The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP023964	Yersinia frederiksenii strain FDAARGOS_418 chromosome, complete genome	4934031	1365886	1374152	4934031		Escherichia_phage(71.43%)	10	NA	NA
WP_004711355.1|1365886_1366399_+	GNAT family N-acetyltransferase	NA	D0R097	Streptococcus_phage	27.2	1.5e-10
WP_004711353.1|1366529_1367762_+	alanine transaminase	NA	NA	NA	NA	NA
WP_004711351.1|1367792_1368317_+	cytochrome b	NA	A0A0U2QLA7	Escherichia_phage	52.9	4.1e-27
WP_098057507.1|1368407_1368482_-	membrane protein YpdK	NA	NA	NA	NA	NA
WP_032911646.1|1368745_1369180_-	hypothetical protein	NA	Q7Y3V7	Yersinia_phage	48.9	9.8e-27
WP_032911645.1|1369294_1369615_-	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_032911644.1|1369628_1370234_-	molecular chaperone	NA	A0A077SLS7	Escherichia_phage	50.3	3.8e-45
WP_004711343.1|1370321_1371098_-	dimethyl sulfoxide reductase anchor subunit	NA	A0A077SK59	Escherichia_phage	40.6	1.1e-39
WP_004711341.1|1371099_1371717_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	69.8	2.0e-89
WP_004711338.1|1371728_1374152_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	55.5	2.0e-262
>prophage 2
NZ_CP023964	Yersinia frederiksenii strain FDAARGOS_418 chromosome, complete genome	4934031	1547156	1589021	4934031	protease,tail,plate	Pseudomonas_phage(21.05%)	37	NA	NA
WP_004708715.1|1547156_1547663_-|protease	serine protease inhibitor ecotin	protease	NA	NA	NA	NA
WP_004708713.1|1547812_1548070_-	2Fe-2S ferredoxin-like protein	NA	G9IAA2	Pseudomonas_phage	67.2	5.2e-20
WP_032910944.1|1548073_1549204_-	ribonucleotide-diphosphate reductase subunit beta	NA	G9IAA3	Pseudomonas_phage	78.6	9.9e-172
WP_004708709.1|1549337_1551623_-	ribonucleoside-diphosphate reductase subunit alpha	NA	I3UMG3	Colwellia_phage	65.1	5.5e-286
WP_004708707.1|1552034_1552793_-	bifunctional 2-polyprenyl-6-hydroxyphenol methylase/3-demethylubiquinol 3-O-methyltransferase UbiG	NA	NA	NA	NA	NA
WP_004708706.1|1552982_1555637_+	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	A0A172JHV7	Bacillus_phage	30.9	1.6e-103
WP_004708704.1|1555752_1558602_+	two-component system sensor histidine kinase RcsC	NA	A0A1V0SGX0	Hokovirus	28.2	1.5e-43
WP_004708702.1|1558746_1559394_-	transcriptional regulator RcsB	NA	NA	NA	NA	NA
WP_004708701.1|1559396_1562090_-	phosphotransferase RcsD	NA	NA	NA	NA	NA
WP_004708700.1|1562112_1563267_-	MFS transporter	NA	NA	NA	NA	NA
WP_004708697.1|1564319_1565432_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	57.3	2.3e-112
WP_004708694.1|1565959_1567102_-	D-alanyl-D-alanine- carboxypeptidase/endopeptidase AmpH	NA	NA	NA	NA	NA
WP_032913203.1|1567528_1569055_-	MFS transporter	NA	NA	NA	NA	NA
WP_032910942.1|1569464_1570454_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_032913205.1|1570521_1572309_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	48.4	1.4e-10
WP_004708679.1|1572631_1572874_-	DinI family protein	NA	K7PKM2	Enterobacterial_phage	73.4	3.5e-26
WP_004708676.1|1573141_1573864_-	LexA family transcriptional regulator	NA	F1C599	Cronobacter_phage	52.7	4.8e-63
WP_032910940.1|1574137_1574617_+	antitermination protein Q	NA	S5M7R9	Escherichia_phage	61.7	5.5e-39
WP_004708672.1|1574880_1575159_+	hypothetical protein	NA	H6WRZ3	Salmonella_phage	46.0	6.0e-14
WP_004708671.1|1575160_1575676_+	lysozyme	NA	A0A2H4JCH1	uncultured_Caudovirales_phage	61.4	1.9e-53
WP_032910938.1|1575672_1576002_+	DUF2570 domain-containing protein	NA	NA	NA	NA	NA
WP_004708664.1|1576331_1576862_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032910937.1|1576866_1577061_+	DUF2635 domain-containing protein	NA	NA	NA	NA	NA
WP_004708661.1|1577057_1578566_+|tail	phage tail sheath subtilisin-like domain-containing protein	tail	B5TK67	Pseudomonas_phage	44.6	4.3e-106
WP_004708659.1|1578600_1578969_+|tail	phage tail tube protein	tail	NA	NA	NA	NA
WP_004708656.1|1578970_1579270_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_004708654.1|1579390_1580986_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032910935.1|1581076_1582477_+	DNA circularization protein	NA	A0A2P9JZK2	Alteromonadaceae_phage	26.9	8.9e-21
WP_032911003.1|1582488_1583544_+|tail	tail protein	tail	M1PVV2	Vibrio_phage	28.9	3.4e-41
WP_004708648.1|1583557_1584154_+|plate	phage baseplate assembly protein	plate	NA	NA	NA	NA
WP_032910933.1|1584150_1584588_+	phage GP46 family protein	NA	A0A0C4UR04	Shigella_phage	43.8	7.1e-17
WP_004708645.1|1584591_1585728_+|plate	baseplate J/gp47 family protein	plate	B5TK75	Pseudomonas_phage	30.6	2.4e-32
WP_032910931.1|1585724_1586321_+	YmfQ family protein	NA	A0A2P9JZK7	Alteromonadaceae_phage	37.2	1.9e-33
WP_050129976.1|1587428_1587614_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004712760.1|1587744_1587897_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032912300.1|1587905_1588400_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032911527.1|1588454_1589021_+	recombinase family protein	NA	A0A1S6L009	Salmonella_phage	68.6	4.8e-66
>prophage 3
NZ_CP023964	Yersinia frederiksenii strain FDAARGOS_418 chromosome, complete genome	4934031	1944534	1985563	4934031	tail,integrase,plate,tRNA,terminase,head	Pectobacterium_phage(69.05%)	58	1944431:1944458	1992978:1993005
1944431:1944458	attL	ATAGGAATCGTATTCGGTCTTTTTTTAA	NA	NA	NA	NA
WP_032913217.1|1944534_1945617_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	52.6	2.4e-106
WP_032912248.1|1945591_1945858_-	excisionase	NA	A0A2H4J5E1	uncultured_Caudovirales_phage	42.9	8.6e-10
WP_032912247.1|1945930_1946443_-	siphovirus Gp157 family protein	NA	H9C156	Pectobacterium_phage	45.3	7.4e-34
WP_032912246.1|1946439_1948587_-	hypothetical protein	NA	H9C157	Pectobacterium_phage	35.9	4.9e-103
WP_004712689.1|1948600_1948873_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004712687.1|1949124_1949457_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086019124.1|1949470_1949644_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_004712686.1|1949665_1949884_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032912244.1|1950068_1950539_-	helix-turn-helix domain-containing protein	NA	A0A0U2QW76	Escherichia_phage	42.6	3.1e-26
WP_032912243.1|1950640_1950889_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_115155797.1|1950950_1951370_+|tRNA	tRNA-(guanine-N1)-methyltransferase	tRNA	H9C162	Pectobacterium_phage	53.5	3.9e-33
WP_032912242.1|1951383_1951635_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032912251.1|1952849_1953296_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	45.7	5.9e-35
WP_071985066.1|1953310_1953820_+	hypothetical protein	NA	H9C166	Pectobacterium_phage	43.8	1.5e-18
WP_032912241.1|1954117_1954300_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004712680.1|1954373_1954967_+	DUF1367 family protein	NA	H9C173	Pectobacterium_phage	57.9	1.3e-61
WP_032912240.1|1954975_1955260_+	DUF1364 domain-containing protein	NA	H9C174	Pectobacterium_phage	79.8	1.6e-38
WP_032912249.1|1955301_1955655_+	antitermination protein	NA	A0A0P0ZCW0	Stx2-converting_phage	72.6	7.1e-44
WP_032912239.1|1955645_1956071_-	hypothetical protein	NA	A0A1W5PTL2	Pseudoalteromonas_phage	57.1	7.1e-14
WP_032912238.1|1956318_1956513_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019082932.1|1956934_1957150_+	peptidoglycan-binding protein LysM	NA	H9C183	Pectobacterium_phage	55.6	4.0e-13
WP_004712366.1|1957149_1957680_+	lysozyme	NA	H9C184	Pectobacterium_phage	74.3	2.0e-74
WP_032912003.1|1957672_1958005_+	DUF2570 domain-containing protein	NA	NA	NA	NA	NA
WP_032912001.1|1957976_1958210_+	hypothetical protein	NA	NA	NA	NA	NA
WP_115155711.1|1958374_1958995_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032912000.1|1959020_1959596_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138070078.1|1959794_1960517_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004712360.1|1960962_1961472_+	ParB N-terminal domain-containing protein	NA	A0A0R6PD10	Moraxella_phage	50.0	3.9e-35
WP_032911997.1|1961468_1962083_+	hypothetical protein	NA	C9E2P8	Enterococcus_phage	61.6	2.3e-66
WP_004712358.1|1962085_1962346_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004712357.1|1962349_1963381_+|terminase	terminase small subunit	terminase	A0A248SKT2	Klebsiella_phage	42.4	1.7e-40
WP_032911996.1|1963634_1963874_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004712356.1|1963870_1964830_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004712355.1|1964959_1966603_+|terminase	phage terminase large subunit	terminase	H9C191	Pectobacterium_phage	84.8	3.1e-291
WP_004712354.1|1966605_1967991_+	DUF1073 domain-containing protein	NA	H9C192	Pectobacterium_phage	69.1	1.9e-188
WP_004712353.1|1968049_1968799_+|head	phage head morphogenesis protein	head	H9C193	Pectobacterium_phage	77.5	1.6e-106
WP_032911995.1|1968810_1970010_+	DUF2213 domain-containing protein	NA	H9C194	Pectobacterium_phage	77.5	2.1e-132
WP_032911993.1|1970009_1970531_+	hypothetical protein	NA	H9C195	Pectobacterium_phage	65.3	3.4e-50
WP_004712351.1|1970550_1971486_+	DUF2184 domain-containing protein	NA	H9C196	Pectobacterium_phage	82.3	1.6e-146
WP_004712350.1|1971488_1971869_+	hypothetical protein	NA	H9C197	Pectobacterium_phage	37.3	5.4e-13
WP_004712349.1|1971893_1972301_+	DUF4054 domain-containing protein	NA	H9C198	Pectobacterium_phage	75.0	9.1e-51
WP_032911991.1|1972297_1972765_+	hypothetical protein	NA	H9C199	Pectobacterium_phage	78.7	1.7e-64
WP_032911989.1|1972767_1973187_+	hypothetical protein	NA	H9C1A0	Pectobacterium_phage	73.6	8.4e-60
WP_004712347.1|1973186_1973747_+	hypothetical protein	NA	H9C1A1	Pectobacterium_phage	60.6	1.9e-54
WP_032911988.1|1973730_1974888_+	DUF3383 family protein	NA	H9C1A2	Pectobacterium_phage	75.8	1.8e-168
WP_004712345.1|1974894_1975299_+	hypothetical protein	NA	H9C1A3	Pectobacterium_phage	81.3	5.5e-56
WP_004712344.1|1975301_1975691_+	hypothetical protein	NA	H9C1A4	Pectobacterium_phage	58.9	9.3e-37
WP_032911985.1|1975950_1977480_+	DUF4041 domain-containing protein	NA	Q5G8X0	Enterobacteria_phage	75.9	1.1e-112
WP_004712342.1|1977610_1979272_+	glycoside hydrolase family 104 protein	NA	H9C1A7	Pectobacterium_phage	49.6	5.6e-139
WP_032911984.1|1979271_1979940_+	hypothetical protein	NA	H9C1A8	Pectobacterium_phage	48.4	3.3e-34
WP_032911983.1|1979939_1980230_+	hypothetical protein	NA	H9C1A9	Pectobacterium_phage	59.4	1.2e-25
WP_032911981.1|1980222_1981116_+	hypothetical protein	NA	A0A2I7QQH5	Vibrio_phage	29.6	4.6e-23
WP_004712339.1|1981123_1981801_+	hypothetical protein	NA	H9C1B1	Pectobacterium_phage	56.9	6.8e-67
WP_032911979.1|1981873_1982224_+	hypothetical protein	NA	H9C1B2	Pectobacterium_phage	64.7	2.2e-37
WP_032913218.1|1982223_1983423_+|plate	baseplate J/gp47 family protein	plate	H9C1B3	Pectobacterium_phage	65.8	1.1e-147
WP_004712337.1|1983415_1984060_+	DUF2612 domain-containing protein	NA	H9C1B4	Pectobacterium_phage	47.5	3.6e-41
WP_004712336.1|1984073_1985042_+	hypothetical protein	NA	A0A1J0GW57	Streptomyces_phage	50.0	3.7e-10
WP_032911978.1|1985041_1985563_+|tail	tail assembly chaperone	tail	A9DEL3	Yersinia_phage	51.1	5.2e-43
1992978:1993005	attR	ATAGGAATCGTATTCGGTCTTTTTTTAA	NA	NA	NA	NA
>prophage 4
NZ_CP023964	Yersinia frederiksenii strain FDAARGOS_418 chromosome, complete genome	4934031	2798410	2920569	4934031	tail,capsid,integrase,plate,lysis,portal,terminase,holin,head	Salmonella_phage(24.77%)	155	2884437:2884487	2920719:2920769
WP_004706424.1|2798410_2799415_-|integrase	tyrosine-type recombinase/integrase	integrase	Q94N03	Haemophilus_virus	54.3	4.5e-99
WP_004706423.1|2799439_2800243_-	DUF4393 domain-containing protein	NA	A0A0M4RU42	Bacillus_phage	31.4	5.3e-18
WP_032910103.1|2800275_2800815_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004706421.1|2800855_2801224_-	helix-turn-helix transcriptional regulator	NA	A0A2H4JFL3	uncultured_Caudovirales_phage	41.3	2.0e-12
WP_004706420.1|2801284_2801476_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004706419.1|2801488_2801692_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004706418.1|2801703_2801910_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032910101.1|2801906_2802221_+	hypothetical protein	NA	NA	NA	NA	NA
WP_115155702.1|2802205_2802358_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032910100.1|2802398_2802704_+	DUF5347 family protein	NA	NA	NA	NA	NA
WP_004706414.1|2802786_2802984_+	DUF2732 family protein	NA	NA	NA	NA	NA
WP_004706413.1|2802991_2803816_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1S6L011	Salmonella_phage	53.8	1.7e-75
WP_032910099.1|2803808_2806364_+	replication endonuclease	NA	A0A1S6L028	Salmonella_phage	36.5	8.1e-129
WP_032910097.1|2806344_2806575_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032910096.1|2806571_2806928_+	hypothetical protein	NA	H9C172	Pectobacterium_phage	43.6	5.5e-20
WP_032910095.1|2807278_2807998_+	DUF4393 domain-containing protein	NA	NA	NA	NA	NA
WP_004706408.1|2808133_2809000_-	DUF2971 domain-containing protein	NA	NA	NA	NA	NA
WP_032910094.1|2809861_2810893_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	65.5	7.7e-131
WP_050413871.1|2810889_2811615_-	hypothetical protein	NA	A0A1S6KZW3	Salmonella_phage	34.9	5.4e-30
WP_004706406.1|2811614_2813378_-	oxidoreductase	NA	A0A1S6KZW3	Salmonella_phage	64.3	1.2e-227
WP_032910093.1|2813546_2814359_+|capsid	GPO family capsid scaffolding protein	capsid	A0A1J0I2E9	Salmonella_phage	48.8	6.9e-58
WP_032913164.1|2814395_2815451_+|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	63.9	1.7e-125
WP_004706403.1|2815457_2816114_+	hypothetical protein	NA	F1BUQ7	Erwinia_phage	47.2	9.2e-45
WP_004706402.1|2816212_2816704_+|head	head completion/stabilization protein	head	A0A1S5NNA6	Burkholderia_phage	49.1	1.6e-33
WP_032910092.1|2816703_2816907_+|tail	tail protein X	tail	E5G6M9	Salmonella_phage	67.2	1.0e-23
WP_071985006.1|2816938_2817325_+|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_032910091.1|2817311_2817707_+	M15 family metallopeptidase	NA	A9DET4	Yersinia_phage	68.5	4.5e-47
WP_004706399.1|2817710_2818124_+|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	45.3	8.4e-20
WP_004706398.1|2818237_2818705_+|tail	phage tail protein	tail	F1BUP9	Erwinia_phage	56.6	3.4e-41
WP_032910090.1|2818701_2819148_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	47.3	3.0e-31
WP_004706396.1|2819312_2819948_+|plate	phage baseplate assembly protein V	plate	A0A0M4S6F6	Salmonella_phage	62.9	2.0e-65
WP_032910089.1|2819944_2820301_+	GPW/gp25 family protein	NA	F1BUP4	Erwinia_phage	60.0	1.3e-32
WP_004706395.1|2820300_2821209_+|plate	baseplate assembly protein	plate	F1BUP3	Erwinia_phage	73.5	1.9e-120
WP_032910088.1|2821201_2821810_+|tail	phage tail protein I	tail	F1BUP2	Erwinia_phage	75.0	5.3e-87
WP_004706392.1|2823253_2823436_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004706391.1|2823573_2824749_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	80.4	2.7e-180
WP_004706390.1|2824760_2825276_+|tail	phage major tail tube protein	tail	A0A218M4J0	Erwinia_phage	67.4	9.4e-61
WP_050413873.1|2825391_2825706_+|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	53.6	4.6e-18
WP_004706388.1|2825720_2825840_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_032910086.1|2825832_2828751_+|tail	phage tail tape measure protein	tail	Q9ZXK0	Pseudomonas_virus	47.3	1.3e-159
WP_004706386.1|2828762_2829227_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	65.4	2.1e-43
WP_086019095.1|2829232_2830330_+	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	66.4	1.9e-127
WP_004706384.1|2830404_2830620_+	ogr/Delta-like zinc finger family protein	NA	S4TNZ3	Salmonella_phage	60.6	8.2e-19
WP_004712479.1|2831044_2831287_+	DinI family protein	NA	K7PKR6	Enterobacteria_phage	70.1	1.6e-23
WP_004712480.1|2831300_2831546_+	DinI-like family protein	NA	S5MQI1	Escherichia_phage	42.5	5.0e-12
WP_032912088.1|2833042_2833717_-	DUF2612 domain-containing protein	NA	A9YX13	Burkholderia_phage	47.9	1.6e-52
WP_004712482.1|2833716_2834904_-|plate	baseplate J/gp47 family protein	plate	A0A0M4RD32	Salmonella_phage	56.3	4.8e-116
WP_004712483.1|2834904_2835258_-	hypothetical protein	NA	A0A2H4J629	uncultured_Caudovirales_phage	73.5	2.7e-43
WP_032912090.1|2835259_2835997_-	translation initiation factor IF-2	NA	A0A2H4J8H6	uncultured_Caudovirales_phage	58.4	1.0e-76
WP_032912091.1|2836057_2836426_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032912092.1|2836437_2836767_-	hypothetical protein	NA	A0A0M4RTY3	Salmonella_phage	63.0	1.3e-20
WP_004712487.1|2836766_2837780_-	hypothetical protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	61.6	3.7e-125
WP_032912093.1|2837833_2838142_-	hypothetical protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	42.4	1.3e-17
WP_004712489.1|2838138_2838720_-	hypothetical protein	NA	A0A0M3ULD5	Salmonella_phage	68.5	1.0e-63
WP_032912095.1|2838728_2840735_-	transglycosylase SLT domain-containing protein	NA	A0A0M4REK7	Salmonella_phage	63.1	7.5e-239
WP_069018196.1|2840731_2840902_-	lytic transglycosylase	NA	A0A2H4J1A2	uncultured_Caudovirales_phage	42.6	3.1e-05
WP_004712491.1|2840913_2841312_-	hypothetical protein	NA	A0A2H4J2V6	uncultured_Caudovirales_phage	60.6	1.7e-33
WP_004712492.1|2841322_2841763_-	DUF3277 family protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	70.5	3.1e-52
WP_004712493.1|2841774_2843250_-	DUF3383 domain-containing protein	NA	A0A0P0I492	Acinetobacter_phage	55.3	5.3e-149
WP_032912099.1|2843254_2843818_-	hypothetical protein	NA	A0A2H4J1A0	uncultured_Caudovirales_phage	61.1	7.1e-62
WP_032912101.1|2843783_2844182_-	hypothetical protein	NA	A0A0M3ULK0	Salmonella_phage	79.8	2.3e-54
WP_032912103.1|2844168_2844762_-	hypothetical protein	NA	A0A0M4S631	Salmonella_phage	54.6	8.9e-47
WP_032912104.1|2844758_2845163_-	DUF4054 domain-containing protein	NA	A0A2H4J1A6	uncultured_Caudovirales_phage	68.7	6.7e-46
WP_004712498.1|2845116_2845461_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004712499.1|2845498_2846443_-	DUF2184 domain-containing protein	NA	A0A2H4J191	uncultured_Caudovirales_phage	72.9	1.6e-135
WP_032912106.1|2846455_2846947_-	hypothetical protein	NA	A0A2H4JHM9	uncultured_Caudovirales_phage	62.2	1.8e-53
WP_004712501.1|2846950_2848177_-	DUF2213 domain-containing protein	NA	A0A2H4J159	uncultured_Caudovirales_phage	52.6	3.8e-108
WP_032912108.1|2848180_2848834_-|capsid	minor capsid protein	capsid	A0A2H4J8F5	uncultured_Caudovirales_phage	63.3	8.5e-75
WP_032912109.1|2848793_2850266_-	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	60.8	1.1e-178
WP_004712504.1|2850265_2851882_-	hypothetical protein	NA	A9YWZ6	Burkholderia_phage	73.2	8.7e-238
WP_032912110.1|2852111_2853131_-|terminase	terminase small subunit	terminase	A0A248SKT2	Klebsiella_phage	41.6	5.1e-42
WP_004712507.1|2853245_2853452_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032912112.1|2853555_2853741_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032912113.1|2853967_2854300_-	DUF2570 domain-containing protein	NA	NA	NA	NA	NA
WP_004712509.1|2854292_2854823_-	lysozyme	NA	H9C184	Pectobacterium_phage	71.4	9.3e-72
WP_019082932.1|2854822_2855038_-	peptidoglycan-binding protein LysM	NA	H9C183	Pectobacterium_phage	55.6	4.0e-13
WP_115155791.1|2855102_2855825_-	protein mom	NA	A0A0C4UQZ7	Shigella_phage	68.6	7.4e-88
WP_032912166.1|2856114_2856687_-	DUF1133 family protein	NA	NA	NA	NA	NA
WP_032912168.1|2856683_2856968_-	DUF1364 domain-containing protein	NA	H9C174	Pectobacterium_phage	77.7	8.9e-37
WP_004712579.1|2856976_2857570_-	DUF1367 family protein	NA	H9C173	Pectobacterium_phage	55.8	2.2e-61
WP_004712580.1|2857675_2858095_-	DUF2513 domain-containing protein	NA	NA	NA	NA	NA
WP_032912170.1|2858123_2858477_-	hypothetical protein	NA	H9C172	Pectobacterium_phage	59.0	2.4e-31
WP_032912172.1|2858469_2859309_-	DNA adenine methylase	NA	R4JMC6	Burkholderia_phage	45.7	1.4e-61
WP_032912174.1|2859305_2861501_-	DNA cytosine methyltransferase	NA	H9C171	Pectobacterium_phage	53.0	6.7e-233
WP_004712585.1|2861497_2862004_-	hypothetical protein	NA	L0ASX3	Klebsiella_phage	39.7	3.2e-05
WP_032912176.1|2862000_2862252_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032912178.1|2862256_2862637_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032912180.1|2862681_2864055_-	replicative DNA helicase	NA	Q8HA30	Enterobacteria_phage	48.4	1.1e-111
WP_004712587.1|2864051_2865092_-	hypothetical protein	NA	A0A2H4JAA4	uncultured_Caudovirales_phage	50.0	2.0e-25
WP_004712588.1|2865094_2865319_-	hypothetical protein	NA	H9C163	Pectobacterium_phage	68.9	5.2e-24
WP_004712589.1|2865335_2865800_-	hypothetical protein	NA	H9C162	Pectobacterium_phage	54.7	1.5e-33
WP_032912182.1|2865860_2866046_-	Cro/Cl family transcriptional regulator	NA	H9C161	Pectobacterium_phage	70.5	3.2e-19
WP_172460457.1|2866137_2866800_+	LexA family transcriptional regulator	NA	H9C160	Pectobacterium_phage	71.4	3.0e-88
WP_004712593.1|2866981_2867134_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032912184.1|2867447_2867783_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004712595.1|2867838_2870037_+	hypothetical protein	NA	H9C157	Pectobacterium_phage	45.1	4.0e-169
WP_032912186.1|2870033_2870534_+	siphovirus Gp157 family protein	NA	H9C156	Pectobacterium_phage	75.5	1.8e-61
WP_032912188.1|2871137_2871371_+	DUF4224 domain-containing protein	NA	H9C153	Pectobacterium_phage	50.0	3.1e-11
WP_004712599.1|2871370_2872381_+|integrase	tyrosine-type recombinase/integrase	integrase	K7PLZ2	Enterobacterial_phage	66.4	6.0e-128
WP_019080796.1|2872939_2873488_-	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_032910814.1|2873546_2875379_-	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
WP_032910813.1|2875371_2876028_-	UvrY/SirA/GacA family response regulator transcription factor	NA	NA	NA	NA	NA
WP_004708316.1|2876721_2876946_+	DUF2594 family protein	NA	NA	NA	NA	NA
WP_004708315.1|2877058_2877397_+	GlpM family protein	NA	NA	NA	NA	NA
WP_004708314.1|2877428_2877683_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032910812.1|2878088_2879660_+	MCP four helix bundle domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	28.4	5.9e-13
WP_004708311.1|2879764_2881255_-	alpha-amylase	NA	NA	NA	NA	NA
WP_004708310.1|2881401_2881731_+	DHCW motif cupin fold protein	NA	NA	NA	NA	NA
WP_004708309.1|2881813_2882311_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004708308.1|2882704_2883439_+	class I SAM-dependent methyltransferase	NA	A0A1X9I6N4	Streptococcus_phage	42.8	1.2e-53
2884437:2884487	attL	TTTGTTGGTGGGTCGTGCAGGGTTCGAACCTGCGACCAATTGATTAAGAGT	NA	NA	NA	NA
WP_004708307.1|2884619_2887910_-	DEAD/DEAH box helicase	NA	NA	NA	NA	NA
WP_004708306.1|2887911_2888691_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004708305.1|2888756_2889761_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	62.4	7.1e-121
WP_004708304.1|2889768_2890359_-	phage repressor protein CI	NA	A0A0M4RE65	Salmonella_phage	37.6	1.2e-30
WP_004708303.1|2890565_2890745_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004708302.1|2890772_2891294_+	phage regulatory CII family protein	NA	A0A0M4QWN1	Salmonella_phage	38.3	2.3e-22
WP_004708301.1|2891294_2891753_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004708300.1|2891954_2892131_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050413892.1|2892127_2892637_+	hypothetical protein	NA	M1SV55	Escherichia_phage	54.5	3.0e-43
WP_050121987.1|2892704_2892956_+	DUF2732 family protein	NA	NA	NA	NA	NA
WP_032910811.1|2892967_2893186_+	TraR/DksA family transcriptional regulator	NA	Q6K1F5	Salmonella_virus	50.7	1.5e-12
WP_004708296.1|2893182_2895453_+	replication endonuclease	NA	U5N0W3	Enterobacteria_phage	59.7	1.9e-262
WP_032910810.1|2895565_2895751_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004708295.1|2895946_2896177_+	type II toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_032910809.1|2896399_2897530_+	DNA cytosine methyltransferase	NA	M1PSQ0	Streptococcus_phage	33.4	2.8e-41
WP_032910808.1|2897486_2898479_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_153802879.1|2898521_2898668_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004708292.1|2898664_2900062_+	RES family NAD+ phosphorylase	NA	NA	NA	NA	NA
WP_032910807.1|2900143_2901172_-|portal	phage portal protein	portal	F1BUR7	Erwinia_phage	74.6	2.1e-152
WP_004708291.1|2901171_2902935_-|terminase	terminase ATPase subunit family protein	terminase	F1BUR2	Erwinia_phage	81.1	6.9e-289
WP_004708290.1|2903077_2903899_+|capsid	GPO family capsid scaffolding protein	capsid	Q6K1I7	Salmonella_virus	62.5	7.1e-95
WP_004708289.1|2903920_2904988_+|capsid	phage major capsid protein, P2 family	capsid	Q778Y7	Enterobacteria_phage	72.8	3.4e-145
WP_032910806.1|2904991_2905654_+|terminase	terminase endonuclease subunit	terminase	F1BUQ7	Erwinia_phage	67.4	4.3e-74
WP_004708287.1|2905743_2906250_+|head	head completion/stabilization protein	head	M1SNN6	Escherichia_phage	77.5	1.3e-70
WP_032910805.1|2906249_2906453_+|tail	tail protein X	tail	A0A0F7LCN2	Escherichia_phage	85.1	5.0e-26
WP_032910804.1|2906443_2906665_+	hypothetical protein	NA	A0A218M4L5	Erwinia_phage	69.9	7.9e-25
WP_032910803.1|2906648_2907158_+	lysozyme	NA	A0A218M4K3	Erwinia_phage	82.6	4.6e-76
WP_032910802.1|2907154_2907580_+|lysis	LysB family phage lysis regulatory protein	lysis	O80310	Escherichia_phage	66.7	2.0e-40
WP_004708283.1|2907675_2908143_+|tail	phage tail protein	tail	A0A0F7LA33	Escherichia_phage	78.7	1.4e-68
WP_032910801.1|2908135_2908582_+	phage virion morphogenesis protein	NA	A0A218M4K4	Erwinia_phage	70.1	6.5e-50
WP_004708279.1|2908585_2909356_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004708278.1|2909475_2910111_+|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	80.1	2.6e-92
WP_032910800.1|2910107_2910455_+	GPW/gp25 family protein	NA	A0A0F7LDQ1	Escherichia_phage	73.9	3.5e-43
WP_004708273.1|2910459_2911368_+|plate	baseplate assembly protein	plate	A0A218M4K5	Erwinia_phage	80.5	1.9e-133
WP_032910799.1|2911360_2911966_+|tail	phage tail protein I	tail	A0A218M4J3	Erwinia_phage	75.9	4.6e-83
WP_032910798.1|2911970_2913251_+|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	45.6	9.7e-107
WP_004708267.1|2913253_2913832_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	42.9	1.1e-41
WP_004708266.1|2913961_2915152_+|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	90.1	3.1e-208
WP_004708265.1|2915164_2915683_+|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	90.7	5.3e-88
WP_004708264.1|2915744_2916023_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	85.1	2.9e-32
WP_071777697.1|2916058_2916178_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	89.7	2.6e-14
WP_004708262.1|2916170_2918615_+|tail	phage tail tape measure protein	tail	M1T2S3	Escherichia_phage	69.0	1.0e-258
WP_032910797.1|2918627_2919107_+|tail	phage tail protein	tail	A0A0F7LDE8	Escherichia_phage	78.5	3.3e-68
WP_004708260.1|2919106_2920267_+	phage late control D family protein	NA	A0A0M5M5V5	Salmonella_phage	78.4	2.1e-169
WP_071985026.1|2920350_2920569_+	ogr/Delta-like zinc finger family protein	NA	E5G6Q4	Salmonella_phage	58.3	7.1e-18
2920719:2920769	attR	TTTGTTGGTGGGTCGTGCAGGGTTCGAACCTGCGACCAATTGATTAAGAGT	NA	NA	NA	NA
>prophage 5
NZ_CP023964	Yersinia frederiksenii strain FDAARGOS_418 chromosome, complete genome	4934031	3002110	3014435	4934031		Paramecium_bursaria_Chlorella_virus(16.67%)	8	NA	NA
WP_004708116.1|3002110_3004810_-	magnesium-translocating P-type ATPase	NA	M1HLC0	Paramecium_bursaria_Chlorella_virus	25.1	5.3e-46
WP_032910766.1|3005082_3005781_-	MgtC family protein	NA	G3MA03	Bacillus_virus	41.0	6.2e-15
WP_153802878.1|3006329_3006476_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004708109.1|3007100_3008840_+	Tar ligand binding domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	30.6	1.1e-09
WP_004708108.1|3008973_3009165_-	protein DsrB	NA	NA	NA	NA	NA
WP_002210893.1|3009409_3009622_-	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	80.0	2.0e-25
WP_004708106.1|3010101_3011136_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	53.6	4.9e-85
WP_004708104.1|3011285_3014435_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	62.6	0.0e+00
