The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP017638	Dickeya dianthicola RNS04.9 chromosome, complete genome	4720132	332127	428622	4720132	protease,tRNA,lysis,capsid,integrase,tail,plate,holin,head,terminase,portal,transposase	Salmonella_phage(46.94%)	102	354981:354997	424784:424800
WP_024104498.1|332127_332526_-|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_024104499.1|332529_332835_-	DUF883 domain-containing protein	NA	NA	NA	NA	NA
WP_024104500.1|333034_333382_-	EnvZ/OmpR regulon moderator MzrA	NA	NA	NA	NA	NA
WP_024104501.1|333381_334059_-	DedA family protein	NA	NA	NA	NA	NA
WP_024104502.1|334737_335517_-	transcriptional regulator ExuR	NA	NA	NA	NA	NA
WP_024104503.1|335753_337055_-	MFS transporter	NA	NA	NA	NA	NA
WP_024104504.1|337611_339030_+	glucuronate isomerase	NA	NA	NA	NA	NA
WP_024104505.1|339342_340794_+	tagaturonate reductase	NA	NA	NA	NA	NA
WP_024104506.1|340812_342303_+	altronate dehydratase	NA	NA	NA	NA	NA
WP_024104507.1|342416_342965_+	YgjV family protein	NA	NA	NA	NA	NA
WP_024104508.1|343019_343973_-	TerC family protein	NA	I7HPH5	Enterobacteria_phage	34.2	5.3e-33
WP_024108205.1|344302_344494_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024104509.1|344492_345707_+	23S rRNA (guanine(1835)-N(2))-methyltransferase RlmG	NA	NA	NA	NA	NA
WP_024104510.1|345800_346097_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024104511.1|346406_347354_+	pectate lyase	NA	NA	NA	NA	NA
WP_024104512.1|347546_348137_+	transcriptional regulator UhpA	NA	NA	NA	NA	NA
WP_024104513.1|348136_349648_+	signal transduction histidine-protein kinase/phosphatase UhpB	NA	NA	NA	NA	NA
WP_026594637.1|349647_350994_+	MFS transporter	NA	NA	NA	NA	NA
WP_024104515.1|351165_352557_+	hexose-6-phosphate:phosphate antiporter	NA	NA	NA	NA	NA
WP_024104516.1|352804_353272_+	ATP-independent periplasmic protein-refolding chaperone	NA	NA	NA	NA	NA
WP_024104517.1|353496_354543_+	FAD:protein FMN transferase ApbE	NA	NA	NA	NA	NA
WP_024104518.1|354702_356139_+	coniferyl aldehyde dehydrogenase	NA	NA	NA	NA	NA
354981:354997	attL	GGCGGAGGAAGAGCAGA	NA	NA	NA	NA
WP_024104519.1|356698_359476_+	flavocytochrome c	NA	A0A2P0ZL82	Lactobacillus_phage	32.7	3.4e-48
WP_024104520.1|359546_360518_+	FAD:protein FMN transferase	NA	NA	NA	NA	NA
WP_024104521.1|360530_361112_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_024104523.1|361590_362454_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_026594638.1|363787_364402_+	Fic family protein	NA	NA	NA	NA	NA
WP_024104526.1|364398_364557_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099327146.1|364715_365824_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	38.8	3.1e-45
WP_024104529.1|366128_367163_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	88.1	3.1e-180
WP_024104530.1|367162_367750_-	phage repressor protein CI	NA	A0A218M4J1	Erwinia_phage	57.4	8.8e-63
WP_024104531.1|367878_368178_+	transcriptional switch protein	NA	A0A218M4I5	Erwinia_phage	86.9	4.6e-36
WP_024104532.1|368170_368674_+	phage regulatory CII family protein	NA	A0A218M4I4	Erwinia_phage	55.5	2.6e-47
WP_024104533.1|368803_369238_+	tellurite resistance TerB family protein	NA	Q1MVI3	Enterobacteria_phage	87.1	3.2e-62
WP_099327147.1|369237_369402_+	DUF3927 family protein	NA	NA	NA	NA	NA
WP_024104535.1|369635_369965_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024104536.1|370036_370267_+	DUF2732 domain-containing protein	NA	NA	NA	NA	NA
WP_035071554.1|370266_370491_+	TraR/DksA family transcriptional regulator	NA	Q6K1F5	Salmonella_virus	61.6	3.0e-16
WP_046830372.1|370487_371324_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	59.8	5.2e-85
WP_099327148.1|371320_372238_+	DNA cytosine methyltransferase	NA	A0A1L5C2B8	Pseudoalteromonas_phage	29.3	4.2e-11
WP_024104539.1|372234_372522_+	hypothetical protein	NA	A0A1I9LJL9	Stx_converting_phage	60.9	1.9e-26
WP_024104540.1|372518_374576_+	replication endonuclease	NA	F1BUM9	Cronobacter_phage	61.8	3.0e-235
WP_024104541.1|374717_375413_+	DNA adenine methylase	NA	A0A0M4S5U3	Salmonella_phage	60.4	1.3e-73
WP_161128625.1|375574_375733_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026594902.1|376167_376386_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024104544.1|376385_377228_+	hypothetical protein	NA	A0A0M4R2T6	Salmonella_phage	48.1	9.0e-61
WP_024104545.1|377482_378547_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	83.0	7.4e-161
WP_024104546.1|378546_380313_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	85.5	1.9e-310
WP_024104547.1|380458_381292_+|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	57.9	6.8e-77
WP_024104548.1|381306_382416_+|capsid	phage major capsid protein, P2 family	capsid	A0A1S6KZZ3	Salmonella_phage	72.0	1.7e-147
WP_024104549.1|382418_383081_+	hypothetical protein	NA	E5G6M7	Salmonella_phage	59.1	7.8e-60
WP_024104550.1|383173_383638_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	63.0	3.2e-52
WP_024104551.1|383637_383841_+|tail	tail protein X	tail	E5G6M9	Salmonella_phage	71.6	3.0e-23
WP_024104552.1|383844_384141_+|holin	phage holin family protein	holin	A0A0F7LA12	Escherichia_phage	70.5	4.3e-26
WP_035063310.1|384133_384619_+	glycoside hydrolase family 104 protein	NA	S4TUB1	Salmonella_phage	73.9	1.7e-64
WP_035063479.1|384645_385050_+|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	50.0	1.8e-22
WP_024104555.1|385142_385574_+|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	51.7	6.5e-39
WP_024104556.1|385566_386010_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	57.7	5.1e-39
WP_024104557.1|386019_387654_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024104558.1|387790_388324_+|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	58.3	6.1e-55
WP_024104559.1|388323_388671_+	GPW/gp25 family protein	NA	A0A1S6KZZ4	Salmonella_phage	60.7	5.2e-31
WP_024104560.1|388667_389576_+|plate	baseplate assembly protein	plate	F1BUP3	Erwinia_phage	73.5	4.7e-116
WP_024104561.1|389568_390177_+|tail	phage tail protein I	tail	E5G6N9	Salmonella_phage	65.3	1.3e-74
WP_024104562.1|390173_391313_+|tail	phage tail protein	tail	A0A2I8TVA9	Erwinia_phage	55.7	9.2e-101
WP_024104563.1|391312_391936_+|tail	tail fiber assembly protein	tail	A0A218M4J2	Erwinia_phage	38.1	1.4e-29
WP_024104564.1|392029_393202_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	82.8	2.8e-185
WP_024104565.1|393213_393729_+|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	69.6	9.7e-66
WP_024104566.1|393789_394092_+|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	60.0	7.0e-24
WP_026594904.1|394106_394226_+|tail	GpE family phage tail protein	tail	Q858U8	Yersinia_virus	56.4	8.8e-07
WP_026594905.1|394215_397056_+|tail	phage tail tape measure protein	tail	A0A1S6L010	Salmonella_phage	39.3	1.1e-123
WP_026594906.1|397082_397586_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	62.2	2.6e-47
WP_024104570.1|397582_398692_+	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	70.0	5.8e-132
WP_024104571.1|398771_398987_+	ogr/Delta-like zinc finger family protein	NA	Q53ZE7	Salmonella_virus	67.2	5.7e-20
WP_024104572.1|399046_399421_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051119501.1|399609_400032_-	hypothetical protein	NA	E5FFG2	Burkholderia_phage	31.2	2.8e-10
WP_024104574.1|400448_402284_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.3	1.1e-34
WP_024104575.1|402440_404195_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.2	3.5e-75
WP_001144069.1|404322_404538_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_024104576.1|404784_405798_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	58.6	1.7e-109
WP_013316302.1|405843_406314_-	transcriptional regulator ArgR	NA	NA	NA	NA	NA
WP_024104577.1|406804_407746_+	malate dehydrogenase	NA	NA	NA	NA	NA
WP_022632112.1|407816_408098_-	helix-turn-helix domain-containing protein	NA	A0A2I7S995	Vibrio_phage	66.2	2.7e-17
WP_024104578.1|408286_408673_+	putative DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_024104579.1|408899_409274_+	putative DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_024104580.1|409275_410247_-	octaprenyl diphosphate synthase	NA	A0A1V0SE37	Indivirus	27.3	1.7e-07
WP_013316308.1|410507_410819_+	50S ribosomal protein L21	NA	NA	NA	NA	NA
WP_024104581.1|410838_411096_+	50S ribosomal protein L27	NA	NA	NA	NA	NA
WP_024104582.1|411199_412144_+	DMT family transporter	NA	NA	NA	NA	NA
WP_024104583.1|412410_413586_+	Obg family GTPase CgtA	NA	NA	NA	NA	NA
WP_024104584.1|413689_415123_-	serine-type D-Ala-D-Ala carboxypeptidase	NA	NA	NA	NA	NA
WP_024104585.1|415387_415864_+	transcription elongation factor GreA	NA	NA	NA	NA	NA
WP_013316313.1|415987_416281_-	ribosome assembly RNA-binding protein YhbY	NA	NA	NA	NA	NA
WP_024104586.1|416438_417068_+	23S rRNA (uridine(2552)-2'-O)-methyltransferase RlmE	NA	NA	NA	NA	NA
WP_071598731.1|417115_419068_+|protease	ATP-dependent zinc metalloprotease FtsH	protease	G8DDJ2	Micromonas_pusilla_virus	43.5	1.6e-116
WP_024104588.1|419173_420007_+	dihydropteroate synthase	NA	NA	NA	NA	NA
WP_024104589.1|420015_421353_+	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_024104590.1|421651_421987_+	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
WP_026594639.1|422482_422935_+	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_024104592.1|422956_424447_+	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_024104593.1|424472_427190_+	translation initiation factor IF-2	NA	A0A2H4UTS4	Bodo_saltans_virus	25.0	5.2e-25
424784:424800	attR	GGCGGAGGAAGAGCAGA	NA	NA	NA	NA
WP_024104594.1|427264_427666_+	30S ribosome-binding factor RbfA	NA	NA	NA	NA	NA
WP_024104595.1|427665_428622_+|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
>prophage 2
NZ_CP017638	Dickeya dianthicola RNS04.9 chromosome, complete genome	4720132	607743	615681	4720132		Vibrio_phage(16.67%)	7	NA	NA
WP_071598738.1|607743_608031_-	helix-turn-helix domain-containing protein	NA	A0A2I7S995	Vibrio_phage	69.2	3.2e-18
WP_024104747.1|608385_609075_+	LuxR family transcriptional regulator	NA	Q2A088	Sodalis_phage	33.3	9.1e-11
WP_024104748.1|609090_610386_+	cytosine permease	NA	NA	NA	NA	NA
WP_024104749.1|610626_611526_+	Dyp-type peroxidase	NA	S4VXK8	Pandoravirus	31.0	1.1e-21
WP_024104750.1|611617_612499_+	cysteine synthase CysM	NA	A0A1X9I5F1	Streptococcus_phage	39.8	1.6e-52
WP_024104751.1|612516_614463_-	MacB family efflux pump subunit	NA	G9BWD6	Planktothrix_phage	41.6	1.1e-37
WP_024104752.1|614466_615681_-	efflux RND transporter periplasmic adaptor subunit	NA	A0A140XAI1	Dickeya_phage	94.7	7.9e-50
>prophage 3
NZ_CP017638	Dickeya dianthicola RNS04.9 chromosome, complete genome	4720132	1389493	1457494	4720132	plate,lysis,transposase	Cronobacter_phage(16.67%)	52	NA	NA
WP_024105444.1|1389493_1389925_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_024105445.1|1389927_1391694_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_024107943.1|1391657_1392671_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_024105446.1|1392673_1393903_+	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_099327164.1|1393902_1394439_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_024105448.1|1394441_1395779_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_024105449.1|1395795_1396572_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_024105450.1|1396587_1399224_+	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	33.1	2.5e-93
WP_024105451.1|1399226_1400765_+	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_024105452.1|1400764_1401328_+	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_024105453.1|1401339_1402776_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_024105454.1|1402801_1406296_+	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_024105455.1|1406347_1407781_+	type VI secretion system ImpA family N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_024105456.1|1407851_1409219_+	SEL1-like repeat protein	NA	NA	NA	NA	NA
WP_024105457.1|1409241_1410174_+	DKNYY domain-containing protein	NA	NA	NA	NA	NA
WP_024105458.1|1410429_1411989_+	GGDEF domain-containing protein	NA	G3MA91	Bacillus_virus	29.2	9.3e-11
WP_024105459.1|1412208_1413054_+	FTR1 family protein	NA	NA	NA	NA	NA
WP_024105460.1|1413143_1414265_+	iron uptake system protein EfeO	NA	NA	NA	NA	NA
WP_024105461.1|1414276_1415590_+	deferrochelatase/peroxidase EfeB	NA	NA	NA	NA	NA
WP_024105462.1|1415639_1415867_+	DUF1272 domain-containing protein	NA	NA	NA	NA	NA
WP_024105463.1|1416009_1416774_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_024105464.1|1416937_1417633_-	lactate utilization protein C	NA	NA	NA	NA	NA
WP_024105465.1|1417632_1419060_-	iron-sulfur cluster-binding protein	NA	NA	NA	NA	NA
WP_024105466.1|1419069_1419789_-	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_024105467.1|1420005_1420803_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_024105468.1|1420844_1421540_-|lysis	CidB/LrgB family autolysis modulator	lysis	NA	NA	NA	NA
WP_024105469.1|1421529_1421946_-	CidA/LrgA family protein	NA	NA	NA	NA	NA
WP_024105470.1|1422279_1424481_-	catalase/peroxidase HPI	NA	NA	NA	NA	NA
WP_024105471.1|1425083_1425881_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_026594933.1|1425952_1427527_+	nickel ABC transporter, nickel/metallophore periplasmic binding protein	NA	NA	NA	NA	NA
WP_024105473.1|1427611_1428544_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_024105474.1|1428546_1429410_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_024105475.1|1429416_1430229_+	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_181367086.1|1430232_1430994_+	ABC transporter ATP-binding protein	NA	A0A1V0SKJ1	Klosneuvirus	26.1	1.7e-10
WP_024105477.1|1431224_1431695_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_024105478.1|1431708_1432887_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_024105479.1|1432897_1434424_+	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_024105480.1|1434515_1435415_+	helix-turn-helix domain-containing protein	NA	D0R0F8	Streptococcus_phage	36.2	4.2e-08
WP_024105481.1|1435619_1436105_+	DUF2501 domain-containing protein	NA	NA	NA	NA	NA
WP_024105482.1|1436246_1436837_-	flavin reductase family protein	NA	NA	NA	NA	NA
WP_024105483.1|1437217_1437550_+	DUF1971 domain-containing protein	NA	NA	NA	NA	NA
WP_024105484.1|1437560_1437899_+	DUF1869 domain-containing protein	NA	NA	NA	NA	NA
WP_024105485.1|1439107_1439983_+	DUF2971 domain-containing protein	NA	NA	NA	NA	NA
WP_024105486.1|1440073_1444108_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024105488.1|1446051_1447911_+	hypothetical protein	NA	A0A0U4J920	Pseudomonas_phage	35.2	8.7e-24
WP_024105490.1|1448437_1448674_+	type II toxin-antitoxin system CcdA family antitoxin	NA	NA	NA	NA	NA
WP_019844797.1|1448676_1448991_+	CcdB family protein	NA	NA	NA	NA	NA
WP_046830389.1|1449479_1452578_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046830449.1|1452817_1453393_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051119500.1|1453662_1455228_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_187299602.1|1455998_1456559_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099327152.1|1456650_1457494_+|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	45.6	6.3e-22
>prophage 4
NZ_CP017638	Dickeya dianthicola RNS04.9 chromosome, complete genome	4720132	2140290	2149926	4720132	tRNA	Tupanvirus(33.33%)	11	NA	NA
WP_024106051.1|2140290_2141115_+	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	54.0	2.3e-69
WP_029729523.1|2141271_2142183_+	aromatic amino acid DMT transporter YddG	NA	NA	NA	NA	NA
WP_024106053.1|2142256_2142664_+	nitrous oxide-stimulated promoter family protein	NA	NA	NA	NA	NA
WP_012769674.1|2142682_2142982_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
WP_024106054.1|2142985_2145373_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	A0A1L3IZU3	BeAn_58058_virus	25.8	2.8e-06
WP_024106055.1|2145388_2146372_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	39.0	7.6e-35
WP_106120997.1|2146551_2146596_-	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_012769671.1|2146758_2147115_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_024106056.1|2147158_2147356_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_071598754.1|2147451_2147994_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	34.8	3.3e-16
WP_024106058.1|2147997_2149926_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	36.9	3.6e-129
>prophage 5
NZ_CP017638	Dickeya dianthicola RNS04.9 chromosome, complete genome	4720132	2298188	2309320	4720132	tail,plate	Escherichia_phage(45.45%)	15	NA	NA
WP_181367102.1|2298188_2299001_-	helix-turn-helix domain-containing protein	NA	Q6K1G0	Salmonella_virus	54.5	5.6e-84
WP_144414580.1|2299155_2299626_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051119515.1|2299769_2300213_+	hypothetical protein	NA	A0A0F7LA07	Escherichia_phage	50.4	4.2e-25
WP_024106179.1|2300400_2300613_+	DUF2732 family protein	NA	NA	NA	NA	NA
WP_024106180.1|2300612_2300837_+	TraR/DksA family transcriptional regulator	NA	Q6K1F5	Salmonella_virus	54.9	1.4e-13
WP_024106181.1|2301023_2303186_+	replication endonuclease	NA	A0A0F7LBQ2	Escherichia_phage	45.8	4.4e-176
WP_024106182.1|2303249_2303471_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024106183.1|2304063_2304267_+|tail	tail protein X	tail	A0A0F7LCN2	Escherichia_phage	64.2	1.2e-19
WP_024106184.1|2304342_2304804_+|tail	phage tail protein	tail	U5N0S7	Enterobacteria_phage	43.8	5.1e-26
WP_158666902.1|2305135_2305279_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026594756.1|2305435_2306089_+|plate	phage baseplate assembly protein V	plate	A0A2I8TV69	Erwinia_phage	62.9	4.8e-70
WP_024106187.1|2306085_2306436_+	GPW/gp25 family protein	NA	F1BUP4	Erwinia_phage	62.1	2.7e-35
WP_024106188.1|2306440_2307349_+|plate	baseplate assembly protein	plate	A0A0F7LCQ9	Escherichia_phage	73.2	7.3e-117
WP_024106189.1|2307341_2307953_+|tail	phage tail protein I	tail	F1BUP2	Erwinia_phage	66.5	5.5e-76
WP_046830405.1|2308192_2309320_+|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	47.4	5.9e-108
>prophage 6
NZ_CP017638	Dickeya dianthicola RNS04.9 chromosome, complete genome	4720132	2313161	2363182	4720132	tRNA,tail,protease	Salmonella_phage(25.0%)	44	NA	NA
WP_046830463.1|2313161_2313575_-|tail	tail fiber protein	tail	M1TAS6	Escherichia_phage	54.3	2.4e-35
WP_024106196.1|2313671_2314232_+	recombinase family protein	NA	A0A286S1P7	Klebsiella_phage	76.8	2.1e-74
WP_024108845.1|2314414_2315005_+|tail	tail fiber protein	tail	A0A2I8TVA9	Erwinia_phage	44.1	2.3e-26
WP_026594758.1|2315007_2315619_+|tail	tail fiber assembly protein	tail	A0A0M4QWM3	Salmonella_phage	34.8	9.9e-25
WP_024106199.1|2315843_2317013_+|tail	phage tail sheath protein	tail	S4TRX2	Salmonella_phage	82.9	7.8e-188
WP_013318224.1|2317027_2317546_+|tail	phage major tail tube protein	tail	S4TNZ0	Salmonella_phage	77.9	9.4e-77
WP_024106200.1|2317606_2317897_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	63.2	1.5e-23
WP_099327176.1|2317893_2318049_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	72.3	9.8e-14
WP_024106202.1|2318041_2319133_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024106203.1|2319143_2319638_+|tail	phage tail protein	tail	Q6K1G5	Salmonella_virus	56.6	1.5e-39
WP_024106204.1|2319634_2320813_+	late control D family protein	NA	Q6K1G4	Salmonella_virus	42.7	1.9e-77
WP_024106205.1|2320909_2321101_+	ogr/Delta-like zinc finger family protein	NA	A0A2I8TV89	Erwinia_phage	66.7	6.8e-17
WP_024106206.1|2321492_2322809_+	guanine deaminase	NA	NA	NA	NA	NA
WP_024106207.1|2323131_2324958_+	diguanylate cyclase	NA	NA	NA	NA	NA
WP_024106208.1|2325481_2327029_+	PAS domain-containing methyl-accepting chemotaxis protein	NA	A0A1B0V854	Salmonella_phage	52.4	1.2e-34
WP_024106209.1|2327095_2327395_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024106210.1|2327723_2328410_-	metallophosphoesterase	NA	K7P6H8	Enterobacteria_phage	55.6	6.6e-70
WP_024106211.1|2328557_2330159_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_024106212.1|2330251_2330935_-	ATP-binding cassette domain-containing protein	NA	R4TX06	Phaeocystis_globosa_virus	27.3	1.3e-09
WP_024106213.1|2330927_2331776_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	22.6	5.4e-05
WP_046830465.1|2331762_2332623_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_024106215.1|2332628_2333669_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_024106216.1|2333811_2334489_-	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_024106217.1|2335062_2336163_+	sodium-potassium/proton antiporter ChaA	NA	NA	NA	NA	NA
WP_024106218.1|2336446_2338162_+	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	26.1	2.3e-31
WP_024106219.1|2338219_2338651_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024106220.1|2338890_2339634_+	two-component system response regulator RstA	NA	NA	NA	NA	NA
WP_024106221.1|2339630_2340986_+	two-component system sensor histidine kinase RstB	NA	NA	NA	NA	NA
WP_024106222.1|2341061_2341514_+	acid resistance repetitive basic protein Asr	NA	NA	NA	NA	NA
WP_024106223.1|2341857_2342676_+|protease	serine protease	protease	NA	NA	NA	NA
WP_024106224.1|2342980_2344531_+	L-lactate permease	NA	NA	NA	NA	NA
WP_024106225.1|2344614_2345334_+	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_024106226.1|2345344_2346766_+	iron-sulfur cluster-binding protein	NA	NA	NA	NA	NA
WP_024106227.1|2346765_2347461_+	lactate utilization protein C	NA	NA	NA	NA	NA
WP_024106228.1|2347571_2351459_-	ATP-dependent RNA helicase HrpA	NA	A0A1V0SBU4	Catovirus	26.1	3.8e-53
WP_024106229.1|2351818_2352424_+	FMN-dependent NADH-azoreductase	NA	NA	NA	NA	NA
WP_024106230.1|2352520_2352784_-	YnbE family lipoprotein	NA	NA	NA	NA	NA
WP_024106231.1|2352807_2355411_-	YdbH family protein	NA	NA	NA	NA	NA
WP_024106232.1|2355755_2357309_+	PAS domain-containing methyl-accepting chemotaxis protein	NA	A0A1B0V854	Salmonella_phage	55.1	5.0e-41
WP_024106233.1|2357411_2357690_-	DUF333 domain-containing protein	NA	NA	NA	NA	NA
WP_024106235.1|2359141_2359639_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024106236.1|2360178_2360475_-	hypothetical protein	NA	NA	NA	NA	NA
WP_147363703.1|2360632_2362087_+	hypothetical protein	NA	A0A2H5BFZ4	Vibrio_phage	35.3	4.0e-24
WP_024106239.1|2362240_2363182_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	91.1	3.5e-138
>prophage 7
NZ_CP017638	Dickeya dianthicola RNS04.9 chromosome, complete genome	4720132	3509816	3581589	4720132	tRNA,integrase,tail,plate,holin,terminase,capsid,transposase	Burkholderia_phage(27.66%)	77	3511566:3511590	3569534:3569558
WP_024107182.1|3509816_3510851_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_024107183.1|3511042_3511318_+	envelope stress response protein PspG	NA	NA	NA	NA	NA
3511566:3511590	attL	AGCCAACGCACCTGCAACTTGAAGT	NA	NA	NA	NA
WP_024107184.1|3511854_3513261_-	cytochrome P450	NA	S4VQU1	Pandoravirus	34.4	3.8e-19
WP_024107185.1|3513646_3514648_-	quinone oxidoreductase	NA	NA	NA	NA	NA
WP_024107186.1|3514768_3516172_+	replicative DNA helicase	NA	A0A1B0VG30	Salmonella_phage	75.2	1.0e-189
WP_024107187.1|3516245_3517322_+	alanine racemase	NA	NA	NA	NA	NA
WP_024107188.1|3517500_3517749_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_024107189.1|3517992_3518760_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_024105338.1|3518868_3519489_-|tail	tail fiber assembly protein	tail	Q9MCR5	Enterobacteria_phage	37.8	8.7e-29
WP_024105337.1|3519488_3520349_-|tail	tail fiber protein	tail	M1TAS6	Escherichia_phage	48.4	2.6e-31
WP_024105336.1|3520348_3520924_-|tail	phage tail protein	tail	A4JWL7	Burkholderia_virus	58.5	1.3e-58
WP_024105335.1|3520916_3522029_-|plate	baseplate J/gp47 family protein	plate	Q6QI99	Burkholderia_phage	52.1	3.2e-90
WP_016941518.1|3522019_3522367_-	GPW/gp25 family protein	NA	Q6QIA0	Burkholderia_phage	62.0	5.6e-33
WP_024105334.1|3522457_3522721_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024105333.1|3522721_3523306_-|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	42.6	2.3e-15
WP_024105332.1|3523302_3524469_-	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	47.2	3.5e-79
WP_024105331.1|3524456_3524669_-|tail	tail protein X	tail	A4JWL2	Burkholderia_virus	62.9	1.5e-17
WP_024105330.1|3524671_3525559_-|tail	phage tail protein	tail	Q6QIA4	Burkholderia_phage	48.8	7.3e-53
WP_024105329.1|3525558_3528030_-|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	41.3	2.8e-171
WP_024105328.1|3528071_3528350_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071598747.1|3528312_3528459_-|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_024105327.1|3528409_3528730_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_024105326.1|3528859_3529063_-	hypothetical protein	NA	K7PHC3	Enterobacterial_phage	68.3	1.6e-16
WP_024105325.1|3529072_3529594_-|tail	phage major tail tube protein	tail	A4JWK6	Burkholderia_virus	70.6	1.5e-69
WP_024105324.1|3529593_3531015_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	A4JWK5	Burkholderia_virus	69.2	6.6e-189
WP_024105323.1|3531004_3531229_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024105322.1|3531225_3531693_-	Gp37 family protein	NA	Q6QIB2	Burkholderia_phage	50.7	1.1e-36
WP_024105321.1|3531692_3532139_-	DUF1320 domain-containing protein	NA	A4JWK2	Burkholderia_virus	52.5	3.0e-31
WP_024105320.1|3532140_3532497_-	DUF2190 family protein	NA	Q6QIB4	Burkholderia_phage	52.2	1.8e-18
WP_024105319.1|3532507_3533443_-	hypothetical protein	NA	A4JWK0	Burkholderia_virus	45.0	1.1e-62
WP_024105318.1|3533460_3534561_-	peptidase	NA	A4JWJ9	Burkholderia_virus	48.8	3.5e-89
WP_024105317.1|3534755_3535205_-	phage virion morphogenesis protein	NA	Q6QIB8	Burkholderia_phage	45.0	9.1e-28
WP_024105316.1|3535201_3536023_-|capsid	minor capsid protein	capsid	Q6QIB9	Burkholderia_phage	61.7	4.8e-99
WP_024105315.1|3536003_3537497_-	DUF935 domain-containing protein	NA	Q6QIC0	Burkholderia_phage	58.9	2.1e-169
WP_024105314.1|3537496_3538813_-|terminase	terminase	terminase	A0A2P9JZI8	Alteromonadaceae_phage	63.6	5.2e-148
WP_024105313.1|3538809_3539358_-	DUF3486 family protein	NA	A4JWJ3	Burkholderia_virus	60.2	8.8e-49
WP_016941497.1|3539357_3539669_-	hypothetical protein	NA	A0A0S4L0A3	Pseudomonas_phage	59.6	4.0e-30
WP_024105312.1|3539661_3539991_-	hypothetical protein	NA	A4JWP6	Burkholderia_virus	44.1	5.3e-17
WP_024105311.1|3539987_3540629_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024105310.1|3540612_3541341_-	transglycosylase SLT domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	50.4	1.1e-59
WP_024105309.1|3541343_3541688_-|holin	putative holin	holin	Q6QIC8	Burkholderia_phage	52.7	9.1e-20
WP_035071616.1|3541764_3542604_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024105306.1|3542674_3543208_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024105305.1|3543223_3543634_-	helix-turn-helix transcriptional regulator	NA	Q5ZQZ8	Pseudomonas_phage	40.2	7.6e-13
WP_024105304.1|3543738_3543924_+	DNA-binding protein	NA	A0A0S4L0D0	Pseudomonas_phage	74.5	6.6e-17
WP_144414586.1|3543980_3544214_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024105302.1|3544216_3544522_+	helix-turn-helix domain-containing protein	NA	Q5ZR02	Pseudomonas_phage	56.0	1.0e-22
WP_024105301.1|3544537_3545464_+	DUF3102 domain-containing protein	NA	A4JWN3	Burkholderia_virus	58.2	7.6e-77
WP_024105300.1|3545464_3547231_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	Q6QIE0	Burkholderia_phage	68.7	1.3e-231
WP_024105299.1|3547244_3548396_+	AAA family ATPase	NA	A4JWN1	Burkholderia_virus	60.1	8.1e-121
WP_024105298.1|3548465_3548762_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024105297.1|3548791_3549310_+	host-nuclease inhibitor Gam family protein	NA	L7P7T1	Pseudomonas_phage	60.2	2.9e-54
WP_024105296.1|3549309_3549609_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024105295.1|3549592_3550300_+	DUF2786 domain-containing protein	NA	A0A2P9JZH4	Alteromonadaceae_phage	36.2	8.2e-31
WP_024105294.1|3550300_3550720_+	regulatory protein GemA	NA	Q6QIE7	Burkholderia_phage	55.3	2.4e-30
WP_024105293.1|3550716_3551097_+	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	53.1	2.7e-28
WP_024107190.1|3551539_3552913_-	amino acid permease	NA	NA	NA	NA	NA
WP_024107191.1|3553303_3553780_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_024107192.1|3554045_3554660_+	YitT family protein	NA	NA	NA	NA	NA
WP_024107193.1|3554701_3555895_+	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_024107194.1|3556929_3557484_-	type I-F CRISPR-associated endoribonuclease Cas6/Csy4	NA	NA	NA	NA	NA
WP_024107195.1|3557490_3558498_-	type I-F CRISPR-associated protein Csy3	NA	A0A2D0YYX4	Vibrio_phage	40.1	1.0e-50
WP_024107196.1|3558514_3559468_-	type I-F CRISPR-associated protein Csy2	NA	NA	NA	NA	NA
WP_024107197.1|3559464_3560802_-	type I-F CRISPR-associated protein Csy1	NA	NA	NA	NA	NA
WP_024107198.1|3560816_3564095_-	type I-F CRISPR-associated helicase Cas3	NA	A0A2I7RCU8	Vibrio_phage	28.5	1.4e-88
WP_024107199.1|3564091_3565093_-	type I-F CRISPR-associated endonuclease Cas1	NA	A0A2D0YFC9	Vibrio_phage	37.1	1.7e-50
WP_024107200.1|3567795_3569484_-	MCP four helix bundle domain-containing protein	NA	NA	NA	NA	NA
WP_024107201.1|3570631_3572242_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	34.8	7.1e-22
3569534:3569558	attR	ACTTCAAGTTGCAGGTGCGTTGGCT	NA	NA	NA	NA
WP_024107202.1|3572362_3575194_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	55.4	5.7e-309
WP_024107203.1|3575449_3575998_+	single-stranded DNA-binding protein SSB1	NA	A0A291LCB6	Klebsiella_phage	77.5	1.3e-52
WP_024107204.1|3576055_3576634_-	flavin reductase family protein	NA	NA	NA	NA	NA
WP_024107205.1|3576668_3576968_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024107206.1|3577162_3577651_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024107208.1|3577933_3578521_+	DUF4255 domain-containing protein	NA	NA	NA	NA	NA
WP_024107209.1|3578527_3579373_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024107210.1|3579513_3581067_+|tail	phage tail sheath family protein	tail	A0A2H4N7L3	Lake_Baikal_phage	31.2	1.1e-08
WP_024107211.1|3581118_3581589_+|tail	phage tail protein	tail	A0A059XEM3	uncultured_phage	44.6	9.3e-23
