The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP023972	Pasteurella multocida strain FDAARGOS_385 chromosome, complete genome	2346712	73274	183685	2346712	tail,capsid,integrase,tRNA,plate,terminase,holin	Haemophilus_phage(26.92%)	136	126613:126640	182883:182910
WP_005756524.1|73274_73667_+|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_096742887.1|73679_73958_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096742888.1|74023_76630_-	type I DNA topoisomerase	NA	A0A2K9L1Q2	Tupanvirus	33.9	3.0e-86
WP_096742889.1|76790_77624_-	PHP domain-containing protein	NA	NA	NA	NA	NA
WP_096742890.1|77710_78730_-	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_010906757.1|78882_81492_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	25.2	2.4e-19
WP_010906758.1|81662_82163_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	40.6	1.7e-19
WP_096742891.1|82227_83316_+	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_005751474.1|83459_84650_+	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_096742892.1|84710_85163_-	molybdopterin synthase catalytic subunit MoaE	NA	NA	NA	NA	NA
WP_096742893.1|85163_85409_-	molybdopterin synthase sulfur carrier subunit	NA	NA	NA	NA	NA
WP_096742894.1|85421_85898_-	cyclic pyranopterin monophosphate synthase MoaC	NA	NA	NA	NA	NA
WP_096742895.1|85957_86971_-	GTP 3',8-cyclase MoaA	NA	NA	NA	NA	NA
WP_010906761.1|87343_88270_+	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	30.8	3.1e-30
WP_096742896.1|88289_88775_-	C40 family peptidase	NA	S5MM68	Bacillus_phage	37.5	4.2e-10
WP_005722212.1|88857_89154_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	4.6e-12
WP_096742897.1|89157_91545_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_050547921.1|91567_92017_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096742898.1|92057_93041_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2H4UW22	Bodo_saltans_virus	36.8	5.4e-33
WP_096742899.1|93219_93738_-	ClbS/DfsB family four-helix bundle protein	NA	NA	NA	NA	NA
WP_096742900.1|93766_94429_-	TIGR01621 family pseudouridine synthase	NA	NA	NA	NA	NA
WP_010906766.1|94536_95187_+	histidine phosphatase family protein	NA	A0A1X9IGJ2	Lactococcus_phage	32.7	5.8e-07
WP_096742901.1|95217_96546_-	bifunctional tetrahydrofolate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_005751483.1|96538_97453_-	acetyl-CoA carboxylase, carboxyltransferase subunit beta	NA	NA	NA	NA	NA
WP_096742902.1|97536_98331_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_096742903.1|98488_99331_+	patatin family protein	NA	NA	NA	NA	NA
WP_005756556.1|99599_99857_-	hypothetical protein	NA	A0A0M3LNN9	Mannheimia_phage	60.0	1.4e-20
WP_096742904.1|99846_100434_-	DUF4376 domain-containing protein	NA	A0A0M3LRX2	Mannheimia_phage	33.2	1.2e-30
WP_096742905.1|100444_101953_-|tail	tail fiber protein	tail	Q94MY0	Haemophilus_virus	45.0	1.2e-74
WP_096742906.1|101965_102544_-	DUF2612 domain-containing protein	NA	D0UIH4	Aggregatibacter_phage	69.1	3.4e-75
WP_096742907.1|102543_103683_-|plate	baseplate J/gp47 family protein	plate	Q7Y5S4	Haemophilus_phage	65.8	2.9e-139
WP_096742908.1|103693_104047_-	hypothetical protein	NA	Q7Y5S5	Haemophilus_phage	66.7	5.7e-41
WP_096742909.1|104043_104712_-|plate	baseplate protein	plate	D0UIH7	Aggregatibacter_phage	62.6	1.2e-71
WP_096742910.1|104769_105021_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096742911.1|105160_105412_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096742912.1|105502_106168_-	KilA-N domain-containing protein	NA	A0A0P0ZCS0	Stx2-converting_phage	54.9	4.7e-20
WP_096742913.1|106472_106961_-	DUF2335 domain-containing protein	NA	NA	NA	NA	NA
WP_096742914.1|106938_107145_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096742915.1|107469_108414_-	DUF4236 domain-containing protein	NA	NA	NA	NA	NA
WP_096742916.1|108565_109093_+	hypothetical protein	NA	A0A127KNL4	Pseudomonas_phage	31.5	2.6e-18
WP_096742917.1|109289_110129_-	hypothetical protein	NA	D0UIH8	Aggregatibacter_phage	76.4	9.1e-122
WP_096742918.1|110097_110430_-	hypothetical protein	NA	D0UII0	Aggregatibacter_phage	79.0	1.8e-41
WP_096742919.1|110445_111213_-	hypothetical protein	NA	Q7Y5T0	Haemophilus_phage	56.8	3.3e-70
WP_096742920.1|111225_112851_-|tail	phage tail tape measure protein	tail	Q7Y5T2	Haemophilus_phage	41.2	2.8e-87
WP_071523250.1|112995_113412_-	hypothetical protein	NA	Q776V6	Haemophilus_phage	60.1	3.7e-39
WP_096742921.1|113415_113844_-	DUF3277 family protein	NA	Q7Y5T4	Haemophilus_phage	71.1	3.5e-53
WP_096742922.1|113855_115364_-	DUF3383 domain-containing protein	NA	Q7Y5T5	Haemophilus_phage	71.1	3.1e-205
WP_096742923.1|115363_115735_-	hypothetical protein	NA	Q7Y5T6	Haemophilus_phage	57.1	8.0e-30
WP_096742924.1|115799_116174_-	hypothetical protein	NA	Q776V7	Haemophilus_phage	58.1	4.2e-34
WP_096742925.1|116170_116617_-	hypothetical protein	NA	Q7Y5T8	Haemophilus_phage	54.1	6.5e-42
WP_096742926.1|116613_116973_-	DUF4054 domain-containing protein	NA	Q7Y5T9	Haemophilus_phage	57.6	4.4e-33
WP_096742927.1|116982_117897_-	DUF2184 domain-containing protein	NA	Q7Y5U0	Haemophilus_phage	51.0	1.2e-77
WP_096742928.1|117916_118366_-	hypothetical protein	NA	D0UIJ1	Aggregatibacter_phage	55.0	1.2e-27
WP_096742929.1|118377_119445_-	DUF2213 domain-containing protein	NA	D0UIJ2	Aggregatibacter_phage	63.3	2.1e-94
WP_096743999.1|119552_121082_-|capsid	minor capsid protein	capsid	Q7Y5U5	Haemophilus_phage	55.0	2.3e-70
WP_096744000.1|121044_122346_-	DUF1073 domain-containing protein	NA	D0UIJ6	Aggregatibacter_phage	54.7	2.4e-129
WP_096744001.1|122354_123740_-|terminase	phage terminase large subunit	terminase	D0UIJ7	Aggregatibacter_phage	81.5	2.7e-227
WP_096742930.1|123762_124290_-|terminase	terminase	terminase	C7U0W1	Enterobacteria_phage	66.4	1.4e-48
WP_096742931.1|124374_124560_+	type II toxin-antitoxin system HicA family toxin	NA	A0A0M4RCZ9	Salmonella_phage	76.9	2.0e-05
WP_096742932.1|124588_125023_+	type II toxin-antitoxin system HicB family antitoxin	NA	A0A0R6PK80	Moraxella_phage	35.2	1.3e-18
WP_096742934.1|125240_125564_-	DUF2570 family protein	NA	NA	NA	NA	NA
WP_096742935.1|125536_126067_-	lysozyme	NA	A0A0M3LPQ1	Mannheimia_phage	50.9	4.4e-45
WP_096742936.1|126063_126360_-	hypothetical protein	NA	A0A0M3LR95	Mannheimia_phage	50.0	4.9e-14
126613:126640	attL	GGTGAATCATACTTACACTACGACCACC	NA	NA	NA	NA
WP_014391474.1|126685_127147_-	antitermination protein	NA	NA	NA	NA	NA
WP_096742937.1|127148_127751_-	recombination protein NinG	NA	H6WRY9	Salmonella_phage	38.2	3.7e-32
WP_096742939.1|128068_128269_-	hypothetical protein	NA	A0A0M3LR43	Mannheimia_phage	69.4	6.7e-23
WP_096742940.1|128342_128801_-	recombination protein NinB	NA	Q7Y5V7	Haemophilus_phage	54.1	4.5e-38
WP_096742941.1|128804_130241_-	AAA family ATPase	NA	Q7Y5V9	Haemophilus_phage	63.0	1.3e-173
WP_096742942.1|130240_131305_-	replication protein	NA	A0A0M3LQL8	Mannheimia_phage	73.8	1.2e-57
WP_096742943.1|131540_131741_-	hypothetical protein	NA	D0UIL7	Aggregatibacter_phage	71.1	3.0e-07
WP_096742944.1|131743_132196_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096742945.1|132243_132435_-	hypothetical protein	NA	A5VW97	Enterobacteria_phage	56.9	4.7e-10
WP_096742946.1|132532_133183_+	helix-turn-helix domain-containing protein	NA	A0A1I9KG86	Aeromonas_phage	39.0	1.2e-28
WP_096742947.1|133187_135095_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_096742948.1|135545_135773_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096742949.1|135919_136201_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096742950.1|136187_136415_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172452375.1|136428_136590_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096742951.1|136762_137407_+	ribonuclease H-like domain-containing protein	NA	R9ZX90	Cellulophaga_phage	25.0	2.0e-07
WP_096742952.1|137410_138076_+	AAA family ATPase	NA	A0A2D1GLT5	Escherichia_phage	54.5	2.1e-65
WP_096742953.1|138078_138681_+	hypothetical protein	NA	A0A0N7KZV4	Escherichia_phage	45.1	1.3e-32
WP_096742954.1|138738_139407_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096742956.1|139650_140043_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096742957.1|140039_140351_+	hypothetical protein	NA	Q6J1P1	Burkholderia_virus	40.8	8.0e-07
WP_096742958.1|140428_140812_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096742959.1|140814_141723_+	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	44.5	9.1e-59
WP_096742960.1|141866_142352_+	DUF551 domain-containing protein	NA	A0A0M3LS47	Mannheimia_phage	42.2	1.5e-23
WP_096742961.1|142354_142585_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096742962.1|142638_143130_+	pyruvate kinase	NA	A0A0M3LPG0	Mannheimia_phage	45.6	5.0e-27
WP_096742963.1|143134_143449_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042742798.1|143484_143736_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_096742964.1|143737_144769_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M3LQJ3	Mannheimia_phage	64.8	3.7e-125
WP_005716009.1|144920_145205_-	50S ribosomal protein L25	NA	NA	NA	NA	NA
WP_083002187.1|145422_146037_+	DedA family protein	NA	NA	NA	NA	NA
WP_083002189.1|146104_146839_-	dethiobiotin synthase	NA	NA	NA	NA	NA
WP_005756709.1|147004_148216_-	ROK family protein	NA	NA	NA	NA	NA
WP_096742965.1|148510_149914_+|tRNA	asparagine--tRNA ligase	tRNA	A0A1V0SDB6	Indivirus	38.0	6.3e-83
WP_096742966.1|149974_152332_+	penicillin-binding protein 1C	NA	NA	NA	NA	NA
WP_096742967.1|152377_153223_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	43.2	4.4e-47
WP_096742968.1|153300_155013_+	penicillin-binding protein activator	NA	NA	NA	NA	NA
WP_083002202.1|155014_155374_+	YraN family protein	NA	NA	NA	NA	NA
WP_096742969.1|155376_155964_+	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_083002207.1|156027_156612_+	divisome-associated lipoprotein YraP	NA	NA	NA	NA	NA
WP_096742970.1|156673_157288_-	riboflavin synthase subunit alpha	NA	NA	NA	NA	NA
WP_083002213.1|157343_158747_+	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_096742971.1|158746_159799_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_083002217.1|159928_161368_-	pyruvate kinase	NA	NA	NA	NA	NA
WP_096742972.1|161932_163180_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	42.8	8.3e-79
WP_096742973.1|163205_163466_-	DNA helicase UvrD	NA	A0A0M3LNN9	Mannheimia_phage	58.8	4.8e-21
WP_192940542.1|163452_164046_-	DUF4376 domain-containing protein	NA	Q7Y5S1	Haemophilus_phage	39.8	2.6e-38
WP_192940543.1|164045_165533_-|tail	tail fiber protein	tail	Q94MY0	Haemophilus_virus	46.6	1.0e-70
WP_096742975.1|165545_166124_-	DUF2612 domain-containing protein	NA	D0UIH4	Aggregatibacter_phage	69.6	3.4e-75
WP_096742976.1|166123_167263_-|plate	baseplate J/gp47 family protein	plate	Q7Y5S4	Haemophilus_phage	65.3	3.8e-139
WP_096742977.1|167273_167627_-	hypothetical protein	NA	Q7Y5S5	Haemophilus_phage	66.7	5.1e-42
WP_096742978.1|167623_168277_-|plate	baseplate protein	plate	D0UIH7	Aggregatibacter_phage	60.9	1.6e-68
WP_096742979.1|168394_168652_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096742980.1|168710_169064_-	DUF2513 domain-containing protein	NA	NA	NA	NA	NA
WP_159074467.1|170028_170187_-	hypothetical protein	NA	NA	NA	NA	NA
WP_192940544.1|170336_170900_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_096742982.1|171110_172256_-	type I restriction enzyme HsdR N-terminal domain-containing protein	NA	A0A1S5SAB0	Streptococcus_phage	32.5	1.0e-38
WP_096742916.1|172406_172934_+	hypothetical protein	NA	A0A127KNL4	Pseudomonas_phage	31.5	2.6e-18
WP_096742983.1|173130_173970_-	hypothetical protein	NA	D0UIH8	Aggregatibacter_phage	74.3	1.7e-120
WP_096742984.1|173938_174271_-	hypothetical protein	NA	Q7Y5S9	Haemophilus_phage	78.0	1.4e-41
WP_096742985.1|174286_175054_-	hypothetical protein	NA	Q7Y5T0	Haemophilus_phage	58.0	8.7e-71
WP_192940545.1|175063_175300_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096742988.1|175716_176136_-	HD domain-containing protein	NA	D0UIJ3	Aggregatibacter_phage	62.8	1.4e-38
WP_096742989.1|176135_176354_-	hypothetical protein	NA	A0A0M3LPI7	Mannheimia_phage	72.2	4.6e-25
WP_138223025.1|176353_177394_-|capsid	minor capsid protein	capsid	Q7Y5U5	Haemophilus_phage	27.6	6.1e-59
WP_096742991.1|177415_177613_-	recombinase	NA	NA	NA	NA	NA
WP_096742992.1|177730_179038_-	DUF1073 domain-containing protein	NA	D0UIJ6	Aggregatibacter_phage	55.6	7.3e-134
WP_096742993.1|180360_180813_-|terminase	terminase small subunit	terminase	A0A1X9SFE5	Acinetobacter_phage	56.4	2.3e-31
WP_096742994.1|180885_181068_+	type II toxin-antitoxin system HicA family toxin	NA	A0A0D4DC32	Acinetobacter_phage	54.2	6.5e-09
WP_096742995.1|181096_181531_+	type II toxin-antitoxin system HicB family antitoxin	NA	A0A0R6PJ17	Moraxella_phage	38.0	1.0e-20
WP_096742997.1|181750_182083_-	DUF2570 family protein	NA	NA	NA	NA	NA
WP_096742998.1|182585_182810_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005716039.1|183475_183685_-	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	57.1	1.4e-15
182883:182910	attR	GGTGAATCATACTTACACTACGACCACC	NA	NA	NA	NA
>prophage 2
NZ_CP023972	Pasteurella multocida strain FDAARGOS_385 chromosome, complete genome	2346712	568650	578008	2346712		Planktothrix_phage(33.33%)	9	NA	NA
WP_096743148.1|568650_569925_+	multifunctional CCA addition/repair protein	NA	A0A0F6YPT7	Sinorhizobium_phage	49.1	9.7e-91
WP_083005128.1|569965_570583_+	lipoprotein localization protein LolB	NA	NA	NA	NA	NA
WP_096743149.1|570582_571470_+	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
WP_005724296.1|571539_572487_+	ribose-phosphate pyrophosphokinase	NA	A0A2K9L2G2	Tupanvirus	38.7	1.9e-43
WP_083005124.1|572561_574115_-	murein DD-endopeptidase MepM	NA	A0A2K9VGT1	Pontimonas_phage	49.6	8.4e-20
WP_010906540.1|574349_575141_+	zinc ABC transporter ATP-binding protein ZnuC	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	29.7	4.4e-17
WP_083005121.1|575149_575935_+	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_083005119.1|576012_576993_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.6	3.4e-19
WP_096743150.1|577009_578008_-	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.4	2.3e-15
>prophage 3
NZ_CP023972	Pasteurella multocida strain FDAARGOS_385 chromosome, complete genome	2346712	1091792	1099860	2346712		Escherichia_phage(66.67%)	7	NA	NA
WP_096743382.1|1091792_1093667_+	selenocysteine-specific translation elongation factor	NA	A0A2K9KZ60	Tupanvirus	26.2	2.2e-14
WP_096743383.1|1093717_1094266_-	ferredoxin-type protein NapF	NA	NA	NA	NA	NA
WP_096744018.1|1094283_1094889_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.7	1.2e-22
WP_083004167.1|1094977_1095826_-	dimethyl sulfoxide reductase anchor subunit	NA	A0A077SK59	Escherichia_phage	33.8	2.0e-20
WP_083004164.1|1095827_1096448_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	58.3	1.2e-70
WP_096743384.1|1096458_1098894_-	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	49.9	6.3e-224
WP_083004163.1|1099140_1099860_-	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	34.2	3.4e-16
>prophage 4
NZ_CP023972	Pasteurella multocida strain FDAARGOS_385 chromosome, complete genome	2346712	1635055	1706536	2346712	tail,transposase,head,integrase,plate,tRNA	Burkholderia_phage(20.0%)	85	1630803:1630819	1666621:1666637
1630803:1630819	attL	TTTAATTTCGCCGTTTG	NA	NA	NA	NA
WP_096743593.1|1635055_1637854_-|tRNA	isoleucine--tRNA ligase	tRNA	K7YVP8	Megavirus	27.3	8.9e-89
WP_096743594.1|1637887_1638823_-	bifunctional riboflavin kinase/FAD synthetase	NA	NA	NA	NA	NA
WP_096743595.1|1638911_1640486_-	murein biosynthesis integral membrane protein MurJ	NA	NA	NA	NA	NA
WP_005718552.1|1640797_1641061_+	30S ribosomal protein S20	NA	NA	NA	NA	NA
WP_046333738.1|1641119_1641800_-	YtjB family periplasmic protein	NA	NA	NA	NA	NA
WP_046333739.1|1641879_1642842_+	phosphoserine phosphatase	NA	NA	NA	NA	NA
WP_096743597.1|1642848_1643340_+	YajQ family cyclic di-GMP-binding protein	NA	NA	NA	NA	NA
WP_005718542.1|1643429_1643693_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_108511585.1|1644139_1644604_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A1B5FPC6	Escherichia_phage	38.2	2.3e-21
WP_096743598.1|1645083_1646001_-	inorganic pyrophosphatase	NA	A4JWK0	Burkholderia_virus	43.7	7.0e-67
WP_096743599.1|1646000_1646441_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096743600.1|1646452_1647028_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005725338.1|1647024_1647360_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_096743601.1|1647750_1649544_-	D5 N like family protein	NA	Q7M2A8	Enterobacteria_phage	34.5	4.4e-57
WP_005725335.1|1649533_1649722_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096743602.1|1649721_1650015_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096744027.1|1650007_1650574_-	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_046333744.1|1650654_1650846_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_096743603.1|1651368_1652604_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1V0E8G8	Vibrio_phage	36.5	2.7e-74
WP_096743604.1|1653164_1654445_-	TRAP transporter large permease	NA	NA	NA	NA	NA
WP_046333747.1|1654441_1655002_-	TRAP transporter small permease	NA	NA	NA	NA	NA
WP_083003433.1|1655025_1656015_-	DctP family TRAP transporter solute-binding subunit	NA	NA	NA	NA	NA
WP_083003430.1|1656367_1657381_+	4-hydroxythreonine-4-phosphate dehydrogenase PdxA	NA	NA	NA	NA	NA
WP_005718532.1|1657401_1658406_+	dihydroxyacetone kinase subunit DhaK	NA	NA	NA	NA	NA
WP_083003424.1|1658407_1659034_+	dihydroxyacetone kinase subunit L	NA	NA	NA	NA	NA
WP_096743605.1|1659212_1660073_+	sugar phosphate isomerase/epimerase	NA	NA	NA	NA	NA
WP_005718523.1|1660065_1661019_+	sugar-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_083003419.1|1661040_1661496_+	ribose 5-phosphate isomerase B	NA	NA	NA	NA	NA
WP_083003416.1|1661544_1662522_+	TRAP transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005718519.1|1662575_1663052_+	TRAP transporter small permease	NA	NA	NA	NA	NA
WP_096743606.1|1663051_1664344_+	TRAP transporter large permease	NA	NA	NA	NA	NA
WP_096743607.1|1664354_1665026_+	cyclase family protein	NA	NA	NA	NA	NA
WP_096743608.1|1665038_1666088_+	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_096743609.1|1666105_1667056_+	transaldolase	NA	A0A127KNC6	Cyanophage	26.8	3.7e-10
1666621:1666637	attR	TTTAATTTCGCCGTTTG	NA	NA	NA	NA
WP_096743610.1|1667389_1667881_-	enoyl-CoA hydratase	NA	F6MIM0	Haemophilus_phage	61.0	8.4e-51
WP_096743611.1|1668498_1670130_-|tail	tail fiber protein	tail	Q94MY0	Haemophilus_virus	41.1	2.8e-50
WP_096743612.1|1670166_1670733_-|tail	phage tail protein	tail	Q6QI98	Burkholderia_phage	47.2	1.3e-42
WP_096743613.1|1670725_1671832_-|plate	baseplate J/gp47 family protein	plate	Q6QI99	Burkholderia_phage	38.3	8.2e-62
WP_096743614.1|1671828_1672194_-	GPW/gp25 family protein	NA	E5G6N7	Salmonella_phage	34.2	6.1e-06
WP_096744029.1|1672248_1672863_-|plate	phage baseplate assembly protein V	plate	A0A291LA20	Bordetella_phage	43.2	9.6e-12
WP_096743615.1|1672862_1674044_-	hypothetical protein	NA	Q6QIA2	Burkholderia_phage	41.9	1.5e-66
WP_096743616.1|1674036_1674267_-|tail	tail protein X	tail	Q6QIA3	Burkholderia_phage	43.3	6.8e-11
WP_096743617.1|1674247_1675186_-|tail	phage tail protein	tail	Q6QIA4	Burkholderia_phage	31.8	2.0e-21
WP_096743618.1|1675185_1677450_-|tail	phage tail tape measure protein	tail	K4ICR4	Acidithiobacillus_phage	34.8	2.5e-57
WP_096743619.1|1677488_1677749_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096743620.1|1677761_1677884_-|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_096743621.1|1677910_1678165_-|tail	phage tail assembly protein	tail	Q6QIA8	Burkholderia_phage	39.2	3.6e-05
WP_096743622.1|1678264_1678783_-|tail	phage major tail tube protein	tail	A4JWK6	Burkholderia_virus	46.7	1.3e-38
WP_096743623.1|1678793_1680179_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	A4JWK5	Burkholderia_virus	44.1	4.0e-98
WP_096743624.1|1680188_1680674_-	hypothetical protein	NA	A4JWK3	Burkholderia_virus	36.0	1.1e-21
WP_096743625.1|1680675_1681110_-	DUF1320 domain-containing protein	NA	A4JWK2	Burkholderia_virus	41.0	4.4e-19
WP_096743626.1|1681109_1681454_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096743627.1|1681524_1682451_-	hypothetical protein	NA	A4JWK0	Burkholderia_virus	47.9	1.6e-74
WP_096743628.1|1682462_1683575_-	peptidase	NA	A4JWJ9	Burkholderia_virus	39.9	1.4e-69
WP_096743629.1|1683824_1684289_-	phage virion morphogenesis protein	NA	Q6QIB8	Burkholderia_phage	32.0	1.4e-10
WP_096743630.1|1684414_1685671_-|head	phage head morphogenesis protein	head	J9STS2	Pseudomonas_phage	48.2	5.3e-57
WP_096743631.1|1685667_1687098_-	DUF935 family protein	NA	Q6QIC0	Burkholderia_phage	44.8	2.1e-110
WP_096743632.1|1687097_1688654_-	hypothetical protein	NA	A0A2I7S9C5	Vibrio_phage	62.2	3.1e-163
WP_064775717.1|1688656_1689238_-	DUF3486 family protein	NA	A0A2I7S9D1	Vibrio_phage	44.5	2.4e-36
WP_096743633.1|1689260_1689563_-	hypothetical protein	NA	A0A0C4UR00	Shigella_phage	60.4	8.3e-25
WP_064775719.1|1689559_1689889_-	DUF2730 family protein	NA	NA	NA	NA	NA
WP_096743634.1|1690006_1690267_-	DUF2681 domain-containing protein	NA	NA	NA	NA	NA
WP_096743635.1|1690263_1690494_-	DUF2644 domain-containing protein	NA	F6MIK0	Haemophilus_phage	69.3	7.4e-18
WP_192940539.1|1690477_1690837_-	hypothetical protein	NA	NA	NA	NA	NA
WP_192940540.1|1690836_1690980_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083002521.1|1690988_1691525_-	N-acetylmuramoyl-L-alanine amidase	NA	F6MIJ9	Haemophilus_phage	68.6	7.2e-72
WP_096743636.1|1691611_1692001_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096743637.1|1692437_1692938_-	toxin	NA	L7THB5	Pseudomonas_virus	28.0	5.6e-10
WP_096743638.1|1692941_1693304_-	helix-turn-helix transcriptional regulator	NA	L7TKV7	Pseudomonas_virus	53.3	2.6e-25
WP_096743639.1|1693441_1693816_-	transcriptional regulator	NA	Q6QIE8	Burkholderia_phage	45.8	1.5e-23
WP_096743640.1|1693815_1694361_-	hypothetical protein	NA	A0A0M3LPP6	Mannheimia_phage	42.3	3.8e-36
WP_096743641.1|1694357_1694864_-	regulatory protein GemA	NA	A0A0C4UQU3	Shigella_phage	30.6	2.5e-13
WP_096743642.1|1694937_1695450_-	DUF551 domain-containing protein	NA	A0A0M3LS47	Mannheimia_phage	45.0	1.0e-27
WP_061406041.1|1695458_1695674_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096743643.1|1695691_1695883_-	ANR family transcriptional regulator	NA	NA	NA	NA	NA
WP_096743644.1|1695936_1696458_-	host-nuclease inhibitor Gam family protein	NA	C9DGL8	Escherichia_phage	55.0	6.0e-47
WP_083002501.1|1696477_1696681_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096743645.1|1696680_1697598_-	AAA family ATPase	NA	M4M9P4	Vibrio_phage	42.0	4.4e-61
WP_096743646.1|1697608_1699594_-|transposase	Mu transposase C-terminal domain-containing protein	transposase	A0A0C4UR24	Shigella_phage	44.5	1.3e-155
WP_005719952.1|1699639_1699906_-	transcriptional regulator	NA	F6MII4	Haemophilus_phage	64.6	6.4e-21
WP_096743647.1|1700081_1700789_+	helix-turn-helix transcriptional regulator	NA	F6MII3	Haemophilus_phage	48.4	1.7e-52
WP_046333751.1|1701262_1703131_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.8	4.5e-36
WP_096743648.1|1703206_1704955_-	DNA primase	NA	A0A1S5RF71	Helicobacter_phage	32.6	1.1e-41
WP_005717672.1|1705070_1705286_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_096743649.1|1705504_1706536_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	58.6	1.8e-111
