The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP023946	Klebsiella pneumoniae strain FDAARGOS_446 chromosome, complete genome	5392753	251664	263318	5392753	integrase	Enterobacteria_phage(70.0%)	13	239798:239812	262855:262869
239798:239812	attL	AGCGCGGAGAGATTG	NA	NA	NA	NA
WP_002889890.1|251664_253998_-	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	82.2	0.0e+00
WP_002889897.1|254009_254330_-	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_002889911.1|254326_254554_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072028197.1|254550_255102_-	ash family protein	NA	Q7M2A7	Enterobacteria_phage	70.4	1.8e-33
WP_002889915.1|255104_255371_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	71.6	2.6e-30
WP_002889917.1|255912_256650_+	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	60.7	9.0e-73
WP_002889919.1|256646_256892_+	ogr/Delta-like zinc finger family protein	NA	Q7M294	Enterobacteria_phage	58.0	1.9e-19
WP_002889930.1|256909_257476_+	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	64.3	1.5e-59
WP_004152979.1|258044_258470_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152029.1|258469_259420_-	AAA family ATPase	NA	A0A1X9IGI7	Lactococcus_phage	27.1	1.2e-13
WP_002889938.1|259407_260598_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	62.7	6.4e-145
WP_002889940.1|260950_262204_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	44.9	8.9e-89
WP_004144574.1|262214_263318_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.5	4.8e-62
262855:262869	attR	AGCGCGGAGAGATTG	NA	NA	NA	NA
>prophage 2
NZ_CP023946	Klebsiella pneumoniae strain FDAARGOS_446 chromosome, complete genome	5392753	914122	944257	5392753	lysis,head,capsid,integrase,tail,portal,terminase,plate	Salmonella_phage(83.87%)	37	914030:914048	944329:944347
914030:914048	attL	CAGGCAACAAAAAACCCAT	NA	NA	NA	NA
WP_014342959.1|914122_915103_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	57.2	1.4e-97
WP_004178082.1|915590_917078_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_001154434.1|917178_917367_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	98.4	5.5e-27
WP_001217575.1|917377_917611_+	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
WP_000700647.1|917725_918403_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004199124.1|918678_920421_+	AIPR family protein	NA	NA	NA	NA	NA
WP_002895959.1|920482_921508_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	86.7	7.6e-171
WP_004150858.1|921507_923274_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.0	0.0e+00
WP_002895967.1|923416_924250_+|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	88.8	6.3e-123
WP_002895972.1|924266_925325_+|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.1	1.1e-180
WP_000059191.1|925328_925979_+|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	96.3	8.7e-112
WP_002896151.1|926074_926539_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.0	8.4e-77
WP_002896155.1|926538_926742_+|tail	tail protein X	tail	A0A1S6KZY4	Salmonella_phage	88.1	1.3e-29
WP_002896158.1|926745_926961_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	90.1	3.6e-30
WP_002896161.1|926941_927451_+	lysozyme	NA	E5G6N1	Salmonella_phage	83.4	2.1e-81
WP_002896163.1|927455_927839_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	42.0	2.1e-17
WP_002896168.1|927835_928264_+|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	77.9	9.6e-51
WP_002896170.1|928250_928397_+	hypothetical protein	NA	A0A1S6KZX6	Salmonella_phage	76.1	6.0e-13
WP_002896172.1|928359_928791_+|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	82.5	9.9e-64
WP_002896175.1|928783_929230_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	71.2	2.2e-50
WP_004150857.1|929226_929919_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002896177.1|930013_930586_+|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	72.3	4.7e-77
WP_002896179.1|930582_930945_+	GPW/gp25 family protein	NA	A0A1S6KZZ4	Salmonella_phage	84.7	5.8e-49
WP_002896182.1|930931_931840_+|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	66.9	7.6e-106
WP_004150856.1|931832_932432_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	60.5	1.3e-58
WP_019724930.1|934650_935385_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171482189.1|935745_936120_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002896188.1|936116_936320_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002896191.1|936349_937426_+|tail	phage tail protein	tail	Q37842	Escherichia_phage	44.8	1.2e-25
WP_002896193.1|937564_938737_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	93.3	1.9e-210
WP_002896201.1|938746_939262_+|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	85.4	1.3e-81
WP_002896204.1|939314_939614_+|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	79.0	3.7e-33
WP_002896220.1|939628_939748_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.2e-13
WP_014342962.1|939974_942368_+|tail	phage tail tape measure protein	tail	E5FFG5	Burkholderia_phage	44.0	1.1e-106
WP_002896224.1|942364_942850_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	75.6	7.2e-63
WP_002896225.1|942846_943947_+	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	87.4	4.9e-176
WP_000972391.1|944038_944257_+	ogr/Delta-like zinc finger family protein	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
944329:944347	attR	CAGGCAACAAAAAACCCAT	NA	NA	NA	NA
>prophage 3
NZ_CP023946	Klebsiella pneumoniae strain FDAARGOS_446 chromosome, complete genome	5392753	978673	988137	5392753	protease,tRNA	Dickeya_phage(16.67%)	8	NA	NA
WP_002896440.1|978673_979789_+	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
WP_004150848.1|979785_981726_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.5	1.9e-37
WP_002896516.1|981802_982024_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
WP_002896520.1|982349_982667_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
WP_002896522.1|982697_984977_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
WP_001040187.1|985097_985316_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_002898014.1|985669_986371_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_004150847.1|986415_988137_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	34.3	1.5e-14
>prophage 4
NZ_CP023946	Klebsiella pneumoniae strain FDAARGOS_446 chromosome, complete genome	5392753	1377103	1390529	5392753	transposase,integrase	Enterobacteria_phage(18.18%)	12	1379783:1379798	1390733:1390748
WP_004140269.1|1377103_1377913_-	peptide ABC transporter ATP-binding protein SapF	NA	A0A2H4PQG7	Staphylococcus_phage	28.9	2.1e-14
WP_004140266.1|1377914_1378907_-	peptide ABC transporter ATP-binding protein SapD	NA	G9BWD6	Planktothrix_phage	27.2	3.0e-07
WP_004151901.1|1378906_1379797_-	peptide ABC transporter permease SapC	NA	NA	NA	NA	NA
1379783:1379798	attL	GCTATCGTAGGGCATA	NA	NA	NA	NA
WP_004151900.1|1379943_1381161_+|integrase	site-specific integrase	integrase	K7PGY1	Enterobacteria_phage	51.9	8.6e-121
WP_004151899.1|1381368_1382031_-	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	84.6	2.7e-105
WP_004151898.1|1382027_1382456_-	hypothetical protein	NA	M9NYX4	Enterobacteria_phage	80.3	7.5e-64
WP_001067855.1|1382900_1383605_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_004178082.1|1385514_1387002_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_002901812.1|1387081_1387501_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	57.5	1.4e-35
WP_002901813.1|1387502_1388768_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	82.7	9.6e-208
WP_071531199.1|1388843_1389671_-	FRG domain-containing protein	NA	A0A1S6KZX9	Salmonella_phage	30.2	8.4e-19
WP_002901815.1|1389857_1390529_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	59.6	4.5e-79
1390733:1390748	attR	GCTATCGTAGGGCATA	NA	NA	NA	NA
>prophage 5
NZ_CP023946	Klebsiella pneumoniae strain FDAARGOS_446 chromosome, complete genome	5392753	1423462	1496869	5392753	terminase,holin,integrase,plate	uncultured_Caudovirales_phage(33.33%)	84	1421543:1421557	1430483:1430497
1421543:1421557	attL	AGTTGATCCTCTGGC	NA	NA	NA	NA
WP_004152144.1|1423462_1424224_+	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.5	2.4e-20
WP_004152145.1|1424440_1425973_+	HD domain-containing protein	NA	A0A1B1ISR1	uncultured_Mediterranean_phage	30.0	1.1e-21
WP_016197745.1|1426171_1426720_-	DJ-1/PfpI family protein	NA	NA	NA	NA	NA
WP_004152147.1|1426916_1428098_+|integrase	site-specific integrase	integrase	A0A0M4QX09	Salmonella_phage	84.2	5.6e-202
WP_004152148.1|1428078_1428321_-	hypothetical protein	NA	A0A0M4RTZ2	Salmonella_phage	73.8	2.2e-20
WP_004198245.1|1428280_1428427_-	hypothetical protein	NA	A0A1B5FPC2	Escherichia_phage	70.8	2.9e-15
WP_014343018.1|1428499_1428733_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152150.1|1428975_1429188_-	hypothetical protein	NA	A0A286S2B6	Klebsiella_phage	98.6	3.4e-33
WP_004152151.1|1429184_1429409_-	hypothetical protein	NA	A0A286S2B3	Klebsiella_phage	89.2	3.1e-29
WP_004154298.1|1429398_1430109_-	Rha family transcriptional regulator	NA	A0A286S260	Klebsiella_phage	88.3	2.1e-111
WP_004152153.1|1430114_1430633_-	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	98.8	1.7e-94
1430483:1430497	attR	GCCAGAGGATCAACT	NA	NA	NA	NA
WP_004152154.1|1430737_1431565_-	hypothetical protein	NA	Q8W654	Enterobacteria_phage	84.0	5.5e-111
WP_004152155.1|1431561_1431756_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152156.1|1431752_1432178_-	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	77.9	3.5e-53
WP_004177208.1|1432174_1432393_-	hypothetical protein	NA	A0A286S1P6	Klebsiella_phage	98.6	6.6e-32
WP_004152157.1|1432364_1432619_-	hypothetical protein	NA	A0A286SGR4	Klebsiella_phage	97.6	3.1e-41
WP_004152158.1|1432611_1432977_-	hypothetical protein	NA	A0A286S1Q6	Klebsiella_phage	99.2	6.9e-58
WP_004152159.1|1433146_1433335_-	hypothetical protein	NA	A0A286S1P8	Klebsiella_phage	100.0	4.6e-26
WP_004152160.1|1433327_1433642_-	hypothetical protein	NA	A0A286S1T9	Klebsiella_phage	100.0	1.0e-49
WP_004152161.1|1433812_1434481_-	LexA family transcriptional regulator	NA	A0A286S2B2	Klebsiella_phage	99.5	2.4e-125
WP_004152162.1|1434578_1434800_+	helix-turn-helix transcriptional regulator	NA	A0A286S2C1	Klebsiella_phage	100.0	3.0e-32
WP_004198228.1|1435376_1437035_+	DEAD/DEAH box helicase	NA	A0A286N2P9	Klebsiella_phage	96.0	0.0e+00
WP_004198233.1|1437036_1437999_+	toprim domain-containing protein	NA	A0A286N2Q0	Klebsiella_phage	99.4	4.8e-183
WP_004198239.1|1437995_1438472_+	hypothetical protein	NA	A0A286N2Q1	Klebsiella_phage	100.0	1.8e-90
WP_004152167.1|1438468_1439251_+	antitermination protein	NA	F1C595	Cronobacter_phage	76.8	7.2e-113
WP_004146526.1|1439656_1439905_+|holin	class II holin family protein	holin	NA	NA	NA	NA
WP_004152169.1|1439907_1440438_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	77.1	2.7e-79
WP_004153952.1|1440434_1440824_+	lipase chaperone	NA	A0A192Y6H8	Salmonella_phage	49.2	9.4e-21
WP_004152170.1|1441058_1441379_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004218030.1|1441744_1442233_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152172.1|1442183_1443584_+|terminase	PBSX family phage terminase large subunit	terminase	A0A077KAW0	Edwardsiella_phage	69.0	9.4e-188
WP_004152173.1|1443821_1445273_+	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	68.8	3.8e-192
WP_004152174.1|1445328_1445877_+	hypothetical protein	NA	A0A0M4REK0	Salmonella_phage	56.3	3.0e-49
WP_004199270.1|1445928_1447131_+	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	54.1	2.6e-106
WP_000528476.1|1447134_1447629_+	hypothetical protein	NA	A0A2H4JHM9	uncultured_Caudovirales_phage	62.7	4.2e-50
WP_001132269.1|1447640_1448582_+	DUF2184 domain-containing protein	NA	A0A2H4J191	uncultured_Caudovirales_phage	77.1	1.7e-137
WP_000725700.1|1448621_1448903_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000113538.1|1448871_1449291_+	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	60.7	3.3e-40
WP_000834982.1|1449287_1449794_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001116156.1|1449793_1450180_+	hypothetical protein	NA	A0A2H4J1A4	uncultured_Caudovirales_phage	78.2	1.1e-48
WP_004152176.1|1450274_1450715_+	hypothetical protein	NA	A0A2H4J1A0	uncultured_Caudovirales_phage	51.7	1.6e-40
WP_004152177.1|1450718_1451864_+	DUF3383 domain-containing protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	76.9	6.3e-166
WP_004199809.1|1451874_1452315_+	DUF3277 family protein	NA	A0A0M5M1K6	Salmonella_phage	80.1	3.3e-62
WP_004152564.1|1452318_1452744_+	hypothetical protein	NA	A0A2H4J2V6	uncultured_Caudovirales_phage	63.4	2.6e-40
WP_004152565.1|1452779_1452932_+	hypothetical protein	NA	A0A2H4J1A2	uncultured_Caudovirales_phage	88.0	7.6e-19
WP_004152566.1|1452921_1454925_+	lytic transglycosylase domain-containing protein	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	63.6	1.2e-247
WP_004152567.1|1454924_1455524_+	hypothetical protein	NA	A0A2H4J1B3	uncultured_Caudovirales_phage	57.6	9.9e-54
WP_004217362.1|1455599_1455827_+	hypothetical protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	56.0	4.6e-20
WP_004152569.1|1455829_1456852_+	hypothetical protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	54.2	9.2e-100
WP_004152570.1|1456851_1457193_+	hypothetical protein	NA	A0A2H4J1A5	uncultured_Caudovirales_phage	46.6	1.8e-23
WP_004199301.1|1457242_1457425_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152571.1|1457467_1458034_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152572.1|1458087_1458741_+	hypothetical protein	NA	A0A2H4J8H6	uncultured_Caudovirales_phage	63.5	1.0e-59
WP_004152573.1|1458742_1459096_+	hypothetical protein	NA	A0A2H4J629	uncultured_Caudovirales_phage	80.3	2.3e-50
WP_004152574.1|1459095_1460292_+|plate	baseplate J/gp47 family protein	plate	A0A0M4RD32	Salmonella_phage	72.9	3.9e-158
WP_004152575.1|1460288_1461062_+	DUF2612 domain-containing protein	NA	A0A2H4J1A9	uncultured_Caudovirales_phage	54.4	2.8e-77
WP_004152576.1|1461061_1461928_+	hypothetical protein	NA	A0A2H4IYR0	uncultured_Caudovirales_phage	64.5	1.9e-34
WP_004152577.1|1461927_1462125_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004218487.1|1464475_1465204_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171482183.1|1465571_1465946_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002902131.1|1465942_1466152_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004178082.1|1466601_1468089_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_002902133.1|1468166_1468451_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002902136.1|1468673_1468922_-	DinI-like family protein	NA	S5MQI1	Escherichia_phage	70.4	1.4e-25
WP_002902144.1|1469767_1470259_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_002902148.1|1470301_1471846_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_004218490.1|1471855_1473199_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_004151603.1|1473195_1473885_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_004151602.1|1473881_1475588_+	OmpA family protein	NA	NA	NA	NA	NA
WP_002902160.1|1475592_1476084_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_002902163.1|1476348_1479003_+	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	33.4	2.5e-96
WP_004228410.1|1479004_1481374_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	33.8	9.1e-18
WP_002902169.1|1481374_1482154_+	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_002902172.1|1482217_1482748_+	T6SS immunity phospholipase A1-binding lipoprotein Tli1-KP	NA	NA	NA	NA	NA
WP_002902174.1|1482816_1483347_+	T6SS immunity phospholipase A1-binding lipoprotein Tli1-KP	NA	NA	NA	NA	NA
WP_002902176.1|1483414_1483945_+	T6SS immunity phospholipase A1-binding lipoprotein Tli1-KP	NA	NA	NA	NA	NA
WP_002902178.1|1484013_1484544_+	T6SS immunity phospholipase A1-binding lipoprotein Tli1-KP	NA	NA	NA	NA	NA
WP_002902180.1|1484611_1485142_+	T6SS immunity phospholipase A1-binding lipoprotein Tli1-KP	NA	NA	NA	NA	NA
WP_004151601.1|1485129_1487547_+	DUF2235 domain-containing protein	NA	NA	NA	NA	NA
WP_002902252.1|1487591_1487849_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_002902254.1|1487845_1488985_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004151599.1|1488968_1492394_+	type VI secretion protein VasK	NA	NA	NA	NA	NA
WP_004151598.1|1494065_1495820_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_002902268.1|1495783_1496869_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
>prophage 6
NZ_CP023946	Klebsiella pneumoniae strain FDAARGOS_446 chromosome, complete genome	5392753	1692906	1703793	5392753		Escherichia_phage(87.5%)	9	NA	NA
WP_002210516.1|1692906_1693527_-	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
WP_004151609.1|1693519_1694785_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	99.5	6.6e-233
WP_004151610.1|1694796_1695699_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.3	7.7e-159
WP_002210513.1|1695959_1696721_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_004176269.1|1696741_1697602_-	class A broad-spectrum beta-lactamase SHV-11	NA	A0A077SL40	Escherichia_phage	99.3	2.2e-155
WP_002904006.1|1697899_1698160_+	hypothetical protein	NA	A0A077SK33	Escherichia_phage	97.7	3.5e-40
WP_001620097.1|1698246_1699335_+	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	100.0	8.0e-211
WP_004151612.1|1699365_1700631_-	MFS transporter	NA	NA	NA	NA	NA
WP_004151613.1|1700685_1703793_-	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.6	0.0e+00
>prophage 7
NZ_CP023946	Klebsiella pneumoniae strain FDAARGOS_446 chromosome, complete genome	5392753	1809329	1836673	5392753	head,integrase,transposase,terminase,plate	Escherichia_phage(14.29%)	26	1807535:1807549	1813616:1813630
1807535:1807549	attL	TTTAAACCCTGTCGA	NA	NA	NA	NA
WP_096753182.1|1809329_1810208_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_064351480.1|1810211_1810469_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032749077.1|1811547_1812501_+	hypothetical protein	NA	A0A1D8EQC7	Escherichia_phage	26.4	1.4e-09
WP_096753183.1|1812497_1813208_+|plate	phage baseplate protein	plate	NA	NA	NA	NA
WP_096753184.1|1813218_1813596_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096753185.1|1813810_1814158_+	hypothetical protein	NA	NA	NA	NA	NA
1813616:1813630	attR	TCGACAGGGTTTAAA	NA	NA	NA	NA
WP_096753186.1|1814144_1815554_+|plate	baseplate J/gp47 family protein	plate	A0A2I7QTL1	Vibrio_phage	22.8	1.3e-08
WP_096753187.1|1815553_1816309_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004113037.1|1816301_1816535_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096753188.1|1816531_1816768_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096753189.1|1816767_1817400_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163574005.1|1817776_1817917_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096753192.1|1817971_1819099_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152345.1|1819443_1821471_+	SAM-dependent DNA methyltransferase	NA	NA	NA	NA	NA
WP_004152344.1|1821467_1822784_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_004152343.1|1822784_1826042_+	type I restriction endonuclease subunit R	NA	NA	NA	NA	NA
WP_004152342.1|1826046_1827315_+|transposase	ISL3-like element ISKpn25 family transposase	transposase	Q6V7R1	Burkholderia_virus	34.7	5.2e-60
WP_138087936.1|1827447_1828302_-	hypothetical protein	NA	A0A2K9VAJ3	Klebsiella_virus	39.1	6.0e-20
WP_096753193.1|1828414_1828930_-	recombinase	NA	Q5QBN4	Enterobacteria_phage	48.1	1.2e-39
WP_096753194.1|1828947_1830546_-	ERF family protein	NA	NA	NA	NA	NA
WP_096753195.1|1830820_1831216_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100290036.1|1831557_1831713_+	Hok/Gef family protein	NA	NA	NA	NA	NA
WP_096753196.1|1832034_1832580_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004113052.1|1832566_1833976_+|terminase	PBSX family phage terminase large subunit	terminase	Q716H3	Shigella_phage	32.7	5.9e-57
WP_096753197.1|1833972_1835325_+	DUF1073 domain-containing protein	NA	NA	NA	NA	NA
WP_096753198.1|1835311_1836673_+|head	phage head morphogenesis protein	head	E5AGA5	Erwinia_phage	28.6	2.2e-16
>prophage 8
NZ_CP023946	Klebsiella pneumoniae strain FDAARGOS_446 chromosome, complete genome	5392753	2405394	2448404	5392753	transposase,tRNA,plate	Microcystis_virus(28.57%)	42	NA	NA
WP_002910404.1|2405394_2406651_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_032411797.1|2406921_2407533_+	lipoprotein localization protein LolB	NA	NA	NA	NA	NA
WP_004898981.1|2407532_2408381_+	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
WP_002910407.1|2408564_2409512_+	ribose-phosphate diphosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.5	2.3e-44
WP_004200291.1|2409636_2411316_+	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	23.4	1.0e-23
WP_002910436.1|2411316_2412363_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002910437.1|2412584_2412860_-	stress-induced protein YchH	NA	NA	NA	NA	NA
WP_004180389.1|2413132_2413717_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_002910443.1|2413834_2414926_+	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_032411802.1|2415007_2415337_-	DUF1869 domain-containing protein	NA	NA	NA	NA	NA
WP_002910453.1|2415421_2416336_-	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_023285288.1|2416467_2417919_-	type VI secretion system ImpA family N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_004175538.1|2417938_2418382_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_020806091.1|2418384_2418921_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_072198475.1|2418901_2419918_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_032411805.1|2419947_2421711_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_032411808.1|2421844_2425255_-	type VI secretion protein VasK	NA	NA	NA	NA	NA
WP_002910497.1|2426404_2426671_-	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_072093174.1|2426968_2427154_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014343198.1|2427891_2428464_-	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A7H6	Microcystis_virus	33.3	3.9e-07
WP_162487910.1|2428427_2428661_-	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	NA	NA	NA	NA
WP_004099053.1|2429635_2430604_+|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	98.8	5.1e-185
WP_096753213.1|2430649_2430916_-	sulfatase modifying factor 1	NA	NA	NA	NA	NA
WP_038435084.1|2430937_2431066_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016946122.1|2431091_2431985_-	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A075BSL8	Microcystis_phage	27.3	1.7e-12
WP_032410376.1|2432006_2432123_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060614315.1|2432168_2433062_-	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A7H6	Microcystis_virus	30.5	1.1e-13
WP_015958629.1|2433083_2433389_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072198474.1|2433412_2434441_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015958632.1|2434902_2435409_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004200304.1|2435405_2435915_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032425067.1|2435915_2437271_-	S-type pyocin domain-containing protein	NA	NA	NA	NA	NA
WP_060614320.1|2437564_2438074_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002910589.1|2438063_2438216_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002910591.1|2438310_2438817_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032425068.1|2438813_2439323_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072198477.1|2439399_2440368_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	91.3	2.9e-172
WP_032425069.1|2440412_2441744_-	S-type pyocin domain-containing protein	NA	NA	NA	NA	NA
WP_032425070.1|2441767_2444254_-	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_032425071.1|2444712_2446410_-	OmpA family protein	NA	NA	NA	NA	NA
WP_004184632.1|2446413_2447067_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_004899025.1|2447063_2448404_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
>prophage 9
NZ_CP023946	Klebsiella pneumoniae strain FDAARGOS_446 chromosome, complete genome	5392753	2741208	2751860	5392753		Escherichia_phage(25.0%)	9	NA	NA
WP_004175262.1|2741208_2742213_+	NAD-dependent epimerase	NA	E3T4Y8	Cafeteria_roenbergensis_virus	29.5	1.8e-31
WP_022631332.1|2742612_2742735_+	small membrane protein	NA	NA	NA	NA	NA
WP_004175261.1|2743157_2744324_-	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	54.7	4.1e-112
WP_004175260.1|2744503_2745058_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	57.6	1.9e-51
WP_021313306.1|2745072_2745963_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.2	2.8e-28
WP_004175258.1|2745994_2746864_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	67.0	5.7e-111
WP_014343304.1|2746890_2747955_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	55.0	1.2e-105
WP_014343305.1|2748177_2749584_-	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.7	4.7e-38
WP_124724669.1|2749850_2751860_-	hypothetical protein	NA	B3VD19	Klebsiella_phage	27.0	3.1e-19
>prophage 10
NZ_CP023946	Klebsiella pneumoniae strain FDAARGOS_446 chromosome, complete genome	5392753	3196798	3306460	5392753	lysis,head,holin,capsid,integrase,tail,portal,tRNA,terminase,plate	Salmonella_phage(52.75%)	128	3271554:3271600	3308121:3308167
WP_002914079.1|3196798_3197536_-|tRNA	tRNA1(Val) (adenine(37)-N6)-methyltransferase	tRNA	NA	NA	NA	NA
WP_002914082.1|3197667_3198999_+	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	31.9	6.2e-48
WP_002914084.1|3199044_3199428_-	autonomous glycyl radical cofactor GrcA	NA	A0A193GZ98	Escherichia_phage	79.3	4.0e-32
WP_002914088.1|3199742_3200432_+	uracil-DNA glycosylase	NA	A0A077BCN4	Equid_alphaherpesvirus	53.0	1.3e-57
WP_002914089.1|3200489_3201575_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_002914091.1|3201778_3202204_+	thioredoxin TrxC	NA	A0A1J0GW78	Streptomyces_phage	40.2	6.0e-13
WP_002914092.1|3202273_3202972_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_004188841.1|3203006_3205658_+	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_002914094.1|3205778_3207134_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_002914095.1|3207175_3207499_+	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_096753219.1|3207502_3208801_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	31.5	1.8e-44
WP_004150973.1|3214765_3217339_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.4	6.9e-128
WP_002914109.1|3217468_3218200_-	polyphenol oxidase	NA	NA	NA	NA	NA
WP_002914110.1|3218196_3219177_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_004145664.1|3219308_3220046_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_002914111.1|3220316_3220652_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_100250063.1|3220758_3220806_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150975.1|3220906_3222067_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_002914112.1|3222063_3222936_-	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
WP_002914113.1|3222998_3224120_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_002914114.1|3224129_3225200_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.5	1.8e-90
WP_073557492.1|3225542_3226052_+	YfiR family protein	NA	NA	NA	NA	NA
WP_002914116.1|3226044_3227268_+	diguanylate cyclase DgcN	NA	NA	NA	NA	NA
WP_002914117.1|3227281_3227764_+	OmpA family protein	NA	NA	NA	NA	NA
WP_002914118.1|3227772_3229143_-	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_002914119.1|3229199_3229658_-	DUF2946 domain-containing protein	NA	NA	NA	NA	NA
WP_098988184.1|3229873_3230923_-|integrase	site-specific integrase	integrase	A0A0M4S6G4	Salmonella_phage	92.6	1.6e-195
WP_019725392.1|3230947_3231286_-	DUF2511 domain-containing protein	NA	A0A0M3ULF8	Salmonella_phage	67.9	2.3e-39
WP_019725391.1|3231294_3232155_-	phage repressor protein CI	NA	Q6K1G0	Salmonella_virus	84.6	1.7e-139
WP_019725390.1|3232276_3232630_+	hypothetical protein	NA	Q6K1F9	Salmonella_virus	92.3	8.4e-53
WP_019725389.1|3232681_3233191_+	phage regulatory CII family protein	NA	Q6K1F8	Salmonella_virus	94.1	1.6e-84
WP_019725388.1|3233198_3233399_+	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	71.0	9.3e-17
WP_004195894.1|3233479_3233767_+	hypothetical protein	NA	F1BUS4	Erwinia_phage	57.0	2.3e-24
WP_096753220.1|3233832_3234057_+	DUF2732 domain-containing protein	NA	A0A218M4I9	Erwinia_phage	70.3	5.7e-15
WP_004195898.1|3234056_3234284_+	TraR/DksA family transcriptional regulator	NA	A0A0M4S5Q7	Salmonella_phage	79.2	2.1e-25
WP_004195903.1|3234280_3234553_+	DUF5405 family protein	NA	A0A218M4I8	Erwinia_phage	74.4	2.2e-32
WP_004195917.1|3234549_3234831_+	DUF3850 domain-containing protein	NA	A0A0P0I3U9	Klebsiella_phage	51.3	7.5e-12
WP_172952315.1|3234974_3237044_+	replication endonuclease	NA	A0A218M4H2	Erwinia_phage	89.2	0.0e+00
WP_032419998.1|3237165_3237351_+	hypothetical protein	NA	A0A0M5M1G5	Salmonella_phage	77.0	6.0e-18
WP_019704250.1|3237354_3237585_+	DinI-like family protein	NA	A0A218M4I0	Erwinia_phage	77.6	2.7e-28
WP_096753222.1|3238017_3239061_-|portal	phage portal protein	portal	M1SV64	Escherichia_phage	82.1	2.0e-166
WP_096753223.1|3239060_3240830_-|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCK3	Escherichia_phage	87.8	1.4e-305
WP_040227518.1|3240995_3241850_+|capsid	GPO family capsid scaffolding protein	capsid	Q94MB7	Escherichia_virus	81.3	1.3e-126
WP_025710540.1|3241923_3242982_+|capsid	phage major capsid protein, P2 family	capsid	S4TUA6	Salmonella_phage	83.8	4.9e-165
WP_172952316.1|3243009_3243729_+|terminase	terminase endonuclease subunit	terminase	Q94MJ2	Enterobacteria_phage	79.0	1.1e-94
WP_009309691.1|3243825_3244332_+|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	84.3	5.4e-61
WP_019725382.1|3244331_3244535_+|tail	tail protein X	tail	S4TTA0	Salmonella_phage	79.1	9.5e-25
WP_019725381.1|3244539_3244830_+|holin	phage holin family protein	holin	A0A0M5M1H1	Salmonella_phage	79.6	5.0e-35
WP_096753225.1|3244816_3245314_+	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	86.7	5.1e-80
WP_065782256.1|3245310_3245742_+|lysis	LysB family phage lysis regulatory protein	lysis	O80310	Escherichia_phage	65.5	5.3e-41
WP_032427129.1|3245716_3245875_+	hypothetical protein	NA	A0A218M4L1	Erwinia_phage	74.0	3.8e-13
WP_096753226.1|3245837_3246305_+|tail	phage tail protein	tail	A0A0F7LA33	Escherichia_phage	74.2	3.5e-62
WP_096753227.1|3246297_3246747_+	phage virion morphogenesis protein	NA	O80313	Escherichia_phage	66.7	1.0e-47
WP_096753228.1|3246815_3247457_+|plate	phage baseplate assembly protein V	plate	A0A0M4S6F6	Salmonella_phage	77.9	2.0e-92
WP_014343405.1|3247453_3247801_+	GPW/gp25 family protein	NA	Q7Y4D7	Escherichia_virus	77.4	4.9e-45
WP_096753229.1|3247805_3248714_+|plate	baseplate assembly protein	plate	F1BUP3	Erwinia_phage	71.2	3.8e-113
WP_096753230.1|3248706_3249303_+|tail	phage tail protein I	tail	E5G6N9	Salmonella_phage	50.3	6.2e-48
WP_159126271.1|3249307_3251581_+	hypothetical protein	NA	A0A1I9SEI8	Klebsiella_phage	30.4	9.6e-57
WP_096753231.1|3251847_3253005_+|tail	phage tail protein	tail	S4TP62	Salmonella_phage	51.2	3.0e-46
WP_096753232.1|3253115_3254297_+|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	86.6	6.0e-196
WP_014343412.1|3254310_3254826_+|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	75.6	3.2e-69
WP_004195711.1|3254886_3255162_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	77.3	2.4e-31
WP_014343413.1|3255194_3255314_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	92.3	2.0e-14
WP_096753233.1|3255306_3257745_+|tail	phage tail tape measure protein	tail	A0A0M3UL85	Salmonella_phage	83.3	9.3e-300
WP_019724795.1|3257756_3258236_+|tail	phage tail protein	tail	A0A0F7LDE8	Escherichia_phage	77.7	1.4e-66
WP_025987643.1|3258235_3259393_+	phage late control D family protein	NA	Q7Y4C6	Escherichia_virus	80.7	1.9e-173
WP_019704610.1|3259469_3259688_+	DNA-binding transcriptional regulator	NA	Q37973	Salmonella_virus	84.7	1.0e-32
WP_002914145.1|3259838_3260186_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_002914147.1|3260225_3260993_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_004150977.1|3261024_3261573_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_002914149.1|3261591_3261840_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_002914152.1|3262099_3263464_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_002914153.1|3263627_3264419_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_004149392.1|3264438_3265725_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_002914155.1|3265844_3266435_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_002914158.1|3266559_3267438_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_002914159.1|3267524_3269186_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_002914160.1|3269333_3269675_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_002914161.1|3269741_3270032_-	RnfH family protein	NA	NA	NA	NA	NA
WP_004188817.1|3270021_3270498_-	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_002914164.1|3270608_3271091_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	2.3e-29
3271554:3271600	attL	ATGTAGGAATTTCGGACGCGGGTTCAACTCCCGCCAGCTCCACCAAA	NA	NA	NA	NA
WP_004150980.1|3271694_3272072_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150981.1|3272099_3272318_-	ogr/Delta-like zinc finger family protein	NA	Q53ZE7	Salmonella_virus	72.2	1.9e-26
WP_004150982.1|3272384_3273479_-	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	83.6	2.4e-170
WP_004150983.1|3273475_3273961_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.1	5.2e-61
WP_072093161.1|3273957_3276354_-|tail	phage tail tape measure protein	tail	E5FFG5	Burkholderia_phage	44.5	8.1e-107
WP_002896220.1|3276580_3276700_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.2e-13
WP_004150985.1|3276714_3277014_-|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	78.0	8.2e-33
WP_004150986.1|3277066_3277582_-|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	84.2	1.4e-80
WP_004150987.1|3277591_3278764_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	91.5	3.4e-207
WP_004150988.1|3278912_3279986_-|tail	phage tail protein	tail	A0A1S6KZZ8	Salmonella_phage	53.6	6.6e-40
WP_004200602.1|3280037_3281156_-	hypothetical protein	NA	A0A248XD67	Klebsiella_phage	38.0	4.4e-55
WP_004150990.1|3281165_3283115_-	CotH kinase family protein	NA	Q6QI97	Burkholderia_phage	38.9	1.0e-06
WP_004152935.1|3283116_3283788_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	58.9	3.2e-61
WP_004150992.1|3283780_3284689_-|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	68.9	1.9e-109
WP_004150993.1|3284675_3285038_-	GPW/gp25 family protein	NA	A0A1S6KZZ4	Salmonella_phage	85.6	8.4e-48
WP_004150994.1|3285034_3285607_-|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	70.8	1.4e-76
WP_004150995.1|3285701_3286568_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150996.1|3286590_3287037_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	72.3	2.5e-54
WP_004150997.1|3287029_3287452_-|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	83.2	8.2e-63
WP_072093160.1|3287414_3287573_-	hypothetical protein	NA	A0A1S6KZX6	Salmonella_phage	75.0	9.0e-15
WP_004150998.1|3287547_3287976_-|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	82.5	7.1e-54
WP_004150999.1|3287972_3288356_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	45.4	1.9e-18
WP_004151000.1|3288360_3288870_-	lysozyme	NA	E5G6N1	Salmonella_phage	85.2	1.6e-81
WP_004134639.1|3288850_3289066_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	88.7	6.1e-30
WP_004151001.1|3289069_3289273_-|tail	tail protein X	tail	E5G6M9	Salmonella_phage	89.6	9.8e-30
WP_004151002.1|3289272_3289737_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	85.7	1.5e-73
WP_004134644.1|3289832_3290486_-|terminase	terminase endonuclease subunit	terminase	A0A1S6KZX1	Salmonella_phage	80.0	1.9e-90
WP_004151003.1|3290489_3291542_-|capsid	phage major capsid protein, P2 family	capsid	A0A1S6KZZ3	Salmonella_phage	91.0	6.8e-175
WP_004151004.1|3291558_3292392_-|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	77.6	4.4e-100
WP_019405037.1|3292532_3294296_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	91.8	0.0e+00
WP_004151006.1|3294295_3295339_+|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	85.6	3.1e-172
WP_024940854.1|3295395_3295665_-	hypothetical protein	NA	D2IZW1	Enterococcus_phage	41.3	1.4e-15
WP_004151007.1|3296186_3297188_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004151008.1|3297187_3298267_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004151009.1|3298253_3298937_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004151010.1|3299032_3299266_-	DinI family protein	NA	A0A0M4S6H1	Salmonella_phage	96.1	2.0e-34
WP_004151011.1|3299277_3299466_-	hypothetical protein	NA	A0A1S6L006	Salmonella_phage	90.3	2.2e-23
WP_004151012.1|3299628_3302013_-	replication endonuclease	NA	A0A1S6L028	Salmonella_phage	87.9	0.0e+00
WP_004151013.1|3302009_3302861_-	DNA adenine methylase	NA	A0A1S6L011	Salmonella_phage	75.4	2.2e-115
WP_004151014.1|3302857_3303085_-	TraR/DksA family transcriptional regulator	NA	A0A1S6L007	Salmonella_phage	92.0	5.1e-35
WP_004151016.1|3303084_3303318_-	DUF2732 family protein	NA	A0A1S6L021	Salmonella_phage	90.9	6.0e-31
WP_004144796.1|3303385_3303724_-	DUF5347 domain-containing protein	NA	A0A218M4I7	Erwinia_phage	58.0	6.2e-29
WP_004151017.1|3303687_3303888_-	DUF2724 domain-containing protein	NA	A0A1S6L005	Salmonella_phage	68.8	4.5e-19
WP_004151018.1|3303895_3304405_-	phage regulatory CII family protein	NA	A0A1S6L008	Salmonella_phage	85.8	1.1e-77
WP_001397669.1|3304437_3304680_-	hypothetical protein	NA	A0A1S6KZZ6	Salmonella_phage	98.8	4.0e-38
WP_004151019.1|3304802_3305432_+	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	54.5	1.4e-61
WP_004151020.1|3305434_3306460_+|integrase	site-specific integrase	integrase	A0A1S6L016	Salmonella_phage	93.8	1.5e-190
3308121:3308167	attR	ATGTAGGAATTTCGGACGCGGGTTCAACTCCCGCCAGCTCCACCAAA	NA	NA	NA	NA
>prophage 11
NZ_CP023946	Klebsiella pneumoniae strain FDAARGOS_446 chromosome, complete genome	5392753	4029461	4100063	5392753	protease,terminase,head,capsid,integrase,transposase,portal,tRNA,tail	uncultured_Caudovirales_phage(60.0%)	73	4065220:4065237	4082440:4082457
WP_002918465.1|4029461_4029956_-|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	54.8	1.5e-26
WP_002918467.1|4029959_4030598_-	stringent starvation protein A	NA	NA	NA	NA	NA
WP_135801240.1|4030567_4030852_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000829818.1|4030909_4031302_-	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_002918559.1|4031317_4031746_-	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_004144945.1|4032011_4033139_-	cell division protein ZapE	NA	NA	NA	NA	NA
WP_002918565.1|4033329_4033728_+	DUF1043 family protein	NA	NA	NA	NA	NA
WP_002918566.1|4033901_4035269_+|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	25.3	6.0e-22
WP_002918568.1|4035356_4036415_+	outer membrane-stress sensor serine endopeptidase DegS	NA	NA	NA	NA	NA
WP_002918570.1|4036551_4037490_-	malate dehydrogenase	NA	NA	NA	NA	NA
WP_002918625.1|4037904_4038375_+	transcriptional regulator ArgR	NA	NA	NA	NA	NA
WP_002918626.1|4038750_4039014_+	peroxide/acid stress response protein YhcN	NA	NA	NA	NA	NA
WP_002918627.1|4039112_4039379_+	peroxide/acid stress response protein YhcN	NA	NA	NA	NA	NA
WP_002918629.1|4039429_4039705_-	barstar family protein	NA	NA	NA	NA	NA
WP_002918632.1|4039784_4041752_-	p-hydroxybenzoic acid efflux pump subunit AaeB	NA	NA	NA	NA	NA
WP_002918639.1|4041757_4042690_-	p-hydroxybenzoic acid efflux pump subunit AaeA	NA	NA	NA	NA	NA
WP_002918640.1|4042697_4042901_-	AaeX family protein	NA	NA	NA	NA	NA
WP_002918641.1|4043032_4043962_+	HTH-type transcriptional activator AaeR	NA	NA	NA	NA	NA
WP_002918642.1|4043997_4045443_-|protease	metalloprotease TldD	protease	NA	NA	NA	NA
WP_004150952.1|4045531_4049329_-	AsmA2 domain-containing protein	NA	NA	NA	NA	NA
WP_002918644.1|4049366_4050836_-	ribonuclease G	NA	NA	NA	NA	NA
WP_002918646.1|4050838_4051420_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_002918648.1|4051427_4051916_-	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_004149974.1|4051915_4052908_-	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_002918653.1|4052978_4054022_-	rod shape-determining protein MreB	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
WP_002918686.1|4054327_4056268_-	RNase E specificity factor CsrD	NA	NA	NA	NA	NA
WP_002918687.1|4056347_4056539_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002918688.1|4056767_4057769_+	protein-methionine-sulfoxide reductase catalytic subunit MsrP	NA	NA	NA	NA	NA
WP_002918689.1|4057768_4058377_+	protein-methionine-sulfoxide reductase heme-binding subunit MsrQ	NA	NA	NA	NA	NA
WP_002918732.1|4058600_4059053_+	type II 3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
WP_002918736.1|4059075_4059543_+	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
WP_002918738.1|4059553_4060903_+	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_002918740.1|4061013_4061256_+	YhdT family protein	NA	NA	NA	NA	NA
WP_002918742.1|4061245_4062697_+	sodium/pantothenate symporter	NA	NA	NA	NA	NA
WP_002918745.1|4062708_4063590_+	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
WP_004144972.1|4063947_4064913_+|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_000462905.1|4064937_4065234_+	DNA-binding transcriptional regulator Fis	NA	NA	NA	NA	NA
4065220:4065237	attL	TACGGCATGAACTGATAC	NA	NA	NA	NA
WP_004150954.1|4065387_4065579_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004150955.1|4065581_4067243_-|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	98.0	0.0e+00
WP_000113647.1|4067226_4067583_-|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	99.2	5.5e-60
WP_004150957.1|4067713_4067866_-	hypothetical protein	NA	A0A2H4JCY9	uncultured_Caudovirales_phage	88.0	2.4e-17
WP_004150959.1|4067858_4068302_-	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	91.8	2.8e-77
WP_001547824.1|4068301_4068601_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4JD08	uncultured_Caudovirales_phage	80.8	3.4e-39
WP_004150961.1|4068597_4068933_-|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	57.8	3.7e-26
WP_004150962.1|4068929_4070171_-|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	96.5	1.0e-230
WP_001547826.1|4070172_4070733_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	95.7	1.2e-98
WP_001549743.1|4070784_4071951_-|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	95.9	9.8e-207
WP_004150963.1|4072214_4072727_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096753235.1|4072775_4073015_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087759376.1|4073030_4074151_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.2	6.0e-52
WP_004150965.1|4074678_4076814_-	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	62.4	3.4e-205
WP_001549749.1|4076813_4077179_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004150966.1|4077175_4077544_-	hypothetical protein	NA	A0A2H4JCX7	uncultured_Caudovirales_phage	81.1	3.7e-51
WP_004150967.1|4077540_4077855_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001549752.1|4077847_4078036_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106918304.1|4078028_4078298_-	host cell division inhibitor Icd-like protein	NA	A0A2H4JGW3	uncultured_Caudovirales_phage	94.4	2.4e-44
WP_004150969.1|4078749_4079529_-	phage antirepressor KilAC domain-containing protein	NA	Q8HA02	Enterobacteria_phage	51.5	6.2e-40
WP_001547839.1|4079539_4079824_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_004150970.1|4080005_4080947_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004150971.1|4081039_4082266_-|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	62.2	1.8e-150
WP_004150972.1|4082541_4083192_-	acrEF/envCD operon transcriptional regulator	NA	NA	NA	NA	NA
4082440:4082457	attR	TACGGCATGAACTGATAC	NA	NA	NA	NA
WP_002919101.1|4083570_4084710_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_002919102.1|4084722_4087833_+	multidrug efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_002919103.1|4088126_4088348_+	membrane protein	NA	NA	NA	NA	NA
WP_002919123.1|4094142_4094697_+	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_002919125.1|4094672_4094930_-	DUF1488 domain-containing protein	NA	NA	NA	NA	NA
WP_002919126.1|4094926_4095745_-	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_002919132.1|4095748_4096321_-	L-threonylcarbamoyladenylate synthase type 1 TsaC	NA	NA	NA	NA	NA
WP_004145330.1|4096325_4096868_-	topoisomerase DNA-binding C4 zinc finger domain-containing protein	NA	NA	NA	NA	NA
WP_002919137.1|4096893_4097367_-	DUF494 domain-containing protein	NA	NA	NA	NA	NA
WP_002919139.1|4097338_4098463_-	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_002919144.1|4098591_4099101_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	40.3	2.6e-18
WP_002919147.1|4099115_4100063_+|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	37.2	2.2e-07
>prophage 12
NZ_CP023946	Klebsiella pneumoniae strain FDAARGOS_446 chromosome, complete genome	5392753	5169284	5175109	5392753		Enterobacteria_phage(100.0%)	8	NA	NA
WP_004152202.1|5169284_5169851_-	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	63.8	9.7e-59
WP_004152203.1|5169868_5170114_-	ogr/Delta-like zinc finger family protein	NA	Q7M294	Enterobacteria_phage	56.8	5.5e-19
WP_004152204.1|5170110_5170848_-	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	59.4	1.1e-70
WP_000556592.1|5171408_5171675_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	71.6	2.0e-30
WP_072093163.1|5171677_5172220_+	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	69.4	1.1e-30
WP_004152205.1|5172216_5172444_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152206.1|5172440_5172761_+	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_004152207.1|5172775_5175109_+	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	83.9	0.0e+00
>prophage 1
NZ_CP023948	Klebsiella pneumoniae strain FDAARGOS_446 plasmid unnamed1, complete sequence	219350	0	10499	219350		Wolbachia_phage(25.0%)	17	NA	NA
WP_000849069.1|1281_1890_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000393783.1|1894_2416_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000648873.1|2418_2940_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000057876.1|3036_3510_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001370730.1|3520_3814_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000539391.1|3818_4673_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000829617.1|4672_5632_+	S49 family peptidase	NA	Q9JMP1	Wolbachia_phage	30.5	1.6e-16
WP_004201087.1|5647_6508_+	DsbA family protein	NA	NA	NA	NA	NA
WP_000591076.1|6541_6970_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000422769.1|7027_7387_+	hypothetical protein	NA	A0A076G835	Escherichia_phage	49.4	5.6e-20
WP_000919343.1|7386_7833_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000210757.1|7829_8348_+	nitrite reductase	NA	NA	NA	NA	NA
WP_000972665.1|8347_8578_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001167036.1|8564_9422_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171820680.1|9333_9639_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004201083.1|9641_10169_+	thermonuclease family protein	NA	A0A1W6JQ32	Staphylococcus_phage	32.4	2.0e-05
WP_001043046.1|10226_10499_+	HU family DNA-binding protein	NA	A3E2K9	Sodalis_phage	58.4	1.6e-19
>prophage 2
NZ_CP023948	Klebsiella pneumoniae strain FDAARGOS_446 plasmid unnamed1, complete sequence	219350	14102	18122	219350		Pseudomonas_phage(50.0%)	4	NA	NA
WP_001273096.1|14102_14591_+	DUF1643 domain-containing protein	NA	B5WZV8	Pseudomonas_phage	61.7	1.7e-51
WP_000062185.1|14593_15091_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000434070.1|15652_16585_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004201081.1|16658_18122_+	AAA family ATPase	NA	U5XGM6	Phormidium_phage	38.2	2.4e-45
>prophage 3
NZ_CP023948	Klebsiella pneumoniae strain FDAARGOS_446 plasmid unnamed1, complete sequence	219350	22582	38953	219350		Yersinia_phage(12.5%)	23	NA	NA
WP_000268394.1|22582_23521_+	chromosome partitioning protein ParB	NA	A0A2P9HXK7	Yersinia_phage	50.2	1.2e-69
WP_001096360.1|23955_24198_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001258026.1|24200_24563_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000098294.1|24555_25800_+	site-specific DNA-methyltransferase	NA	H8ZMF1	Synechococcus_phage	20.9	1.2e-05
WP_001053910.1|25813_26263_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000380893.1|26244_26556_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001151305.1|26729_27515_+	ParA family protein	NA	A0A1X9IGI7	Lactococcus_phage	26.4	1.0e-10
WP_001207227.1|27518_28700_+	ParB/RepB/Spo0J family partition protein	NA	I3NLC2	Bifidobacterium_phage	28.7	2.4e-11
WP_000703827.1|28748_29021_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000074431.1|29073_29709_-	N-6 DNA methylase	NA	NA	NA	NA	NA
WP_000939033.1|29800_29944_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001125904.1|30270_30648_+	hypothetical protein	NA	A0A2H4P7P5	Pseudomonas_phage	49.6	1.7e-22
WP_000044823.1|30640_30922_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000344149.1|30896_31571_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001326170.1|31638_32070_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002210541.1|32075_32387_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000647188.1|32395_32896_+	hypothetical protein	NA	I3UMJ0	Colwellia_phage	38.4	9.5e-18
WP_000936897.1|32899_34327_+	DNA cytosine methyltransferase	NA	NA	NA	NA	NA
WP_000268552.1|34326_34983_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000464630.1|35038_35656_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001326171.1|35867_36167_+	hypothetical protein	NA	A0A0K1LLW2	Caulobacter_phage	55.4	3.6e-20
WP_004201072.1|36257_36746_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000366823.1|36760_38953_-	DNA topoisomerase 3	NA	A0A1X9I6W8	Streptococcus_phage	29.4	9.9e-43
>prophage 4
NZ_CP023948	Klebsiella pneumoniae strain FDAARGOS_446 plasmid unnamed1, complete sequence	219350	47480	86291	219350	transposase,protease,integrase	Escherichia_phage(17.65%)	41	44876:44890	83229:83243
44876:44890	attL	TTGAAAAGTCGTGGC	NA	NA	NA	NA
WP_085955245.1|47480_48672_+|transposase	IS3-like element ISKpn18 family transposase	transposase	U5P429	Shigella_phage	43.5	3.5e-50
WP_000709517.1|50015_50876_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000796664.1|50998_51640_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000547566.1|51934_52255_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001186917.1|52558_52744_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000085160.1|52963_53932_+	CbbQ/NirQ/NorQ C-terminal domain-containing protein	NA	L7TKP0	Rhizobium_phage	32.6	1.2e-29
WP_000739139.1|53942_54851_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000987165.1|54911_55442_+	single-stranded DNA-binding protein	NA	A0A291LCB6	Klebsiella_phage	71.8	2.6e-42
WP_001282585.1|55536_56526_+	phage recombination protein Bet	NA	B5AX97	Iodobacteriophage	39.6	1.1e-52
WP_000706865.1|56588_57599_+	YqaJ viral recombinase family protein	NA	E0YQ48	Mycobacterium_phage	28.7	5.6e-09
WP_000170087.1|57798_59076_+	DUF3150 domain-containing protein	NA	NA	NA	NA	NA
WP_000039319.1|59160_60957_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_001447572.1|61018_61354_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004200877.1|61618_62053_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000050847.1|62107_62311_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000071870.1|62382_62988_+	5'-deoxynucleotidase	NA	NA	NA	NA	NA
WP_000184110.1|62980_63250_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000260293.1|63263_63482_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000064432.1|63555_64113_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000595210.1|64187_65039_+	hypothetical protein	NA	A0A219UQS0	Bacillus_phage	29.4	3.6e-09
WP_001077336.1|65497_65884_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000122922.1|66061_67789_+	toprim domain-containing protein	NA	A0A0P0ZFY3	Escherichia_phage	32.6	9.9e-14
WP_000268337.1|67775_68054_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000714163.1|68126_68348_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000427620.1|68529_69534_-|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_001138073.1|69612_72585_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.1	0.0e+00
WP_001162012.1|72587_73145_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	81.3	5.8e-48
WP_000845048.1|73450_74464_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_004201280.1|74619_75093_+	trimethoprim-resistant dihydrofolate reductase DfrA14	NA	G3MBI7	Bacillus_virus	28.9	8.4e-16
WP_001144737.1|75313_75580_+	plasmid mobilization relaxosome protein MobC	NA	NA	NA	NA	NA
WP_001389365.1|75722_76487_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_004098817.1|76747_77962_+	type II site-specific deoxyribonuclease	NA	E5E3X4	Burkholderia_phage	42.5	1.2e-34
WP_072094655.1|77995_79399_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	50.6	9.0e-106
WP_001749967.1|79810_80017_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071549088.1|80021_80534_-	restriction endonuclease	NA	NA	NA	NA	NA
WP_020324562.1|80558_81263_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	9.9e-138
WP_009310051.1|81327_81591_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058650054.1|82157_82502_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016338367.1|82609_83245_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
83229:83243	attR	TTGAAAAGTCGTGGC	NA	NA	NA	NA
WP_098988202.1|83244_85287_-	peptidase domain-containing ABC transporter	NA	W8CYL7	Bacillus_phage	27.3	2.4e-38
WP_004099053.1|85322_86291_+|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	98.8	5.1e-185
>prophage 5
NZ_CP023948	Klebsiella pneumoniae strain FDAARGOS_446 plasmid unnamed1, complete sequence	219350	92250	96108	219350	transposase,integrase	Macacine_betaherpesvirus(50.0%)	4	82839:82854	102452:102467
82839:82854	attL	ACAACACCTCTGAATA	NA	NA	NA	NA
WP_004152340.1|92250_93033_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	90.2	4.6e-51
WP_011977773.1|93924_94155_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152341.1|94246_94720_-	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_004152342.1|94839_96108_-|transposase	ISL3-like element ISKpn25 family transposase	transposase	Q6V7R1	Burkholderia_virus	34.7	5.2e-60
102452:102467	attR	TATTCAGAGGTGTTGT	NA	NA	NA	NA
>prophage 6
NZ_CP023948	Klebsiella pneumoniae strain FDAARGOS_446 plasmid unnamed1, complete sequence	219350	100683	133198	219350	transposase	Enterobacteria_phage(16.67%)	42	NA	NA
WP_004152345.1|100683_102711_-	SAM-dependent DNA methyltransferase	NA	A0A220A2U5	Liberibacter_phage	26.6	2.1e-26
WP_098988204.1|102822_103038_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152347.1|103262_103595_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152348.1|103971_104946_-	ParB/RepB/Spo0J family partition protein	NA	Q1MVJ4	Enterobacteria_phage	62.3	1.4e-105
WP_004152349.1|104942_106148_-	AAA family ATPase	NA	Q1MVJ3	Enterobacteria_phage	89.0	7.3e-205
WP_004152350.1|106469_107366_-	replication initiation protein	NA	Q71TL8	Escherichia_phage	53.8	3.3e-69
WP_096753238.1|107766_109038_-	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	63.7	6.8e-153
WP_048991179.1|109037_109469_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	53.3	2.1e-29
WP_001568038.1|109703_110675_+	hypothetical protein	NA	A0A222YXF2	Escherichia_phage	46.8	1.1e-73
WP_001568039.1|110677_111349_+	plasmid partitioning/stability family protein	NA	NA	NA	NA	NA
WP_032445747.1|111411_111642_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001568041.1|112078_112780_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.2	1.6e-26
WP_001568042.1|112779_113001_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001568043.1|113010_113430_+	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_032445745.1|113483_114251_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013214014.1|115403_115910_+	antirestriction protein ArdA	NA	G9FHQ1	Rhodococcus_virus	31.4	1.2e-07
WP_040245861.1|115952_116144_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096753251.1|116331_116586_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	47.9	6.3e-10
WP_004118473.1|116620_116938_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014343512.1|117733_118276_+	single-stranded DNA-binding protein	NA	A0A0A0P1Q9	Enterobacteria_phage	76.7	4.6e-50
WP_032445658.1|118324_118573_+	DUF905 domain-containing protein	NA	NA	NA	NA	NA
WP_096753239.1|118642_120700_+	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	25.7	8.2e-23
WP_004194235.1|120744_121176_+	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
WP_015065618.1|121172_121901_+	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
WP_001568059.1|121897_122224_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064148030.1|122279_122654_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085949440.1|122857_124226_+|transposase	IS3-like element ISKpn8 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	95.5	9.4e-108
WP_014343509.1|124328_124487_+	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_096753240.1|125185_125458_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046664183.1|125454_125805_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032445789.1|125819_126137_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019706019.1|126976_127333_+	hypothetical protein	NA	A0A248SL90	Klebsiella_phage	58.1	4.4e-25
WP_032445756.1|127393_127606_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014343499.1|127616_127841_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152720.1|127921_128242_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A088CBP5	Shigella_phage	39.5	6.8e-09
WP_004152721.1|128231_128510_+	helix-turn-helix transcriptional regulator	NA	O64356	Escherichia_phage	39.4	2.5e-07
WP_013023817.1|128510_128924_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_020802391.1|129641_130022_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032445771.1|130088_130436_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152750.1|130530_130677_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032445769.1|130727_131561_+	N-6 DNA methylase	NA	A0A2K9V411	Faecalibacterium_phage	33.5	1.4e-21
WP_004152492.1|132376_133198_+	DUF945 domain-containing protein	NA	K4F5L3	Cronobacter_phage	40.1	1.2e-44
>prophage 7
NZ_CP023948	Klebsiella pneumoniae strain FDAARGOS_446 plasmid unnamed1, complete sequence	219350	162909	172120	219350		Virus_Rctr197k(25.0%)	8	NA	NA
WP_096753246.1|162909_168168_+	conjugative transfer relaxase/helicase TraI	NA	A0A1P8DII4	Virus_Rctr197k	33.3	4.0e-05
WP_096753247.1|168246_168972_+	type-F conjugative transfer system pilin acetylase TraX	NA	A0A1D6ZIU7	Xanthomonas_phage	28.8	3.2e-06
WP_096753248.1|169043_169640_+	fertility inhibition protein FinO	NA	NA	NA	NA	NA
WP_029497437.1|169659_170007_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029497438.1|170232_170454_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016831064.1|170509_171160_+	DUF2726 domain-containing protein	NA	NA	NA	NA	NA
WP_004152383.1|171156_171465_+	hypothetical protein	NA	K7PKY8	Enterobacterial_phage	31.7	1.1e-08
WP_172952321.1|171640_172120_+	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	31.7	5.9e-17
>prophage 8
NZ_CP023948	Klebsiella pneumoniae strain FDAARGOS_446 plasmid unnamed1, complete sequence	219350	176570	180968	219350	transposase,integrase	Escherichia_phage(33.33%)	5	172040:172053	182638:182651
172040:172053	attL	GTTCCAGTCGTAGC	NA	NA	NA	NA
WP_001067855.1|176570_177275_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000845048.1|177820_178834_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_032488579.1|179064_179619_+	aminoglycoside N-acetyltransferase AAC(6')-Ib3	NA	NA	NA	NA	NA
WP_000679427.1|179787_180135_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259031.1|180128_180968_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
182638:182651	attR	GCTACGACTGGAAC	NA	NA	NA	NA
>prophage 9
NZ_CP023948	Klebsiella pneumoniae strain FDAARGOS_446 plasmid unnamed1, complete sequence	219350	189425	191412	219350		uncultured_virus(100.0%)	2	NA	NA
WP_004201172.1|189425_189716_+	co-chaperone GroES	NA	A0A221S322	uncultured_virus	47.8	2.1e-17
WP_004201176.1|189771_191412_+	chaperonin GroEL	NA	A0A219YK78	uncultured_virus	62.1	8.2e-175
>prophage 10
NZ_CP023948	Klebsiella pneumoniae strain FDAARGOS_446 plasmid unnamed1, complete sequence	219350	197714	199599	219350	integrase	Gordonia_phage(50.0%)	2	193932:193944	201789:201801
193932:193944	attL	CAGCCCGTTCGGT	NA	NA	NA	NA
WP_000543934.1|197714_198725_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0K0N6I5	Gordonia_phage	31.9	3.1e-07
WP_004201184.1|198729_199599_+	3'-5' exonuclease	NA	A0A1S6L012	Salmonella_phage	35.1	3.5e-23
201789:201801	attR	ACCGAACGGGCTG	NA	NA	NA	NA
>prophage 11
NZ_CP023948	Klebsiella pneumoniae strain FDAARGOS_446 plasmid unnamed1, complete sequence	219350	202758	204270	219350		Pseudoalteromonas_phage(100.0%)	1	NA	NA
WP_000811656.1|202758_204270_+	ATP-dependent helicase	NA	A0A2D1GN12	Pseudoalteromonas_phage	30.7	3.6e-44
>prophage 12
NZ_CP023948	Klebsiella pneumoniae strain FDAARGOS_446 plasmid unnamed1, complete sequence	219350	211598	215345	219350		uncultured_Caudovirales_phage(50.0%)	7	NA	NA
WP_000356489.1|211598_211871_+	helix-turn-helix domain-containing protein	NA	A0A2H4J3B6	uncultured_Caudovirales_phage	41.0	1.3e-08
WP_000790610.1|211870_212404_+	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_000891157.1|212414_213023_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001020646.1|213019_213571_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000651490.1|213630_214050_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_000919078.1|214051_214345_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000077457.1|214361_215345_-	ParM/StbA family protein	NA	A7KUY1	Bacillus_phage	24.4	2.1e-08
>prophage 1
NZ_CP023947	Klebsiella pneumoniae strain FDAARGOS_446 plasmid unnamed2, complete sequence	153385	24279	79240	153385	protease,transposase,holin	uncultured_Caudovirales_phage(27.78%)	54	NA	NA
WP_004118209.1|24279_24543_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_004118208.1|24557_24821_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152118.1|25064_25346_+	helix-turn-helix domain-containing protein	NA	A0A1B1IUF9	uncultured_Mediterranean_phage	38.2	5.2e-05
WP_004181999.1|25380_25950_+	small heat shock protein sHSP20	NA	NA	NA	NA	NA
WP_004152116.1|26073_28869_+	heat shock survival AAA family ATPase ClpK	NA	K4FB40	Cronobacter_phage	41.0	5.2e-129
WP_004152115.1|28868_29066_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009483782.1|29303_30053_+	phosphate-starvation-inducible PsiE family protein	NA	NA	NA	NA	NA
WP_004152113.1|30039_31002_+|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_072198477.1|31192_32161_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	91.3	2.9e-172
WP_003026803.1|33567_34050_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003026799.1|34037_34304_-	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_004152108.1|34479_34734_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152107.1|34809_35067_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152106.1|35115_35319_-	hemolysin expression modulator Hha	NA	NA	NA	NA	NA
WP_004152105.1|35352_35721_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152104.1|35764_36259_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_004152103.1|36289_36865_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152102.1|36852_37122_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152101.1|37479_37830_+	As(III)-sensing metalloregulatory transcriptional repressor ArsR	NA	A0A2H4J145	uncultured_Caudovirales_phage	50.9	1.4e-23
WP_004152100.1|37879_38242_+	arsenite efflux transporter metallochaperone ArsD	NA	NA	NA	NA	NA
WP_004152099.1|38259_40011_+	arsenite efflux transporter ATPase subunit ArsA	NA	NA	NA	NA	NA
WP_004152098.1|40058_41348_+	arsenite efflux transporter membrane subunit ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	74.0	1.9e-171
WP_004152097.1|41360_41786_+	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	72.9	2.3e-52
WP_004152096.1|41818_42355_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_004152095.1|44251_44614_-	arsenic metallochaperone ArsD family protein	NA	NA	NA	NA	NA
WP_004182005.1|44689_45235_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_004182006.1|45243_45957_-	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	77.0	2.9e-92
WP_004152092.1|45953_46280_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004196778.1|46611_47109_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_004196769.1|47158_47668_-	aquaporin	NA	NA	NA	NA	NA
WP_024623170.1|49410_49590_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_004152085.1|49821_50256_-	copper resistance system metallochaperone PcoE	NA	NA	NA	NA	NA
WP_004152084.1|50472_51873_-	copper resistance membrane spanning protein PcoS	NA	W8CYF6	Bacillus_phage	26.3	4.1e-18
WP_001188930.1|51869_52550_-	copper response regulator transcription factor PcoR	NA	W8CYM9	Bacillus_phage	34.4	8.7e-30
WP_004118344.1|52604_53534_-	copper resistance inner membrane protein PcoD	NA	NA	NA	NA	NA
WP_000025662.1|53538_53919_-	copper resistance system metallochaperone PcoC	NA	NA	NA	NA	NA
WP_001378118.1|53958_54849_-	copper resistance outer membrane transporter PcoB	NA	NA	NA	NA	NA
WP_000925242.1|54854_56672_-	multicopper oxidase PcoA	NA	NA	NA	NA	NA
WP_001023257.1|56905_57355_+	copper resistance protein	NA	NA	NA	NA	NA
WP_004182013.1|57643_58381_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A2H4JAF5	uncultured_Caudovirales_phage	32.5	1.2e-11
WP_000843497.1|58414_58612_-	DUF2933 domain-containing protein	NA	NA	NA	NA	NA
WP_001567371.1|60879_61284_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	95.5	2.0e-66
WP_001567372.1|61280_61628_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	99.1	5.7e-62
WP_014386538.1|61677_63216_+|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	92.4	2.5e-274
WP_000758228.1|63689_64130_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004098958.1|64216_67363_-	Cu(+)/Ag(+) efflux RND transporter permease subunit SilA	NA	S5VTK5	Leptospira_phage	22.5	4.0e-61
WP_004098959.1|67373_68666_-	Cu(+)/Ag(+) efflux RND transporter periplasmic adaptor subunit SilB	NA	NA	NA	NA	NA
WP_001246153.1|68779_69133_-	cation efflux system protein CusF	NA	NA	NA	NA	NA
WP_004182016.1|69161_70547_-	Cu(+)/Ag(+) efflux RND transporter outer membrane channel SilC	NA	NA	NA	NA	NA
WP_001572351.1|70736_71417_+	copper/silver response regulator transcription factor SilR	NA	W8CYM9	Bacillus_phage	35.6	2.1e-31
WP_003032875.1|71409_72885_+	copper/silver sensor histidine kinase SilS	NA	W8CYF6	Bacillus_phage	30.1	1.0e-27
WP_004178091.1|73135_73567_+	silver-binding protein SilE	NA	NA	NA	NA	NA
WP_085955172.1|74995_76202_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	63.2	1.7e-100
WP_004178088.1|77242_79240_+|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	25.9	9.7e-21
