777954_4779220_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	41.5	2.2e-74
WP_000418440.1|4779278_4780172_-	DUF4868 domain-containing protein	NA	NA	NA	NA	NA
WP_000932801.1|4780180_4780696_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001205027.1|4780893_4781205_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001825860.1|4781514_4782087_-	hypothetical protein	NA	Q7M2A1	Enterobacteria_phage	96.2	1.9e-94
WP_021038238.1|4782160_4782661_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_001283029.1|4782657_4783392_-	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	98.8	1.0e-129
WP_001149160.1|4783944_4784211_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	100.0	4.9e-45
WP_080213683.1|4784207_4784798_+	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	97.0	4.5e-67
WP_099205968.1|4784790_4785078_+	Derepression protein	NA	Q7M2A0	Enterobacteria_phage	95.8	1.6e-46
WP_096246359.1|4785070_4785526_+	hypothetical protein	NA	Q7M298	Enterobacteria_phage	98.2	4.7e-64
WP_000856729.1|4785661_4785982_+	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_099205970.1|4785996_4788330_+	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	98.7	0.0e+00
WP_044815386.1|4788676_4788871_+	hypothetical protein	NA	Q38404	Enterobacteria_phage	100.0	1.5e-24
4801090:4801105	attR	GTGCTGTTCATCGAAA	NA	NA	NA	NA
