The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP023899	Escherichia coli strain FDAARGOS_433 chromosome, complete genome	4711093	328401	410308	4711093	protease,transposase,tail,lysis,portal,holin,integrase	Escherichia_phage(31.58%)	80	365099:365158	396594:396653
WP_000131044.1|328401_330435_-|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	27.4	3.4e-21
WP_001299022.1|330563_331151_+	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_000089055.1|331164_332637_+	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001159094.1|332650_334321_+|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.2	4.7e-61
WP_001209100.1|334533_335202_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001323770.1|335444_336140_-	lactate utilization protein C	NA	NA	NA	NA	NA
WP_000023927.1|336132_337560_-	iron-sulfur cluster-binding protein	NA	NA	NA	NA	NA
WP_001102099.1|337570_338290_-	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_000339586.1|338817_339672_-	DNA-binding transcriptional regulator RclR	NA	NA	NA	NA	NA
WP_001046317.1|339897_341223_+	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	47.6	2.5e-113
WP_000474091.1|341331_341568_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001306921.1|341579_342173_+	reactive chlorine species resistance protein RclC	NA	NA	NA	NA	NA
WP_000621009.1|342763_343615_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000020229.1|343754_348011_-	intimin-like adhesin FdeC	NA	NA	NA	NA	NA
WP_000662258.1|349125_349227_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000803998.1|349590_349854_+	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_000866436.1|349853_349994_+	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_001147279.1|350028_350256_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001323479.1|351078_351621_+	ECP biosynthesis operon DNA-binding transcriptional regulator EcpR	NA	NA	NA	NA	NA
WP_000730974.1|351695_352283_+	common pilus major fimbrillin subunit EcpA	NA	NA	NA	NA	NA
WP_000716398.1|352340_353009_+	fimbrial chaperone EcpB	NA	NA	NA	NA	NA
WP_001131091.1|353034_355560_+	fimbrial usher EcpC	NA	NA	NA	NA	NA
WP_001323478.1|355549_357193_+	fimbrial adhesin EcpD	NA	NA	NA	NA	NA
WP_001305432.1|357161_357872_+	fimbrial chaperone EcpE	NA	NA	NA	NA	NA
WP_001303809.1|358184_358514_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_001019920.1|358761_359376_-	YagU family protein	NA	NA	NA	NA	NA
WP_000070694.1|359793_360483_+	aldehyde dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_000643336.1|360479_361436_+	aldehyde oxidoreductase FAD-binding subunit PaoB	NA	NA	NA	NA	NA
WP_000667031.1|361432_363631_+	aldehyde oxidoreductase molybdenum-binding subunit PaoC	NA	A0A0P0I429	Acinetobacter_phage	25.8	1.1e-38
WP_000121355.1|363640_364597_+	molybdenum cofactor insertion chaperone PaoD	NA	NA	NA	NA	NA
WP_001111345.1|364575_364986_+	hypothetical protein	NA	NA	NA	NA	NA
365099:365158	attL	CTTATTGATTTAAATGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
WP_086625066.1|365668_366448_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085453487.1|367059_367593_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099010528.1|367589_368864_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_099010529.1|369254_373013_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A2D1UII2	Escherichia_phage	87.5	0.0e+00
WP_086625100.1|373077_373677_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	97.5	1.3e-109
WP_001161009.1|375243_375573_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_001774464.1|375581_375968_-|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	96.1	6.4e-62
WP_089438741.1|376028_376772_-|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	97.6	1.4e-129
WP_001079419.1|376782_377184_-|tail	tail protein	tail	A5LH34	Enterobacteria_phage	99.2	1.9e-72
WP_000677112.1|377180_377759_-|tail	phage tail protein	tail	A0A291AWZ0	Escherichia_phage	99.5	9.4e-102
WP_001283147.1|377770_378046_-	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	98.9	1.1e-44
WP_001097046.1|378038_378362_-	DUF2190 family protein	NA	A5LH31	Enterobacteria_phage	100.0	8.5e-52
WP_077695248.1|378448_380476_-|protease	Clp protease ClpP	protease	A0A291AWT6	Escherichia_phage	99.5	0.0e+00
WP_000985945.1|380420_381929_-|portal	phage portal protein	portal	A0A291AWU2	Escherichia_phage	99.8	7.8e-289
WP_001135250.1|381955_382453_-	lysozyme RrrD	NA	A0A291AWW2	Escherichia_phage	100.0	4.5e-92
WP_000839596.1|382452_382668_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_029365220.1|382735_383788_-	site-specific DNA-methyltransferase	NA	A5LH81	Enterobacteria_phage	99.7	3.6e-208
WP_001355891.1|383937_384132_-	hypothetical protein	NA	Q8SBE3	Shigella_phage	100.0	1.8e-28
WP_001564338.1|384380_385541_+	DUF262 domain-containing protein	NA	A0A0R6PJX3	Moraxella_phage	37.0	6.4e-57
WP_001564336.1|385543_386233_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001025377.1|386201_387242_-	DNA cytosine methyltransferase	NA	A0A0R6PG08	Moraxella_phage	50.9	8.7e-98
WP_021534260.1|387321_387675_-	hypothetical protein	NA	A0A0P0ZCW0	Stx2-converting_phage	85.5	5.8e-54
WP_024172633.1|387692_388682_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.1	1.8e-193
WP_086625103.1|388689_389037_-	hypothetical protein	NA	A0A291AWV6	Escherichia_phage	98.1	7.0e-52
WP_033547788.1|389039_389981_-	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	92.7	1.1e-139
WP_001250269.1|389970_390150_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_000526668.1|390325_390883_-	protein YmfL	NA	S5FXP0	Shigella_phage	94.6	1.7e-95
WP_001191669.1|390875_391136_-	helix-turn-helix transcriptional regulator	NA	K7PJQ8	Enterobacteria_phage	100.0	5.4e-41
WP_001020632.1|391233_391926_+	helix-turn-helix domain-containing protein	NA	S5FUZ3	Shigella_phage	96.5	6.4e-121
WP_000135680.1|392628_392991_+	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
WP_000081270.1|393056_393881_+	DUF2303 family protein	NA	U5P439	Shigella_phage	99.6	1.7e-149
WP_001506964.1|394008_394545_+	5'-deoxynucleotidase	NA	S5MW55	Escherichia_phage	98.9	1.4e-99
WP_001506963.1|394535_394898_+	phage protein	NA	U5P092	Shigella_phage	99.2	1.4e-66
WP_000206735.1|394897_395203_+	hypothetical protein	NA	U5P0J0	Shigella_phage	99.0	1.5e-50
WP_000051887.1|395429_396593_+|integrase	site-specific integrase	integrase	U5P434	Shigella_phage	100.0	2.4e-229
WP_000893260.1|396797_398051_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.0	1.7e-95
396594:396653	attR	CTTATTGATTTAAATGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
WP_001285288.1|398062_399166_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000749881.1|399453_400509_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.9	7.7e-118
WP_000174677.1|400547_400949_-	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
WP_000189539.1|401006_402251_-	esterase FrsA	NA	NA	NA	NA	NA
WP_001291992.1|402342_402801_-	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001293003.1|403061_404519_+	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
WP_001295204.1|404575_404716_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001295202.1|404875_405142_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001059874.1|405448_405901_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001226155.1|405897_406953_-	DNA polymerase IV	NA	NA	NA	NA	NA
WP_032283079.1|407023_407809_-	putative lateral flagellar export/assembly protein LafU	NA	NA	NA	NA	NA
WP_000952760.1|407753_409493_+	flagellar type III secretion system protein FlhA	NA	NA	NA	NA	NA
WP_000006256.1|409810_410308_-|transposase	REP-associated tyrosine transposase RayT	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP023899	Escherichia coli strain FDAARGOS_433 chromosome, complete genome	4711093	700911	717955	4711093	tail,integrase	Enterobacteria_phage(38.46%)	13	706492:706506	719936:719950
WP_099010532.1|700911_704613_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A2D1UII2	Escherichia_phage	85.5	0.0e+00
WP_047657079.1|704677_705277_-	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	96.5	1.6e-107
WP_086625106.1|705345_708825_-	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	90.4	0.0e+00
706492:706506	attL	ATTGATACTGGCGGC	NA	NA	NA	NA
WP_000090882.1|708885_709488_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	85.1	6.2e-88
WP_032300617.1|709424_710168_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.4	4.7e-146
WP_128684128.1|710584_710785_+	hypothetical protein	NA	A0A2I6TC81	Escherichia_phage	63.2	7.4e-06
WP_000135680.1|710799_711162_+	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
WP_000081287.1|711227_712052_+	DUF2303 family protein	NA	U5P439	Shigella_phage	100.0	6.0e-150
WP_021551571.1|712179_712716_+	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	98.9	4.8e-100
WP_001242714.1|712706_713069_+	phage protein	NA	K7PH61	Enterobacteria_phage	97.4	1.7e-64
WP_086625077.1|713068_713689_+	DUF551 domain-containing protein	NA	A5LH60	Enterobacteria_phage	89.8	9.1e-111
WP_086625076.1|714016_716623_-	HNH endonuclease	NA	A0A1S6KZY3	Salmonella_phage	41.1	1.7e-20
WP_086625075.1|716731_717955_-|integrase	site-specific integrase	integrase	A5LH57	Enterobacteria_phage	98.3	1.8e-235
719936:719950	attR	GCCGCCAGTATCAAT	NA	NA	NA	NA
>prophage 3
NZ_CP023899	Escherichia coli strain FDAARGOS_433 chromosome, complete genome	4711093	794709	855830	4711093	protease,transposase,tRNA,integrase	Escherichia_phage(10.0%)	53	815302:815329	822616:822643
WP_000998019.1|794709_796095_+|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	89.3	3.4e-259
WP_000823243.1|796333_797692_-	esterase-like activity of phytase family protein	NA	NA	NA	NA	NA
WP_000555341.1|798424_798682_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001297096.1|799968_800748_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_000255956.1|800747_801770_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.1	1.0e-199
WP_001283626.1|802391_802913_+	RNA polymerase sigma factor FecI	NA	NA	NA	NA	NA
WP_001068910.1|802909_803863_+	fec operon regulator FecR	NA	NA	NA	NA	NA
WP_000188267.1|803949_806274_+	Fe(3+) dicitrate transport protein FecA	NA	NA	NA	NA	NA
WP_001376066.1|806318_807221_+	Fe(3+) dicitrate ABC transporter substrate-binding protein FecB	NA	NA	NA	NA	NA
WP_000125187.1|807217_808216_+	iron-dicitrate ABC transporter permease FecC	NA	NA	NA	NA	NA
WP_000684856.1|808212_809169_+	Fe(3+) dicitrate ABC transporter permease subunit FecD	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.1	1.1e-17
WP_000175457.1|809169_809937_+	Fe(3+) dicitrate ABC transporter ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	24.8	6.4e-13
WP_000177060.1|810494_810752_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001254876.1|811803_812955_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	36.0	2.6e-42
WP_000747102.1|812874_813225_-|transposase	transposase	transposase	Q716C1	Shigella_phage	97.7	8.9e-39
WP_000227281.1|813325_813898_+	hypothetical protein	NA	Q858R9	Enterobacteria_phage	69.0	2.2e-71
WP_000594911.1|813946_814771_-	hypothetical protein	NA	L7TR00	Rhizobium_phage	35.5	3.0e-16
815302:815329	attL	ACTTGGTGCCGAAGGCCGGACTCGAACC	NA	NA	NA	NA
WP_000749342.1|815808_816273_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000145203.1|816513_817008_+	membrane protein	NA	NA	NA	NA	NA
WP_000331917.1|817068_817914_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000190110.1|817927_818488_-	recombinase family protein	NA	A0A219Y912	Aeromonas_phage	39.9	4.2e-22
WP_000085626.1|818817_819147_+	DUF1643 domain-containing protein	NA	A0A1V0EBT6	Caulobacter_phage	35.4	2.0e-11
WP_001261095.1|820152_820485_+	NIPSNAP family protein	NA	NA	NA	NA	NA
WP_023148066.1|820617_822528_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_000061768.1|822898_823918_+	NADPH-dependent aldehyde reductase Ahr	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	30.4	1.9e-44
822616:822643	attR	ACTTGGTGCCGAAGGCCGGACTCGAACC	NA	NA	NA	NA
WP_001376011.1|824047_825550_+	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	44.8	2.1e-84
WP_086625050.1|825710_826793_-	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_000584114.1|826792_827893_-	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_000397144.1|828159_829671_+	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.0	6.0e-47
WP_000786399.1|829928_830372_+	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_000416392.1|830371_833227_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.7	1.8e-140
WP_001680070.1|833280_834477_-	DUF898 domain-containing protein	NA	NA	NA	NA	NA
WP_001059398.1|834669_835173_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000002953.1|835218_835635_-	ribonuclease E inhibitor RraB	NA	NA	NA	NA	NA
WP_000012904.1|835796_836801_+	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_000036437.1|836857_838453_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001336307.1|838575_839028_-	toxin-antitoxin biofilm protein TabA	NA	NA	NA	NA	NA
WP_001375985.1|839172_839766_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000500727.1|839836_840550_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_000230281.1|840680_841076_+	RidA family protein	NA	NA	NA	NA	NA
WP_001296693.1|841356_841491_+	pyr operon leader peptide	NA	NA	NA	NA	NA
WP_000013046.1|841494_842430_+	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	40.2	2.9e-52
WP_000148581.1|842442_842904_+	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_000047539.1|842976_843363_+	2-iminobutanoate/2-iminopropanoate deaminase	NA	NA	NA	NA	NA
WP_000471866.1|843568_846265_-	magnesium-translocating P-type ATPase	NA	M1HLC0	Paramecium_bursaria_Chlorella_virus	27.4	9.0e-46
WP_001387276.1|846405_846459_-	mgtA regulatory leader peptide MgtL	NA	NA	NA	NA	NA
WP_001181324.1|846643_847591_+	HTH-type transcriptional regulator TreR	NA	C6ZCU4	Enterobacteria_phage	21.8	7.9e-13
WP_001299664.1|847709_849131_+	PTS trehalose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_001375992.1|849180_850836_+	alpha,alpha-phosphotrehalase	NA	NA	NA	NA	NA
WP_000187791.1|851229_853368_+	anaerobic ribonucleoside-triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	64.6	9.1e-267
WP_001106226.1|853527_853992_+	anaerobic ribonucleoside-triphosphate reductase-activating protein	NA	H6WXC9	Vibrio_phage	59.7	2.5e-52
WP_001232255.1|854036_854423_-	cytochrome b562	NA	NA	NA	NA	NA
WP_001162184.1|854477_855830_-|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
>prophage 4
NZ_CP023899	Escherichia coli strain FDAARGOS_433 chromosome, complete genome	4711093	2525393	2538576	4711093		Escherichia_phage(50.0%)	12	NA	NA
WP_001374723.1|2525393_2526155_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	2.0e-59
WP_000254708.1|2526148_2526775_+	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
WP_001272592.1|2526914_2528054_+	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
WP_000081550.1|2528116_2529109_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
WP_000104456.1|2529202_2530567_-	GntP family transporter	NA	NA	NA	NA	NA
WP_001136918.1|2530655_2531432_-	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_001278994.1|2531436_2532075_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_000590392.1|2532071_2533334_-	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	1.3e-135
WP_000847985.1|2533330_2534239_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_001297141.1|2534434_2535202_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	3.3e-70
WP_001141340.1|2535252_2535909_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.3	8.0e-49
WP_001272924.1|2536014_2538576_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.7e-30
>prophage 5
NZ_CP023899	Escherichia coli strain FDAARGOS_433 chromosome, complete genome	4711093	3393456	3419700	4711093	holin,terminase	Klebsiella_phage(22.58%)	45	NA	NA
WP_000019585.1|3393456_3394200_-	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	3.5e-24
WP_000252980.1|3394240_3394636_-	MAPEG family protein	NA	NA	NA	NA	NA
WP_046659708.1|3394688_3395468_-	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	98.4	2.3e-71
WP_046659706.1|3395464_3396724_-	DUF3596 domain-containing protein	NA	A0A286S1S8	Klebsiella_phage	90.6	2.7e-226
WP_016244760.1|3396766_3397012_-	excisionase family protein	NA	A0A286S2A4	Klebsiella_phage	93.4	3.8e-36
WP_046659703.1|3397171_3397390_-	TraR/DksA C4-type zinc finger protein	NA	A0A0K2FI84	Escherichia_phage	56.6	7.8e-09
WP_046659701.1|3397386_3397587_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086625037.1|3397741_3397945_+	DUF4752 family protein	NA	T1S9K2	Salmonella_phage	78.5	1.2e-22
WP_086625036.1|3398051_3398435_+	hypothetical protein	NA	A0A1V0E5L5	Salmonella_phage	61.5	1.0e-11
WP_046659679.1|3398434_3398629_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025269967.1|3398827_3399025_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025269966.1|3399061_3399244_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025269997.1|3399240_3399504_+	DNA polymerase III subunit theta	NA	G8C7V1	Escherichia_phage	73.7	1.5e-25
WP_046659672.1|3399610_3400207_+	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	53.8	9.5e-57
WP_024194779.1|3400415_3400706_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	88.5	3.1e-45
WP_029363688.1|3400702_3401065_+	RusA family crossover junction endodeoxyribonuclease	NA	K7PM48	Enterobacteria_phage	82.4	4.3e-52
WP_001548467.1|3401061_3401202_+	YlcG family protein	NA	NA	NA	NA	NA
WP_046659669.1|3401198_3401888_+	antiterminator	NA	I6PDF8	Cronobacter_phage	54.5	3.2e-56
WP_122633140.1|3402343_3402643_+|holin	phage holin family protein	holin	A0A286N2Q5	Klebsiella_phage	87.9	1.4e-40
WP_046659668.1|3402639_3403179_+	glycoside hydrolase family 108 protein	NA	A0A286N2Q6	Klebsiella_phage	96.6	5.3e-99
WP_032412824.1|3403175_3403523_+	hypothetical protein	NA	A0A286N2Q7	Klebsiella_phage	71.3	1.2e-35
WP_046659666.1|3403519_3403795_+	hypothetical protein	NA	G8C7W1	Escherichia_phage	38.2	2.1e-06
WP_046659665.1|3403745_3403943_+	hypothetical protein	NA	A0A286SGR9	Klebsiella_phage	88.1	6.6e-23
WP_024623185.1|3404040_3404349_+	hypothetical protein	NA	Q5QF73	Pseudomonas_virus	55.1	4.2e-16
WP_046659662.1|3404345_3404612_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046659660.1|3404781_3405210_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004218030.1|3405556_3406045_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046659658.1|3405995_3407396_+|terminase	PBSX family phage terminase large subunit	terminase	A0A077KAW0	Edwardsiella_phage	69.0	2.1e-187
WP_001085714.1|3407618_3409070_+	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	68.6	2.5e-191
WP_000233062.1|3409125_3409674_+	hypothetical protein	NA	A0A0M4REK0	Salmonella_phage	55.8	7.0e-46
WP_046659655.1|3409705_3410128_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046659652.1|3410183_3411386_+	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	49.3	2.4e-99
WP_000528476.1|3411389_3411884_+	hypothetical protein	NA	A0A2H4JHM9	uncultured_Caudovirales_phage	62.7	4.2e-50
WP_020804064.1|3411895_3412837_+	DUF2184 domain-containing protein	NA	A0A2H4J191	uncultured_Caudovirales_phage	77.7	3.5e-138
WP_000725700.1|3412876_3413158_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046659650.1|3413126_3413546_+	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	62.2	3.9e-41
WP_025269952.1|3413542_3414049_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023312779.1|3414048_3414435_+	hypothetical protein	NA	A0A2H4J1A4	uncultured_Caudovirales_phage	79.0	2.8e-49
WP_004152176.1|3414529_3414970_+	hypothetical protein	NA	A0A2H4J1A0	uncultured_Caudovirales_phage	51.7	1.6e-40
WP_162403646.1|3415123_3415864_+	DUF2612 domain-containing protein	NA	A0A2H4J1A9	uncultured_Caudovirales_phage	52.2	1.8e-68
WP_025270001.1|3415863_3416745_+	hypothetical protein	NA	A0A2H4IYR0	uncultured_Caudovirales_phage	61.1	4.3e-29
WP_164686900.1|3416744_3416915_+	hypothetical protein	NA	NA	NA	NA	NA
WP_126875314.1|3416996_3419081_+	hypothetical protein	NA	A0A0C5Q3X6	Klebsiella_phage	47.3	7.1e-107
WP_025270003.1|3419089_3419269_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025270004.1|3419382_3419700_+	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	50.0	5.3e-22
>prophage 6
NZ_CP023899	Escherichia coli strain FDAARGOS_433 chromosome, complete genome	4711093	3701857	3728051	4711093	lysis,integrase	Escherichia_phage(27.78%)	29	3702922:3702936	3726700:3726714
WP_000041556.1|3701857_3704284_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.0	7.7e-214
3702922:3702936	attL	CGCCGTCGCGGATTG	NA	NA	NA	NA
WP_001307224.1|3704482_3704788_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_001321287.1|3704895_3705606_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001138581.1|3705608_3706169_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_000705211.1|3706203_3706545_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_000598292.1|3706679_3707006_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_001295394.1|3707211_3708426_+	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_000836058.1|3708437_3709457_+	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	26.2	4.3e-17
WP_001360138.1|3709514_3709625_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000877001.1|3709644_3710925_-|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	62.3	6.6e-156
WP_000005552.1|3710959_3711211_-	excisionase family protein	NA	S4TND0	Salmonella_phage	50.0	2.2e-15
WP_001372999.1|3711283_3713755_-	exonuclease	NA	K7PLW7	Enterobacteria_phage	59.8	6.1e-57
WP_001083281.1|3713848_3714040_-|lysis	lysis protein YdfD	lysis	NA	NA	NA	NA
WP_000854559.1|3714036_3714225_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_072163420.1|3714308_3714551_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000054501.1|3714531_3715497_+	hypothetical protein	NA	U5P0A0	Shigella_phage	63.9	9.7e-59
WP_001373616.1|3715537_3715960_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	85.6	2.0e-61
WP_001678528.1|3716089_3717034_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001678529.1|3717581_3718931_-	hypothetical protein	NA	A0A1W6JNS5	Morganella_phage	98.0	5.7e-259
WP_023147793.1|3719248_3719851_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1V0E036	Clostridioides_phage	31.2	3.7e-08
WP_023147794.1|3720210_3721191_+	hypothetical protein	NA	NA	NA	NA	NA
WP_122083109.1|3721710_3721818_-	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	100.0	3.8e-09
WP_012578894.1|3721919_3722075_+	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	94.1	2.5e-17
WP_000980999.1|3722290_3722542_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023147795.1|3722608_3722887_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	7.4e-12
WP_001373319.1|3722888_3723938_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.3	4.2e-108
WP_000904112.1|3723950_3724325_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	8.4e-35
WP_000762889.1|3724321_3725143_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	59.0	2.7e-78
WP_001373320.1|3725888_3728051_+	DUF1983 domain-containing protein	NA	A0A291AWT4	Escherichia_phage	96.6	0.0e+00
3726700:3726714	attR	CGCCGTCGCGGATTG	NA	NA	NA	NA
>prophage 7
NZ_CP023899	Escherichia coli strain FDAARGOS_433 chromosome, complete genome	4711093	4131885	4144623	4711093	transposase,integrase	Enterobacteria_phage(33.33%)	13	4129858:4129881	4143326:4143349
4129858:4129881	attL	AACGGGCGTGTTATACGCCCGTTG	NA	NA	NA	NA
WP_000379042.1|4131885_4133841_-	AAA family ATPase	NA	K4I1H4	Acidithiobacillus_phage	28.6	7.5e-26
WP_001753331.1|4136205_4136745_-	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	65.6	7.5e-61
WP_072163463.1|4136927_4137239_+	recombinase	NA	A0A0N7KZJ3	Stx2-converting_phage	100.0	2.4e-43
WP_001372461.1|4137235_4137916_+	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	98.7	5.1e-131
WP_000149533.1|4137912_4138071_+	DUF1317 family protein	NA	M1FJ61	Enterobacteria_phage	88.5	6.4e-21
WP_001678641.1|4138067_4139132_+	DGQHR domain-containing protein	NA	T1SBJ4	Salmonella_phage	64.8	1.7e-133
WP_001678640.1|4139285_4139504_+	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	94.4	3.2e-34
WP_000488406.1|4139551_4139791_+	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	94.9	3.9e-38
WP_000088653.1|4139930_4140167_+	excisionase	NA	NA	NA	NA	NA
WP_000255956.1|4140290_4141313_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.1	1.0e-199
WP_001297096.1|4141312_4142092_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_086625063.1|4142134_4143259_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21929	Phage_21	99.7	8.0e-206
WP_000444487.1|4143372_4144623_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
4143326:4143349	attR	CAACGGGCGTATAACACGCCCGTT	NA	NA	NA	NA
>prophage 8
NZ_CP023899	Escherichia coli strain FDAARGOS_433 chromosome, complete genome	4711093	4398824	4485910	4711093	protease,tail,lysis,capsid,portal,tRNA,terminase,plate,integrase	Salmonella_phage(57.41%)	90	4391786:4391801	4488481:4488496
4391786:4391801	attL	GTTACCGCCATCGCCA	NA	NA	NA	NA
WP_000886683.1|4398824_4400117_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
WP_000067755.1|4400207_4401551_-	replication-associated recombination protein RarA	NA	G3MBE0	Bacillus_virus	40.8	2.1e-80
WP_001295343.1|4401561_4402173_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_000077063.1|4402327_4406434_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
WP_000228473.1|4406568_4407063_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_000537418.1|4407606_4408572_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	8.5e-63
WP_001043619.1|4408694_4410461_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.3	5.4e-23
WP_001202188.1|4410461_4412183_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	25.2	1.9e-20
WP_001241678.1|4412224_4412929_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|4413213_4413432_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_000934041.1|4414116_4416393_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
WP_000520781.1|4416423_4416744_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_000410785.1|4417066_4417291_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
WP_000188182.1|4417363_4419310_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.1	1.1e-37
WP_000746468.1|4419306_4420422_-	macrolide transporter subunit MacA	NA	NA	NA	NA	NA
WP_001355621.1|4420572_4421529_+	VirK/YbjX family protein	NA	NA	NA	NA	NA
WP_000599806.1|4421525_4423184_-	ATP-dependent endonuclease	NA	NA	NA	NA	NA
WP_001297311.1|4423609_4424305_+	aquaporin Z	NA	NA	NA	NA	NA
WP_000491142.1|4424799_4425699_+	L-lysine exporter LysO	NA	NA	NA	NA	NA
WP_000458817.1|4425842_4427495_+	hydroxylamine reductase	NA	NA	NA	NA	NA
WP_001372573.1|4427506_4428475_+	NADH oxidoreductase	NA	NA	NA	NA	NA
WP_000815362.1|4428607_4430326_+	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.0	5.2e-31
WP_000566372.1|4430362_4431364_+	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_001136554.1|4431374_4432805_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_001338420.1|4432903_4433917_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_001255167.1|4433913_4434744_-	N-acetylmuramoyl-L-alanine amidase AmiD	NA	A0A1B0UZW5	Roseobacter_phage	30.0	5.7e-07
WP_001160737.1|4434740_4435064_-	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001270738.1|4435189_4435705_+	lipoprotein	NA	NA	NA	NA	NA
WP_000027205.1|4435922_4436651_+	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.7	6.0e-29
WP_000756569.1|4436668_4437400_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001372575.1|4437406_4438123_+	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
WP_000464491.1|4438122_4438791_+	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
WP_001372577.1|4439082_4439814_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001149732.1|4439988_4441116_-	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	27.6	3.5e-28
WP_000389260.1|4441156_4441645_-	YbjO family protein	NA	NA	NA	NA	NA
WP_001061657.1|4441704_4442550_-	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_001093864.1|4442546_4443500_-	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_000995994.1|4443509_4444643_-	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.0	1.9e-29
WP_000126053.1|4444737_4445850_-	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_000203025.1|4446200_4446677_-	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_000684321.1|4446764_4447667_-	30S ribosomal protein S6--L-glutamate ligase	NA	I3ULC9	Synechococcus_phage	34.4	2.6e-37
WP_000189159.1|4447727_4448450_-	nitroreductase NfsA	NA	NA	NA	NA	NA
WP_001201560.1|4448433_4448721_-	DUF1418 family protein	NA	NA	NA	NA	NA
WP_001195240.1|4448880_4449138_+	glutaredoxin 1	NA	A0A2I7SAE2	Vibrio_phage	61.9	8.6e-23
WP_000681108.1|4449167_4449545_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001024876.1|4449814_4451500_+	aspartate:alanine antiporter	NA	NA	NA	NA	NA
WP_000972391.1|4451735_4451954_-	ogr/Delta-like zinc finger family protein	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
WP_099010546.1|4452044_4453145_-	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	87.4	3.8e-176
WP_000980394.1|4453141_4453627_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	81.2	1.7e-67
WP_099010547.1|4453623_4456701_-|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	63.1	0.0e+00
WP_000763311.1|4456693_4456813_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.8e-13
WP_001281009.1|4456827_4457130_-|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	5.3e-40
WP_001504081.1|4457184_4457700_-|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	94.7	4.8e-89
WP_000046130.1|4457709_4458882_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.0	3.0e-203
WP_032286389.1|4458988_4459402_-|tail	tail fiber assembly protein	tail	U5P0S4	Shigella_phage	74.3	4.0e-22
WP_099010548.1|4459401_4461717_-|tail	tail fiber protein	tail	A0A0F7LDR4	Escherichia_phage	47.1	3.7e-80
WP_001086834.1|4461713_4462319_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	92.0	4.4e-110
WP_000268294.1|4462311_4463220_-|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	91.1	4.1e-144
WP_000177400.1|4463206_4463566_-	GPW/gp25 family protein	NA	A0A1S6KZZ4	Salmonella_phage	86.6	1.2e-51
WP_057108080.1|4463562_4464141_-|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	84.9	3.4e-91
WP_099010549.1|4464209_4464656_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	84.2	4.3e-62
WP_001039937.1|4464648_4465080_-|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	93.7	1.3e-71
WP_001513113.1|4465175_4465604_-|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	75.9	6.4e-47
WP_032289568.1|4465600_4465978_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	39.2	8.8e-16
WP_170950169.1|4465979_4466492_-	lysozyme	NA	E5G6N1	Salmonella_phage	90.5	9.9e-87
WP_000171568.1|4466472_4466688_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
WP_000868175.1|4466691_4466895_-|tail	tail protein X	tail	E5G6M9	Salmonella_phage	92.5	1.4e-31
WP_000216237.1|4467611_4468445_-|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	91.0	2.8e-123
WP_061355691.1|4468587_4470354_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.5	0.0e+00
WP_099010550.1|4470353_4471379_+|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	87.0	5.8e-171
WP_099010551.1|4471396_4472359_-	RNA-directed DNA polymerase	NA	NA	NA	NA	NA
WP_032177080.1|4472521_4473445_-	hypothetical protein	NA	NA	NA	NA	NA
WP_170950166.1|4473479_4473638_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000508501.1|4473754_4474756_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001085272.1|4474755_4475835_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000756244.1|4475821_4476505_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001217575.1|4476600_4476834_-	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
WP_001154431.1|4476844_4477033_-	hypothetical protein	NA	E5G6M0	Salmonella_phage	96.8	1.6e-26
WP_099010552.1|4477186_4479601_-	replication endonuclease	NA	E5G6L9	Salmonella_phage	97.3	0.0e+00
WP_096967488.1|4479597_4480455_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	96.8	3.0e-160
WP_023135809.1|4480451_4480679_-	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	98.7	1.7e-35
WP_001244228.1|4480678_4480912_-	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	98.7	6.4e-33
WP_000996717.1|4480979_4481321_-	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	98.2	1.7e-55
WP_063278041.1|4481438_4481735_-	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	88.5	1.1e-21
WP_063278040.1|4481742_4482252_-	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	97.6	6.4e-86
WP_000188450.1|4482316_4482520_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099010558.1|4482665_4483235_+	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	41.4	9.4e-38
WP_001350185.1|4483250_4483433_+	hypothetical protein	NA	A0A0R6PI25	Moraxella_phage	55.9	8.5e-09
WP_096967487.1|4483446_4484778_+	NTPase	NA	R9TRQ8	Vibrio_phage	26.6	1.2e-19
WP_063119391.1|4484857_4485910_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	57.3	4.7e-107
4488481:4488496	attR	TGGCGATGGCGGTAAC	NA	NA	NA	NA
>prophage 9
NZ_CP023899	Escherichia coli strain FDAARGOS_433 chromosome, complete genome	4711093	4568063	4591598	4711093	lysis,integrase	Enterobacteria_phage(46.67%)	38	4567409:4567423	4591672:4591686
4567409:4567423	attL	TTAGTATAAAAAAGC	NA	NA	NA	NA
WP_001753290.1|4568063_4569395_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	37.1	1.4e-20
WP_000239881.1|4569794_4570463_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001372490.1|4571353_4571914_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.8	4.9e-87
WP_000105084.1|4572302_4572536_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	94.4	7.3e-21
WP_000079508.1|4572592_4573003_+	DUF1398 family protein	NA	C6ZCX4	Enterobacteria_phage	76.3	1.3e-52
WP_001139678.1|4573354_4573507_-	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	96.0	3.1e-20
WP_000092273.1|4573494_4573962_-|lysis	lysis protein	lysis	A0A2D1GLQ7	Escherichia_phage	96.8	1.6e-75
WP_001372488.1|4573958_4574456_-	lysozyme RrrD	NA	A0A1B5FP97	Escherichia_phage	97.0	1.6e-89
WP_000839582.1|4574455_4574671_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	98.6	1.2e-33
WP_000592543.1|4575940_4576900_-	DUF523 and DUF1722 domain-containing protein	NA	NA	NA	NA	NA
WP_000780581.1|4577092_4577617_+	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	54.1	1.1e-48
WP_001204777.1|4577772_4578150_-	antitermination protein	NA	Q777W5	Enterobacteria_phage	84.2	7.3e-55
WP_000971068.1|4578235_4578376_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	67.4	5.5e-08
WP_001372483.1|4578372_4578735_-	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	97.4	1.5e-60
WP_001372487.1|4578731_4579022_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	91.7	4.8e-46
WP_000224914.1|4579014_4579185_-	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	69.8	2.4e-13
WP_001372486.1|4579184_4579640_-	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.2	5.9e-59
WP_072157016.1|4579636_4579738_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000825400.1|4579830_4580283_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000720581.1|4580279_4580840_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000145917.1|4581324_4581618_-	protein ren	NA	A0A0N6WES4	Escherichia_phage	95.7	1.1e-42
WP_001182899.1|4582229_4582769_-	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	66.1	2.0e-61
WP_001067458.1|4582838_4583069_-	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	68.0	1.5e-21
WP_000858975.1|4583173_4583863_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	75.0	2.8e-92
WP_000389051.1|4583985_4584735_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000210934.1|4584731_4585559_+	DUF3037 domain-containing protein	NA	NA	NA	NA	NA
WP_000233576.1|4586067_4586274_+	phage encoded cell division inhibitor protein	NA	K7P6H3	Enterobacteria_phage	85.3	3.2e-28
WP_000995439.1|4586349_4586646_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
WP_000100847.1|4586651_4587437_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_001372450.1|4587433_4588114_+	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	98.7	3.0e-131
WP_072126246.1|4588110_4588293_+	DUF1317 domain-containing protein	NA	A0A0N7CHV0	Escherichia_phage	98.3	2.2e-28
WP_023148020.1|4588265_4588457_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	98.4	2.8e-26
WP_001395510.1|4588467_4588749_+	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	100.0	2.5e-47
WP_000763365.1|4588847_4589069_+	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	97.3	1.4e-34
WP_000120065.1|4589279_4589882_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000545745.1|4590124_4590292_+	hypothetical protein	NA	A5VWB7	Enterobacteria_phage	98.2	2.9e-27
WP_001303849.1|4590331_4590550_+	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_000533646.1|4590527_4591598_+|integrase	tyrosine-type recombinase/integrase	integrase	Q9MCR4	Enterobacteria_phage	99.7	1.9e-201
4591672:4591686	attR	TTAGTATAAAAAAGC	NA	NA	NA	NA
>prophage 1
NZ_CP023903	Escherichia coli strain FDAARGOS_433 plasmid unnamed1, complete sequence	101274	0	70657	101274	integrase,transposase	Escherichia_phage(33.33%)	54	27536:27552	45337:45353
WP_005012601.1|525_738_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000139363.1|871_1432_-	fertility inhibition protein FinO	NA	NA	NA	NA	NA
WP_086625070.1|1486_2263_-	conjugal transfer pilus acetylase TraX	NA	A0A077JBM8	Xanthomonas_phage	30.5	3.3e-09
WP_086625069.1|2201_2372_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000271685.1|2368_2791_-	DUF1380 family protein	NA	NA	NA	NA	NA
WP_001666994.1|2837_3140_-	antirestriction protein	NA	NA	NA	NA	NA
WP_001006251.1|3676_4447_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001546462.1|4491_4926_-	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_001104873.1|4939_5161_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032181561.1|5161_5845_-	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.0	1.1e-29
WP_000817031.1|7869_8841_-	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	100.0	4.8e-175
WP_000772446.1|8840_10007_-	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	100.0	7.0e-229
WP_000852146.1|10594_11350_-	replication initiation protein RepE	NA	I3WF20	Macacine_betaherpesvirus	100.0	3.8e-143
WP_000016970.1|12071_12878_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	100.0	5.8e-57
WP_001159871.1|12878_13184_-	type II toxin-antitoxin system toxin CcdB	NA	NA	NA	NA	NA
WP_000813630.1|13185_13404_-	type II toxin-antitoxin system antitoxin CcdA	NA	NA	NA	NA	NA
WP_001261286.1|13963_14194_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001034044.1|14190_14607_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_001128474.1|14681_16247_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_000361402.1|16231_17254_+	helicase UvrD	NA	NA	NA	NA	NA
WP_000973519.1|18719_20921_-	ferric aerobactin receptor IutA	NA	NA	NA	NA	NA
WP_000750130.1|21002_22280_-	NADPH-dependent L-lysine N(6)-monooxygenase	NA	NA	NA	NA	NA
WP_001015721.1|22276_24019_-	aerobactin synthase IucC	NA	NA	NA	NA	NA
WP_000011908.1|24018_24966_-	N(6)-hydroxylysine O-acetyltransferase	NA	NA	NA	NA	NA
WP_000602863.1|24966_26691_-	aerobactin synthase IucA	NA	NA	NA	NA	NA
WP_000095526.1|26826_28020_+	MFS transporter	NA	NA	NA	NA	NA
27536:27552	attL	TTGGACTTTCGCCAGCC	NA	NA	NA	NA
WP_001318207.1|28399_28780_-	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	55.0	1.9e-26
WP_000968139.1|30022_30880_-	iron/manganese ABC transporter permease subunit SitD	NA	NA	NA	NA	NA
WP_001101723.1|30876_31734_-	iron/manganese ABC transporter permease subunit SitC	NA	NA	NA	NA	NA
WP_000983710.1|31730_32558_-	iron/manganese ABC transporter ATP-binding protein SitB	NA	A0A1M7XV31	Cedratvirus	27.0	3.6e-14
WP_000949005.1|32557_33472_-	iron/manganese ABC transporter substrate-binding protein SitA	NA	NA	NA	NA	NA
WP_000361611.1|36453_37431_+	replication initiation protein	NA	J9Q7H0	Salmonella_phage	63.9	4.6e-101
WP_001066953.1|37715_38456_-|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	2.0e-24
WP_001309252.1|38576_38765_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001072358.1|39131_40301_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001322642.1|41147_41420_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_001496335.1|42662_44633_+	TonB-dependent hemoglobin/transferrin/lactoferrin family receptor	NA	NA	NA	NA	NA
WP_000977394.1|44639_45431_+	DUF4198 domain-containing protein	NA	NA	NA	NA	NA
45337:45353	attR	GGCTGGCGAAAGTCCAA	NA	NA	NA	NA
WP_000255956.1|46946_47969_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.1	1.0e-199
WP_023893983.1|48072_48369_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099010561.1|48387_49458_+	IncI1-type conjugal transfer protein TrbB	NA	NA	NA	NA	NA
WP_011264051.1|49450_51742_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000255956.1|54964_55987_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.1	1.0e-199
WP_024193849.1|57066_57441_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	9.8e-60
WP_001067855.1|57465_58170_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000219391.1|58291_59197_+	Mph(A) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
WP_001137892.1|60430_61015_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001067855.1|62068_62773_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001393253.1|65094_65427_+	cupin fold metalloprotein, WbuC family	NA	NA	NA	NA	NA
WP_000239590.1|65473_66349_-	class A extended-spectrum beta-lactamase CTX-M-15	NA	A0A1B0VBP7	Salmonella_phage	82.4	1.1e-125
WP_001067855.1|66957_67662_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001334766.1|68293_69124_-	oxacillin-hydrolyzing class D beta-lactamase OXA-1	NA	NA	NA	NA	NA
WP_063840321.1|69254_69809_-	fluoroquinolone-acetylating aminoglycoside 6'-N-acetyltransferase AAC(6')-Ib-cr5	NA	NA	NA	NA	NA
WP_001067855.1|69952_70657_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
>prophage 2
NZ_CP023903	Escherichia coli strain FDAARGOS_433 plasmid unnamed1, complete sequence	101274	76730	80328	101274	transposase	uncultured_archaeal_virus(50.0%)	2	NA	NA
WP_000509965.1|76730_77336_-	recombinase family protein	NA	A0A1S5Y2X8	uncultured_archaeal_virus	35.3	9.4e-20
WP_001553819.1|77430_80328_+|transposase	Tn3-like element Tn5403 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	37.8	4.2e-182
>prophage 3
NZ_CP023903	Escherichia coli strain FDAARGOS_433 plasmid unnamed1, complete sequence	101274	88238	88948	101274		Enterobacteria_phage(50.0%)	2	NA	NA
WP_059330006.1|88238_88601_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	88.5	9.0e-34
WP_000624725.1|88597_88948_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
>prophage 4
NZ_CP023903	Escherichia coli strain FDAARGOS_433 plasmid unnamed1, complete sequence	101274	98739	100678	101274	transposase	Stx2-converting_phage(100.0%)	2	NA	NA
WP_023149734.1|98739_100311_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.5	4.9e-169
WP_000624622.1|100330_100678_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
>prophage 1
NZ_CP023895	Escherichia coli strain FDAARGOS_433 plasmid unnamed2, complete sequence	91648	34985	56960	91648	transposase	Escherichia_phage(50.0%)	23	NA	NA
WP_001067855.1|34985_35690_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_099010525.1|35701_36820_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_001067855.1|36883_37588_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_023063803.1|37709_38624_+	Mph(A) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
WP_001137892.1|39857_40442_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001389365.1|40934_41699_-|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_001235713.1|42000_42558_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	100.0	7.0e-94
WP_000027057.1|42740_43601_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_012372818.1|43770_44526_+	16S rRNA (guanine(1405)-N(7))-methyltransferase RmtB1	NA	NA	NA	NA	NA
WP_014342204.1|44606_45155_-	cation:proton antiporter	NA	NA	NA	NA	NA
WP_014342205.1|45190_45568_+	molecular chaperone GroEL	NA	A0A2I7SAK5	Vibrio_phage	58.1	8.2e-22
WP_001067855.1|45761_46466_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_023408309.1|47024_47837_+	subclass B1 metallo-beta-lactamase NDM-5	NA	NA	NA	NA	NA
WP_004201167.1|47840_48206_+	bleomycin binding protein Ble-MBL	NA	NA	NA	NA	NA
WP_004201168.1|48210_48849_+	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
WP_004201169.1|48859_49891_-	twin-arginine translocation (TAT) pathway signal sequence domain protein	NA	NA	NA	NA	NA
WP_000050481.1|50203_51745_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000259031.1|52149_52989_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000679427.1|52982_53330_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_001206356.1|53493_54285_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
WP_001336345.1|54290_54581_-	DUF1010 domain-containing protein	NA	NA	NA	NA	NA
WP_001083725.1|54692_55190_-	trimethoprim-resistant dihydrofolate reductase DfrA12	NA	A0A0A0PL85	Bacillus_phage	40.9	7.5e-23
WP_001067855.1|56255_56960_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
>prophage 1
NZ_CP023896	Escherichia coli strain FDAARGOS_433 plasmid unnamed3, complete sequence	83988	0	83690	83988	plate,head,tail,terminase,portal,integrase	Escherichia_phage(62.16%)	78	9295:9311	62586:62602
WP_000939948.1|574_1039_+	hypothetical protein	NA	Q1MVK1	Enterobacteria_phage	98.7	4.3e-89
WP_000509939.1|1585_2095_-	hypothetical protein	NA	Q1MVJ9	Enterobacteria_phage	100.0	1.3e-91
WP_000035301.1|2106_2688_-	hypothetical protein	NA	Q1MVJ8	Enterobacteria_phage	97.4	7.3e-102
WP_000041757.1|2723_3539_-	hypothetical protein	NA	A0A1B0V835	Salmonella_phage	99.3	2.6e-113
WP_029487601.1|3548_5138_-	hypothetical protein	NA	Q71TB2	Escherichia_phage	98.5	2.4e-301
WP_059338140.1|5198_6905_-	hypothetical protein	NA	Q1MVJ5	Enterobacteria_phage	94.2	6.3e-311
WP_075851199.1|7130_8132_-	ParB/RepB/Spo0J family partition protein	NA	Q38420	Escherichia_phage	99.4	1.1e-177
WP_001285362.1|8148_9345_-	AAA family ATPase	NA	A0A077SL49	Escherichia_phage	100.0	1.6e-225
9295:9311	attL	CATTCTGTTTGCTCTTT	NA	NA	NA	NA
WP_001076427.1|9902_10763_-	RepB family plasmid replication initiator protein	NA	Q71TL8	Escherichia_phage	100.0	4.7e-158
WP_075851201.1|11081_11474_-	hypothetical protein	NA	A0A077SLJ1	Escherichia_phage	97.7	7.6e-71
WP_075851203.1|11651_12074_-	ppfA	NA	A0A1B0VCB0	Salmonella_phage	86.4	1.1e-46
WP_075851205.1|12113_12902_-	hypothetical protein	NA	A0A1B0V830	Salmonella_phage	96.6	1.4e-116
WP_001177862.1|13363_13648_+	hypothetical protein	NA	Q71TA2	Escherichia_phage	97.9	2.5e-47
WP_000472529.1|13640_14546_+	recombination-associated protein RdgC	NA	A0A077SK17	Escherichia_phage	99.7	1.6e-159
WP_099010526.1|14542_17584_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A077SL51	Escherichia_phage	86.4	0.0e+00
WP_000467133.1|19146_19581_+	tellurite resistance TerB family protein	NA	Q1MVI3	Enterobacteria_phage	100.0	8.1e-74
WP_000146942.1|19580_19745_+	DUF3927 family protein	NA	Q1MVI2	Enterobacteria_phage	98.1	6.9e-18
WP_001702255.1|20000_20144_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001276605.1|20217_21582_+	replicative DNA helicase	NA	O80281	Escherichia_phage	99.6	1.8e-252
WP_001189128.1|21581_21884_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075851211.1|21880_22855_+	hypothetical protein	NA	A0A077SL52	Escherichia_phage	98.1	5.5e-187
WP_073884958.1|22901_23534_-|plate	baseplate protein	plate	Q1MVH8	Enterobacteria_phage	99.4	7.7e-89
WP_000212018.1|23526_24543_-	hypothetical protein	NA	A0A077SLQ1	Escherichia_phage	100.0	3.5e-192
WP_075851213.1|24544_25330_-|plate	baseplate	plate	A0A1B0V7N6	Salmonella_phage	99.2	1.4e-143
WP_000896806.1|25316_26045_-	hypothetical protein	NA	Q71TJ9	Escherichia_phage	100.0	4.2e-139
WP_075851215.1|26048_27266_-|tail	phage tail protein	tail	A0A077SL53	Escherichia_phage	99.5	4.1e-224
WP_000235786.1|27275_27653_-	hypothetical protein	NA	Q38620	Escherichia_phage	100.0	2.2e-67
WP_000840930.1|27799_28045_+	hypothetical protein	NA	A0A1B0VDU5	Salmonella_phage	100.0	1.5e-40
WP_075851217.1|28047_28626_+	VRR-NUC domain-containing protein	NA	Q71T85	Escherichia_phage	99.5	4.4e-107
WP_000096174.1|28692_28848_+	hypothetical protein	NA	Q71TJ4	Escherichia_phage	100.0	7.0e-20
WP_012817939.1|28789_29452_+	hypothetical protein	NA	Q71T83	Escherichia_phage	100.0	4.5e-124
WP_000484108.1|29349_29976_+	norphogenetic protein	NA	Q71T82	Escherichia_phage	99.0	4.0e-122
WP_075851219.1|29972_30650_+	metallophosphoesterase	NA	Q71TJ1	Escherichia_phage	97.3	3.3e-130
WP_075851232.1|30646_31348_+	hypothetical protein	NA	Q71TJ0	Escherichia_phage	99.6	1.0e-142
WP_075851234.1|31649_32912_+	hypothetical protein	NA	A0A1B0V7L1	Salmonella_phage	99.3	1.7e-233
WP_099010527.1|34234_35872_+	acyltransferase	NA	B5WZU0	Pseudomonas_phage	38.2	7.3e-75
WP_000506730.1|38762_39152_+	DNA repair protein	NA	Q1MVE7	Enterobacteria_phage	100.0	8.3e-70
WP_001190712.1|39224_39446_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	A0A222YXU1	Escherichia_phage	100.0	6.7e-32
WP_001216045.1|39445_39826_+	type II toxin-antitoxin system death-on-curing family toxin	NA	Q71T66	Escherichia_phage	100.0	1.9e-63
WP_001339207.1|39830_40010_+	hypothetical protein	NA	Q71TH5	Escherichia_phage	100.0	7.1e-24
WP_023356283.1|40037_41081_+	DUF968 domain-containing protein	NA	Q1MVE3	Enterobacteria_phage	99.7	1.8e-207
WP_001326849.1|41169_41622_+	late promoter-activating protein	NA	Q71T63	Escherichia_phage	100.0	3.0e-79
WP_000219625.1|41707_42901_+	hypothetical protein	NA	Q5QBP3	Enterobacteria_phage	88.7	7.2e-181
WP_000124150.1|42900_44385_+|terminase	terminase	terminase	Q71T61	Escherichia_phage	100.0	1.5e-292
WP_000611657.1|44410_45262_-	hypothetical protein	NA	A0A077SLM8	Escherichia_phage	99.3	4.0e-157
WP_000874154.1|45372_45582_-	hypothetical protein	NA	Q5XLQ8	Enterobacteria_phage	100.0	4.8e-32
WP_000542336.1|46177_46399_+	hypothetical protein	NA	Q5QBN7	Enterobacteria_phage	100.0	4.5e-36
WP_046660036.1|46406_47438_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A077SLE7	Escherichia_phage	99.4	6.4e-194
WP_024245510.1|47488_47800_+	hypothetical protein	NA	Q5XLQ4	Enterobacteria_phage	93.2	6.3e-44
WP_023155281.1|48046_48607_+	Ref family protein	NA	Q71TG3	Escherichia_phage	96.8	3.6e-98
WP_075851364.1|48796_49438_+	maturation control protein	NA	A0A077SK30	Escherichia_phage	96.2	4.2e-111
WP_077902034.1|49528_50569_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024245513.1|50568_51078_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000747846.1|51136_51385_-	hypothetical protein	NA	Q71TG0	Escherichia_phage	100.0	1.8e-41
WP_000224043.1|51381_51822_-	hypothetical protein	NA	A0A077SLF0	Escherichia_phage	100.0	1.7e-79
WP_075851366.1|51855_58623_-	N-6 DNA methylase	NA	Q1MVN7	Enterobacteria_phage	98.6	0.0e+00
WP_075851368.1|58699_60409_+|portal	phage portal protein	portal	Q71TR7	Escherichia_phage	99.6	0.0e+00
WP_046659817.1|60401_61421_+|head	head processing protein	head	Q71TR6	Escherichia_phage	95.9	1.9e-177
WP_001345478.1|61712_62270_-	lysozyme	NA	Q71TF3	Escherichia_phage	100.0	4.2e-107
WP_001615669.1|62438_62927_+	single-stranded DNA-binding protein	NA	A0A1B0VAF5	Salmonella_phage	99.4	1.1e-87
62586:62602	attR	AAAGAGCAAACAGAATG	NA	NA	NA	NA
WP_075851370.1|63129_63924_+	hypothetical protein	NA	Q71TF1	Escherichia_phage	96.6	8.0e-144
WP_001376906.1|63953_64271_-	hypothetical protein	NA	Q1MVN0	Enterobacteria_phage	88.6	7.6e-45
WP_075851372.1|64260_67248_-	hypothetical protein	NA	A0A1B0VFX4	Salmonella_phage	98.4	0.0e+00
WP_045904054.1|67260_67626_-	hypothetical protein	NA	A0A077SK35	Escherichia_phage	98.3	6.7e-45
WP_001286322.1|69801_70236_-	hypothetical protein	NA	A0A077SLL3	Escherichia_phage	98.6	2.8e-74
WP_001561131.1|70314_71151_-	hypothetical protein	NA	A0A077SLH5	Escherichia_phage	99.6	1.5e-153
WP_029487598.1|71150_72584_-	bleomycin hydrolase	NA	Q71TP2	Escherichia_phage	99.4	3.4e-270
WP_000002800.1|72580_72937_-	hypothetical protein	NA	Q71TP1	Escherichia_phage	100.0	1.0e-61
WP_089438725.1|72936_76677_-	transglycosylase SLT domain-containing protein	NA	Q1MVL3	Enterobacteria_phage	87.4	0.0e+00
WP_000926345.1|76758_77640_-	hypothetical protein	NA	A0A1B0VBL3	Salmonella_phage	99.7	3.7e-174
WP_000523980.1|77654_78266_-	hypothetical protein	NA	Q71TN8	Escherichia_phage	99.5	2.9e-109
WP_000188920.1|78276_78843_-	hypothetical protein	NA	A0A077SK12	Escherichia_phage	99.5	6.6e-100
WP_001033469.1|78923_79463_-	DUF5384 family protein	NA	A0A077SL46	Escherichia_phage	100.0	1.8e-46
WP_000039791.1|79466_79979_-	hypothetical protein	NA	A0A077SK39	Escherichia_phage	100.0	4.5e-55
WP_000245712.1|80598_80820_+	host cell division inhibitor Icd-like protein	NA	A0A077SLM6	Escherichia_phage	100.0	1.3e-38
WP_075851195.1|80816_81851_+	phage antirepressor KilAC domain-containing protein	NA	A0A077SLI1	Escherichia_phage	99.1	4.5e-187
WP_075851197.1|82014_82815_+	phage antirepressor KilAC domain-containing protein	NA	Q1MVK4	Enterobacteria_phage	99.6	1.6e-147
WP_053287802.1|82844_83690_+	hypothetical protein	NA	Q1MVK3	Enterobacteria_phage	97.9	1.2e-150
>prophage 1
NZ_CP023900	Escherichia coli strain FDAARGOS_433 plasmid unnamed6, complete sequence	34323	20835	28578	34323		Rhodococcus_virus(16.67%)	6	NA	NA
WP_000117626.1|20835_21336_-	antirestriction protein ArdA	NA	G9FHQ1	Rhodococcus_virus	26.5	7.1e-05
WP_000977995.1|21797_22394_-	hypothetical protein	NA	A0A0N7KZV3	Escherichia_phage	56.6	9.0e-15
WP_000936285.1|23814_25716_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	29.1	3.1e-32
WP_057109540.1|26073_26493_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	47.6	2.0e-24
WP_001703910.1|26492_27764_+	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	60.9	2.0e-144
WP_000587689.1|27951_28578_+	ParA family plasmid-partitioning AAA ATPase	NA	E5FFJ3	Burkholderia_phage	31.1	2.0e-17
