The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP023962	Yersinia frederiksenii strain FDAARGOS_417 chromosome, complete genome	5000678	472723	528688	5000678	protease,capsid,terminase,head,plate,tail,tRNA,integrase,portal	Salmonella_phage(21.05%)	63	471452:471466	522106:522120
471452:471466	attL	CAGTGATTGGCTTGA	NA	NA	NA	NA
WP_098904261.1|472723_473848_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	Q77Z04	Phage_21	58.6	5.7e-119
WP_025379097.1|473831_474074_-	excisionase	NA	NA	NA	NA	NA
WP_098904262.1|474656_475220_-	hypothetical protein	NA	NA	NA	NA	NA
WP_098904263.1|476004_476535_-	hypothetical protein	NA	K7PKJ9	Enterobacteria_phage	56.4	1.6e-47
WP_098904264.1|476628_477450_-	YfdQ family protein	NA	Q8HAA2	Salmonella_phage	60.7	7.1e-87
WP_098904265.1|477498_477855_-	hypothetical protein	NA	A0A2R2X2A9	Escherichia_phage	67.0	4.5e-38
WP_050879402.1|478330_478567_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050879412.1|478534_478714_-	hypothetical protein	NA	NA	NA	NA	NA
WP_098904266.1|479125_479446_-	hypothetical protein	NA	NA	NA	NA	NA
WP_098904267.1|479438_479852_-	hypothetical protein	NA	NA	NA	NA	NA
WP_098904268.1|480531_480789_+	helix-turn-helix domain-containing protein	NA	D0UIL8	Aggregatibacter_phage	55.2	2.0e-11
WP_057645719.1|480817_481345_+	hypothetical protein	NA	NA	NA	NA	NA
WP_098904269.1|481510_481711_+	DUF4222 domain-containing protein	NA	A0A1W6JP38	Morganella_phage	52.9	2.5e-09
WP_098904270.1|481707_482808_+	hypothetical protein	NA	K7PLZ7	Enterobacterial_phage	47.6	1.8e-40
WP_098904271.1|482804_484724_+	phage N-6-adenine-methyltransferase	NA	Q8HA94	Salmonella_phage	55.5	1.0e-91
WP_098904272.1|484720_486487_+	DNA cytosine methyltransferase	NA	H9C171	Pectobacterium_phage	58.1	4.3e-222
WP_098905215.1|486510_487155_+	phage antirepressor KilAC domain-containing protein	NA	G0ZND1	Cronobacter_phage	53.1	1.6e-54
WP_098904273.1|487151_488153_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	49.4	7.6e-91
WP_050146793.1|488178_488841_+	hypothetical protein	NA	I6PDF8	Cronobacter_phage	36.6	3.1e-32
WP_042806577.1|489781_490063_+	hypothetical protein	NA	H6WRZ3	Salmonella_phage	48.9	3.1e-18
WP_057645835.1|490062_490584_+	lysozyme	NA	I6PBN2	Cronobacter_phage	57.9	1.0e-46
WP_019210741.1|490672_491200_+	DUF2514 family protein	NA	Q7Y3V2	Yersinia_phage	90.2	4.3e-77
WP_004390466.1|491578_491782_+	hypothetical protein	NA	A0A1L6Z528	Klebsiella_phage	75.0	6.6e-18
WP_045844189.1|491874_492204_+	HNH endonuclease	NA	F1C587	Cronobacter_phage	63.3	7.4e-35
WP_049602739.1|492355_492823_+|terminase	phage terminase small subunit P27 family	terminase	Q9B019	Phage_GMSE-1	59.1	2.5e-44
WP_098904274.1|492776_494522_+|terminase	terminase large subunit	terminase	A0A0U2C138	Paracoccus_phage	45.0	4.4e-134
WP_098904275.1|494521_495826_+|portal	phage portal protein	portal	K7PJU5	Enterobacteria_phage	77.9	1.3e-199
WP_098904276.1|495838_496696_+|protease	Clp protease ClpP	protease	K7PH05	Enterobacteria_phage	72.6	1.1e-111
WP_057643861.1|496708_497926_+|capsid	phage major capsid protein	capsid	K7PM57	Enterobacteria_phage	76.0	6.7e-174
WP_192941408.1|498083_498314_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049611640.1|498312_498624_+|head,tail	phage gp6-like head-tail connector protein	head,tail	K7PKT4	Enterobacteria_phage	52.8	4.2e-24
WP_098904277.1|498626_499019_+|head	phage head closure protein	head	NA	NA	NA	NA
WP_050090300.1|499018_499537_+	hypothetical protein	NA	Q8HAC8	Salmonella_phage	56.8	1.7e-49
WP_050297043.1|499533_500085_+	hypothetical protein	NA	S5FM61	Shigella_phage	57.6	6.1e-58
WP_098904278.1|500091_500298_+	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	71.4	3.9e-10
WP_098904279.1|500294_501788_+|tail	phage tail sheath subtilisin-like domain-containing protein	tail	A0A192Y7L1	Salmonella_phage	69.2	5.5e-186
WP_050127560.1|501788_502145_+|tail	phage tail tube protein	tail	U5P076	Shigella_phage	86.4	4.1e-55
WP_098904280.1|502141_502423_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_098904281.1|502546_504427_+|tail	phage tail tape measure protein	tail	A0A192Y6D8	Salmonella_phage	54.1	1.9e-175
WP_098904282.1|504477_505782_+	DNA circularization N-terminal domain-containing protein	NA	S5FUX4	Shigella_phage	56.1	3.8e-135
WP_098904283.1|505778_506852_+|plate	baseplate protein	plate	U5P0H6	Shigella_phage	65.2	3.0e-133
WP_057645653.1|506851_507418_+|plate	phage baseplate assembly protein	plate	Q8HAB9	Salmonella_phage	48.6	3.5e-32
WP_050874976.1|507421_507835_+	phage GP46 family protein	NA	A0A192Y6D0	Salmonella_phage	59.9	2.7e-42
WP_050874971.1|508875_509457_+	YmfQ family protein	NA	O22003	Shigella_phage	64.6	3.9e-71
WP_098904284.1|509463_510456_+	hypothetical protein	NA	U5P0I1	Shigella_phage	47.6	1.5e-22
WP_098904285.1|510461_510695_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054872397.1|510737_510947_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050082661.1|511672_512152_-|tRNA	Cys-tRNA(Pro)/Cys-tRNA(Cys) deacylase YbaK	tRNA	NA	NA	NA	NA
WP_050082662.1|512419_513238_-	TraB/GumN family protein	NA	NA	NA	NA	NA
WP_050082664.1|513348_516054_-	copper-exporting P-type ATPase CopA	NA	A0A218MNH6	uncultured_virus	35.9	4.4e-109
WP_050286514.1|516263_516725_+	Cu(I)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_049605767.1|516833_517283_-	NfeD family protein	NA	NA	NA	NA	NA
WP_005158246.1|517285_518200_-	SPFH/Band 7/PHB domain protein	NA	NA	NA	NA	NA
WP_050082668.1|518424_519279_-	co-chaperone YbbN	NA	NA	NA	NA	NA
WP_050082669.1|519356_520133_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_050082670.1|520193_520826_-|protease	multifunctional acyl-CoA thioesterase I/protease I/lysophospholipase L1	protease	NA	NA	NA	NA
WP_049605762.1|520796_521483_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.2	1.2e-31
WP_098904286.1|521479_523912_+	ABC transporter permease	NA	NA	NA	NA	NA
522106:522120	attR	CAGTGATTGGCTTGA	NA	NA	NA	NA
WP_050082672.1|524005_525079_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_050873579.1|525075_525600_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	NA	NA	NA	NA
WP_050286509.1|525794_526517_-	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_019212822.1|526527_527022_-	peptidylprolyl isomerase B	NA	NA	NA	NA	NA
WP_050082678.1|527302_528688_+|tRNA	cysteine--tRNA ligase	tRNA	A0A0G2Y344	Acanthamoeba_polyphaga_mimivirus	29.9	2.9e-40
>prophage 2
NZ_CP023962	Yersinia frederiksenii strain FDAARGOS_417 chromosome, complete genome	5000678	540130	581214	5000678	capsid,terminase,head,plate,tail,integrase,holin	uncultured_Caudovirales_phage(28.89%)	65	579674:579692	585275:585293
WP_019212809.1|540130_540997_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	34.6	1.1e-32
WP_087770159.1|541362_541545_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_098904289.1|541547_541952_-	Rrf2 family transcriptional regulator	NA	U5P451	Shigella_phage	42.6	2.3e-06
WP_098904290.1|541953_542190_-	hypothetical protein	NA	NA	NA	NA	NA
WP_098905217.1|542282_542630_-	hypothetical protein	NA	A0A1B5FPL8	Escherichia_phage	52.7	3.5e-27
WP_098904291.1|542632_542854_-	hypothetical protein	NA	A0A286S2B3	Klebsiella_phage	52.7	1.1e-13
WP_098904292.1|542850_542976_-	sodium:solute symporter	NA	NA	NA	NA	NA
WP_098905218.1|542972_543758_-	Rha family transcriptional regulator	NA	B1GS65	Salmonella_phage	53.3	6.7e-18
WP_138070043.1|543789_544188_-	hypothetical protein	NA	NA	NA	NA	NA
WP_098904294.1|544191_544410_-	hypothetical protein	NA	NA	NA	NA	NA
WP_098904295.1|544406_544754_-	hypothetical protein	NA	NA	NA	NA	NA
WP_098904296.1|544831_545302_-	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	39.1	1.5e-12
WP_098904297.1|545305_545689_-	S24 family peptidase	NA	NA	NA	NA	NA
WP_098904298.1|545681_545897_-	hypothetical protein	NA	NA	NA	NA	NA
WP_098904299.1|545886_546090_-	hypothetical protein	NA	NA	NA	NA	NA
WP_098904300.1|546079_546286_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138070044.1|546282_546561_-	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_098904301.1|546560_546755_-	hypothetical protein	NA	NA	NA	NA	NA
WP_098904302.1|546751_546970_-	hypothetical protein	NA	NA	NA	NA	NA
WP_098904303.1|547172_547925_-	helix-turn-helix transcriptional regulator	NA	A0A2I6PIE7	Escherichia_phage	43.4	1.6e-29
WP_087770142.1|548043_548253_+	helix-turn-helix domain-containing protein	NA	U5P445	Shigella_phage	50.9	5.4e-07
WP_098904304.1|548256_548517_+	hypothetical protein	NA	NA	NA	NA	NA
WP_098904305.1|548533_548821_+	hypothetical protein	NA	A0A1B5FPB9	Escherichia_phage	69.7	2.0e-28
WP_098904306.1|549154_550771_+	DEAD/DEAH box helicase	NA	A0A286N2P9	Klebsiella_phage	79.6	1.4e-248
WP_098904307.1|550767_551730_+	toprim domain-containing protein	NA	A0A286N2Q0	Klebsiella_phage	80.0	1.1e-152
WP_098904308.1|551729_552509_+	antitermination protein	NA	A0A286N2Q2	Klebsiella_phage	48.1	1.1e-63
WP_098904309.1|552771_553341_+	hypothetical protein	NA	NA	NA	NA	NA
WP_192941409.1|553321_553465_-	hypothetical protein	NA	NA	NA	NA	NA
WP_098905220.1|553628_554384_+	hypothetical protein	NA	A0A0M4RCP6	Salmonella_phage	67.3	5.9e-104
WP_050146797.1|554583_554904_+|holin	phage holin family protein	holin	E7C9S8	Salmonella_phage	57.4	4.2e-27
WP_098904310.1|554890_555289_+	M15 family metallopeptidase	NA	E7C9S9	Salmonella_phage	62.4	9.2e-40
WP_098905221.1|555306_555807_+	hypothetical protein	NA	Q7Y3V2	Yersinia_phage	74.7	3.7e-62
WP_098904311.1|556203_556584_+	hypothetical protein	NA	NA	NA	NA	NA
WP_098905222.1|556605_557175_+|terminase	terminase small subunit	terminase	A0A2R3UAN5	Myoviridae_environmental_samples	49.2	2.2e-39
WP_098904312.1|557462_558806_+|terminase	PBSX family phage terminase large subunit	terminase	A0A220NQL3	Acinetobacter_phage	57.7	1.6e-144
WP_098904313.1|558805_560278_+	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	61.4	4.1e-178
WP_098905223.1|560228_560912_+|capsid	minor capsid protein	capsid	A0A2H4J8F5	uncultured_Caudovirales_phage	60.9	3.9e-70
WP_098904314.1|561158_562385_+	DUF2213 domain-containing protein	NA	A0A2H4J159	uncultured_Caudovirales_phage	52.4	1.4e-107
WP_050874928.1|562388_562880_+	hypothetical protein	NA	A0A2H4JHM9	uncultured_Caudovirales_phage	64.0	7.3e-55
WP_098904315.1|562892_563837_+	DUF2184 domain-containing protein	NA	A0A2H4J191	uncultured_Caudovirales_phage	72.9	3.6e-135
WP_138070045.1|563874_564219_+	hypothetical protein	NA	NA	NA	NA	NA
WP_098904316.1|564172_564577_+	DUF4054 domain-containing protein	NA	A0A2H4J1A6	uncultured_Caudovirales_phage	67.9	8.7e-46
WP_192941410.1|564573_565167_+	hypothetical protein	NA	A0A0M4S631	Salmonella_phage	54.1	7.5e-46
WP_098904317.1|565153_565552_+|head,tail	head-tail adaptor	head,tail	A0A0M3ULK0	Salmonella_phage	79.8	3.3e-53
WP_098904318.1|565517_566081_+	hypothetical protein	NA	A0A2H4J1A0	uncultured_Caudovirales_phage	62.8	6.4e-63
WP_098904319.1|566083_567559_+	DUF3383 domain-containing protein	NA	A0A0P0I492	Acinetobacter_phage	54.5	9.3e-146
WP_098904320.1|567570_568011_+	DUF3277 family protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	69.2	2.0e-51
WP_098904321.1|568021_568420_+	hypothetical protein	NA	A0A2H4J2V6	uncultured_Caudovirales_phage	61.4	2.6e-34
WP_098904322.1|568419_568611_+	lytic transglycosylase	NA	A0A2H4J1A2	uncultured_Caudovirales_phage	46.0	1.9e-06
WP_098904323.1|568597_570568_+	lytic transglycosylase	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	48.1	5.2e-168
WP_098904324.1|570576_571158_+	hypothetical protein	NA	A0A0M3ULD5	Salmonella_phage	67.0	2.3e-63
WP_192941411.1|571154_571463_+	hypothetical protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	44.4	1.5e-18
WP_098904325.1|571517_572531_+	hypothetical protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	60.3	1.5e-123
WP_098904326.1|572536_572887_+	hypothetical protein	NA	A0A0M4RTY3	Salmonella_phage	64.1	7.1e-20
WP_098905227.1|573000_573267_+	hypothetical protein	NA	NA	NA	NA	NA
WP_098904327.1|573327_574071_+|plate	phage baseplate protein	plate	A0A0M5M1K7	Salmonella_phage	59.8	1.6e-77
WP_098904328.1|574067_574421_+	hypothetical protein	NA	A0A2H4J629	uncultured_Caudovirales_phage	75.2	5.5e-44
WP_098904329.1|574421_575609_+|plate	baseplate J/gp47 family protein	plate	A0A0M4RD32	Salmonella_phage	55.6	1.4e-115
WP_098904330.1|575608_576283_+	DUF2612 domain-containing protein	NA	A9YX13	Burkholderia_phage	48.8	6.1e-52
WP_098905228.1|576326_577586_+|tail	tail fiber protein	tail	Q9MCR6	Enterobacteria_phage	38.1	6.3e-34
WP_098904331.1|577585_578209_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	45.9	2.5e-36
WP_098904332.1|578393_578945_-	hypothetical protein	NA	NA	NA	NA	NA
WP_098904333.1|578937_579465_-	DUF4065 domain-containing protein	NA	D0UIM3	Aggregatibacter_phage	41.1	1.3e-20
WP_098905229.1|579668_579905_-	DinI-like family protein	NA	K7PM44	Enterobacteria_phage	51.3	4.6e-15
579674:579692	attL	CCTGAAACCAATCATCAGC	NA	NA	NA	NA
WP_098905230.1|579963_581214_-|integrase	site-specific integrase	integrase	A0A248SL35	Klebsiella_phage	31.1	1.3e-34
WP_098905230.1|579963_581214_-|integrase	site-specific integrase	integrase	A0A248SL35	Klebsiella_phage	31.1	1.3e-34
585275:585293	attR	CCTGAAACCAATCATCAGC	NA	NA	NA	NA
>prophage 3
NZ_CP023962	Yersinia frederiksenii strain FDAARGOS_417 chromosome, complete genome	5000678	1154820	1232687	5000678	protease,capsid,terminase,head,plate,tail,tRNA,integrase,portal	Shigella_phage(38.1%)	86	1154913:1154927	1185297:1185311
WP_098904423.1|1154820_1155942_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
1154913:1154927	attL	CTGGCGTTACCGCAG	NA	NA	NA	NA
WP_050081587.1|1156143_1156590_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_098904424.1|1156582_1157209_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_050081583.1|1157339_1158593_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	87.0	8.8e-20
WP_019209644.1|1158716_1159841_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	Q77Z04	Phage_21	58.9	6.9e-125
WP_057643017.1|1159824_1160067_-	excisionase	NA	NA	NA	NA	NA
WP_098904425.1|1160194_1160833_-	hypothetical protein	NA	Q1MVG0	Enterobacteria_phage	64.6	5.9e-81
WP_057645923.1|1161709_1162240_-	hypothetical protein	NA	Q8SBG0	Shigella_phage	58.4	1.2e-50
WP_098904426.1|1162287_1162527_-	hypothetical protein	NA	NA	NA	NA	NA
WP_098904427.1|1162605_1163514_-	recombination-associated protein RdgC	NA	A0A1W6JP69	Morganella_phage	43.2	2.9e-57
WP_138070049.1|1163827_1164091_-	hypothetical protein	NA	NA	NA	NA	NA
WP_098904429.1|1164351_1165014_-	LexA family transcriptional regulator	NA	U5P0T5	Shigella_phage	74.7	1.5e-95
WP_098904430.1|1165102_1165354_+	transcriptional regulator	NA	U5P445	Shigella_phage	69.8	3.7e-18
WP_098904431.1|1165346_1165880_+	DNA-binding protein	NA	Q8SBF4	Shigella_phage	32.3	1.3e-12
WP_098904432.1|1166045_1166243_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_098904433.1|1166239_1167247_+	conserved phage C-terminal domain-containing protein	NA	U5P0A0	Shigella_phage	73.4	8.1e-32
WP_098904434.1|1167243_1167873_+	S-adenosylmethionine-binding protein	NA	A0A193GYV6	Enterobacter_phage	76.2	1.9e-79
WP_098905240.1|1167896_1168541_+	phage antirepressor KilAC domain-containing protein	NA	G0ZND1	Cronobacter_phage	52.7	4.8e-54
WP_098904435.1|1168537_1169539_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	49.7	6.9e-92
WP_098904436.1|1169612_1170035_+	antitermination protein Q	NA	S5M7R9	Escherichia_phage	58.5	1.8e-33
WP_050118249.1|1170199_1170844_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038892741.1|1170936_1171692_+	hypothetical protein	NA	A0A0M4RCP6	Salmonella_phage	67.7	1.6e-104
WP_098904437.1|1171894_1172212_+	hypothetical protein	NA	H6WRZ3	Salmonella_phage	63.2	7.1e-27
WP_098904438.1|1172195_1172702_+	lysozyme	NA	I6PBN2	Cronobacter_phage	63.0	1.5e-50
WP_098904439.1|1172686_1173022_+	DUF2570 domain-containing protein	NA	NA	NA	NA	NA
WP_098904440.1|1173566_1173917_+	HNH endonuclease	NA	A0A1W6JP27	Morganella_phage	69.0	6.4e-45
WP_098904441.1|1174053_1174509_+|terminase	P27 family phage terminase small subunit	terminase	A0A1J0GV10	Halomonas_phage	52.9	1.3e-24
WP_098904442.1|1174511_1176242_+|terminase	terminase large subunit	terminase	Q8W631	Enterobacteria_phage	61.2	8.8e-212
WP_098904443.1|1176252_1176441_+	hypothetical protein	NA	S5FXQ9	Shigella_phage	50.0	4.4e-08
WP_098904444.1|1176440_1177670_+|portal	phage portal protein	portal	Q8W629	Enterobacteria_phage	81.0	7.9e-191
WP_098904445.1|1177659_1178310_+|head,protease	HK97 family phage prohead protease	head,protease	U5P4H2	Shigella_phage	81.9	6.9e-101
WP_098904446.1|1178325_1179534_+|capsid	phage major capsid protein	capsid	M1FPN2	Enterobacteria_phage	78.3	1.7e-177
WP_192941413.1|1179585_1179855_+	hypothetical protein	NA	NA	NA	NA	NA
WP_098904447.1|1179873_1180188_+|head,tail	phage gp6-like head-tail connector protein	head,tail	S5FKK6	Shigella_phage	53.8	8.6e-25
WP_098904448.1|1180184_1180577_+|head	phage head closure protein	head	NA	NA	NA	NA
WP_098904449.1|1180576_1181095_+	hypothetical protein	NA	M1FPE2	Enterobacteria_phage	58.6	5.7e-50
WP_098904450.1|1181091_1181643_+	hypothetical protein	NA	S5FM61	Shigella_phage	57.6	3.0e-57
WP_098904451.1|1181649_1181856_+	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	71.4	3.9e-10
WP_098904452.1|1181852_1183343_+|tail	phage tail sheath subtilisin-like domain-containing protein	tail	A0A192Y7L1	Salmonella_phage	66.6	2.9e-179
WP_050127560.1|1183343_1183700_+|tail	phage tail tube protein	tail	U5P076	Shigella_phage	86.4	4.1e-55
WP_098904453.1|1183696_1183978_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_098904454.1|1184101_1185982_+|tail	phage tail tape measure protein	tail	Q8HAC2	Salmonella_phage	54.4	7.4e-172
1185297:1185311	attR	CTGGCGTTACCGCAG	NA	NA	NA	NA
WP_098904455.1|1185994_1186483_+	hypothetical protein	NA	NA	NA	NA	NA
WP_098904456.1|1186542_1187847_+	DNA circularization N-terminal domain-containing protein	NA	S5FUX4	Shigella_phage	57.1	1.3e-135
WP_098904457.1|1187843_1188914_+|plate	baseplate protein	plate	U5P0H6	Shigella_phage	64.6	1.1e-132
WP_098904458.1|1188913_1189480_+|plate	phage baseplate assembly protein	plate	A0A192Y8K5	Salmonella_phage	50.6	4.5e-32
WP_098904459.1|1189483_1189897_+	phage GP46 family protein	NA	Q8HAB8	Salmonella_phage	58.4	1.0e-41
WP_098904460.1|1189889_1190948_+|plate	baseplate J/gp47 family protein	plate	U5P424	Shigella_phage	63.4	5.9e-134
WP_098904461.1|1190938_1191520_+	YmfQ family protein	NA	O22003	Shigella_phage	63.9	5.1e-71
WP_186381546.1|1191524_1192193_+	hypothetical protein	NA	O22004	Shigella_phage	44.6	2.3e-35
WP_098904462.1|1192195_1192672_+|tail	phage tail protein	tail	F1BUP0	Erwinia_phage	47.4	1.4e-39
WP_098904463.1|1192723_1192960_-	hypothetical protein	NA	NA	NA	NA	NA
WP_098904464.1|1193160_1196028_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	53.4	3.0e-108
WP_098905241.1|1196501_1196744_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138070050.1|1196912_1197134_+	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	85.2	3.4e-20
WP_050873387.1|1197883_1198348_-	GyrI-like domain-containing protein	NA	NA	NA	NA	NA
WP_057650675.1|1199049_1199688_+	DUF1120 domain-containing protein	NA	NA	NA	NA	NA
WP_050081579.1|1199844_1200558_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_098904466.1|1200629_1201442_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_050081576.1|1201615_1202785_-	MFS transporter	NA	NA	NA	NA	NA
WP_098904467.1|1203045_1204071_-	ROK family protein	NA	NA	NA	NA	NA
WP_050081847.1|1204277_1204634_+	DUF488 family protein	NA	NA	NA	NA	NA
WP_050081571.1|1204708_1206238_-	L-asparagine permease	NA	NA	NA	NA	NA
WP_050285995.1|1207407_1208766_+	2-hydroxycarboxylate transporter family protein	NA	A0A140XAH4	Dickeya_phage	59.6	4.3e-28
WP_098904468.1|1208861_1209581_-	two-component system response regulator DcuR	NA	NA	NA	NA	NA
WP_098904469.1|1209573_1211268_-	two-component system sensor histidine kinase DcuS	NA	NA	NA	NA	NA
WP_050081564.1|1212020_1213028_+	glutaminase A	NA	NA	NA	NA	NA
WP_050081562.1|1213138_1214779_+	MFS transporter	NA	NA	NA	NA	NA
WP_050081560.1|1214872_1215415_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050285991.1|1215438_1216386_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_019209710.1|1216690_1217005_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_019209711.1|1217017_1218343_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_050873405.1|1218376_1219777_+	glycoside hydrolase family 1 protein	NA	NA	NA	NA	NA
WP_019209713.1|1219769_1220075_+	PTS lactose/cellobiose transporter subunit IIA	NA	NA	NA	NA	NA
WP_172440362.1|1220289_1221483_+	carbohydrate porin	NA	NA	NA	NA	NA
WP_050873408.1|1221858_1223793_+	FTR1 family iron permease	NA	NA	NA	NA	NA
WP_004390794.1|1223861_1224389_+	iron transporter	NA	NA	NA	NA	NA
WP_098904470.1|1224536_1225958_+	DUF2318 domain-containing protein	NA	NA	NA	NA	NA
WP_050285984.1|1225960_1227253_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_072087131.1|1227287_1228400_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_050873410.1|1228403_1229117_+	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	32.2	8.0e-18
WP_050285978.1|1229106_1229604_+	TlpA family protein disulfide reductase	NA	NA	NA	NA	NA
WP_050081541.1|1229603_1229918_+	cytochrome c	NA	NA	NA	NA	NA
WP_098904471.1|1230089_1230959_+	SAM-dependent methyltransferase TehB	NA	NA	NA	NA	NA
WP_050081538.1|1231038_1231974_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_050285974.1|1232063_1232687_+|tRNA	serine-tRNA(Ala) deacylase AlaX	tRNA	NA	NA	NA	NA
>prophage 4
NZ_CP023962	Yersinia frederiksenii strain FDAARGOS_417 chromosome, complete genome	5000678	1749990	1790501	5000678	capsid,head,plate,tail,lysis,tRNA,integrase,holin,portal	Salmonella_phage(48.48%)	49	1748055:1748079	1783208:1783232
1748055:1748079	attL	AAGAAAAAGGCCGCTTGCGCGGCCT	NA	NA	NA	NA
WP_050873135.1|1749990_1750965_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0F7LBR0	Escherichia_phage	52.9	6.1e-93
WP_050873136.1|1751028_1751331_-	helix-turn-helix domain-containing protein	NA	A0A0M5M1I9	Salmonella_phage	55.6	3.1e-24
WP_050873140.1|1751419_1751686_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080993766.1|1751745_1751928_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050873142.1|1752075_1752312_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050873239.1|1752457_1752694_+	DUF2724 domain-containing protein	NA	NA	NA	NA	NA
WP_050873143.1|1752718_1753048_+	DUF5347 family protein	NA	NA	NA	NA	NA
WP_098904558.1|1753122_1753350_+	DUF2732 family protein	NA	NA	NA	NA	NA
WP_050873145.1|1753349_1753574_+	TraR/DksA family transcriptional regulator	NA	Q6K1F5	Salmonella_virus	56.8	3.6e-17
WP_050873149.1|1753570_1754383_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1S6L011	Salmonella_phage	53.2	9.6e-76
WP_098904559.1|1754373_1755384_+	phosphoadenosine phosphosulfate reductase family protein	NA	B7SYG0	Stenotrophomonas_phage	43.2	7.2e-65
WP_186381621.1|1757339_1757684_+	hypothetical protein	NA	NA	NA	NA	NA
WP_098904561.1|1757714_1759472_-	hypothetical protein	NA	NA	NA	NA	NA
WP_098904562.1|1759468_1759948_-	hypothetical protein	NA	NA	NA	NA	NA
WP_192941417.1|1759944_1761117_-	DUF4297 domain-containing protein	NA	NA	NA	NA	NA
WP_186381576.1|1761670_1762705_-|portal	phage portal protein	portal	A0A0M5M1H6	Salmonella_phage	64.2	5.6e-129
WP_098904566.1|1762713_1764432_-	oxidoreductase	NA	A0A0M4S6K7	Salmonella_phage	58.9	1.6e-189
WP_098904567.1|1764590_1765445_+|capsid	GPO family capsid scaffolding protein	capsid	A0A1J0I2E9	Salmonella_phage	46.8	2.3e-64
WP_050873158.1|1765477_1766518_+|capsid	phage major capsid protein, P2 family	capsid	A0A0M3ULA3	Salmonella_phage	58.3	1.1e-113
WP_098904568.1|1767569_1768052_+|head	head completion/stabilization protein	head	A0A1S5NNA6	Burkholderia_phage	50.9	1.8e-34
WP_050873160.1|1768052_1768256_+|tail	tail protein X	tail	E5G6M9	Salmonella_phage	67.2	1.1e-20
WP_072096238.1|1768293_1768680_+|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_098904569.1|1768666_1769062_+	M15 family metallopeptidase	NA	A9DET4	Yersinia_phage	71.8	4.1e-48
WP_053008858.1|1769065_1769491_+|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	46.1	1.0e-20
WP_053008857.1|1769589_1770051_+|tail	phage tail protein	tail	A0A0M4R2U5	Salmonella_phage	53.0	2.5e-36
WP_053008856.1|1770103_1770721_+	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	40.9	8.7e-37
WP_186381575.1|1770817_1771456_+|plate	phage baseplate assembly protein V	plate	A0A0M4S6F6	Salmonella_phage	51.9	6.4e-51
WP_050139890.1|1771452_1771803_+	GPW/gp25 family protein	NA	F1BUP4	Erwinia_phage	51.8	1.8e-26
WP_098904571.1|1771799_1772708_+|plate	baseplate assembly protein	plate	F1BUP3	Erwinia_phage	74.5	9.6e-117
WP_050873170.1|1772700_1773309_+|tail	phage tail protein I	tail	F1BUP2	Erwinia_phage	73.1	4.9e-85
WP_072102414.1|1773305_1774616_+|tail	phage tail protein	tail	F1BUP1	Erwinia_phage	62.0	1.3e-111
WP_098904572.1|1774618_1775095_+|tail	tail fiber assembly protein	tail	F1BUP0	Erwinia_phage	46.2	2.5e-39
WP_048619992.1|1775166_1775592_-|tail	phage tail protein	tail	A0A1J0I2L5	Salmonella_phage	60.9	4.3e-43
WP_098904573.1|1775597_1778804_-|tail	phage tail tape measure protein	tail	A0A1S6L010	Salmonella_phage	41.3	2.3e-157
WP_172439463.1|1778807_1778939_-|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_186381574.1|1778935_1779259_-|tail	phage tail assembly protein	tail	A0A0M4RCV2	Salmonella_phage	62.8	7.5e-24
WP_098904574.1|1779274_1779790_-|tail	phage major tail tube protein	tail	A0A0M5M1I5	Salmonella_phage	70.8	5.7e-66
WP_098904575.1|1779801_1780980_-|tail	phage tail sheath protein	tail	A0A0M4S6M1	Salmonella_phage	67.5	5.2e-155
WP_098904576.1|1781120_1782251_+	phage late control D family protein	NA	A0A0M4REC6	Salmonella_phage	64.9	1.5e-132
WP_049615915.1|1782292_1782532_+	ogr/Delta-like zinc finger family protein	NA	A0A2I8TV89	Erwinia_phage	50.0	1.3e-09
WP_098904577.1|1782545_1783070_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004875238.1|1783249_1783546_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	4.2e-13
1783208:1783232	attR	AAGAAAAAGGCCGCTTGCGCGGCCT	NA	NA	NA	NA
WP_098904578.1|1783550_1785938_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	A0A1L3IZU3	BeAn_58058_virus	25.8	4.3e-07
WP_050080651.1|1785952_1786936_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	5.8e-35
WP_129111451.1|1787212_1787260_-	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_004706556.1|1787330_1787687_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_002211834.1|1787724_1787922_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_071822392.1|1788017_1788569_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	33.7	8.9e-17
WP_098904579.1|1788572_1790501_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	36.9	9.7e-127
>prophage 5
NZ_CP023962	Yersinia frederiksenii strain FDAARGOS_417 chromosome, complete genome	5000678	1829594	1898542	5000678	protease,capsid,terminase,bacteriocin,tail,coat,portal	Escherichia_phage(27.27%)	64	NA	NA
WP_019210204.1|1829594_1830476_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_050080618.1|1830815_1832885_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	34.7	3.1e-86
WP_049607088.1|1832904_1833621_-	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_050080616.1|1833716_1834214_-	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_019210208.1|1834438_1835686_+	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
WP_050080615.1|1835654_1838285_+	PqiB family protein	NA	NA	NA	NA	NA
WP_050285722.1|1838307_1839213_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_098904586.1|1839342_1840773_+	MFS transporter	NA	NA	NA	NA	NA
WP_050080610.1|1841100_1841637_+|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_080986282.1|1841643_1842201_+|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_050285726.1|1842213_1842771_+|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_098904587.1|1842817_1843567_+	molecular chaperone	NA	NA	NA	NA	NA
WP_098904588.1|1843654_1846117_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_098904589.1|1846136_1847171_+|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_050080603.1|1847381_1849091_+	diguanylate cyclase	NA	NA	NA	NA	NA
WP_049607063.1|1849204_1849447_+	DUF1480 family protein	NA	NA	NA	NA	NA
WP_050080601.1|1849560_1849950_-	ASCH domain-containing protein	NA	NA	NA	NA	NA
WP_088130070.1|1850102_1850234_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005272441.1|1850701_1850935_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057650244.1|1851203_1851839_-	glutathione transferase	NA	NA	NA	NA	NA
WP_019210224.1|1851923_1852172_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049607057.1|1852371_1852566_+	hypothetical protein	NA	NA	NA	NA	NA
WP_098904590.1|1852719_1853349_-	CatB-related O-acetyltransferase	NA	A0A2R8FE91	Brazilian_cedratvirus	38.6	3.1e-21
WP_098904591.1|1854509_1857098_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	40.4	8.5e-102
WP_050080592.1|1857856_1858177_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050875018.1|1859005_1859407_+	VOC family protein	NA	NA	NA	NA	NA
WP_098904593.1|1860229_1860478_+	hypothetical protein	NA	NA	NA	NA	NA
WP_098904594.1|1860515_1867982_-	hypothetical protein	NA	A0A1I9KFG8	Aeromonas_phage	45.2	3.2e-274
WP_192941418.1|1868248_1868410_-	hypothetical protein	NA	NA	NA	NA	NA
WP_098904595.1|1868484_1869882_-	hypothetical protein	NA	A0A088CBK4	Shigella_phage	32.6	3.1e-26
WP_098904596.1|1869894_1870134_-|bacteriocin	bacteriocin	bacteriocin	A0A1I9KFI4	Aeromonas_phage	48.1	2.6e-05
WP_098904597.1|1870133_1870517_-	hypothetical protein	NA	A0A1I9KFD7	Aeromonas_phage	60.0	3.1e-32
WP_098904598.1|1870532_1871171_-	hypothetical protein	NA	A0A1I9KFE8	Aeromonas_phage	54.0	1.1e-47
WP_098904599.1|1871426_1871801_-	hypothetical protein	NA	A0A2L1IV61	Escherichia_phage	54.7	2.5e-31
WP_098904600.1|1871775_1872774_-	hypothetical protein	NA	NA	NA	NA	NA
WP_098904601.1|1872840_1873947_-	DUF1983 domain-containing protein	NA	A0A2L1IV54	Escherichia_phage	50.1	8.9e-109
WP_098904602.1|1873943_1875572_-	hypothetical protein	NA	A0A2L1IV27	Escherichia_phage	56.6	1.1e-174
WP_098904603.1|1875651_1877736_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	K7PH95	Enterobacterial_phage	43.1	2.8e-55
WP_098904604.1|1877732_1878386_-	hypothetical protein	NA	Q08J85	Stx2-converting_phage	57.2	4.2e-66
WP_098904605.1|1878385_1878982_-	hypothetical protein	NA	A0A088CE76	Shigella_phage	39.4	1.5e-30
WP_098904606.1|1878984_1879437_-	hypothetical protein	NA	A0A2L1IV43	Escherichia_phage	50.7	2.6e-30
WP_098904607.1|1879503_1879887_-	hypothetical protein	NA	NA	NA	NA	NA
WP_098904608.1|1879947_1881171_-|capsid	N4-gp56 family major capsid protein	capsid	A0A088CC32	Shigella_phage	74.1	3.3e-173
WP_098904609.1|1881230_1882289_-	hypothetical protein	NA	A0A0P0ZGF7	Escherichia_phage	42.3	9.6e-60
WP_098904610.1|1882558_1884679_-|portal	portal protein	portal	A0A0P0ZG74	Escherichia_phage	67.5	9.3e-256
WP_098905255.1|1884678_1886343_-|terminase	terminase	terminase	A0A2R2Z350	Escherichia_phage	73.1	7.3e-248
WP_098904611.1|1886393_1887254_-|terminase	terminase	terminase	A0A1I9KFG9	Aeromonas_phage	47.8	5.6e-42
WP_098904612.1|1887319_1887760_-	DUF2829 domain-containing protein	NA	A0A2I7R7I1	Vibrio_phage	63.6	2.2e-26
WP_057634099.1|1887784_1887973_-	hypothetical protein	NA	A0A2I7RUD6	Vibrio_phage	77.0	4.7e-18
WP_098904613.1|1887976_1888513_-	DUF2570 domain-containing protein	NA	H9C185	Pectobacterium_phage	38.7	4.3e-16
WP_098904614.1|1888644_1889133_-	lysozyme	NA	A0A2H4JCH1	uncultured_Caudovirales_phage	58.1	1.4e-50
WP_050535402.1|1889132_1889363_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138070055.1|1889545_1890097_-	hypothetical protein	NA	NA	NA	NA	NA
WP_098904616.1|1890122_1890932_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050128217.1|1891024_1891243_-	hypothetical protein	NA	K7PJU3	Enterobacteria_phage	50.8	3.4e-12
WP_098904617.1|1891243_1891702_-	VRR-NUC domain-containing protein	NA	M4SRS1	Psychrobacter_phage	34.8	7.2e-12
WP_098904618.1|1891694_1892024_-	DUF1364 domain-containing protein	NA	A0A2K8HR56	Pseudomonas_phage	45.9	2.2e-18
WP_098904619.1|1892025_1892673_-	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	31.9	5.7e-15
WP_098904620.1|1892669_1894553_-	DNA cytosine methyltransferase	NA	H9C171	Pectobacterium_phage	57.4	1.6e-230
WP_098904621.1|1894549_1895437_-	phage N-6-adenine-methyltransferase	NA	Q8HA94	Salmonella_phage	54.3	5.0e-86
WP_098904622.1|1895433_1895781_-	hypothetical protein	NA	NA	NA	NA	NA
WP_098904623.1|1895780_1896917_-	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	59.7	1.4e-93
WP_098904624.1|1896920_1897694_-	hypothetical protein	NA	H2DE84	Erwinia_phage	53.1	4.0e-47
WP_098904625.1|1897696_1898542_-	hypothetical protein	NA	H2DE83	Erwinia_phage	45.2	3.7e-46
>prophage 6
NZ_CP023962	Yersinia frederiksenii strain FDAARGOS_417 chromosome, complete genome	5000678	1901812	1917920	5000678	integrase	uncultured_Caudovirales_phage(22.22%)	26	1908909:1908922	1918842:1918855
WP_098904631.1|1901812_1902082_+	KTSC domain-containing protein	NA	A9YWW2	Burkholderia_phage	44.6	5.0e-13
WP_098904632.1|1902121_1902592_+	hypothetical protein	NA	G0YQE7	Erwinia_phage	62.6	1.1e-47
WP_138070056.1|1902607_1902934_+	hypothetical protein	NA	NA	NA	NA	NA
WP_192941419.1|1903074_1903224_+	hypothetical protein	NA	NA	NA	NA	NA
WP_098905256.1|1903276_1904080_+	phage recombination protein Bet	NA	A0A1I9KF88	Aeromonas_phage	59.9	7.0e-71
WP_098904634.1|1904066_1905671_+	YqaJ viral recombinase family protein	NA	A0A2H4J6P1	uncultured_Caudovirales_phage	52.1	2.6e-109
WP_098904635.1|1905717_1906857_+	hypothetical protein	NA	M4MHC3	Vibrio_phage	25.2	9.1e-32
WP_098904636.1|1906853_1907282_+	hypothetical protein	NA	NA	NA	NA	NA
WP_098904637.1|1907284_1908082_+	hypothetical protein	NA	Q71T76	Escherichia_phage	53.9	5.7e-65
WP_098905257.1|1908116_1908917_+	hypothetical protein	NA	A0A248SL66	Klebsiella_phage	40.4	3.1e-50
1908909:1908922	attL	AACGATTAATCAGG	NA	NA	NA	NA
WP_098904638.1|1908930_1909266_+	hypothetical protein	NA	A0A248SKX5	Klebsiella_phage	33.0	7.8e-08
WP_098904639.1|1909262_1909499_+	hypothetical protein	NA	A0A248SL48	Klebsiella_phage	63.1	8.5e-17
WP_098904640.1|1909495_1909984_+	hypothetical protein	NA	A0A1W6JPA7	Morganella_phage	43.3	7.1e-26
WP_098904641.1|1909983_1910520_+	hypothetical protein	NA	A0A2D1GNV6	Pseudomonas_phage	48.5	1.7e-44
WP_098904642.1|1910516_1910771_+	hypothetical protein	NA	NA	NA	NA	NA
WP_098904643.1|1911028_1911751_+	hypothetical protein	NA	A0A192Y7N1	Salmonella_phage	40.0	3.5e-21
WP_098904644.1|1911734_1911992_+	stationary-phase-induced ribosome-associated protein	NA	NA	NA	NA	NA
WP_098905258.1|1912128_1912461_+	hypothetical protein	NA	NA	NA	NA	NA
WP_098904645.1|1912460_1913291_+	hypothetical protein	NA	A0A2I7RWZ3	Vibrio_phage	56.7	3.5e-89
WP_098904646.1|1913303_1913798_+	hypothetical protein	NA	V5URG6	Shigella_phage	73.5	6.4e-67
WP_098904647.1|1913790_1914102_+	hypothetical protein	NA	A0A2H4J7V6	uncultured_Caudovirales_phage	52.8	1.9e-16
WP_098905259.1|1914788_1915055_+	antitoxin	NA	NA	NA	NA	NA
WP_098904648.1|1915054_1915810_+	hypothetical protein	NA	H6WRY1	Salmonella_phage	77.3	1.5e-120
WP_192941420.1|1916131_1916482_+	hypothetical protein	NA	NA	NA	NA	NA
WP_098904650.1|1916569_1916839_+	excisionase	NA	A0A2H4J5E1	uncultured_Caudovirales_phage	39.0	9.3e-12
WP_192941421.1|1916813_1917920_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	50.3	1.9e-98
1918842:1918855	attR	AACGATTAATCAGG	NA	NA	NA	NA
>prophage 7
NZ_CP023962	Yersinia frederiksenii strain FDAARGOS_417 chromosome, complete genome	5000678	2092544	2104315	5000678		Paramecium_bursaria_Chlorella_virus(16.67%)	7	NA	NA
WP_050083778.1|2092544_2095241_-	magnesium-translocating P-type ATPase	NA	M1HM40	Paramecium_bursaria_Chlorella_virus	25.6	1.2e-42
WP_050083779.1|2095420_2096119_-	MgtC family protein	NA	G3MA03	Bacillus_virus	42.5	3.6e-15
WP_072084884.1|2096875_2098615_+	Tar ligand binding domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	51.2	4.7e-11
WP_004701013.1|2098763_2098955_-	protein DsrB	NA	NA	NA	NA	NA
WP_002210893.1|2099290_2099503_-	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	80.0	2.0e-25
WP_057643746.1|2099994_2101020_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	51.8	2.9e-85
WP_098904684.1|2101168_2104315_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	63.1	0.0e+00
>prophage 8
NZ_CP023962	Yersinia frederiksenii strain FDAARGOS_417 chromosome, complete genome	5000678	2488119	2537130	5000678	integrase,terminase,plate,head	Edwardsiella_phage(35.29%)	74	2487285:2487299	2492682:2492696
2487285:2487299	attL	GAAATTGGATGGGTA	NA	NA	NA	NA
WP_050080049.1|2488119_2488746_-	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	W5SAS9	Pithovirus	28.3	1.1e-07
WP_098904758.1|2489075_2489987_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	67.8	3.2e-104
WP_098904759.1|2490396_2491575_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	53.9	2.7e-127
WP_098904760.1|2491819_2492029_+	hypothetical protein	NA	NA	NA	NA	NA
WP_098904761.1|2492163_2492385_-	hypothetical protein	NA	NA	NA	NA	NA
WP_098904762.1|2492390_2493815_-	hypothetical protein	NA	A0A077KC23	Edwardsiella_phage	42.4	4.6e-33
2492682:2492696	attR	GAAATTGGATGGGTA	NA	NA	NA	NA
WP_098904763.1|2493815_2494457_-	DUF2612 domain-containing protein	NA	A0A077K9U8	Edwardsiella_phage	75.0	5.4e-90
WP_098904764.1|2494453_2495683_-|plate	baseplate J/gp47 family protein	plate	A0A077KGW9	Edwardsiella_phage	69.7	1.2e-162
WP_050873460.1|2495679_2496039_-	hypothetical protein	NA	A0A077KCA1	Edwardsiella_phage	72.8	4.7e-43
WP_098904765.1|2496035_2496746_-|plate	phage baseplate protein	plate	A0A077KAY0	Edwardsiella_phage	58.3	3.6e-71
WP_098904766.1|2496742_2497600_-	hypothetical protein	NA	A0A077KC17	Edwardsiella_phage	54.0	1.0e-80
WP_098904767.1|2497589_2497895_-	hypothetical protein	NA	A0A077K9U4	Edwardsiella_phage	62.0	4.6e-31
WP_098904768.1|2497891_2498710_-	hypothetical protein	NA	A0A077KGW3	Edwardsiella_phage	57.9	3.7e-75
WP_098904769.1|2498787_2499282_+	hypothetical protein	NA	NA	NA	NA	NA
WP_098904770.1|2499358_2499760_+	hypothetical protein	NA	NA	NA	NA	NA
WP_098904771.1|2499764_2501525_-	lytic transglycosylase domain-containing protein	NA	A0A077KC92	Edwardsiella_phage	38.1	3.3e-97
WP_049602247.1|2501739_2502147_-	hypothetical protein	NA	A0A077KC08	Edwardsiella_phage	60.0	7.0e-35
WP_049525852.1|2502146_2502581_-	hypothetical protein	NA	A0A077K9T0	Edwardsiella_phage	67.1	1.6e-53
WP_098904772.1|2502590_2504078_-	DUF3383 domain-containing protein	NA	A0A077KGV4	Edwardsiella_phage	62.3	4.8e-166
WP_192941423.1|2504074_2504392_-	hypothetical protein	NA	A0A077KC88	Edwardsiella_phage	66.3	3.3e-32
WP_050336332.1|2504589_2504961_-	hypothetical protein	NA	A0A077KAW7	Edwardsiella_phage	62.6	4.5e-41
WP_098904774.1|2504938_2505409_-	hypothetical protein	NA	A0A077KC03	Edwardsiella_phage	59.5	1.3e-45
WP_098904775.1|2505411_2505807_-	DUF4054 domain-containing protein	NA	Q2NPC6	Xanthomonas_phage	41.2	3.9e-14
WP_050336412.1|2505810_2506014_-	hypothetical protein	NA	NA	NA	NA	NA
WP_098904776.1|2506141_2507167_-	hypothetical protein	NA	A0A077KC85	Edwardsiella_phage	37.2	7.6e-62
WP_098904777.1|2507166_2507655_-	hypothetical protein	NA	A0A077KAW3	Edwardsiella_phage	45.9	1.1e-31
WP_098904778.1|2507656_2509408_-	DUF2213 domain-containing protein	NA	A0A219YBB9	Aeromonas_phage	36.1	1.5e-57
WP_098905268.1|2509568_2510264_-|head	phage head morphogenesis protein	head	A0A077KGU5	Edwardsiella_phage	47.6	5.2e-46
WP_098904779.1|2511749_2513270_-|terminase	phage terminase large subunit	terminase	Q7Y5U7	Haemophilus_phage	48.8	1.7e-126
WP_098904780.1|2513223_2513754_-	DNA-packaging protein	NA	I6S1J2	Salmonella_phage	62.9	6.3e-52
WP_098904781.1|2513811_2514027_-	hypothetical protein	NA	NA	NA	NA	NA
WP_098904782.1|2514115_2514802_-	Rha family transcriptional regulator	NA	A0A192Y918	Salmonella_phage	86.0	1.5e-109
WP_098904784.1|2515252_2515642_-	exotoxin	NA	U5P0U9	Shigella_phage	31.0	4.1e-08
WP_098904785.1|2515634_2516165_-	lysozyme	NA	H9C184	Pectobacterium_phage	72.6	2.6e-74
WP_098905269.1|2516164_2516446_-	hypothetical protein	NA	H6WRZ3	Salmonella_phage	48.9	5.3e-18
WP_098905220.1|2516653_2517409_-	hypothetical protein	NA	A0A0M4RCP6	Salmonella_phage	67.3	5.9e-104
WP_192941424.1|2517470_2517626_+	hypothetical protein	NA	NA	NA	NA	NA
WP_098904786.1|2517856_2518681_-	antitermination protein	NA	M9NZB0	Enterobacteria_phage	52.9	4.1e-74
WP_098904787.1|2518677_2518872_-	protein ninH	NA	A0A0P0ZGE1	Escherichia_phage	63.0	1.7e-10
WP_098905270.1|2518868_2519510_-	recombination protein NinG	NA	M9NYX8	Enterobacteria_phage	56.5	1.0e-56
WP_098904788.1|2519772_2520000_-	hypothetical protein	NA	NA	NA	NA	NA
WP_098904789.1|2520330_2520780_-	hypothetical protein	NA	NA	NA	NA	NA
WP_098904790.1|2520788_2521238_-	DUF1367 family protein	NA	A0A096XEN2	Escherichia_phage	63.8	7.4e-54
WP_098904791.1|2521241_2521493_-	DUF4752 family protein	NA	T1S9K2	Salmonella_phage	58.3	3.3e-19
WP_098904792.1|2521489_2522038_-	DUF551 domain-containing protein	NA	NA	NA	NA	NA
WP_138070071.1|2522276_2522459_-	hypothetical protein	NA	NA	NA	NA	NA
WP_098904795.1|2522679_2522862_-	hypothetical protein	NA	NA	NA	NA	NA
WP_098904796.1|2522861_2524265_-	AAA family ATPase	NA	A0A0N7C224	Escherichia_phage	62.1	3.6e-163
WP_098904797.1|2524254_2525139_-	DNA replication protein	NA	F1C5C3	Cronobacter_phage	56.8	2.0e-87
WP_192941401.1|2525131_2525296_-	hypothetical protein	NA	NA	NA	NA	NA
WP_098904798.1|2525292_2525700_-	hypothetical protein	NA	G8C7U4	Escherichia_phage	49.2	1.8e-30
WP_098904799.1|2526046_2526319_-	hypothetical protein	NA	Q76H54	Enterobacteria_phage	61.0	6.1e-19
WP_050297912.1|2526428_2526653_-	helix-turn-helix domain-containing protein	NA	M9NZA8	Enterobacteria_phage	57.5	4.0e-16
WP_098904800.1|2526769_2527480_+	helix-turn-helix transcriptional regulator	NA	K7P7I4	Enterobacteria_phage	56.8	4.3e-72
WP_098904801.1|2527820_2528135_+	hypothetical protein	NA	NA	NA	NA	NA
WP_098904802.1|2528131_2528404_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138070060.1|2528376_2528784_+	hypothetical protein	NA	NA	NA	NA	NA
WP_098904804.1|2529587_2529935_+	hypothetical protein	NA	A0A0K2FII1	Escherichia_phage	34.9	1.3e-05
WP_098904805.1|2529964_2530588_+	DUF5420 family protein	NA	A0A220NQT7	Salmonella_phage	53.2	7.9e-62
WP_098904806.1|2530857_2531064_+	hypothetical protein	NA	NA	NA	NA	NA
WP_098904807.1|2531376_2531670_+	hypothetical protein	NA	NA	NA	NA	NA
WP_098904808.1|2531669_2532173_+	hypothetical protein	NA	A0A0F7L7F5	uncultured_marine_virus	29.1	6.7e-11
WP_098904809.1|2532169_2532799_+	YqaJ viral recombinase family protein	NA	S0A2A9	Cellulophaga_phage	49.5	3.8e-48
WP_098904810.1|2532802_2532985_+	DUF1317 family protein	NA	A0A193GYJ8	Enterobacter_phage	58.8	1.8e-11
WP_098904811.1|2533028_2533232_+	restriction alleviation protein, Lar family	NA	NA	NA	NA	NA
WP_098904812.1|2533245_2533539_+	hypothetical protein	NA	NA	NA	NA	NA
WP_098904813.1|2533528_2534008_+	hypothetical protein	NA	A0A0U4KRZ0	Arthrobacter_phage	65.6	2.8e-06
WP_098904814.1|2534151_2534526_+	DUF2591 domain-containing protein	NA	R9VYJ6	Serratia_phage	37.7	2.2e-11
WP_098904815.1|2534515_2534872_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138070061.1|2535082_2535313_+	DNA polymerase V	NA	NA	NA	NA	NA
WP_019211945.1|2535536_2535830_+	DUF5405 family protein	NA	A0A218M4I8	Erwinia_phage	41.9	3.6e-09
WP_098904817.1|2536029_2536572_+	phage N-6-adenine-methyltransferase	NA	G9L688	Escherichia_phage	68.3	2.6e-61
WP_098904818.1|2536681_2536918_+	hypothetical protein	NA	NA	NA	NA	NA
WP_098904819.1|2536914_2537130_+	AlpA family phage regulatory protein	NA	E5AGD1	Erwinia_phage	48.3	2.0e-09
>prophage 9
NZ_CP023962	Yersinia frederiksenii strain FDAARGOS_417 chromosome, complete genome	5000678	2842408	2925899	5000678	protease,capsid,terminase,transposase,head,plate,tail,tRNA,integrase,holin,portal	Enterobacteria_phage(25.0%)	98	2890179:2890195	2931447:2931463
WP_050082004.1|2842408_2842993_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	S4VYT2	Pandoravirus	36.4	1.7e-05
WP_050082005.1|2843092_2843797_-	phosphatidylglycerophosphatase C	NA	NA	NA	NA	NA
WP_050082006.1|2844152_2844995_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_019212207.1|2845055_2845316_+	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	52.3	1.6e-16
WP_049607664.1|2845400_2845781_-	holo-ACP synthase	NA	NA	NA	NA	NA
WP_019212209.1|2845780_2846512_-	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_050082009.1|2846676_2847402_-	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_050082010.1|2847410_2848322_-	GTPase Era	NA	NA	NA	NA	NA
WP_019212212.1|2848318_2848999_-	ribonuclease III	NA	A0A0P0YM82	Yellowstone_lake_phycodnavirus	29.7	8.1e-20
WP_050082012.1|2849307_2850306_-	signal peptidase I	NA	NA	NA	NA	NA
WP_050082013.1|2850315_2852115_-	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	26.0	1.3e-24
WP_050286234.1|2852601_2853450_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050082017.1|2853466_2853928_-	SoxR-reducing system protein RseC	NA	NA	NA	NA	NA
WP_050082019.1|2853924_2854881_-	sigma-E factor regulatory protein RseB	NA	NA	NA	NA	NA
WP_050286231.1|2854880_2855537_-	anti-sigma-E factor RseA	NA	NA	NA	NA	NA
WP_019212219.1|2855561_2856137_-	RNA polymerase sigma factor RpoE	NA	A0A0F6TH34	Sinorhizobium_phage	28.0	4.8e-05
WP_172986950.1|2856361_2857963_+	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_050286229.1|2858031_2858778_-|tRNA	tRNA1(Val) (adenine(37)-N6)-methyltransferase	tRNA	NA	NA	NA	NA
WP_049607684.1|2858910_2860224_+	ATP-dependent RNA helicase SrmB	NA	A0A1V0SIR5	Klosneuvirus	30.9	4.7e-48
WP_050082025.1|2860344_2860728_-	autonomous glycyl radical cofactor GrcA	NA	A0A1W5N098	Cronobacter_phage	70.9	1.4e-32
WP_050874032.1|2861077_2861758_+	uracil-DNA glycosylase	NA	A0A0A7D9F8	Equid_alphaherpesvirus	49.1	5.0e-54
WP_049607686.1|2861833_2862412_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_019212228.1|2862536_2863418_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_186381559.1|2863504_2865166_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_019212230.1|2865279_2865621_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_019212231.1|2865773_2866058_-	RnfH family protein	NA	NA	NA	NA	NA
WP_071822458.1|2866050_2866539_-	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_042806903.1|2866645_2867128_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	44.9	6.4e-27
WP_050874075.1|2867865_2868108_+	DinI-like family protein	NA	K7PM44	Enterobacteria_phage	53.8	7.3e-16
WP_050874025.1|2868474_2871561_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	42.7	6.6e-101
WP_050874023.1|2871762_2871972_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054872398.1|2872014_2872248_-	hypothetical protein	NA	NA	NA	NA	NA
WP_098904870.1|2872253_2873246_-	hypothetical protein	NA	U5P0I1	Shigella_phage	47.6	1.5e-22
WP_050874971.1|2873252_2873834_-	YmfQ family protein	NA	O22003	Shigella_phage	64.6	3.9e-71
WP_050874973.1|2873824_2874883_-|plate	baseplate J/gp47 family protein	plate	U5P424	Shigella_phage	63.1	1.9e-132
WP_050874976.1|2874875_2875289_-	phage GP46 family protein	NA	A0A192Y6D0	Salmonella_phage	59.9	2.7e-42
WP_050874978.1|2875292_2875859_-|plate	phage baseplate assembly protein	plate	Q8HAB9	Salmonella_phage	48.6	4.5e-32
WP_050874980.1|2875858_2876932_-|plate	baseplate protein	plate	U5P0H6	Shigella_phage	65.7	8.9e-130
WP_050874981.1|2876928_2878233_-	DNA circularization N-terminal domain-containing protein	NA	S5FUX4	Shigella_phage	56.7	5.9e-136
WP_138070064.1|2878298_2878853_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050874986.1|2878815_2880645_-|tail	phage tail tape measure protein	tail	M1FQW0	Enterobacteria_phage	61.4	3.7e-176
WP_050874988.1|2880786_2881053_-|tail	phage tail assembly protein	tail	M1FPE4	Enterobacteria_phage	62.4	2.1e-24
WP_050874990.1|2881049_2881406_-|tail	phage tail tube protein	tail	U5P076	Shigella_phage	84.7	5.9e-54
WP_050874992.1|2881406_2882900_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	A0A192Y7L1	Salmonella_phage	68.3	1.0e-184
WP_050874994.1|2882896_2883103_-	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	66.7	4.3e-09
WP_050874995.1|2883109_2883658_-	hypothetical protein	NA	S5FM61	Shigella_phage	55.4	9.7e-56
WP_049603051.1|2883654_2884173_-	hypothetical protein	NA	M1FPE2	Enterobacteria_phage	59.3	1.7e-49
WP_050874997.1|2884172_2884565_-|head	phage head closure protein	head	NA	NA	NA	NA
WP_050874999.1|2884567_2884879_-|head,tail	phage gp6-like head-tail connector protein	head,tail	K7PKT4	Enterobacteria_phage	52.8	5.5e-24
WP_098905278.1|2884925_2885141_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049602743.1|2885285_2886506_-|capsid	phage major capsid protein	capsid	K7PM57	Enterobacteria_phage	77.6	7.9e-175
WP_050875003.1|2886518_2887376_-|protease	Clp protease ClpP	protease	K7PH05	Enterobacteria_phage	72.6	2.5e-111
WP_050875005.1|2887388_2888693_-|portal	phage portal protein	portal	K7PJU5	Enterobacteria_phage	78.6	2.6e-200
WP_050875007.1|2888692_2890438_-|terminase	terminase large subunit	terminase	A0A0U2C138	Paracoccus_phage	45.2	1.4e-135
2890179:2890195	attL	AAAATAAAGGGTTTACC	NA	NA	NA	NA
WP_050875009.1|2890391_2890859_-|terminase	phage terminase small subunit P27 family	terminase	Q9B019	Phage_GMSE-1	59.7	5.0e-45
WP_045844189.1|2891009_2891339_-	HNH endonuclease	NA	F1C587	Cronobacter_phage	63.3	7.4e-35
WP_004390466.1|2891431_2891635_-	hypothetical protein	NA	A0A1L6Z528	Klebsiella_phage	75.0	6.6e-18
WP_098905279.1|2892014_2892521_-	DUF2514 family protein	NA	Q7Y3V2	Yersinia_phage	88.6	9.5e-74
WP_050079851.1|2892538_2892934_-	M15 family metallopeptidase	NA	E7C9S9	Salmonella_phage	61.8	7.7e-39
WP_080993818.1|2892923_2893262_-|holin	phage holin, lambda family	holin	C6ZR64	Salmonella_phage	51.6	3.5e-16
WP_050079852.1|2893410_2893662_+	bssS family protein	NA	NA	NA	NA	NA
WP_019210745.1|2894630_2894831_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050079854.1|2895212_2895977_-	antitermination protein	NA	A0A286N2Q2	Klebsiella_phage	47.3	3.1e-60
WP_050079855.1|2895992_2897354_-	helicase	NA	Q8W640	Enterobacteria_phage	49.8	2.4e-116
WP_050079856.1|2897350_2898226_-	ATP-binding protein	NA	K7PLU3	Enterobacteria_phage	44.8	1.0e-62
WP_057644627.1|2898222_2899218_-	hypothetical protein	NA	A0A068C8G6	Acinetobacter_phage	48.7	1.6e-32
WP_050079858.1|2899219_2899531_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050079859.1|2899527_2900352_-	transporter	NA	Q8W644	Enterobacteria_phage	70.4	5.3e-114
WP_050079860.1|2900371_2900590_-	helix-turn-helix transcriptional regulator	NA	K7PKH4	Enterobacteria_phage	51.5	6.2e-14
WP_050079861.1|2900693_2901341_+	LexA family transcriptional regulator	NA	A0A077KGZ5	Edwardsiella_phage	60.9	4.6e-73
WP_050079862.1|2901551_2901776_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050079863.1|2902103_2902469_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050079864.1|2902458_2902659_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050079865.1|2902651_2902846_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050075096.1|2902835_2903057_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050079867.1|2903049_2903433_+	S24 family peptidase	NA	NA	NA	NA	NA
WP_050075094.1|2903435_2903864_+	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	38.0	2.2e-15
WP_050075093.1|2903949_2904309_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050079869.1|2904305_2904494_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050075091.1|2904490_2905021_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050079870.1|2905034_2905631_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050874145.1|2905614_2905740_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050874148.1|2905736_2905958_+	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	55.6	6.9e-13
WP_050874150.1|2905954_2906329_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050874152.1|2906318_2906780_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050874159.1|2907245_2908427_+|integrase	site-specific integrase	integrase	I6PDJ1	Cronobacter_phage	69.6	5.7e-154
WP_098904872.1|2908810_2910052_+|integrase	integrase	integrase	A0A1B5FPC6	Escherichia_phage	46.5	3.6e-98
WP_098904873.1|2910192_2913822_+	DNA helicase	NA	NA	NA	NA	NA
WP_048983331.1|2914309_2914831_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_098904874.1|2915133_2916114_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009309819.1|2916110_2916665_+	hypothetical protein	NA	NA	NA	NA	NA
WP_098904875.1|2916664_2917459_+	SIR2 family protein	NA	NA	NA	NA	NA
WP_098904876.1|2917842_2920041_-	DEAD/DEAH box helicase	NA	NA	NA	NA	NA
WP_098904877.1|2920037_2921354_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_098904878.1|2921357_2923667_-	TerB N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_098904879.1|2923969_2924695_-	hypothetical protein	NA	NA	NA	NA	NA
WP_098904880.1|2924778_2925639_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_098904881.1|2925635_2925899_-|transposase	transposase	transposase	U5P4I9	Shigella_phage	58.8	1.5e-14
2931447:2931463	attR	GGTAAACCCTTTATTTT	NA	NA	NA	NA
>prophage 10
NZ_CP023962	Yersinia frederiksenii strain FDAARGOS_417 chromosome, complete genome	5000678	3999518	4008009	5000678		Enterobacteria_phage(66.67%)	10	NA	NA
WP_050287212.1|3999518_4000556_-	virulence RhuM family protein	NA	Q9JMN3	Wolbachia_phage	43.6	3.8e-69
WP_098905054.1|4001464_4002340_-	hypothetical protein	NA	A0A1B0VG30	Salmonella_phage	43.2	3.4e-55
WP_098905055.1|4002468_4004802_-	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	59.5	4.0e-260
WP_098905056.1|4004815_4005157_-	DUF5375 family protein	NA	NA	NA	NA	NA
WP_098905057.1|4005153_4005417_-	hypothetical protein	NA	NA	NA	NA	NA
WP_098905058.1|4005413_4005959_-	ash family protein	NA	Q7M2A7	Enterobacteria_phage	57.7	6.5e-28
WP_049608088.1|4005963_4006152_-	hypothetical protein	NA	NA	NA	NA	NA
WP_098905059.1|4006199_4006457_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	65.0	2.3e-15
WP_098905296.1|4007428_4007761_+	aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_098905060.1|4007763_4008009_+	ogr/Delta-like zinc finger family protein	NA	Q7M294	Enterobacteria_phage	50.0	7.0e-14
