The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP017713	Lactobacillus coryniformis subsp. coryniformis KCTC 3167 = DSM 20001 chromosome, complete genome	2951508	4628	63068	2951508	transposase,integrase	Bacillus_phage(23.81%)	55	NA	NA
WP_056943259.1|4628_6581_+	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	45.0	9.8e-143
WP_003677393.1|6709_9271_+	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	34.9	9.6e-114
WP_003680796.1|9594_9894_+	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_003680798.1|9933_10488_+	single-stranded DNA-binding protein	NA	U5U726	Lactobacillus_phage	61.4	1.4e-41
WP_003680800.1|10517_10763_+	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_069700454.1|10898_11318_-|integrase	tyrosine-type recombinase/integrase	integrase	H7BW99	unidentified_phage	50.0	1.1e-11
WP_141707630.1|11306_11591_+|transposase	transposase	transposase	Q6J1X3	Lactobacillus_phage	98.4	9.2e-26
WP_191982320.1|11631_12141_+|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	98.8	1.2e-89
WP_080595765.1|12144_12474_+|transposase	transposase	transposase	Q6J1X2	Lactobacillus_phage	99.1	4.0e-57
WP_010010464.1|12867_14880_+	DHH family phosphoesterase	NA	NA	NA	NA	NA
WP_169925054.1|15120_16566_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A1X9I6E7	Streptococcus_phage	27.7	1.5e-07
WP_003680229.1|16710_17163_+	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_003680228.1|17358_18765_+	replicative DNA helicase	NA	A0A1P8VVQ6	Streptococcus_phage	53.1	3.0e-125
WP_141707574.1|18910_19057_+	DUF1211 domain-containing protein	NA	NA	NA	NA	NA
WP_010010467.1|19063_19321_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010010468.1|19775_21068_+	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_010010469.1|21116_21584_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010010471.1|21717_22260_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010010472.1|22314_23262_-	TDT family transporter	NA	NA	NA	NA	NA
WP_003680679.1|23494_24787_+	adenylosuccinate synthase	NA	L7Y4J5	Megavirus	34.6	1.4e-65
WP_010010473.1|25046_25844_-	gamma-glutamyl-gamma-aminobutyrate hydrolase family protein	NA	NA	NA	NA	NA
WP_010010474.1|26518_27229_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	40.4	6.0e-42
WP_010010475.1|27465_29346_+	cell wall metabolism sensor histidine kinase WalK	NA	W8CYF6	Bacillus_phage	33.7	3.2e-34
WP_010010476.1|29335_30658_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010010477.1|30657_31482_+	two-component system regulatory protein YycI	NA	NA	NA	NA	NA
WP_010010479.1|31617_32430_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_010010480.1|32528_33788_+	trypsin-like peptidase domain-containing protein	NA	A0A1B1IT49	uncultured_Mediterranean_phage	30.6	4.0e-20
WP_029507996.1|34423_34903_+	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_010010482.1|35045_35621_+	helix-turn-helix transcriptional regulator	NA	A0A0S2MVM8	Bacillus_phage	45.0	3.3e-06
WP_003678159.1|36121_37000_+	proline iminopeptidase-family hydrolase	NA	NA	NA	NA	NA
WP_010010483.1|37390_39358_+	TetM/TetW/TetO/TetS family tetracycline resistance ribosomal protection protein	NA	E4ZFJ7	Streptococcus_phage	32.9	1.1e-72
WP_029508001.1|39347_39893_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010010486.1|39889_40222_+	aminoglycoside 6-adenylyltransferase	NA	NA	NA	NA	NA
WP_029507997.1|40276_40729_+	aminoglycoside 6-adenylyltransferase	NA	NA	NA	NA	NA
WP_010010488.1|40811_42248_-	multidrug efflux MFS transporter	NA	A0A0M3UL24	Mycobacterium_phage	23.7	7.2e-18
WP_010010489.1|42247_42685_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010010490.1|42851_43505_+	DNA alkylation repair protein	NA	NA	NA	NA	NA
WP_010010492.1|44044_44839_+	hypothetical protein	NA	NA	NA	NA	NA
WP_169925055.1|45036_46482_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A1X9I6C6	Streptococcus_phage	28.3	1.5e-07
WP_029507998.1|46625_47207_+	uracil-DNA glycosylase family protein	NA	NA	NA	NA	NA
WP_029507999.1|47323_48877_+	gluconokinase	NA	NA	NA	NA	NA
WP_010010495.1|48922_52858_-	MMPL family transporter	NA	NA	NA	NA	NA
WP_010010496.1|53167_53761_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010010497.1|53838_54579_-	peroxide stress protein YaaA	NA	NA	NA	NA	NA
WP_010010498.1|54706_55099_+	helix-turn-helix transcriptional regulator	NA	A0A0S2MVM8	Bacillus_phage	43.3	2.9e-06
WP_010010499.1|55109_55433_+	hypothetical protein	NA	NA	NA	NA	NA
WP_056943304.1|55749_56475_+	carboxymethylenebutenolidase	NA	NA	NA	NA	NA
WP_056943305.1|56655_57105_-	DUF2188 domain-containing protein	NA	NA	NA	NA	NA
WP_003677733.1|57353_58484_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003677731.1|58476_59172_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.5	2.6e-37
WP_003677729.1|59158_60373_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_010010503.1|60409_60943_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010010504.1|61051_61825_+	helix-turn-helix transcriptional regulator	NA	A0A0S2MVM8	Bacillus_phage	44.3	5.6e-09
WP_056943306.1|61821_62289_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_086989537.1|62292_63068_-|transposase	IS5-like element ISLpl3 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	53.2	2.1e-27
>prophage 2
NZ_CP017713	Lactobacillus coryniformis subsp. coryniformis KCTC 3167 = DSM 20001 chromosome, complete genome	2951508	72201	130340	2951508	transposase,protease	Paenibacillus_phage(30.0%)	48	NA	NA
WP_099267180.1|72201_72942_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_010010524.1|73301_74951_+	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_010010525.1|75026_75704_+	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_010010526.1|75761_76106_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010010527.1|76143_76530_-	iron-sulfur cluster biosynthesis family protein	NA	NA	NA	NA	NA
WP_086989537.1|76581_77357_-|transposase	IS5-like element ISLpl3 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	53.2	2.1e-27
WP_010010528.1|77525_78371_-	acetoacetate decarboxylase family protein	NA	NA	NA	NA	NA
WP_010010529.1|78385_79246_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_010010530.1|79361_81311_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_010010531.1|81482_82946_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_010010533.1|82929_83472_-	dihydrofolate reductase	NA	NA	NA	NA	NA
WP_010010534.1|83541_84915_-	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_010010537.1|85604_86435_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_003677701.1|86541_87279_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.5	1.4e-33
WP_010010538.1|87293_87977_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_003677697.1|87957_88617_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_003677695.1|89325_89967_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_010010539.1|90111_90789_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010010540.1|90839_91319_-	GyrI-like domain-containing protein	NA	NA	NA	NA	NA
WP_003677693.1|91489_92407_+	YafY family transcriptional regulator	NA	NA	NA	NA	NA
WP_010010541.1|92523_94509_+	sodium:proton antiporter	NA	NA	NA	NA	NA
WP_010010542.1|94701_97413_+	HAD-IC family P-type ATPase	NA	M1HN09	Paramecium_bursaria_Chlorella_virus	26.5	1.2e-66
WP_010010543.1|97619_98264_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003677690.1|98324_99005_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_010010544.1|100577_101324_-	nitroreductase family protein	NA	NA	NA	NA	NA
WP_010010545.1|101516_102134_+	flavin reductase family protein	NA	NA	NA	NA	NA
WP_003677686.1|102135_102714_-	DUF2179 domain-containing protein	NA	NA	NA	NA	NA
WP_003677685.1|102824_103343_-	DUF1836 domain-containing protein	NA	NA	NA	NA	NA
WP_003677683.1|103467_104103_+	hemolysin III family protein	NA	NA	NA	NA	NA
WP_016376044.1|105637_106147_-	DUF308 domain-containing protein	NA	NA	NA	NA	NA
WP_015473476.1|106469_107399_-|transposase	IS30-like element ISLpl1 family transposase	transposase	H7BW61	unidentified_phage	29.9	8.5e-20
WP_003680692.1|107643_109062_+|transposase	IS5-like element ISLrh3 family transposase	transposase	NA	NA	NA	NA
WP_099267083.1|109089_109877_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_002816262.1|110157_110589_+	CopY/TcrY family copper transport repressor	NA	NA	NA	NA	NA
WP_056943339.1|110839_112993_+	copper-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	30.3	1.5e-59
WP_010009086.1|113109_113784_+	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	34.0	3.3e-29
WP_010009085.1|113780_114674_+|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	22.4	2.7e-07
WP_099267084.1|115455_116243_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_003581836.1|116526_117270_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	33.5	1.5e-27
WP_010009081.1|117247_118465_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_005691104.1|118469_119141_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_099267085.1|120044_120831_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_099267086.1|121340_122711_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_003567312.1|122845_123403_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010010814.1|123497_124367_-	DUF2075 domain-containing protein	NA	NA	NA	NA	NA
WP_015473476.1|124466_125396_+|transposase	IS30-like element ISLpl1 family transposase	transposase	H7BW61	unidentified_phage	29.9	8.5e-20
WP_099267087.1|125612_127727_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	K4FB40	Cronobacter_phage	39.0	2.4e-118
WP_099267088.1|129161_130340_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP017713	Lactobacillus coryniformis subsp. coryniformis KCTC 3167 = DSM 20001 chromosome, complete genome	2951508	392374	456313	2951508	transposase	Streptococcus_phage(15.79%)	55	NA	NA
WP_099267096.1|392374_393685_-|transposase	IS1380 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	54.3	4.6e-128
WP_056943319.1|393833_394898_+	Ldh family oxidoreductase	NA	NA	NA	NA	NA
WP_010011488.1|395345_395957_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A249XZV3	Enterococcus_phage	75.8	7.1e-23
WP_010011490.1|396100_396931_+	YitT family protein	NA	NA	NA	NA	NA
WP_010011491.1|397101_399093_+	KUP/HAK/KT family potassium transporter	NA	M1HZV6	Acanthocystis_turfacea_Chlorella_virus	32.8	4.8e-60
WP_056943320.1|399146_399668_-	DUF308 domain-containing protein	NA	NA	NA	NA	NA
WP_003678599.1|399880_400759_-	cation transporter	NA	NA	NA	NA	NA
WP_176720015.1|400938_401646_-	MIP family channel protein	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	35.0	1.9e-32
WP_010011496.1|401717_403550_-	type 1 glycerol-3-phosphate oxidase	NA	NA	NA	NA	NA
WP_010011498.1|403718_405230_-	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_164512712.1|405505_406534_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	33.5	1.1e-41
WP_099267097.1|406715_407789_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.2	5.7e-44
WP_099267098.1|408129_409440_-|transposase	IS1380 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	54.1	1.0e-127
WP_003678595.1|409800_410556_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_003678594.1|410685_411678_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	35.3	9.3e-49
WP_010011499.1|411723_412524_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_003678592.1|412614_413676_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010011500.1|413668_414544_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010011501.1|414717_415734_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010011502.1|415903_416764_-	aldo/keto reductase	NA	A0A1V0SKP9	Klosneuvirus	31.6	1.3e-33
WP_003678588.1|416979_418332_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_029507699.1|419033_420434_+	sodium:proton antiporter	NA	NA	NA	NA	NA
WP_056943290.1|420514_421078_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_010011508.1|421193_421853_+	nitroreductase family protein	NA	NA	NA	NA	NA
WP_056943289.1|422264_423089_+	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_010011511.1|424420_425566_+	ArgE/DapE family deacylase	NA	NA	NA	NA	NA
WP_003679769.1|425711_426263_+	sugar O-acetyltransferase	NA	NA	NA	NA	NA
WP_035457528.1|426766_428329_+	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	22.5	1.8e-06
WP_035457526.1|428580_428958_-	YbaN family protein	NA	NA	NA	NA	NA
WP_003679762.1|428997_430311_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_010011514.1|430582_430744_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003679760.1|430865_431306_-	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
WP_003679758.1|431687_432854_+	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	49.5	1.7e-17
WP_003679756.1|432850_433486_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_010011515.1|433485_434415_+	osmoprotectant ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_176720025.1|434423_435083_+	ABC transporter permease	NA	G3M9Y4	Bacillus_virus	29.1	1.0e-06
WP_099235711.1|435861_437244_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	29.6	4.2e-31
WP_010011516.1|437620_438160_+	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_010011517.1|438360_439071_+	5-oxoprolinase subunit PxpB	NA	NA	NA	NA	NA
WP_010011519.1|439082_440087_+	biotin-dependent carboxyltransferase family protein	NA	NA	NA	NA	NA
WP_010011520.1|440118_440529_+	acetyl-CoA carboxylase biotin carboxyl carrier protein subunit	NA	NA	NA	NA	NA
WP_010011521.1|440545_441859_+	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_029508041.1|441996_442746_+	LamB/YcsF family protein	NA	NA	NA	NA	NA
WP_003680334.1|442778_443984_+	divalent metal cation transporter	NA	NA	NA	NA	NA
WP_099235711.1|444472_445855_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	29.6	4.2e-31
WP_035456850.1|446156_447347_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_035456844.1|447753_448632_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_029508042.1|448641_449595_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_010011528.1|449597_450374_+	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	27.8	3.7e-16
WP_010011529.1|450373_451084_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.4	1.3e-15
WP_010011530.1|451089_451713_+	CBS domain-containing protein	NA	M1NSC5	Streptococcus_phage	49.5	1.3e-45
WP_169925044.1|452090_453140_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_050781705.1|453254_454298_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_010011532.1|454341_455088_-	ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	49.2	2.8e-58
WP_029508043.1|455089_456313_-|transposase	IS21 family transposase	transposase	A0A059NT83	Lactococcus_phage	49.0	1.7e-100
>prophage 4
NZ_CP017713	Lactobacillus coryniformis subsp. coryniformis KCTC 3167 = DSM 20001 chromosome, complete genome	2951508	461102	515736	2951508	transposase,tRNA,integrase	unidentified_phage(13.33%)	52	488443:488457	502469:502483
WP_082602270.1|461102_461300_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_169925059.1|461429_462461_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	34.4	5.2e-42
WP_029507734.1|462682_463756_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.2	1.7e-43
WP_010011545.1|463862_464459_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010011547.1|464690_465836_-	AI-2E family transporter	NA	NA	NA	NA	NA
WP_010011548.1|465990_467175_-	amidohydrolase	NA	NA	NA	NA	NA
WP_010011549.1|467244_467646_+	arsenate reductase (thioredoxin)	NA	A0A2H4PQT9	Staphylococcus_phage	54.3	2.4e-32
WP_010011550.1|467722_468403_-	fructose-6-phosphate aldolase	NA	I3ULK3	Synechococcus_phage	30.7	3.7e-20
WP_010011553.1|468420_470850_-	glycyl radical protein	NA	NA	NA	NA	NA
WP_010011554.1|471242_471989_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	27.6	7.8e-16
WP_010011555.1|472124_472928_+	glycyl-radical enzyme activating protein	NA	NA	NA	NA	NA
WP_040473118.1|473138_474509_+	purine/pyrimidine permease	NA	NA	NA	NA	NA
WP_056943268.1|474652_476041_+	MFS transporter	NA	NA	NA	NA	NA
WP_010011561.1|476089_476305_-	DUF2187 domain-containing protein	NA	NA	NA	NA	NA
WP_004562524.1|476686_477871_+	MFS transporter	NA	NA	NA	NA	NA
WP_010011562.1|477919_480943_-	carbamoyl-phosphate synthase large subunit	NA	NA	NA	NA	NA
WP_010011563.1|480990_482067_-	carbamoyl phosphate synthase small subunit	NA	R4TGJ8	Halovirus	35.4	1.4e-53
WP_010011565.1|482468_483494_+	N-acetyl-gamma-glutamyl-phosphate reductase	NA	NA	NA	NA	NA
WP_010011566.1|483641_484838_+	bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ	NA	NA	NA	NA	NA
WP_010011567.1|484896_485652_+	acetylglutamate kinase	NA	NA	NA	NA	NA
WP_010011568.1|485648_486785_+	acetylornithine transaminase	NA	A0A1V0SKB7	Klosneuvirus	26.2	1.0e-14
WP_010011569.1|486949_487969_+	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_010011570.1|488020_488329_-	DUF960 domain-containing protein	NA	NA	NA	NA	NA
488443:488457	attL	TGAAATTAAAAAACA	NA	NA	NA	NA
WP_010011571.1|488508_489369_-	DUF4097 family beta strand repeat protein	NA	NA	NA	NA	NA
WP_004562517.1|489365_489974_-	DUF1700 domain-containing protein	NA	NA	NA	NA	NA
WP_004562516.1|489973_490291_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010011572.1|490419_491580_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_010011573.1|491588_492680_-	DUF871 domain-containing protein	NA	NA	NA	NA	NA
WP_010011574.1|492896_493823_-	SPFH domain-containing protein	NA	NA	NA	NA	NA
WP_004562512.1|494051_495056_+	dihydroxyacetone kinase subunit DhaK	NA	NA	NA	NA	NA
WP_010011576.1|495079_495607_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004562511.1|495630_496218_+	dihydroxyacetone kinase subunit L	NA	NA	NA	NA	NA
WP_010011578.1|496214_496583_+	PTS-dependent dihydroxyacetone kinase phosphotransferase subunit DhaM	NA	NA	NA	NA	NA
WP_069700543.1|497065_498448_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	29.6	4.2e-31
WP_010011817.1|499098_499929_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_056943352.1|500214_500778_+	TIGR01440 family protein	NA	NA	NA	NA	NA
WP_099267101.1|500951_502400_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A1X9I6E7	Streptococcus_phage	26.3	8.1e-09
WP_056943369.1|502575_503442_+	SPFH domain-containing protein	NA	NA	NA	NA	NA
502469:502483	attR	TGTTTTTTAATTTCA	NA	NA	NA	NA
WP_086989537.1|503456_504232_-|transposase	IS5-like element ISLpl3 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	53.2	2.1e-27
WP_056943377.1|504323_504683_-	AP2 domain-containing protein	NA	A8ATW6	Listeria_phage	33.1	6.4e-08
WP_099267102.1|505021_506344_+|transposase	IS1380 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	38.0	3.8e-74
WP_010011865.1|506659_507286_+	recombinase family protein	NA	A0A1B0VBM1	Salmonella_phage	35.6	8.0e-14
WP_003677674.1|507559_508096_-	dihydrofolate reductase	NA	NA	NA	NA	NA
WP_010011863.1|508490_509447_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010011862.1|509451_510138_+	NAD-dependent protein deacylase	NA	NA	NA	NA	NA
WP_010011861.1|510203_510491_+	chorismate mutase	NA	NA	NA	NA	NA
WP_010013330.1|510524_511007_+	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_010011858.1|511298_511766_+	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_010011857.1|511833_512157_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010011855.1|512178_513021_+	DUF72 domain-containing protein	NA	A0A1D6Y809	Golden_Marseillevirus	26.2	2.3e-11
WP_010011853.1|513039_513594_+	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_010011852.1|513705_515736_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SHR2	Klosneuvirus	37.8	3.7e-92
>prophage 5
NZ_CP017713	Lactobacillus coryniformis subsp. coryniformis KCTC 3167 = DSM 20001 chromosome, complete genome	2951508	524592	571332	2951508	transposase	Pseudomonas_phage(20.0%)	41	NA	NA
WP_099267102.1|524592_525915_+|transposase	IS1380 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	38.0	3.8e-74
WP_010011834.1|526192_527587_-	oxaloacetate decarboxylase subunit alpha	NA	NA	NA	NA	NA
WP_010011832.1|527751_528873_-	sodium ion-translocating decarboxylase subunit beta	NA	NA	NA	NA	NA
WP_010011831.1|528904_529288_-	acetyl-CoA carboxylase biotin carboxyl carrier protein subunit	NA	NA	NA	NA	NA
WP_010011830.1|529298_529634_-	hypothetical protein	NA	NA	NA	NA	NA
WP_056943325.1|530022_531366_+	citrate transporter	NA	NA	NA	NA	NA
WP_056943324.1|531394_532090_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010011828.1|532133_532427_+	citrate lyase acyl carrier protein	NA	NA	NA	NA	NA
WP_010011827.1|532429_533341_+	citrate (pro-3S)-lyase subunit beta	NA	NA	NA	NA	NA
WP_010011826.1|533333_534872_+	citrate lyase subunit alpha	NA	NA	NA	NA	NA
WP_099267103.1|534964_535501_+	citrate lyase holo-[acyl-carrier protein] synthase	NA	NA	NA	NA	NA
WP_010011823.1|535508_536378_+	triphosphoribosyl-dephospho-CoA synthase CitG	NA	NA	NA	NA	NA
WP_082602266.1|536442_536757_+	hypothetical protein	NA	W8EBD0	Pseudomonas_phage	40.4	1.9e-08
WP_082602291.1|537755_538115_+	hypothetical protein	NA	A0A0S4KZH7	Pseudomonas_phage	36.8	6.2e-11
WP_169925060.1|538682_539711_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	33.2	3.3e-41
WP_035456673.1|539983_540658_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_099267105.1|540654_541548_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	30.1	2.9e-25
WP_056943364.1|541625_542651_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.4	7.4e-41
WP_099267184.1|542822_543326_+	PTS system mannose/fructose/sorbose family transporter subunit IID	NA	NA	NA	NA	NA
WP_099267106.1|544457_545825_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_056943371.1|546196_546769_+	HTH domain-containing protein	NA	NA	NA	NA	NA
WP_099235755.1|546838_548209_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_040473047.1|548210_549536_+	PRD domain-containing protein	NA	NA	NA	NA	NA
WP_056943322.1|549557_551474_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_010009389.1|551497_552460_+	ketose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_010009387.1|552722_553964_+	ROK family protein	NA	NA	NA	NA	NA
WP_010009386.1|554075_554741_+	hypothetical protein	NA	A0A0E3G348	Synechococcus_phage	42.2	5.9e-39
WP_010009385.1|554750_555407_+	DUF4867 family protein	NA	NA	NA	NA	NA
WP_010009381.1|555422_556757_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010009380.1|556771_557644_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_010009379.1|557657_559685_+	alpha-glucosidase	NA	NA	NA	NA	NA
WP_010500113.1|559786_560665_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_056943372.1|560702_561446_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_004270929.1|561584_562616_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	34.4	5.2e-42
WP_010009378.1|562759_564160_+	MFS transporter	NA	NA	NA	NA	NA
WP_010009376.1|564219_564543_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010009370.1|566320_566872_+	anion permease	NA	NA	NA	NA	NA
WP_010009368.1|567250_567430_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003679178.1|567419_567779_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_035457925.1|567826_569380_+|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	31.4	5.2e-54
WP_099267108.1|569769_571332_+|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	34.7	1.4e-70
>prophage 6
NZ_CP017713	Lactobacillus coryniformis subsp. coryniformis KCTC 3167 = DSM 20001 chromosome, complete genome	2951508	650504	723515	2951508	transposase,protease	Streptococcus_phage(26.67%)	55	NA	NA
WP_099267111.1|650504_651776_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	31.7	7.0e-49
WP_003677222.1|651846_652590_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.8	4.9e-26
WP_010010879.1|652605_653292_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_010010880.1|653398_654199_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_010010881.1|654461_655721_+	hydroxymethylglutaryl-CoA reductase, degradative	NA	NA	NA	NA	NA
WP_010010882.1|656113_656485_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010010883.1|656668_658495_+	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	28.3	3.1e-58
WP_029508015.1|658678_660082_+	isochorismate synthase	NA	NA	NA	NA	NA
WP_010010885.1|660071_661757_+	2-succinyl-5-enolpyruvyl-6-hydroxy-3- cyclohexene-1-carboxylic-acid synthase	NA	NA	NA	NA	NA
WP_010010887.1|661749_662559_+	2-succinyl-6-hydroxy-2, 4-cyclohexadiene-1-carboxylate synthase	NA	NA	NA	NA	NA
WP_010010888.1|662558_663671_+	o-succinylbenzoate synthase	NA	NA	NA	NA	NA
WP_010010889.1|663684_665013_-	amino acid permease	NA	NA	NA	NA	NA
WP_141707555.1|665164_666130_-	decarboxylating 6-phosphogluconate dehydrogenase	NA	M4SJX8	Cyanophage	35.7	4.4e-51
WP_010010891.1|666309_667155_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010010894.1|667191_667551_-	DUF4828 domain-containing protein	NA	NA	NA	NA	NA
WP_010010895.1|667855_668857_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_010010896.1|668856_670116_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	28.7	5.7e-35
WP_010010897.1|670108_670447_+	PTS lactose/cellobiose transporter subunit IIA	NA	NA	NA	NA	NA
WP_010010898.1|670760_671174_+	DUF3284 domain-containing protein	NA	NA	NA	NA	NA
WP_010010900.1|671740_671902_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010010902.1|671947_672163_-	CsbD family protein	NA	NA	NA	NA	NA
WP_010010903.1|672276_673527_-	aminopeptidase	NA	NA	NA	NA	NA
WP_010010904.1|673743_674358_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_035457969.1|674541_675891_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_003677192.1|675971_676424_-	flavodoxin	NA	NA	NA	NA	NA
WP_010010908.1|677672_678557_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	48.1	8.0e-68
WP_003677187.1|678613_678937_-	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_010010910.1|678993_680391_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	36.7	2.8e-83
WP_010010911.1|680718_681519_+	recombination regulator RecX	NA	NA	NA	NA	NA
WP_010010912.1|681644_682178_+	DUF402 domain-containing protein	NA	NA	NA	NA	NA
WP_010010913.1|682232_682556_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010010915.1|682591_683023_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_010010916.1|683316_684444_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_010010917.1|684530_685862_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_010010918.1|685914_687513_+	peptide chain release factor 3	NA	A0A1B0RXH7	Streptococcus_phage	27.2	1.2e-32
WP_035456673.1|687599_688274_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_035456720.1|688270_689164_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	30.1	2.9e-25
WP_010010921.1|689238_690348_-	MucBP domain-containing protein	NA	NA	NA	NA	NA
WP_010010922.1|690445_690721_-	DUF1827 family protein	NA	NA	NA	NA	NA
WP_029507742.1|691091_693326_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	H6X3M6	Enterobacteria_phage	40.9	2.2e-122
WP_010010924.1|693555_693744_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003677166.1|693932_694199_+	phosphocarrier protein HPr	NA	NA	NA	NA	NA
WP_010010925.1|694198_695923_+	phosphoenolpyruvate--protein phosphotransferase	NA	NA	NA	NA	NA
WP_010010927.1|696197_697376_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_010010928.1|697409_698432_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_010010929.1|698434_699451_+	flippase-like domain-containing protein	NA	NA	NA	NA	NA
WP_010010930.1|699621_699858_+	YkuJ family protein	NA	NA	NA	NA	NA
WP_056943314.1|700228_702298_+	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	45.2	5.9e-146
WP_010011787.1|709066_709537_+	CtsR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010011786.1|709557_712047_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	H6X3M6	Enterobacteria_phage	41.1	3.3e-127
WP_010011785.1|712192_713116_+	U32 family peptidase	NA	NA	NA	NA	NA
WP_010011784.1|713117_714341_+	U32 family peptidase	NA	Q6DW11	Phage_TP	32.6	8.8e-41
WP_010011782.1|714711_718302_+	DNA-directed RNA polymerase subunit beta	NA	A0A1B1ISA9	uncultured_Mediterranean_phage	25.0	3.1e-49
WP_003679858.1|718314_721962_+	DNA-directed RNA polymerase subunit beta'	NA	R4TQM7	Phaeocystis_globosa_virus	25.3	4.3e-67
WP_099235908.1|722147_723515_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 7
NZ_CP017713	Lactobacillus coryniformis subsp. coryniformis KCTC 3167 = DSM 20001 chromosome, complete genome	2951508	755186	812842	2951508	transposase,tRNA	Streptococcus_phage(56.52%)	59	NA	NA
WP_010011746.1|755186_755972_+|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_003679352.1|756105_756549_+	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_003679350.1|756562_756958_+	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_137601667.1|758399_758621_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_010011744.1|759125_759323_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_010011742.1|759403_759796_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_010011741.1|760078_761503_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_099267112.1|762068_763142_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.2	7.5e-44
WP_010011737.1|763457_764753_-	arsenic transporter	NA	A0A2H4PQU3	Staphylococcus_phage	63.0	1.8e-145
WP_010011736.1|764809_766540_-	arsenical pump-driving ATPase	NA	NA	NA	NA	NA
WP_010011734.1|766623_766986_-	arsenite efflux transporter metallochaperone ArsD	NA	NA	NA	NA	NA
WP_010011732.1|766972_767323_-	winged helix-turn-helix transcriptional regulator	NA	A0A2H4PQT4	Staphylococcus_phage	42.3	4.6e-19
WP_010011731.1|767622_768516_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	31.4	2.5e-24
WP_010011730.1|768512_769187_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_010011729.1|769289_770561_-	conjugal transfer protein	NA	A0A1S5SF22	Streptococcus_phage	40.6	2.7e-56
WP_010011728.1|770888_771194_-	hypothetical protein	NA	NA	NA	NA	NA
WP_056943271.1|771195_772191_-	lysozyme family protein	NA	A0A1S5SEZ8	Streptococcus_phage	58.7	7.8e-104
WP_056943272.1|772187_774227_-	hypothetical protein	NA	A0A1S5SF30	Streptococcus_phage	51.5	7.3e-149
WP_010011725.1|774227_776681_-	ATP-binding protein	NA	A0A1S5SF64	Streptococcus_phage	66.5	0.0e+00
WP_010011724.1|776677_777058_-	conjugal transfer protein	NA	A0A1S5SEX7	Streptococcus_phage	67.2	2.7e-41
WP_003678269.1|777125_777629_-	antirestriction protein ArdA	NA	NA	NA	NA	NA
WP_003678268.1|777654_777876_-	hypothetical protein	NA	A0A1S5SEY0	Streptococcus_phage	83.6	4.9e-27
WP_003678263.1|777899_778622_-	site-specific DNA-methyltransferase	NA	A0A2K8IKC3	Lactococcus_phage	54.3	2.0e-69
WP_010011722.1|778763_779057_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010011721.1|779049_779370_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010011720.1|779366_780566_-	replication initiation factor domain-containing protein	NA	A0A1S5SEX3	Streptococcus_phage	45.2	1.5e-93
WP_056943273.1|780877_782707_+	RNA-directed DNA polymerase	NA	NA	NA	NA	NA
WP_010011717.1|782758_783019_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010011716.1|783058_784426_-	DNA translocase FtsK	NA	A0A1S5SFB5	Streptococcus_phage	61.0	2.3e-146
WP_010011715.1|784454_784715_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010011713.1|784801_785644_-	nucleotidyl transferase AbiEii/AbiGii toxin family protein	NA	NA	NA	NA	NA
WP_003678254.1|785640_786234_-	abortive infection protein	NA	NA	NA	NA	NA
WP_056943274.1|786394_786763_-	YdcP family protein	NA	A0A1S5SF96	Streptococcus_phage	48.4	5.9e-25
WP_056943275.1|786781_787114_-	YdcP family protein	NA	A0A1S5SF38	Streptococcus_phage	41.7	5.0e-15
WP_056943276.1|787146_787413_-	hypothetical protein	NA	NA	NA	NA	NA
WP_056943277.1|787409_791318_-	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_099267113.1|791908_793201_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	31.7	9.3e-49
WP_099267114.1|793287_794211_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	30.9	8.2e-31
WP_169925062.1|794317_795349_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	34.4	8.8e-42
WP_010011708.1|795500_795965_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010011707.1|796054_796390_+	thiol reductase thioredoxin	NA	A0A1X9I9P5	Staphylococcus_phage	33.7	9.2e-09
WP_010011706.1|796382_796901_+	transcription repressor NadR	NA	NA	NA	NA	NA
WP_003677967.1|796951_797221_-	30S ribosomal protein S14	NA	NA	NA	NA	NA
WP_010011705.1|797428_798616_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	24.7	9.6e-08
WP_010011703.1|798716_799097_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010011702.1|799099_800233_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010011701.1|800242_800455_+	hypothetical protein	NA	NA	NA	NA	NA
WP_141707562.1|800491_801445_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_010011699.1|801383_801752_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003677962.1|802016_802550_-	serine O-acetyltransferase	NA	NA	NA	NA	NA
WP_010011695.1|802585_803725_-	aminotransferase class V-fold PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_010011694.1|803743_804652_-	cysteine synthase family protein	NA	A0A1X9I5K7	Streptococcus_phage	43.8	1.3e-65
WP_010011693.1|805034_805907_-	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_010011692.1|805906_806398_-	ECF transporter S component	NA	NA	NA	NA	NA
WP_029508052.1|806608_807199_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_010011688.1|807349_808462_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	31.9	9.2e-13
WP_010011687.1|808501_809494_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_010011686.1|809546_810821_-	O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase	NA	NA	NA	NA	NA
WP_099267116.1|811519_812842_+|transposase	IS1380 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	38.0	2.9e-74
>prophage 8
NZ_CP017713	Lactobacillus coryniformis subsp. coryniformis KCTC 3167 = DSM 20001 chromosome, complete genome	2951508	889602	940395	2951508	transposase,tRNA,integrase	unidentified_phage(20.0%)	40	924248:924265	940530:940547
WP_010010173.1|889602_890892_+|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_010010172.1|890888_891806_+	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
WP_003677068.1|891930_892905_+	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_003677066.1|892962_894255_+	glutamate-1-semialdehyde 2,1-aminomutase	NA	NA	NA	NA	NA
WP_010010171.1|894261_894990_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003677060.1|894989_895580_+	bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase	NA	NA	NA	NA	NA
WP_010010170.1|895594_896356_+	adenosylcobinamide-GDP ribazoletransferase	NA	NA	NA	NA	NA
WP_003677055.1|896352_896937_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_010010169.1|896953_897652_+	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
WP_157769834.1|898097_898424_-	DUF3899 domain-containing protein	NA	NA	NA	NA	NA
WP_010010165.1|898681_900157_+	ABC transporter substrate-binding protein/permease	NA	NA	NA	NA	NA
WP_056943246.1|900201_901362_-	M20 family metallopeptidase	NA	NA	NA	NA	NA
WP_099267119.1|901707_903000_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_169925060.1|903107_904136_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	33.2	3.3e-41
WP_035457968.1|904432_905074_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_099267120.1|905273_906197_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	30.3	9.0e-30
WP_010009069.1|907718_908594_+	xanthine dehydrogenase FAD-binding subunit XdhB	NA	NA	NA	NA	NA
WP_010009067.1|908596_909064_+	(2Fe-2S)-binding protein	NA	NA	NA	NA	NA
WP_010009065.1|909102_910437_+	purine/pyrimidine permease	NA	Q9KX94	Enterobacteria_phage	25.9	4.2e-20
WP_010009063.1|910455_910926_+	nucleoside deaminase	NA	NA	NA	NA	NA
WP_010009060.1|911284_912670_+	purine permease	NA	NA	NA	NA	NA
WP_003678580.1|913914_914625_-	glucosamine-6-phosphate deaminase	NA	NA	NA	NA	NA
WP_003678579.1|914849_916640_+	PTS mannitol transporter subunit IICBA	NA	NA	NA	NA	NA
WP_003678578.1|916702_918808_+	transcription antiterminator	NA	NA	NA	NA	NA
WP_003678576.1|918804_919248_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_003678574.1|919249_920404_+	mannitol-1-phosphate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_003678573.1|920599_921289_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	39.4	2.6e-37
WP_010009056.1|921315_922467_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	28.3	1.2e-26
WP_169925063.1|922699_924145_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A1X9I6E7	Streptococcus_phage	27.7	3.4e-07
924248:924265	attL	GGTACGTTTGACAGTACC	NA	NA	NA	NA
WP_099267187.1|924330_925545_+	D-alanyl-D-alanine carboxypeptidase	NA	NA	NA	NA	NA
WP_010009054.1|925813_927361_+	UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2, 6-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_191978481.1|927357_928623_+	carboxylate--amine ligase	NA	NA	NA	NA	NA
WP_003678568.1|928622_929336_+	amino acid racemase	NA	NA	NA	NA	NA
WP_099267122.1|930443_931814_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_010011938.1|932493_933291_-	2-keto-4-pentenoate hydratase	NA	NA	NA	NA	NA
WP_010011936.1|933691_934885_-	class I SAM-dependent methyltransferase	NA	A0A2K9L4K8	Tupanvirus	34.3	6.8e-46
WP_029508064.1|935425_936715_+	pyrimidine-nucleoside phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	31.6	2.8e-45
WP_010011933.1|936850_937498_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	35.4	1.6e-20
WP_003678562.1|937494_938250_+	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
WP_056943358.1|938946_940395_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A1X9I6E7	Streptococcus_phage	25.7	2.4e-08
940530:940547	attR	GGTACGTTTGACAGTACC	NA	NA	NA	NA
>prophage 9
NZ_CP017713	Lactobacillus coryniformis subsp. coryniformis KCTC 3167 = DSM 20001 chromosome, complete genome	2951508	1075172	1136857	2951508	transposase,tRNA	Streptococcus_phage(22.73%)	60	NA	NA
WP_010009484.1|1075172_1076579_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	30.9	2.7e-49
WP_010009486.1|1076578_1076998_+	Mini-ribonuclease 3	NA	NA	NA	NA	NA
WP_010009487.1|1076981_1077764_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_010009489.1|1077760_1078288_+	NYN domain-containing protein	NA	NA	NA	NA	NA
WP_010009490.1|1078379_1078958_+	DNA-directed RNA polymerase sigma-70 factor	NA	NA	NA	NA	NA
WP_010009493.1|1079062_1079269_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010009494.1|1079457_1079910_+	CopY/TcrY family copper transport repressor	NA	NA	NA	NA	NA
WP_010009495.1|1080167_1082213_+	copper-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	30.1	4.9e-60
WP_010009497.1|1082431_1084648_+	anaerobic ribonucleoside-triphosphate reductase	NA	A0A0C5KKX3	Enterococcus_phage	62.8	7.9e-274
WP_010009498.1|1084752_1085334_+	anaerobic ribonucleoside-triphosphate reductase activating protein	NA	A0A0C5K925	Enterococcus_phage	53.1	7.1e-49
WP_164512712.1|1085673_1086702_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	33.5	1.1e-41
WP_169925046.1|1086783_1087122_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010009500.1|1087402_1087906_-	monooxygenase	NA	NA	NA	NA	NA
WP_003680740.1|1088099_1088843_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_010009501.1|1089225_1089624_+	transcriptional regulator Spx	NA	NA	NA	NA	NA
WP_010009502.1|1089832_1090546_+	adaptor protein MecA	NA	NA	NA	NA	NA
WP_003678413.1|1090638_1091625_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A096XT60	Enterococcus_phage	65.2	1.6e-117
WP_010009504.1|1091682_1093854_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	60.1	5.8e-253
WP_010009506.1|1093988_1094216_-	glutaredoxin-like protein NrdH	NA	X2KRY7	Enterococcus_phage	55.8	1.8e-11
WP_010009507.1|1094490_1095099_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_010009508.1|1095170_1095515_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010009509.1|1095580_1096420_+	aldo/keto reductase	NA	NA	NA	NA	NA
WP_010009511.1|1096477_1097005_+	nucleoside deaminase	NA	A0A2H4PQS8	Staphylococcus_phage	32.5	4.4e-05
WP_010009515.1|1097486_1099187_+	DNA polymerase III subunit gamma/tau	NA	E7DN81	Pneumococcus_phage	37.9	9.7e-54
WP_010009516.1|1099216_1099528_+	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_003678406.1|1099761_1100358_+	recombination protein RecR	NA	NA	NA	NA	NA
WP_010009517.1|1100526_1100796_+	YaaL family protein	NA	NA	NA	NA	NA
WP_010009518.1|1101057_1101699_+	dTMP kinase	NA	M1PSC7	Streptococcus_phage	51.9	2.9e-51
WP_003678402.1|1101763_1102093_+	cyclic-di-AMP receptor	NA	NA	NA	NA	NA
WP_050781689.1|1102102_1103077_+	DNA polymerase III subunit delta'	NA	E7DN81	Pneumococcus_phage	30.3	2.4e-09
WP_010009521.1|1103357_1104149_+	stage 0 sporulation family protein	NA	NA	NA	NA	NA
WP_003678395.1|1104312_1104672_+	DNA replication initiation control protein YabA	NA	NA	NA	NA	NA
WP_056943296.1|1104786_1105656_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	54.2	7.8e-76
WP_010009522.1|1105706_1106450_+	acyl-ACP thioesterase	NA	NA	NA	NA	NA
WP_176720060.1|1106803_1107436_+	sugar transferase	NA	NA	NA	NA	NA
WP_010009525.1|1107506_1108271_+	DUF4422 domain-containing protein	NA	NA	NA	NA	NA
WP_169925064.1|1108453_1109482_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	33.5	8.8e-42
WP_029507962.1|1109672_1110743_+	CDP-glycerol--glycerophosphate glycerophosphotransferase	NA	NA	NA	NA	NA
WP_010009527.1|1110891_1111509_+	chain-length determining protein	NA	NA	NA	NA	NA
WP_010009529.1|1111544_1112924_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003678381.1|1113017_1113428_+	glycerol-3-phosphate cytidylyltransferase	NA	A0A1V0SGE7	Hokovirus	40.3	3.3e-16
WP_010009531.1|1113493_1114588_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_010009532.1|1114600_1115491_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_156403532.1|1115905_1118614_+	sulfatase-like hydrolase/transferase	NA	NA	NA	NA	NA
WP_010009602.1|1118685_1120767_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003681017.1|1120908_1121814_+	EpsIIB, glycosyltransferase	NA	NA	NA	NA	NA
WP_099267127.1|1122075_1123068_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	34.3	1.3e-39
WP_056943351.1|1123181_1123367_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003680852.1|1123363_1124122_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_099267128.1|1124108_1125671_-|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	34.0	1.4e-70
WP_141707550.1|1125968_1126319_+	KxYKxGKxW signal peptide domain-containing protein	NA	NA	NA	NA	NA
WP_099267129.1|1126496_1127807_-|transposase	IS1380 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	54.1	7.8e-128
WP_145955956.1|1128032_1130285_+	SH3-like domain-containing protein	NA	F8J1A5	Lactobacillus_virus	30.0	2.8e-16
WP_081455889.1|1130517_1131999_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003679926.1|1132018_1133014_+	glycosyltransferase family 2 protein	NA	A8CG95	Salmonella_phage	38.0	1.1e-49
WP_003679924.1|1133054_1134221_+	acyltransferase family protein	NA	NA	NA	NA	NA
WP_010009869.1|1134295_1134787_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029507971.1|1134878_1135283_-	GtrA family protein	NA	NA	NA	NA	NA
WP_010009867.1|1135421_1136354_+	glycosyltransferase family 2 protein	NA	V5USA4	Oenococcus_phage	50.2	3.3e-80
WP_081455888.1|1136632_1136857_-|transposase	transposase	transposase	A0A1X9I6F6	Streptococcus_phage	47.9	3.5e-12
>prophage 10
NZ_CP017713	Lactobacillus coryniformis subsp. coryniformis KCTC 3167 = DSM 20001 chromosome, complete genome	2951508	1273854	1320855	2951508	transposase,lysis,tRNA,integrase	Orpheovirus(11.11%)	41	1289109:1289126	1330037:1330054
WP_010009724.1|1273854_1276647_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A2I2L3Y0	Orpheovirus	27.1	1.2e-90
WP_010009722.1|1276883_1277861_+	diaminopimelate epimerase	NA	NA	NA	NA	NA
WP_029507967.1|1277930_1279373_+	MFS transporter	NA	NA	NA	NA	NA
WP_010009715.1|1279418_1280606_-	toxic anion resistance protein	NA	A0A291I9K4	Lactobacillus_phage	28.3	4.1e-35
WP_010009714.1|1280595_1281303_-|lysis	5-bromo-4-chloroindolyl phosphate hydrolysis family protein	lysis	NA	NA	NA	NA
WP_010009712.1|1281499_1282039_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_010009710.1|1282136_1282391_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003677504.1|1282488_1283181_+	5'-methylthioadenosine/adenosylhomocysteine nucleosidase	NA	NA	NA	NA	NA
WP_003677506.1|1283252_1284413_+	cysteine desulfurase	NA	NA	NA	NA	NA
WP_003677507.1|1284531_1284873_+	DUF1831 domain-containing protein	NA	NA	NA	NA	NA
WP_003677509.1|1285188_1286313_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_010009707.1|1286422_1287082_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_003677513.1|1287090_1287747_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_010009706.1|1287756_1290258_+	ATP-dependent RecD-like DNA helicase	NA	A0A1P8DII4	Virus_Rctr197k	30.5	4.3e-42
1289109:1289126	attL	CTTATTGATCATTGATGA	NA	NA	NA	NA
WP_003677517.1|1290284_1291247_-	diacylglycerol kinase family lipid kinase	NA	NA	NA	NA	NA
WP_003677518.1|1291331_1293014_-	ribonuclease J	NA	NA	NA	NA	NA
WP_010009705.1|1292988_1293228_-	DNA-dependent RNA polymerase auxiliary subunit epsilon family protein	NA	NA	NA	NA	NA
WP_056943362.1|1293566_1294736_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_010009702.1|1295399_1295906_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003677521.1|1295953_1296511_-	peptide deformylase	NA	A0A2I7S809	Vibrio_phage	37.0	6.9e-09
WP_003677522.1|1296826_1297753_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010009699.1|1297749_1298028_+	UPF0223 family protein	NA	NA	NA	NA	NA
WP_003677524.1|1298037_1298817_+	inositol monophosphatase family protein	NA	NA	NA	NA	NA
WP_099267131.1|1299414_1301262_+	translational GTPase TypA	NA	NA	NA	NA	NA
WP_010009696.1|1301443_1301809_+	DUF1507 family protein	NA	NA	NA	NA	NA
WP_010009695.1|1301827_1303048_+	FtsW/RodA/SpoVE family cell cycle protein	NA	NA	NA	NA	NA
WP_010009693.1|1303074_1306530_+	pyruvate carboxylase	NA	NA	NA	NA	NA
WP_010009691.1|1306542_1306959_+	YlbF family regulator	NA	NA	NA	NA	NA
WP_010009689.1|1307020_1307359_+	YlbG family protein	NA	NA	NA	NA	NA
WP_010009687.1|1307362_1307932_+	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
WP_010009685.1|1307921_1308419_+	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	35.4	9.2e-21
WP_010009683.1|1308421_1309453_+	PDZ domain-containing protein	NA	NA	NA	NA	NA
WP_099267122.1|1309551_1310922_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_099267101.1|1311212_1312661_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A1X9I6E7	Streptococcus_phage	26.3	8.1e-09
WP_035456922.1|1312836_1313514_+	helix-hairpin-helix domain-containing protein	NA	NA	NA	NA	NA
WP_010009681.1|1313880_1314372_+	ComE operon protein 2	NA	A7KUY9	Bacillus_phage	58.3	3.8e-35
WP_010009680.1|1314381_1316595_+	DNA internalization-related competence protein ComEC/Rec2	NA	Q0H255	Geobacillus_phage	35.2	2.2e-29
WP_003680528.1|1316694_1317720_+	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
WP_010009676.1|1317770_1318025_-	30S ribosomal protein S20	NA	NA	NA	NA	NA
WP_099267132.1|1318248_1319616_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_099267133.1|1319829_1320855_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.4	7.4e-41
1330037:1330054	attR	TCATCAATGATCAATAAG	NA	NA	NA	NA
>prophage 11
NZ_CP017713	Lactobacillus coryniformis subsp. coryniformis KCTC 3167 = DSM 20001 chromosome, complete genome	2951508	1337578	1346150	2951508		Synechococcus_phage(50.0%)	9	NA	NA
WP_010009660.1|1337578_1338064_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	40.1	1.1e-18
WP_010009658.1|1338056_1339175_+	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_010009657.1|1339174_1339903_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3FUQ7	Synechococcus_phage	38.1	7.8e-37
WP_010009656.1|1339889_1340135_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_010009655.1|1340137_1340818_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_010009654.1|1340814_1343013_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	42.0	6.7e-140
WP_010009652.1|1343006_1344434_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	34.7	2.6e-52
WP_010009651.1|1344549_1345584_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3FC27	Synechococcus_phage	42.6	3.8e-61
WP_010009649.1|1345580_1346150_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	38.3	3.7e-26
>prophage 12
NZ_CP017713	Lactobacillus coryniformis subsp. coryniformis KCTC 3167 = DSM 20001 chromosome, complete genome	2951508	1349817	1407814	2951508	transposase,tRNA,protease,integrase	Bacillus_phage(21.43%)	59	1352571:1352587	1390808:1390824
WP_169925048.1|1349817_1351347_+|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	31.3	1.9e-53
WP_035457969.1|1352473_1353823_-|transposase	transposase	transposase	NA	NA	NA	NA
1352571:1352587	attL	TTTTCACCTAGACCAGT	NA	NA	NA	NA
WP_003679950.1|1353956_1355903_-	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_010010113.1|1355929_1356847_-	1-phosphofructokinase	NA	NA	NA	NA	NA
WP_010010112.1|1356843_1357599_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	32.3	1.1e-22
WP_003679956.1|1358190_1359486_+	GTPase ObgE	NA	NA	NA	NA	NA
WP_010010111.1|1359518_1361411_+	acetyltransferase	NA	A0A1R3Y5Q6	Salmonella_virus	27.9	1.9e-29
WP_010010110.1|1361560_1362247_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.5	7.2e-32
WP_099267194.1|1362252_1363563_+	histidine kinase	NA	W8CYF6	Bacillus_phage	33.2	1.6e-27
WP_003680309.1|1364291_1365245_+	ribonuclease Z	NA	NA	NA	NA	NA
WP_010010106.1|1365269_1366061_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_010010105.1|1366145_1366517_+	LapA family protein	NA	NA	NA	NA	NA
WP_010010103.1|1366579_1368916_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	31.0	3.0e-74
WP_003680303.1|1368905_1369424_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	41.3	4.9e-25
WP_010010102.1|1369801_1370968_-	hydroxymethylglutaryl-CoA synthase	NA	NA	NA	NA	NA
WP_010010101.1|1371002_1371404_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035457700.1|1371572_1371914_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035457699.1|1372090_1372327_+	cytochrome b5	NA	NA	NA	NA	NA
WP_099267134.1|1372474_1374028_+	flavocytochrome c	NA	A0A2P0ZL82	Lactobacillus_phage	30.2	1.1e-51
WP_029507982.1|1374403_1375732_+	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_010010095.1|1375832_1376777_+	DMT family transporter	NA	NA	NA	NA	NA
WP_010010094.1|1376858_1377698_+	aldo/keto reductase	NA	NA	NA	NA	NA
WP_056943291.1|1377780_1378287_+	O-acetyl-ADP-ribose deacetylase	NA	A0A0K1L687	Scale_drop_disease_virus	59.4	1.4e-37
WP_010010092.1|1379352_1379616_+	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	NA	NA	NA	NA
WP_035457574.1|1380057_1380270_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010010089.1|1380446_1380785_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_169925066.1|1380957_1382403_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A1X9I6E7	Streptococcus_phage	27.2	9.9e-07
WP_010010088.1|1382546_1383563_+	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_010010087.1|1383658_1384510_+	glycosyltransferase family 8 protein	NA	NA	NA	NA	NA
WP_010010086.1|1384484_1385006_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003679889.1|1385002_1385458_+	nucleoside 2-deoxyribosyltransferase	NA	A0A2K9L7B8	Tupanvirus	40.5	4.0e-15
WP_029507980.1|1385487_1386069_+	TIGR00730 family Rossman fold protein	NA	NA	NA	NA	NA
WP_004562637.1|1386230_1387091_+	sugar transporter	NA	NA	NA	NA	NA
WP_004562639.1|1387117_1387996_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010010082.1|1388287_1388536_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010010081.1|1388685_1388868_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157769840.1|1388942_1389278_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099267136.1|1389571_1390921_+|transposase	transposase	transposase	NA	NA	NA	NA
1390808:1390824	attR	ACTGGTCTAGGTGAAAA	NA	NA	NA	NA
WP_010010079.1|1391454_1392528_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010010078.1|1392541_1392913_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003677044.1|1392958_1393396_-	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_010010077.1|1393581_1394361_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_010010075.1|1394367_1394991_+	hydrolase	NA	NA	NA	NA	NA
WP_010010074.1|1395161_1395350_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003677037.1|1395397_1396018_-	transcriptional repressor LexA	NA	A0A0N9RTK0	Paenibacillus_phage	34.6	5.0e-08
WP_035456688.1|1396171_1396408_+	DUF896 domain-containing protein	NA	NA	NA	NA	NA
WP_099267122.1|1396506_1397877_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_010010068.1|1398066_1398285_+	YneF family protein	NA	NA	NA	NA	NA
WP_010010067.1|1398320_1398935_-	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_056943264.1|1399046_1399784_+|tRNA	tRNA1(Val) (adenine(37)-N6)-methyltransferase	tRNA	NA	NA	NA	NA
WP_010010064.1|1399770_1400055_+	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_003677032.1|1400143_1401136_+	D-2-hydroxyacid dehydrogenase	NA	M1H9J0	Paramecium_bursaria_Chlorella_virus	35.0	7.9e-48
WP_003677030.1|1401372_1402197_+	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_003677027.1|1402460_1403345_+	elongation factor Ts	NA	NA	NA	NA	NA
WP_003677024.1|1403481_1404207_+	UMP kinase	NA	NA	NA	NA	NA
WP_010010062.1|1404208_1404769_+	ribosome recycling factor	NA	NA	NA	NA	NA
WP_003677021.1|1404907_1405672_+	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	42.0	6.3e-21
WP_003677019.1|1405709_1406492_+	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_003677017.1|1406539_1407814_+|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
>prophage 13
NZ_CP017713	Lactobacillus coryniformis subsp. coryniformis KCTC 3167 = DSM 20001 chromosome, complete genome	2951508	1521629	1529213	2951508	tRNA	Staphylococcus_phage(33.33%)	7	NA	NA
WP_003680513.1|1521629_1522499_-	YitT family protein	NA	M1Q1P6	Streptococcus_phage	39.5	4.0e-56
WP_029507975.1|1522689_1523478_+	4-hydroxy-tetrahydrodipicolinate reductase	NA	NA	NA	NA	NA
WP_010009965.1|1523474_1524677_+|tRNA	CCA tRNA nucleotidyltransferase	tRNA	H7BUW3	unidentified_phage	51.2	1.6e-47
WP_010009964.1|1524796_1526686_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	29.7	1.1e-50
WP_029507974.1|1526708_1527659_+	thymidylate synthase	NA	A0A0N9SH48	Staphylococcus_phage	64.6	4.3e-120
WP_003679735.1|1527710_1528211_+	dihydrofolate reductase	NA	A0A217ER00	Bacillus_phage	33.7	1.2e-23
WP_003679736.1|1528367_1529213_+	DegV family protein	NA	A0A0N9SI50	Staphylococcus_phage	40.6	1.3e-19
>prophage 14
NZ_CP017713	Lactobacillus coryniformis subsp. coryniformis KCTC 3167 = DSM 20001 chromosome, complete genome	2951508	1823765	1891022	2951508	bacteriocin,tRNA,transposase	Staphylococcus_phage(18.18%)	60	NA	NA
WP_003680060.1|1823765_1825457_-|tRNA	arginine--tRNA ligase	tRNA	A0A2I2L3K1	Orpheovirus	33.5	2.2e-74
WP_003680063.1|1825767_1826478_-	VIT family protein	NA	NA	NA	NA	NA
WP_010010988.1|1826718_1827510_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010010987.1|1827927_1828662_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_029508020.1|1828701_1830426_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	43.3	2.5e-121
WP_010010985.1|1830639_1831029_+	DUF1648 domain-containing protein	NA	NA	NA	NA	NA
WP_010010984.1|1831086_1831365_+	SdpI family protein	NA	NA	NA	NA	NA
WP_010010983.1|1831488_1831821_-	DUF1648 domain-containing protein	NA	NA	NA	NA	NA
WP_010010982.1|1833639_1834449_+	ATP-binding cassette domain-containing protein	NA	A0A2R8FG22	Brazilian_cedratvirus	24.0	5.5e-07
WP_010010981.1|1834475_1835201_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081455904.1|1835482_1835962_+	nucleotidyltransferase family protein	NA	NA	NA	NA	NA
WP_010010975.1|1835962_1836460_-	kinase	NA	NA	NA	NA	NA
WP_029508019.1|1836591_1837458_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004562604.1|1837494_1837914_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010010973.1|1838164_1839184_+	aldehyde reductase	NA	M1NML0	Moumouvirus	31.0	5.9e-06
WP_004562607.1|1839698_1841075_+	branched-chain amino acid transport system II carrier protein	NA	NA	NA	NA	NA
WP_010010970.1|1841182_1841716_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010010969.1|1841762_1842074_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_010010968.1|1842094_1842241_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010010967.1|1842263_1842548_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_010010965.1|1842706_1843549_-	ParA family protein	NA	NA	NA	NA	NA
WP_010010964.1|1843646_1844138_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_010010963.1|1844302_1844875_+	methylphosphotriester-DNA--protein-cysteine methyltransferase family protein	NA	NA	NA	NA	NA
WP_010010962.1|1844858_1845515_+	deoxyribonuclease I	NA	NA	NA	NA	NA
WP_029508017.1|1845548_1846643_-	glycerate kinase	NA	NA	NA	NA	NA
WP_010010960.1|1848667_1850059_-	cation:dicarboxylase symporter family transporter	NA	NA	NA	NA	NA
WP_010010958.1|1850776_1851370_+	TVP38/TMEM64 family protein	NA	M1Q152	Streptococcus_phage	35.1	7.6e-30
WP_056943334.1|1851446_1852607_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_004562613.1|1853162_1854665_-	ABC-F type ribosomal protection protein	NA	A0A1V0SGN0	Hokovirus	25.9	1.0e-14
WP_010010955.1|1854906_1855740_-	NAD(P)H-hydrate dehydratase	NA	NA	NA	NA	NA
WP_169925050.1|1855825_1856242_-	hypothetical protein	NA	NA	NA	NA	NA
WP_169925067.1|1856316_1857345_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	33.8	3.9e-42
WP_003680825.1|1857808_1858171_+	DUF1304 domain-containing protein	NA	NA	NA	NA	NA
WP_003680827.1|1858205_1858676_-	universal stress protein	NA	NA	NA	NA	NA
WP_010010953.1|1858772_1859330_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010010952.1|1859533_1859938_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035446519.1|1860002_1860215_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003680600.1|1860652_1861405_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_003680601.1|1861451_1862930_-	MFS transporter	NA	NA	NA	NA	NA
WP_010010945.1|1863122_1863473_+	HIRAN domain-containing protein	NA	NA	NA	NA	NA
WP_010010944.1|1863666_1864068_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010010943.1|1864145_1864967_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_010010942.1|1865059_1865278_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010010941.1|1865331_1865919_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010010940.1|1865911_1866370_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010010939.1|1866442_1867756_-	MFS transporter	NA	NA	NA	NA	NA
WP_010010937.1|1867819_1868341_-	GrpB family protein	NA	A0A2K5B2B6	Erysipelothrix_phage	31.7	1.5e-13
WP_003680176.1|1868391_1869117_-	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_003680178.1|1869126_1870758_-	oligosaccharide flippase family protein	NA	NA	NA	NA	NA
WP_010010936.1|1870935_1871367_+	universal stress protein	NA	NA	NA	NA	NA
WP_099267146.1|1871621_1872959_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_003680180.1|1873170_1875591_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	71.4	0.0e+00
WP_010500113.1|1876010_1876889_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_056943298.1|1876960_1877623_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_010010933.1|1877619_1879092_-	MFS transporter	NA	NA	NA	NA	NA
WP_003680443.1|1879179_1880367_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	67.8	5.4e-144
WP_010011645.1|1887975_1888356_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010011646.1|1888457_1888829_-	S1 RNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_003678941.1|1889045_1889630_-	peptidylprolyl isomerase	NA	A0A1V0S9I2	Catovirus	41.0	1.2e-24
WP_099267088.1|1889843_1891022_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
>prophage 15
NZ_CP017713	Lactobacillus coryniformis subsp. coryniformis KCTC 3167 = DSM 20001 chromosome, complete genome	2951508	1954732	2008407	2951508	tRNA,tail,plate,protease,integrase,transposase	Lactobacillus_phage(42.11%)	47	1954334:1954349	2012822:2012837
1954334:1954349	attL	CATCTAAGCCTAAATA	NA	NA	NA	NA
WP_010010664.1|1954732_1957375_-|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	33.6	2.2e-60
WP_010010665.1|1957720_1958707_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003678647.1|1958732_1960082_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	31.9	1.1e-47
WP_003678649.1|1960309_1961263_-	bifunctional oligoribonuclease/PAP phosphatase NrnA	NA	NA	NA	NA	NA
WP_010010666.1|1961265_1962579_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_010010667.1|1962666_1963803_-	DNA polymerase IV	NA	NA	NA	NA	NA
WP_010010668.1|1963941_1965444_-	glucose-6-phosphate dehydrogenase	NA	M4SP85	Cyanophage	34.4	4.4e-74
WP_010010669.1|1965572_1968194_-	bifunctional acetaldehyde-CoA/alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_003678499.1|1970446_1970878_-	preprotein translocase subunit YajC	NA	NA	NA	NA	NA
WP_003678498.1|1970954_1972097_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	42.7	6.7e-83
WP_029508007.1|1972504_1973539_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_010010673.1|1973593_1974613_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	28.3	1.8e-07
WP_010010674.1|1974646_1975258_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_010010675.1|1975467_1976037_-	septum formation protein Maf	NA	NA	NA	NA	NA
WP_010010677.1|1976033_1977971_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	29.9	4.3e-58
WP_010010678.1|1978094_1980740_-	DNA mismatch repair protein MutS	NA	A0A1V0SGG8	Hokovirus	22.8	2.5e-32
WP_010010679.1|1980951_1981317_-	YlbF family regulator	NA	NA	NA	NA	NA
WP_003678490.1|1981337_1982147_-	TIGR00282 family metallophosphoesterase	NA	NA	NA	NA	NA
WP_010010680.1|1982246_1984073_-	APC family permease	NA	NA	NA	NA	NA
WP_003678487.1|1984330_1985971_-	chaperonin GroEL	NA	A0A240F766	uncultured_virus	54.2	3.2e-155
WP_010010682.1|1986152_1986437_-	co-chaperone GroES	NA	A0A221S386	uncultured_virus	46.2	7.3e-15
WP_010010683.1|1986625_1987261_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_010010686.1|1988801_1989395_-	collagen-like protein	NA	A0A2P0ZL67	Lactobacillus_phage	42.3	1.2e-14
WP_099267197.1|1989399_1989852_-	hypothetical protein	NA	A0A075KL04	Lactobacillus_phage	34.8	4.1e-12
WP_010010691.1|1991846_1992209_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099267198.1|1992201_1992555_-	hypothetical protein	NA	D6PSR9	Lactobacillus_phage	47.4	1.2e-22
WP_010010693.1|1992674_1993298_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010010694.1|1993331_1993511_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010010696.1|1993513_1993744_-	XkdX family protein	NA	NA	NA	NA	NA
WP_010010698.1|1993743_1994118_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029508008.1|1994130_1994562_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010010700.1|1994605_1995058_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010010701.1|1995197_1995665_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003677555.1|1995785_1996811_-|plate	BppU family phage baseplate upper protein	plate	NA	NA	NA	NA
WP_035456932.1|1996811_1997255_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010010705.1|1998679_1999030_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010010706.1|1998980_2000129_-|tail	phage tail protein	tail	O03938	Lactobacillus_phage	43.8	1.8e-67
WP_010010708.1|2000142_2000967_-|tail	phage tail family protein	tail	D2KRB8	Lactobacillus_phage	36.4	4.1e-42
WP_056943312.1|2000966_2002283_-	hypothetical protein	NA	A0A2I6PER7	Staphylococcus_phage	42.8	1.1e-28
WP_099267122.1|2002388_2003759_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_010010118.1|2004034_2004196_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010010119.1|2004252_2004486_-	helix-turn-helix transcriptional regulator	NA	O03906	Lactobacillus_phage	48.6	8.4e-09
WP_010010122.1|2004676_2005066_+	helix-turn-helix transcriptional regulator	NA	O03970	Lactobacillus_phage	45.5	3.2e-21
WP_010010123.1|2005083_2005518_+	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_010010124.1|2005534_2006458_+	DUF4352 domain-containing protein	NA	Q9AZW5	Lactococcus_phage	42.1	4.6e-26
WP_010010125.1|2006530_2007094_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010010127.1|2007216_2008407_+|integrase	site-specific integrase	integrase	A0A0P0I3D2	Lactobacillus_phage	54.5	3.2e-112
2012822:2012837	attR	TATTTAGGCTTAGATG	NA	NA	NA	NA
>prophage 16
NZ_CP017713	Lactobacillus coryniformis subsp. coryniformis KCTC 3167 = DSM 20001 chromosome, complete genome	2951508	2027146	2084958	2951508	transposase,tRNA	unidentified_phage(30.0%)	42	NA	NA
WP_099267149.1|2027146_2028524_+|transposase	IS3 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	34.8	2.5e-23
WP_010010142.1|2028704_2030057_-	FAD-dependent oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	44.9	6.9e-103
WP_010010144.1|2030390_2031236_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_003678891.1|2031464_2032442_+	GMP reductase	NA	G3MBI2	Bacillus_virus	78.3	1.4e-145
WP_010010146.1|2032631_2033684_+	nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_010010147.1|2033699_2034077_-	PTS glucitol/sorbitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_010010148.1|2034287_2035319_+	lactonase family protein	NA	NA	NA	NA	NA
WP_176720053.1|2035345_2035981_+	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_040473077.1|2036134_2036662_-	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_010010152.1|2036661_2037096_-	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_176720052.1|2037237_2038596_-	magnesium transporter	NA	NA	NA	NA	NA
WP_010010154.1|2038623_2039514_-	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_010010155.1|2039510_2040326_-	NAD kinase	NA	NA	NA	NA	NA
WP_010500113.1|2041702_2042581_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_099267150.1|2042787_2043501_-	GTP pyrophosphokinase family protein	NA	NA	NA	NA	NA
WP_010500113.1|2043650_2044529_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_010010156.1|2044761_2045379_+	CYTH domain-containing protein	NA	NA	NA	NA	NA
WP_010010157.1|2045462_2046092_+	DsbA family protein	NA	NA	NA	NA	NA
WP_099267151.1|2046222_2047146_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	30.9	6.2e-31
WP_169925069.1|2047367_2048399_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	33.8	1.0e-42
WP_010010158.1|2048826_2050179_+	amino acid permease	NA	NA	NA	NA	NA
WP_010010159.1|2050266_2052444_-	alpha-galactosidase	NA	NA	NA	NA	NA
WP_010010160.1|2052558_2054238_-	alpha-glucosidase	NA	NA	NA	NA	NA
WP_003678873.1|2054255_2055116_-	ROK family protein	NA	NA	NA	NA	NA
WP_003678871.1|2055128_2057090_-	PTS beta-glucoside transporter subunit IIBCA	NA	NA	NA	NA	NA
WP_003678869.1|2057333_2058830_+	sucrose-6-phosphate hydrolase	NA	S6ATV4	Bacillus_phage	24.7	6.6e-14
WP_010010162.1|2058843_2059824_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	30.8	3.2e-25
WP_056943348.1|2066753_2068031_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	50.7	1.8e-92
WP_010009283.1|2068479_2069145_+	deoxynucleoside kinase	NA	C1KFI3	Lactobacillus_virus	45.9	6.2e-49
WP_099267122.1|2070290_2071661_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_010010587.1|2072264_2073770_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_010010588.1|2073868_2075332_-	amino acid permease	NA	NA	NA	NA	NA
WP_010010589.1|2075666_2076392_-	acetolactate decarboxylase	NA	NA	NA	NA	NA
WP_056943321.1|2076486_2078166_-	acetolactate synthase AlsS	NA	NA	NA	NA	NA
WP_010010593.1|2078468_2078615_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003679143.1|2078736_2079261_-	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_010010595.1|2079718_2080282_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010010596.1|2080391_2080931_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003679147.1|2081084_2081873_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_010010597.1|2082006_2082285_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010010598.1|2082262_2083156_-	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_164512712.1|2083929_2084958_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	33.5	1.1e-41
>prophage 17
NZ_CP017713	Lactobacillus coryniformis subsp. coryniformis KCTC 3167 = DSM 20001 chromosome, complete genome	2951508	2165580	2172402	2951508		Streptococcus_phage(33.33%)	8	NA	NA
WP_010009034.1|2165580_2166429_-	SDR family oxidoreductase	NA	A0A2N9QUX2	Trichoplusia_ni_ascovirus	41.4	4.4e-47
WP_010009033.1|2166511_2167084_-	DUF1211 domain-containing protein	NA	NA	NA	NA	NA
WP_010009031.1|2167228_2168215_+	zinc-binding dehydrogenase	NA	K7Z7U2	Megavirus	23.2	1.7e-05
WP_003678991.1|2168332_2168914_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	52.3	8.4e-50
WP_003678993.1|2168990_2169503_+	DsbA family protein	NA	NA	NA	NA	NA
WP_003678995.1|2169551_2170499_-	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	36.8	9.8e-48
WP_003678997.1|2170519_2171521_-	YvcK family protein	NA	A1IMD5	Streptococcus_phage	56.8	7.6e-99
WP_003679000.1|2171517_2172402_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	29.7	4.2e-08
>prophage 18
NZ_CP017713	Lactobacillus coryniformis subsp. coryniformis KCTC 3167 = DSM 20001 chromosome, complete genome	2951508	2244342	2298787	2951508	transposase,integrase	Streptococcus_phage(20.0%)	53	2245762:2245777	2291396:2291411
WP_099267102.1|2244342_2245665_+|transposase	IS1380 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	38.0	3.8e-74
2245762:2245777	attL	ATCAAACTAACTAAAT	NA	NA	NA	NA
WP_010008957.1|2245968_2247114_-	AI-2E family transporter	NA	NA	NA	NA	NA
WP_010008956.1|2247189_2248179_-	zinc-binding dehydrogenase	NA	NA	NA	NA	NA
WP_010008955.1|2248327_2248882_+	nitroreductase family protein	NA	NA	NA	NA	NA
WP_010008951.1|2251214_2252048_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_003680836.1|2252057_2252966_-	magnesium transporter CorA family protein	NA	NA	NA	NA	NA
WP_010008948.1|2253030_2253549_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_029507944.1|2253565_2253883_-	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_010012393.1|2254166_2254403_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099267157.1|2254545_2255469_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	30.6	1.4e-30
WP_010008944.1|2255905_2257291_-	amino acid permease	NA	NA	NA	NA	NA
WP_003680634.1|2257435_2257942_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003680883.1|2260676_2261378_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_081495540.1|2261435_2261627_-	phosphoglyceromutase	NA	NA	NA	NA	NA
WP_010008936.1|2261856_2262714_-	RNA-directed DNA polymerase	NA	NA	NA	NA	NA
WP_010008935.1|2262794_2263082_-	helix-turn-helix transcriptional regulator	NA	S5M5X8	Brevibacillus_phage	54.7	6.0e-17
WP_156403526.1|2263133_2263283_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010008934.1|2263601_2264750_-|integrase	tyrosine-type recombinase/integrase	integrase	Q4ZD55	Staphylococcus_phage	29.8	1.2e-26
WP_010008933.1|2264806_2265091_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010008932.1|2265112_2266741_-	primase	NA	A0A2I7QLM0	Vibrio_phage	29.3	3.8e-23
WP_010008930.1|2266721_2267084_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010008929.1|2267073_2267526_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010008927.1|2267539_2268682_-	DNA-directed DNA polymerase	NA	R4KLC5	uncultured_virus	25.8	1.7e-09
WP_010008925.1|2268929_2269775_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010008924.1|2269853_2270384_-	DUF1643 domain-containing protein	NA	NA	NA	NA	NA
WP_010008923.1|2270479_2270842_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010008922.1|2270831_2271308_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010008920.1|2271409_2271691_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010008919.1|2272016_2274827_+	class I SAM-dependent DNA methyltransferase	NA	Q6NE04	Leptospira_phage	35.4	2.0e-144
WP_010008918.1|2275272_2275962_-	2,3-diphosphoglycerate-dependent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_029507575.1|2276128_2276320_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010008916.1|2276285_2277506_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_003677794.1|2277985_2279026_-	AI-2E family transporter	NA	NA	NA	NA	NA
WP_010008914.1|2279150_2279813_-	type 1 glutamine amidotransferase	NA	NA	NA	NA	NA
WP_010008913.1|2279877_2280345_-	CinA family protein	NA	B5TK85	Pseudomonas_phage	32.0	1.2e-11
WP_010008912.1|2280752_2281082_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010008911.1|2281144_2282266_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_003677785.1|2282292_2283108_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010008908.1|2283538_2283829_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010008907.1|2283862_2284708_-	PTS system mannose/fructose/sorbose family transporter subunit IID	NA	NA	NA	NA	NA
WP_029507942.1|2284710_2285562_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_010008904.1|2285593_2286088_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_010008903.1|2286101_2286536_-	PTS fructose transporter subunit IIA	NA	NA	NA	NA	NA
WP_010008902.1|2287123_2289649_+	PRD domain-containing protein	NA	NA	NA	NA	NA
WP_099267158.1|2289889_2290315_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099267159.1|2290329_2291256_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_169925041.1|2291456_2291633_+	hypothetical protein	NA	NA	NA	NA	NA
2291396:2291411	attR	ATCAAACTAACTAAAT	NA	NA	NA	NA
WP_010011941.1|2291622_2291976_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_169925051.1|2292040_2293570_+|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	31.1	7.4e-53
WP_010011944.1|2294489_2294960_-	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_056943338.1|2294961_2295720_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_029508065.1|2295814_2297200_-	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_010011946.1|2297557_2298787_+|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	49.1	1.1e-83
>prophage 19
NZ_CP017713	Lactobacillus coryniformis subsp. coryniformis KCTC 3167 = DSM 20001 chromosome, complete genome	2951508	2376352	2452301	2951508	transposase	unidentified_phage(25.0%)	58	NA	NA
WP_056943250.1|2376352_2377543_+|transposase	IS110 family transposase	transposase	Q9JMN8	Wolbachia_phage	29.4	3.2e-35
WP_029508072.1|2377676_2380058_-	phosphoketolase family protein	NA	NA	NA	NA	NA
WP_010012027.1|2380243_2380975_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010012028.1|2381345_2382191_-	SDR family NAD(P)-dependent oxidoreductase	NA	A0A2P0VP75	Tetraselmis_virus	27.1	4.1e-05
WP_010012029.1|2382321_2383944_-	NAD-dependent malic enzyme	NA	NA	NA	NA	NA
WP_010012030.1|2384201_2384537_+	VOC family protein	NA	NA	NA	NA	NA
WP_010012032.1|2384847_2386590_+	pyruvate oxidase	NA	NA	NA	NA	NA
WP_010012033.1|2386687_2389606_-	glycoside hydrolase family 3 C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_010012060.1|2389769_2390786_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_056943251.1|2390797_2391298_-	GtrA family protein	NA	NA	NA	NA	NA
WP_010012061.1|2391297_2393709_-	glycoside hydrolase family 3 C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_010012062.1|2393878_2394583_+	response regulator transcription factor	NA	A0A2R2ZGH8	Clostridioides_phage	30.9	2.1e-26
WP_056943252.1|2394647_2395886_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_003678834.1|2395932_2396712_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_010012065.1|2396859_2398413_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_010012066.1|2398656_2399457_+	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_003678831.1|2399481_2400957_+	iron-sulfur cluster-binding protein	NA	NA	NA	NA	NA
WP_010012068.1|2400953_2401661_+	lactate utilization protein C	NA	NA	NA	NA	NA
WP_003678827.1|2401778_2402270_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010012069.1|2402506_2403283_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010012070.1|2403476_2404913_-	glutamate synthase subunit beta	NA	NA	NA	NA	NA
WP_010012071.1|2404934_2409389_-	glutamate synthase large subunit	NA	NA	NA	NA	NA
WP_010012073.1|2409636_2409852_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003677462.1|2410098_2410464_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003677459.1|2410656_2411817_-	cation:proton antiporter	NA	NA	NA	NA	NA
WP_010012075.1|2411923_2412811_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010012076.1|2413066_2413726_+	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_010012077.1|2413700_2414345_-	GyrI-like domain-containing protein	NA	NA	NA	NA	NA
WP_010012078.1|2414426_2414783_+	DUF488 family protein	NA	NA	NA	NA	NA
WP_010012079.1|2415005_2415407_+	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_010012081.1|2415502_2416210_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_139026548.1|2416185_2417085_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_010012084.1|2417155_2421469_-	2-hydroxyacyl-CoA dehydratase	NA	NA	NA	NA	NA
WP_003677444.1|2422189_2422798_+	TetR/AcrR family transcriptional regulator C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_003677443.1|2423076_2423883_+	tyrosine-protein phosphatase	NA	NA	NA	NA	NA
WP_003677441.1|2426764_2427727_+	sugar kinase	NA	NA	NA	NA	NA
WP_010012088.1|2427776_2428922_-	ArgE/DapE family deacylase	NA	NA	NA	NA	NA
WP_099267109.1|2429114_2430038_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	30.9	6.2e-31
WP_010012090.1|2430344_2431202_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_003677437.1|2431211_2431643_+	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_099267163.1|2433327_2434755_-	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_010012092.1|2434898_2435489_-	CvpA family protein	NA	NA	NA	NA	NA
WP_176720061.1|2435841_2437194_+	DUF21 domain-containing protein	NA	NA	NA	NA	NA
WP_010012094.1|2437363_2438512_+	LCP family protein	NA	NA	NA	NA	NA
WP_010012095.1|2438611_2439577_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_002822190.1|2439643_2440126_+	DNA starvation/stationary phase protection protein	NA	A0A2K9VCK5	Lactobacillus_phage	31.1	8.9e-13
WP_010012236.1|2440220_2440895_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_099267164.1|2440891_2441785_+|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	24.7	2.2e-12
WP_010012100.1|2441855_2442386_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_010012102.1|2442494_2442962_-	YbaK/EbsC family protein	NA	NA	NA	NA	NA
WP_010012104.1|2443109_2443790_+	deoxyribose-phosphate aldolase	NA	NA	NA	NA	NA
WP_010012105.1|2443838_2444567_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_056943327.1|2446403_2447366_-	2-hydroxyacid dehydrogenase family protein	NA	A0A2R8FCS0	Cedratvirus	33.1	1.1e-30
WP_010012112.1|2447447_2448479_-	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
WP_176720016.1|2448956_2450099_+	MFS transporter	NA	NA	NA	NA	NA
WP_029508075.1|2450116_2450599_+	nucleoside deaminase	NA	NA	NA	NA	NA
WP_010012116.1|2450635_2450830_-	hypothetical protein	NA	NA	NA	NA	NA
WP_169925064.1|2451272_2452301_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	33.5	8.8e-42
>prophage 20
NZ_CP017713	Lactobacillus coryniformis subsp. coryniformis KCTC 3167 = DSM 20001 chromosome, complete genome	2951508	2464458	2528705	2951508	transposase,integrase	Streptococcus_phage(27.27%)	53	2464339:2464398	2537880:2537998
2464339:2464398	attL	GGTACTGTCAAACGTACCTCGTTTTTGTTATTAATTTCCGAATATTAAAAAACACCCGAA	NA	NA	NA	NA
WP_169925070.1|2464458_2465889_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A1X9I6E7	Streptococcus_phage	27.7	1.5e-07
WP_050781713.1|2466125_2466821_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082602276.1|2466880_2467729_-	rhamnulose-1-phosphate aldolase	NA	NA	NA	NA	NA
WP_010012127.1|2467759_2469037_-	L-rhamnose isomerase	NA	NA	NA	NA	NA
WP_010012128.1|2469111_2469426_-	L-rhamnose mutarotase	NA	NA	NA	NA	NA
WP_010012129.1|2469489_2470944_-	rhamnulokinase	NA	NA	NA	NA	NA
WP_010012131.1|2473259_2474015_+	AraC family ligand binding domain-containing protein	NA	NA	NA	NA	NA
WP_010012133.1|2474058_2474805_-	ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	49.2	2.2e-58
WP_003680666.1|2474806_2476030_-|transposase	IS21 family transposase	transposase	A0A059NT83	Lactococcus_phage	48.8	3.4e-101
WP_010012135.1|2476061_2476415_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_010012136.1|2476671_2477793_+	NAD(P)-dependent alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_099267166.1|2478176_2479487_+|transposase	IS1380 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	54.3	2.1e-128
WP_010012139.1|2480341_2481463_+	NAD(P)-dependent alcohol dehydrogenase	NA	A0A2K9L7I1	Tupanvirus	29.3	2.0e-15
WP_010012140.1|2481724_2482033_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_040473149.1|2482241_2483552_-	glucarate dehydratase	NA	Q6A202	Oenococcus_phage	23.3	1.3e-05
WP_029508078.1|2483673_2485182_-	UxaA family hydrolase	NA	NA	NA	NA	NA
WP_010012143.1|2485193_2486333_-	glycerate kinase	NA	W6LM47	Streptococcus_phage	38.0	3.2e-37
WP_010012144.1|2486357_2487245_-	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
WP_010012145.1|2487283_2488609_-	glucarate dehydratase	NA	NA	NA	NA	NA
WP_010012147.1|2488683_2489574_-	2-hydroxy-3-oxopropionate reductase	NA	NA	NA	NA	NA
WP_010012148.1|2489689_2491021_-	citrate transporter	NA	NA	NA	NA	NA
WP_056943316.1|2491338_2492394_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_010500113.1|2492590_2493469_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_010012149.1|2493526_2494354_-	tyrosine-protein phosphatase	NA	NA	NA	NA	NA
WP_010012150.1|2494426_2495152_-	L-ribulose-5-phosphate 4-epimerase	NA	NA	NA	NA	NA
WP_010012151.1|2495144_2496017_-	L-ribulose-5-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_010012152.1|2496071_2496710_-	3-keto-L-gulonate-6-phosphate decarboxylase UlaD	NA	NA	NA	NA	NA
WP_010012153.1|2496766_2497837_-	PTS fructose transporter subunit IIC	NA	NA	NA	NA	NA
WP_010012154.1|2497873_2498191_-	PTS fructose transporter subunit IIB	NA	NA	NA	NA	NA
WP_010012155.1|2498192_2498663_-	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_010012157.1|2498999_2499890_-	decarboxylating 6-phosphogluconate dehydrogenase	NA	NA	NA	NA	NA
WP_010012158.1|2499959_2501900_-	transcription antiterminator	NA	NA	NA	NA	NA
WP_169925071.1|2502067_2503099_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	34.4	5.2e-42
WP_167578815.1|2504312_2505782_-|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	31.0	1.0e-51
WP_010620863.1|2505831_2506725_-|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	25.0	2.8e-12
WP_010012236.1|2506721_2507396_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_010009090.1|2507605_2507965_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_010009091.1|2507954_2508134_-	hypothetical protein	NA	NA	NA	NA	NA
WP_056943347.1|2508583_2510566_-	transketolase	NA	NA	NA	NA	NA
WP_099267140.1|2510682_2512053_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_010009608.1|2512084_2513359_-	PTS transporter subunit IIC	NA	NA	NA	NA	NA
WP_029507964.1|2513454_2513739_-	PTS ascorbate transporter subunit IIB	NA	NA	NA	NA	NA
WP_010009613.1|2513749_2515702_-	transcription antiterminator	NA	NA	NA	NA	NA
WP_010009614.1|2515947_2516070_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_010009620.1|2519182_2519671_+	glutathione peroxidase	NA	NA	NA	NA	NA
WP_010009621.1|2519716_2520037_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_010009622.1|2520052_2521681_-	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_010009623.1|2521713_2522442_-	gamma-glutamyl-gamma-aminobutyrate hydrolase family protein	NA	NA	NA	NA	NA
WP_010009624.1|2522473_2524084_-	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_010009625.1|2524741_2526169_-	C69 family dipeptidase	NA	NA	NA	NA	NA
WP_003678956.1|2526508_2526934_+	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
WP_003678958.1|2527039_2527441_-	transcriptional regulator Spx	NA	NA	NA	NA	NA
WP_056943364.1|2527679_2528705_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.4	7.4e-41
2537880:2537998	attR	GGTACTGTCAAACGTACCTCGTTTTTGTTATTAATTTCCGAATATTAAAAAACACCCGAACGTCTTTTTCTGGTATTCTTGGTGTGCGAACAACAAGAAAATCCAGAAAGAAGGATTCG	NA	NA	NA	NA
>prophage 21
NZ_CP017713	Lactobacillus coryniformis subsp. coryniformis KCTC 3167 = DSM 20001 chromosome, complete genome	2951508	2532516	2590040	2951508	transposase,tRNA,integrase	Bacillus_phage(23.53%)	47	2535944:2535960	2569798:2569814
WP_010009632.1|2532516_2532735_+|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	44.6	5.6e-07
WP_176720049.1|2532804_2534103_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	33.2	5.7e-46
WP_010009636.1|2534383_2535580_+	NAD-dependent formate dehydrogenase	NA	A0A1V0SBV6	Catovirus	30.3	1.6e-18
WP_010009637.1|2535664_2536531_-	aldo/keto reductase	NA	A0A1V0SKP9	Klosneuvirus	31.2	2.1e-28
2535944:2535960	attL	AACGATGATGCCATTAT	NA	NA	NA	NA
WP_010009638.1|2536562_2537312_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_169925066.1|2537999_2539445_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A1X9I6E7	Streptococcus_phage	27.2	9.9e-07
WP_003678974.1|2539769_2540645_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_099267168.1|2540835_2542173_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_164512712.1|2542407_2543436_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	33.5	1.1e-41
WP_003680217.1|2543807_2545172_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	51.7	1.2e-131
WP_003680215.1|2545294_2546281_-	diacylglycerol kinase	NA	A0A1V0SBJ0	Catovirus	25.7	2.3e-15
WP_010010820.1|2546293_2547724_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB	tRNA	NA	NA	NA	NA
WP_010010821.1|2547723_2549187_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
WP_010010822.1|2549183_2549498_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC	tRNA	NA	NA	NA	NA
WP_010010823.1|2549677_2550973_-	cation:dicarboxylase symporter family transporter	NA	NA	NA	NA	NA
WP_010010825.1|2551173_2552316_-	CamS family sex pheromone protein	NA	NA	NA	NA	NA
WP_169925052.1|2552404_2552731_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010010827.1|2552675_2554712_-	NAD-dependent DNA ligase LigA	NA	A0A1W6DX16	Sphingobium_phage	35.8	7.9e-95
WP_010010828.1|2554783_2557057_-	DNA helicase PcrA	NA	A7KV33	Bacillus_phage	41.4	3.4e-131
WP_010010829.1|2557341_2558640_-	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	32.4	1.9e-17
WP_003678537.1|2558722_2559859_-	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_010010831.1|2560014_2561343_-	purine permease	NA	Q9KX94	Enterobacteria_phage	28.6	2.2e-29
WP_010010833.1|2561332_2561929_-	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_010010834.1|2562385_2563021_-	glycoside hydrolase family 73 protein	NA	Q9ZXE4	Bacillus_phage	43.7	4.5e-20
WP_010010835.1|2563126_2564089_-	aromatic acid exporter family protein	NA	NA	NA	NA	NA
WP_010010836.1|2564214_2565408_-	phosphoglycerate dehydrogenase	NA	M1NSB9	Streptococcus_phage	44.4	2.7e-95
WP_010010837.1|2565407_2566484_-	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	54.5	3.8e-104
WP_010010838.1|2566720_2567635_-	prenyltransferase	NA	NA	NA	NA	NA
WP_010010841.1|2567894_2569625_-	thiol reductant ABC exporter subunit CydC	NA	W8CYL7	Bacillus_phage	25.9	1.1e-20
WP_010010842.1|2569621_2571352_-	thiol reductant ABC exporter subunit CydD	NA	W8CYL7	Bacillus_phage	24.7	3.2e-20
2569798:2569814	attR	ATAATGGCATCATCGTT	NA	NA	NA	NA
WP_010010843.1|2571348_2572365_-	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_010010844.1|2572357_2573797_-	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_010010845.1|2574190_2576506_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010010846.1|2576544_2576802_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_010010848.1|2577018_2577897_+	glycosyltransferase family 8 protein	NA	NA	NA	NA	NA
WP_010010850.1|2577923_2578736_-	sugar-phosphatase	NA	NA	NA	NA	NA
WP_056943261.1|2578842_2579463_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_010010852.1|2579556_2581014_-	cardiolipin synthase	NA	NA	NA	NA	NA
WP_010010854.1|2581183_2582656_+	multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_010010856.1|2582655_2583174_+	DUF4811 domain-containing protein	NA	NA	NA	NA	NA
WP_099267136.1|2583309_2584659_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_010010857.1|2584816_2585137_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029508013.1|2585301_2586651_+	ATP synthase subunit J	NA	NA	NA	NA	NA
WP_010010859.1|2586678_2587344_+	TrkA family potassium uptake protein	NA	NA	NA	NA	NA
WP_162253083.1|2587454_2588276_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_010010862.1|2588346_2588556_-	DUF2187 family protein	NA	NA	NA	NA	NA
WP_099267171.1|2588669_2590040_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 22
NZ_CP017713	Lactobacillus coryniformis subsp. coryniformis KCTC 3167 = DSM 20001 chromosome, complete genome	2951508	2709959	2765551	2951508	transposase,protease,integrase	unidentified_phage(30.0%)	40	2763951:2764010	2774435:2774585
WP_169925060.1|2709959_2710988_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	33.2	3.3e-41
WP_010009275.1|2711865_2713626_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	32.0	1.2e-59
WP_004562648.1|2713683_2714109_-	universal stress protein	NA	NA	NA	NA	NA
WP_010009276.1|2714127_2715702_-	Nramp family divalent metal transporter	NA	NA	NA	NA	NA
WP_010009277.1|2716313_2717453_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_010009278.1|2717453_2718548_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_010009279.1|2718556_2719495_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	34.0	6.1e-26
WP_069700561.1|2719665_2720655_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	40.1	9.9e-59
WP_010011790.1|2726156_2727005_-	fructosamine kinase family protein	NA	NA	NA	NA	NA
WP_010011792.1|2727112_2728963_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010011793.1|2729486_2730383_-	L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha	NA	NA	NA	NA	NA
WP_010011795.1|2730401_2731055_-	serine dehydratase	NA	NA	NA	NA	NA
WP_003679813.1|2731337_2732879_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L0W2	Tupanvirus	28.2	3.9e-46
WP_010011797.1|2733427_2734303_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003679815.1|2734508_2735372_+	FAD synthetase family protein	NA	NA	NA	NA	NA
WP_010011798.1|2735449_2736226_-	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_010011799.1|2736248_2737169_-	FAD:protein FMN transferase	NA	NA	NA	NA	NA
WP_003679818.1|2737259_2739020_-	pyruvate oxidase	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	26.8	3.8e-29
WP_010011801.1|2739278_2740460_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_010011802.1|2740567_2742004_-	FAD-binding protein	NA	NA	NA	NA	NA
WP_010011804.1|2742455_2744810_+	cbb3-type cytochrome c oxidase subunit I	NA	NA	NA	NA	NA
WP_003679984.1|2744859_2745453_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010011805.1|2745627_2747112_+	multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_010011806.1|2747138_2747687_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010011807.1|2747791_2748328_+	phenolic acid decarboxylase	NA	NA	NA	NA	NA
WP_010011808.1|2748663_2749176_+	DUF1440 domain-containing protein	NA	NA	NA	NA	NA
WP_010011809.1|2749162_2750506_+	MFS transporter	NA	NA	NA	NA	NA
WP_010011810.1|2750750_2750897_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010011812.1|2751332_2751950_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010011814.1|2752198_2752900_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099267173.1|2753200_2754274_+|transposase	IS30 family transposase	transposase	H7BW47	unidentified_phage	35.0	5.6e-31
WP_010012694.1|2754798_2755038_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099267174.1|2756337_2758452_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	K4FB40	Cronobacter_phage	38.9	1.5e-117
WP_164512712.1|2758689_2759718_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	33.5	1.1e-41
WP_056943345.1|2759953_2761078_+	hypothetical protein	NA	NA	NA	NA	NA
WP_141707553.1|2761493_2761730_-	KxYKxGKxW signal peptide domain-containing protein	NA	NA	NA	NA	NA
WP_010009884.1|2761849_2762182_-	PTS sugar transporter	NA	NA	NA	NA	NA
WP_010009885.1|2762215_2763061_-	PTS system mannose/fructose/sorbose family transporter subunit IID	NA	NA	NA	NA	NA
WP_010009886.1|2763063_2763927_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
2763951:2764010	attL	GGTACTGTCAAACGTACCCGATTTTGTCTAGTTTTAATTATTGTTTCTAATGGTTTTGTA	NA	NA	NA	NA
WP_056943358.1|2764102_2765551_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A1X9I6E7	Streptococcus_phage	25.7	2.4e-08
WP_056943358.1|2764102_2765551_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A1X9I6E7	Streptococcus_phage	25.7	2.4e-08
2774435:2774585	attR	TACAAAACCATTAGAAACAATAATTAAAACTAGACAAAATCGGGTACGTTTGACAGTACCGAAATAATTTGGAGGTAAAGATTATGGGAGCACCAGAGGGACATCCTTTCTTTGGAAATCAGTATACAAATGGTGGGTATCAACAAGGAAG	NA	NA	NA	NA
>prophage 23
NZ_CP017713	Lactobacillus coryniformis subsp. coryniformis KCTC 3167 = DSM 20001 chromosome, complete genome	2951508	2771073	2824238	2951508	transposase,integrase	Lactobacillus_phage(18.18%)	47	2763951:2764010	2774435:2774586
2763951:2764010	attL	GGTACTGTCAAACGTACCCGATTTTGTCTAGTTTTAATTATTGTTTCTAATGGTTTTGTA	NA	NA	NA	NA
WP_010009912.1|2771073_2772474_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_010009915.1|2772505_2772697_+	hypothetical protein	NA	NA	NA	NA	NA
WP_056943358.1|2772893_2774342_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A1X9I6E7	Streptococcus_phage	25.7	2.4e-08
WP_056943355.1|2774517_2774985_+	hypothetical protein	NA	NA	NA	NA	NA
2774435:2774586	attR	TACAAAACCATTAGAAACAATAATTAAAACTAGACAAAATCGGGTACGTTTGACAGTACCGAAATAATTTGGAGGTAAAGATTATGGGAGCACCAGAGGGACATCCTTTCTTTGGAAATCAGTATACAAATGGTGGGTATCAACAAGGAAGT	NA	NA	NA	NA
WP_056943354.1|2774988_2775324_+	hypothetical protein	NA	NA	NA	NA	NA
WP_056943353.1|2775407_2775941_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_176720008.1|2776087_2776564_+	hypothetical protein	NA	A0A0P0I4A4	Acinetobacter_phage	30.6	8.0e-06
WP_099267171.1|2776518_2777889_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_145955961.1|2778550_2778823_+|transposase	transposase	transposase	Q6J1X3	Lactobacillus_phage	98.6	3.5e-30
WP_046872534.1|2778876_2779617_+|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	99.2	4.0e-137
WP_010010295.1|2779951_2781631_+	D-lactate dehydrogenase	NA	NA	NA	NA	NA
WP_010010297.1|2783004_2784510_-	glycoside hydrolase family 1 protein	NA	NA	NA	NA	NA
WP_010010298.1|2784524_2786390_-	PTS beta-glucoside transporter subunit IIBCA	NA	NA	NA	NA	NA
WP_010010300.1|2786379_2787243_-	PRD domain-containing protein	NA	NA	NA	NA	NA
WP_010010301.1|2787470_2787710_-	protein-export chaperone SecB	NA	NA	NA	NA	NA
WP_164512712.1|2787983_2789012_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	33.5	1.1e-41
WP_010010303.1|2790908_2791523_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A0E3XCL7	Enterococcus_phage	73.5	4.6e-22
WP_010010304.1|2791737_2793549_+	oligoendopeptidase F	NA	NA	NA	NA	NA
WP_010010305.1|2793772_2794459_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_010010307.1|2795055_2796201_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010010308.1|2796357_2796969_-	DUF1211 domain-containing protein	NA	NA	NA	NA	NA
WP_010010309.1|2797116_2799213_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	30.2	1.0e-44
WP_010010310.1|2799217_2800954_-	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	29.4	7.2e-12
WP_010010311.1|2801150_2801810_+	TetR/AcrR family transcriptional regulator C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_010010312.1|2801853_2802888_-	branched-chain amino acid aminotransferase	NA	NA	NA	NA	NA
WP_010010314.1|2803134_2803518_+	reactive intermediate/imine deaminase	NA	NA	NA	NA	NA
WP_010010315.1|2803556_2804339_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.4	3.7e-16
WP_010010316.1|2804419_2805694_-	threonine ammonia-lyase IlvA	NA	NA	NA	NA	NA
WP_003679829.1|2805936_2806947_-	ketol-acid reductoisomerase	NA	NA	NA	NA	NA
WP_003679832.1|2807258_2807741_-	acetolactate synthase small subunit	NA	NA	NA	NA	NA
WP_010010317.1|2807741_2809442_-	biosynthetic-type acetolactate synthase large subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	31.5	2.1e-64
WP_137636541.1|2809918_2810131_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010010318.1|2810961_2812716_+	dihydroxy-acid dehydratase	NA	NA	NA	NA	NA
WP_010010320.1|2812911_2813241_+	metal-sulfur cluster assembly factor	NA	NA	NA	NA	NA
WP_010010321.1|2813268_2814243_+	bile acid:sodium symporter family protein	NA	NA	NA	NA	NA
WP_010010322.1|2814358_2815573_+	MFS transporter	NA	NA	NA	NA	NA
WP_056943265.1|2815678_2816611_+	L-lactate dehydrogenase	NA	NA	NA	NA	NA
WP_010010324.1|2816594_2817317_-	DNA/RNA nuclease SfsA	NA	NA	NA	NA	NA
WP_003679846.1|2817381_2817882_-	universal stress protein	NA	NA	NA	NA	NA
WP_010010325.1|2818074_2818293_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010010327.1|2818438_2818882_-	threonine/serine exporter family protein	NA	NA	NA	NA	NA
WP_010010328.1|2818909_2819656_-	threonine/serine exporter family protein	NA	NA	NA	NA	NA
WP_010010329.1|2819899_2820547_-	C39 family peptidase	NA	NA	NA	NA	NA
WP_010010331.1|2820683_2821622_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_010010332.1|2821623_2822493_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_010010333.1|2822688_2822952_+	hypothetical protein	NA	NA	NA	NA	NA
WP_169925064.1|2823209_2824238_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	33.5	8.8e-42
