The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP023815	Escherichia coli strain IMT16316 chromosome, complete genome	4937350	64979	153435	4937350	tRNA,protease,portal,tail,terminase,capsid,head,lysis,plate,integrase	Salmonella_phage(61.82%)	86	119131:119157	153510:153536
WP_000886683.1|64979_66272_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
WP_000067771.1|66362_67706_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	41.0	7.3e-81
WP_001295343.1|67716_68328_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_022645455.1|68486_72557_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
WP_000228473.1|72691_73186_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_000537432.1|73729_74695_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	1.1e-62
WP_001043590.1|74817_76584_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.3	4.1e-23
WP_001202192.1|76584_78306_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	31.2	4.0e-15
WP_022645453.1|78347_79052_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|79336_79555_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_000934041.1|80302_82579_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
WP_000520781.1|82609_82930_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_000410785.1|83252_83477_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
WP_022645444.1|83549_85496_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.1	6.5e-38
WP_000746460.1|85492_86608_-	macrolide transporter subunit MacA	NA	NA	NA	NA	NA
WP_001400542.1|86758_87715_+	DUF535 domain-containing protein	NA	NA	NA	NA	NA
WP_000599806.1|87711_89370_-	ATP-dependent endonuclease	NA	NA	NA	NA	NA
WP_000488716.1|89795_90491_+	aquaporin Z	NA	NA	NA	NA	NA
WP_022645441.1|90948_91848_+	L-lysine exporter LysO	NA	NA	NA	NA	NA
WP_022645440.1|91990_93643_+	hydroxylamine reductase	NA	NA	NA	NA	NA
WP_000178691.1|93654_94623_+	NADH oxidoreductase	NA	NA	NA	NA	NA
WP_000815366.1|94755_96474_+	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.0	6.8e-31
WP_000566375.1|96510_97512_+	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_022645439.1|97522_98953_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_001305933.1|99051_100065_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_001255167.1|100061_100892_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	30.0	5.7e-07
WP_001160731.1|100888_101212_-	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001270657.1|102783_103299_+	lipoprotein	NA	NA	NA	NA	NA
WP_000027205.1|103516_104245_+	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.7	6.0e-29
WP_000756575.1|104262_104994_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001001702.1|105000_105717_+	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
WP_000464489.1|105716_106385_+	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
WP_001295905.1|106610_107342_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001149713.1|107370_108498_-	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	27.6	3.5e-28
WP_000389260.1|108538_109027_-	YbjO family protein	NA	NA	NA	NA	NA
WP_001061658.1|109086_109932_-	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_000105436.1|109928_110882_-	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_000996007.1|110891_112025_-	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.0	1.4e-29
WP_000126075.1|112119_113232_-	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_000203025.1|113582_114059_-	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_000684321.1|114146_115049_-	30S ribosomal protein S6--L-glutamate ligase	NA	I3ULC9	Synechococcus_phage	34.4	2.6e-37
WP_000681108.1|116653_117031_-	hypothetical protein	NA	NA	NA	NA	NA
WP_098944878.1|117300_118986_+	aspartate:alanine antiporter	NA	NA	NA	NA	NA
119131:119157	attL	GTGGGTTTTTTGTTGCCTGAAATTTAT	NA	NA	NA	NA
WP_000972391.1|119221_119440_-	transcriptional activator Ogr/delta	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
WP_022645435.1|119530_120631_-	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	85.2	1.0e-176
WP_022645434.1|120627_121113_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	79.4	1.6e-65
WP_022645433.1|121109_124187_-|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	69.3	0.0e+00
WP_000763311.1|124179_124299_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.8e-13
WP_022645432.1|124313_124616_-|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	88.0	3.5e-39
WP_001207660.1|124670_125186_-|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.3	2.1e-89
WP_000046146.1|125195_126368_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.0	7.8e-204
WP_022645431.1|126501_127104_-|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	84.4	3.7e-93
WP_022645430.1|127103_128645_-|tail	phage tail collar protein	tail	M1TAS6	Escherichia_phage	71.2	7.6e-199
WP_022645429.1|128641_129247_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	92.5	1.2e-110
WP_022645428.1|129239_130148_-|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	90.7	3.5e-143
WP_000177597.1|130134_130494_-|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	85.7	2.8e-51
WP_000993764.1|130490_131069_-|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	86.5	7.2e-94
WP_022645427.1|131172_131979_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021522006.1|131920_132367_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	84.2	4.0e-60
WP_001595569.1|132359_132791_-|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	93.7	9.9e-72
WP_022645426.1|132886_133315_-|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	75.2	1.9e-46
WP_022645425.1|133311_133689_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	40.0	8.8e-16
WP_086555589.1|133690_134164_-	lysozyme	NA	E5G6N1	Salmonella_phage	90.4	8.3e-80
WP_000171568.1|134183_134399_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
WP_000868175.1|134402_134606_-|tail	tail protein X	tail	E5G6M9	Salmonella_phage	92.5	1.4e-31
WP_000673523.1|134605_135070_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.6	6.4e-77
WP_021534472.1|135165_135816_-|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	95.8	9.6e-111
WP_000742503.1|135819_136878_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.1	8.4e-181
WP_022645423.1|136894_137728_-|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	91.0	2.8e-123
WP_022645422.1|137870_139637_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.5	0.0e+00
WP_022645421.1|139636_140671_+|portal	phage portal protein	portal	E5G6M3	Salmonella_phage	85.5	2.3e-167
WP_022645420.1|140707_142489_-	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_022645419.1|143022_144081_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001217562.1|144255_144489_-	DinI family protein	NA	E5G6M1	Salmonella_phage	98.7	2.3e-35
WP_001154434.1|144499_144688_-	hypothetical protein	NA	E5G6M0	Salmonella_phage	98.4	5.5e-27
WP_098944879.1|144841_147256_-	replication endonuclease	NA	E5G6L9	Salmonella_phage	97.8	0.0e+00
WP_000104157.1|147252_148110_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	98.2	4.1e-162
WP_001399246.1|148106_148334_-	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	98.7	7.8e-36
WP_001244228.1|148333_148567_-	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	98.7	6.4e-33
WP_001311552.1|148634_148976_-	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	98.2	1.7e-55
WP_000956182.1|148939_149140_-	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	98.5	7.1e-33
WP_022645417.1|149147_149657_-	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	98.2	1.3e-86
WP_000188448.1|149689_149911_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022645416.1|150006_150603_+	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	42.9	1.4e-39
WP_022645415.1|150623_152300_+	DUF4041 domain-containing protein	NA	A0A142LP25	Marinitoga_camini_virus	66.8	9.8e-83
WP_001595551.1|152382_153435_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	55.8	4.8e-104
153510:153536	attR	GTGGGTTTTTTGTTGCCTGAAATTTAT	NA	NA	NA	NA
>prophage 2
NZ_CP023815	Escherichia coli strain IMT16316 chromosome, complete genome	4937350	1455719	1501914	4937350	tRNA,tail,plate	Burkholderia_phage(31.58%)	46	NA	NA
WP_001298868.1|1455719_1456757_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_022646425.1|1457118_1458123_-	DUF2713 family protein	NA	NA	NA	NA	NA
WP_000416263.1|1458440_1458956_+	zinc uptake transcriptional repressor Zur	NA	NA	NA	NA	NA
WP_001296638.1|1458997_1459207_-	CsbD family protein	NA	NA	NA	NA	NA
WP_001361471.1|1459322_1460648_-	MATE family efflux transporter DinF	NA	NA	NA	NA	NA
WP_000646078.1|1460720_1461329_-	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
WP_000002907.1|1461438_1461807_-	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_000017354.1|1461977_1464401_+	glycerol-3-phosphate 1-O-acyltransferase PlsB	NA	NA	NA	NA	NA
WP_000455227.1|1464555_1465428_-	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_001308201.1|1465440_1465938_-	chorismate lyase	NA	NA	NA	NA	NA
WP_022646424.1|1466160_1467741_-	SopA family protein	NA	NA	NA	NA	NA
WP_000783444.1|1467968_1468889_-	maltose operon protein MalM	NA	NA	NA	NA	NA
WP_000973665.1|1469131_1470472_-	maltoporin LamB	NA	NA	NA	NA	NA
WP_000179165.1|1470543_1471659_-	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	31.7	4.3e-18
WP_000695389.1|1472023_1473214_+	maltose/maltodextrin ABC transporter substrate-binding protein MalE	NA	NA	NA	NA	NA
WP_022646423.1|1473367_1474912_+	maltose ABC transporter permease MalF	NA	NA	NA	NA	NA
WP_001252058.1|1474926_1475817_+	maltose ABC transporter permease MalG	NA	NA	NA	NA	NA
WP_000202902.1|1475910_1476321_-	phosphate-starvation-inducible protein PsiE	NA	NA	NA	NA	NA
WP_001295279.1|1476534_1476813_+	periplasmic protein	NA	NA	NA	NA	NA
WP_022646422.1|1476859_1478956_-	YjbH domain-containing protein	NA	NA	NA	NA	NA
WP_022646421.1|1478955_1479693_-	capsule biosynthesis GfcC family protein	NA	NA	NA	NA	NA
WP_001296632.1|1479689_1480328_-	YjbF family lipoprotein	NA	NA	NA	NA	NA
WP_000757333.1|1480441_1480684_-	polysaccharide production threonine-rich protein	NA	NA	NA	NA	NA
WP_022646420.1|1481038_1482688_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_022646419.1|1483212_1484562_+	lysine-sensitive aspartokinase 3	NA	NA	NA	NA	NA
WP_000619864.1|1484616_1484964_-	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	49.0	2.2e-21
WP_022646418.1|1485501_1485789_+	hypothetical protein	NA	Q6QIC8	Burkholderia_phage	48.6	3.9e-16
WP_000266448.1|1485791_1486397_+	transglycosylase SLT domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	57.1	3.3e-57
WP_000777272.1|1486409_1486724_+	membrane protein	NA	Q5ZQY8	Pseudomonas_phage	43.2	9.2e-19
WP_022646417.1|1486868_1487324_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000875310.1|1487320_1487518_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022646416.1|1487507_1488932_+|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	70.2	7.0e-191
WP_000907502.1|1488931_1489456_+|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.0	9.5e-69
WP_022646415.1|1489506_1489824_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_015674804.1|1489783_1489912_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_022646414.1|1490013_1492389_+	hypothetical protein	NA	A4JWL0	Burkholderia_virus	26.0	1.0e-56
WP_022646413.1|1492388_1493342_+	hypothetical protein	NA	A4JWL1	Burkholderia_virus	50.8	3.3e-35
WP_001269711.1|1493341_1493551_+	membrane protein	NA	A4JWL2	Burkholderia_virus	60.3	1.3e-16
WP_022646412.1|1493538_1494579_+	phage late control D family protein	NA	A4JWL3	Burkholderia_virus	45.1	2.0e-73
WP_000679403.1|1494588_1495290_+|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	36.3	6.4e-12
WP_022646411.1|1495388_1495748_+	hypothetical protein	NA	Q6QIA0	Burkholderia_phage	64.2	1.1e-34
WP_022646410.1|1495738_1496854_+	hypothetical protein	NA	Q6QI99	Burkholderia_phage	51.7	2.0e-100
WP_098944904.1|1496846_1497563_+|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	37.2	4.1e-22
WP_022646408.1|1497565_1499176_+|tail	phage tail protein	tail	A0A0M3ULH6	Salmonella_phage	39.1	3.8e-84
WP_022646406.1|1500653_1501109_+	hypothetical protein	NA	F6MIM0	Haemophilus_phage	42.7	6.6e-26
WP_022646405.1|1501122_1501914_-	nucleotidyltransferase domain-containing protein	NA	A0A2D1GQQ2	Pseudomonas_phage	45.1	2.0e-46
>prophage 3
NZ_CP023815	Escherichia coli strain IMT16316 chromosome, complete genome	4937350	3253874	3288329	4937350	terminase,tail,integrase	Escherichia_phage(51.52%)	35	3236776:3236791	3275256:3275271
3236776:3236791	attL	GCGTGAAATTGATGAC	NA	NA	NA	NA
WP_001299507.1|3253874_3255341_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	39.1	2.3e-88
WP_000138270.1|3255409_3256987_+	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_098944944.1|3257179_3258430_+|integrase	site-specific integrase	integrase	A0A0F6TJM5	Escherichia_coli_O157_typing_phage	99.3	8.0e-239
WP_001077943.1|3258433_3258628_-	DUF1382 family protein	NA	G9L698	Escherichia_phage	96.9	2.8e-26
WP_001617199.1|3258624_3259275_-	hypothetical protein	NA	A0A0F6TJC3	Escherichia_coli_O157_typing_phage	97.2	3.4e-124
WP_001335975.1|3259267_3259519_-	PerC family transcriptional regulator	NA	G9L6A0	Escherichia_phage	100.0	3.1e-41
WP_000675390.1|3259676_3259925_-	AlpA family phage regulatory protein	NA	A0A0F6TJ45	Escherichia_coli_O157_typing_phage	100.0	3.6e-42
WP_000063818.1|3259974_3260856_-	recombinase RecT	NA	G9L6A2	Escherichia_phage	98.6	2.6e-159
WP_021524932.1|3260852_3261674_-	hypothetical protein	NA	G9L6A3	Escherichia_phage	98.9	6.1e-163
WP_001102254.1|3261670_3261970_-	hypothetical protein	NA	A0A0F6R7M4	Escherichia_coli_O157_typing_phage	98.0	1.4e-45
WP_000836290.1|3262278_3262863_-	helix-turn-helix transcriptional regulator	NA	A0A0F6R8L7	Escherichia_coli_O157_typing_phage	100.0	7.0e-105
WP_001282457.1|3263017_3263248_+	hypothetical protein	NA	G9L6A7	Escherichia_phage	97.4	2.9e-38
WP_098944945.1|3263614_3264454_+	primosomal protein	NA	Q286X4	Escherichia_phage	96.4	2.7e-118
WP_001066741.1|3264450_3265236_+	hypothetical protein	NA	A0A0F6TJ71	Escherichia_coli_O157_typing_phage	99.6	3.6e-152
WP_021558026.1|3265353_3265701_+	hypothetical protein	NA	A0A0F6R8N5	Escherichia_coli_O157_typing_phage	96.5	5.9e-59
WP_024946514.1|3265762_3266242_+	hypothetical protein	NA	Q9MCR3	Enterobacteria_phage	54.2	1.5e-28
WP_024946515.1|3266238_3266784_+	hypothetical protein	NA	J9Q748	Salmonella_phage	83.2	3.2e-83
WP_001593200.1|3266780_3267080_+	hypothetical protein	NA	A5VWB2	Enterobacteria_phage	97.0	1.4e-56
WP_024946516.1|3267081_3267846_+	ead/Ea22-like family protein	NA	A0A1B0VCG7	Salmonella_phage	95.6	2.4e-68
WP_024946517.1|3268359_3269289_+	DUF551 domain-containing protein	NA	Q1MVF7	Enterobacteria_phage	50.6	7.9e-66
WP_024946519.1|3269781_3270456_+|terminase	terminase small subunit	terminase	Q287B7	Escherichia_phage	99.6	3.4e-119
WP_024946520.1|3270452_3271922_+	hypothetical protein	NA	G9L6B8	Escherichia_phage	97.4	1.2e-289
WP_024946521.1|3271926_3272532_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000335899.1|3273293_3273500_+	hypothetical protein	NA	G9L6C1	Escherichia_phage	100.0	6.0e-11
WP_024946522.1|3273514_3275194_+|tail	tail protein	tail	G9L6C2	Escherichia_phage	99.1	3.1e-302
WP_000133160.1|3275190_3275487_+	hypothetical protein	NA	G9L6C3	Escherichia_phage	100.0	1.3e-46
3275256:3275271	attR	GCGTGAAATTGATGAC	NA	NA	NA	NA
WP_001048075.1|3275489_3276185_+	peptidase	NA	G9L6C4	Escherichia_phage	100.0	6.0e-95
WP_024946523.1|3276199_3277186_+	hypothetical protein	NA	G9L6C5	Escherichia_phage	94.5	2.5e-179
WP_000012377.1|3277685_3278021_+	hypothetical protein	NA	G9L6C7	Escherichia_phage	100.0	7.7e-56
WP_000179260.1|3278077_3278683_+	hypothetical protein	NA	G9L6C9	Escherichia_phage	100.0	2.8e-112
WP_098944946.1|3278682_3281154_+	hypothetical protein	NA	G9L6D0	Escherichia_phage	99.1	0.0e+00
WP_098944947.1|3281153_3281618_+	hypothetical protein	NA	G9L6D1	Escherichia_phage	99.4	3.2e-84
WP_000332877.1|3281617_3282193_+	hypothetical protein	NA	A0A0F6TJ56	Escherichia_coli_O157_typing_phage	95.3	7.0e-81
WP_098944948.1|3282192_3284940_+	hypothetical protein	NA	A0A193GYI3	Enterobacter_phage	44.1	1.4e-118
WP_001123342.1|3284939_3288329_+	hypothetical protein	NA	A0A1E1GEP2	Vibrio_phage	36.9	6.2e-185
>prophage 4
NZ_CP023815	Escherichia coli strain IMT16316 chromosome, complete genome	4937350	3689514	3698956	4937350		Enterobacteria_phage(85.71%)	10	NA	NA
WP_022645872.1|3689514_3690441_+	glycine betaine ABC transporter ATP binding protein YehX	NA	F2Y1V5	Organic_Lake_phycodnavirus	26.8	5.7e-08
WP_022645871.1|3690445_3691177_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|3691157_3691265_-	protein YohO	NA	NA	NA	NA	NA
WP_001240398.1|3691324_3692056_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.0	2.8e-111
WP_001334139.1|3692277_3693963_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.5	9.5e-304
WP_012311742.1|3693959_3694679_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295430.1|3694725_3695196_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_001296231.1|3695236_3695698_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	99.3	3.2e-76
WP_022645869.1|3695822_3697823_-	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	95.8	0.0e+00
WP_001329822.1|3697819_3698956_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.4	4.2e-162
>prophage 5
NZ_CP023815	Escherichia coli strain IMT16316 chromosome, complete genome	4937350	4255689	4323564	4937350	protease,portal,tail,lysis,integrase	Enterobacteria_phage(43.4%)	81	4250979:4250995	4281720:4281736
4250979:4250995	attL	CTTTAAGAGATAAAAAA	NA	NA	NA	NA
WP_022645727.1|4255689_4258116_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.2	1.7e-213
WP_001295396.1|4258314_4258620_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_001445899.1|4258727_4259438_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001138584.1|4259440_4260001_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_000705197.1|4260035_4260377_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001304355.1|4260511_4260838_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	54.5	2.9e-23
WP_001295394.1|4261043_4262258_+	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_000836037.1|4262269_4263289_+	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	26.2	4.3e-17
WP_001389342.1|4263346_4263475_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000876976.1|4263476_4264757_-|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	62.6	1.0e-156
WP_001296941.1|4264791_4265028_-	excisionase family protein	NA	S4TND0	Salmonella_phage	50.7	6.1e-15
WP_024946566.1|4265115_4267587_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	57.5	8.5e-59
WP_001090200.1|4267679_4267871_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_001317853.1|4267867_4268056_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000159335.1|4268558_4268759_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001320327.1|4268727_4269093_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379591.1|4269104_4269257_-	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	53.2	6.6e-07
WP_001003381.1|4269449_4269857_-	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	46.2	2.5e-24
WP_000476993.1|4269934_4270162_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000705349.1|4270145_4270667_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000054505.1|4270647_4271613_+	hypothetical protein	NA	U5P0A0	Shigella_phage	61.2	2.9e-55
WP_001151189.1|4271653_4272055_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	95.5	2.4e-64
WP_022645725.1|4272254_4273277_+	hypothetical protein	NA	Q858S2	Enterobacteria_phage	62.4	2.5e-105
WP_001546200.1|4274139_4274247_-	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	96.6	2.5e-08
WP_000887491.1|4274291_4274504_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	97.1	1.7e-29
WP_000980999.1|4274720_4274972_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032140164.1|4275038_4275317_+	hypothetical protein	NA	A0A077KB22	Edwardsiella_phage	37.1	6.1e-06
WP_001376415.1|4275318_4276368_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	6.5e-109
WP_000904111.1|4276380_4276737_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	6.1e-35
WP_000762886.1|4276751_4277573_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	59.0	2.1e-78
WP_000562553.1|4278468_4278600_+	DUF3927 domain-containing protein	NA	H6WZJ7	Escherichia_phage	100.0	3.7e-06
WP_000506936.1|4278966_4279395_+	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
WP_001348108.1|4279566_4279941_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000839562.1|4280192_4280408_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	1.3e-32
WP_000196128.1|4280412_4280724_+	DUF1327 domain-containing protein	NA	K7PGU6	Enterobacteria_phage	62.6	1.5e-24
WP_001092966.1|4280720_4281254_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.2	8.4e-97
WP_001071776.1|4281250_4281748_+	DUF2514 domain-containing protein	NA	NA	NA	NA	NA
4281720:4281736	attR	CTTTAAGAGATAAAAAA	NA	NA	NA	NA
WP_000066495.1|4282111_4282324_+	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_071526745.1|4282334_4282523_+	cold-shock protein	NA	NA	NA	NA	NA
WP_001443523.1|4282670_4282826_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001019207.1|4282998_4283172_+	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_000548593.1|4283467_4283674_+	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	79.4	3.4e-22
WP_022645722.1|4284226_4284721_+	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	99.4	3.8e-83
WP_098944965.1|4287058_4287628_+	antirepressor protein	NA	A0A1W6JPH8	Morganella_phage	61.3	2.0e-51
WP_050489335.1|4287844_4288288_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050489334.1|4288319_4288514_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032279725.1|4288849_4289050_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087907452.1|4289055_4289355_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_087907453.1|4289351_4291211_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	50.2	1.9e-127
WP_087907454.1|4291498_4291744_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087907455.1|4291740_4292163_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_001475270.1|4292526_4292700_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042021406.1|4292792_4294706_+|protease	Clp protease ClpP	protease	S5M7Q8	Escherichia_phage	56.8	6.1e-214
WP_000373415.1|4294963_4295449_+	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	67.5	1.7e-48
WP_001504099.1|4295451_4295733_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001072975.1|4297216_4297429_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_000985958.1|4297428_4298937_+|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	99.4	6.6e-288
WP_001136588.1|4298881_4300909_+|protease	Clp protease ClpP	protease	K7PGT6	Enterobacteria_phage	99.7	0.0e+00
WP_001097050.1|4300994_4301318_+	DUF2190 family protein	NA	A0A291AWX2	Escherichia_phage	100.0	8.5e-52
WP_022645721.1|4301310_4301586_+	phage protein	NA	K7PH43	Enterobacteria_phage	98.9	3.8e-45
WP_000677120.1|4301597_4302188_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	80.1	7.2e-81
WP_001079410.1|4302184_4302586_+|tail	tail protein	tail	A0A291AWY2	Escherichia_phage	99.2	2.4e-72
WP_022645720.1|4302596_4303340_+|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	98.4	7.3e-131
WP_001370402.1|4303400_4303787_+|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	96.1	4.9e-62
WP_063815218.1|4303795_4304113_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	4.4e-53
WP_022645718.1|4304096_4307162_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	98.2	0.0e+00
WP_000447253.1|4307161_4307491_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	100.0	1.7e-60
WP_001152382.1|4307500_4308199_+|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	99.6	1.3e-134
WP_024946565.1|4308204_4308948_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	98.4	9.2e-150
WP_023277304.1|4308845_4309493_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	94.9	4.7e-110
WP_022645716.1|4309553_4313033_+	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	90.3	0.0e+00
WP_001228249.1|4313100_4313700_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	92.0	1.5e-102
WP_001546831.1|4313764_4316137_+|tail	phage tail fiber protein	tail	A0A0E3M0V5	Enterobacteria_phage	47.5	4.1e-103
WP_001546830.1|4316133_4316412_+	hypothetical protein	NA	A0A0E3GMJ7	Enterobacteria_phage	54.3	3.8e-24
WP_001546829.1|4316422_4317463_+|tail	tail fiber domain-containing protein	tail	A0A0E3M4A9	Enterobacteria_phage	80.5	4.5e-155
WP_001546828.1|4317505_4317799_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000086527.1|4318026_4318617_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_000836768.1|4318933_4319167_-	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_120795384.1|4319235_4319349_-	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000347484.1|4320730_4322014_+	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_000527788.1|4322103_4323564_+	mannitol dehydrogenase family protein	NA	G8DCZ3	Micromonas_pusilla_virus	30.1	6.6e-43
>prophage 1
NZ_CP023816	Escherichia coli strain IMT16316 plasmid pEcIMT16316, complete sequence	145883	20085	85767	145883	protease,integrase,transposase	Macacine_betaherpesvirus(26.09%)	60	29700:29716	54880:54896
WP_085947770.1|20085_21455_-|transposase	IS3-like element IS150 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	100.0	1.3e-112
WP_001276232.1|21614_22334_-	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
WP_000845940.1|22330_22765_-	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
WP_000117179.1|22819_24778_-	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	27.4	1.3e-22
WP_000005990.1|24843_25077_-	DUF905 domain-containing protein	NA	NA	NA	NA	NA
WP_042045560.1|25139_25637_-	single-stranded DNA-binding protein	NA	I3PGW4	Xanthomonas_phage	72.3	3.3e-39
WP_000936285.1|25786_27688_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	29.1	3.1e-32
WP_032143370.1|28573_28762_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001348622.1|28982_29195_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001348621.1|29220_29784_-	class I SAM-dependent methyltransferase	NA	A8HNV9	Thalassomonas_phage	37.3	1.0e-20
29700:29716	attL	ATTCAGCCCGGATTTCA	NA	NA	NA	NA
WP_000170714.1|29830_31192_-	DUF3560 domain-containing protein	NA	NA	NA	NA	NA
WP_000218642.1|31243_31474_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001027516.1|32508_32700_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000271753.1|32696_33119_-	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_001671341.1|33165_33468_-	antirestriction protein	NA	NA	NA	NA	NA
WP_000274437.1|34834_35269_-	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_001104873.1|35282_35504_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000086185.1|35504_36188_-	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.9	5.1e-30
WP_001348615.1|36572_37475_-	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
WP_000817036.1|38341_39313_-	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	99.4	7.0e-174
WP_000772446.1|39312_40479_-	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	100.0	7.0e-229
WP_000852146.1|41066_41822_-	replication initiation protein RepE	NA	I3WF20	Macacine_betaherpesvirus	100.0	3.8e-143
WP_000016982.1|42595_43402_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	100.0	5.8e-57
WP_001159868.1|43402_43708_-	type II toxin-antitoxin system toxin CcdB	NA	NA	NA	NA	NA
WP_023909027.1|43709_43928_-	type II toxin-antitoxin system antitoxin CcdA	NA	NA	NA	NA	NA
WP_000215657.1|44560_44758_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000642771.1|44754_45039_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000545983.1|45058_46192_-	DUF3800 domain-containing protein	NA	NA	NA	NA	NA
WP_023909028.1|46454_49574_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001261287.1|49880_50111_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001044768.1|50107_50524_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_000350635.1|50685_52824_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_000246636.1|53288_54284_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000991832.1|54287_55220_+	hypothetical protein	NA	NA	NA	NA	NA
54880:54896	attR	TGAAATCCGGGCTGAAT	NA	NA	NA	NA
WP_031311986.1|56267_59384_-	HsdR family type I site-specific deoxyribonuclease	NA	A0A220A398	Liberibacter_phage	24.0	2.9e-27
WP_001617890.1|59505_60789_-	restriction endonuclease subunit S	NA	F2Y1N5	Organic_Lake_phycodnavirus	26.5	2.2e-10
WP_001553856.1|60785_62342_-	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	42.5	7.1e-104
WP_001190712.1|62524_62746_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	A0A222YXU1	Escherichia_phage	100.0	6.7e-32
WP_001216034.1|62745_63126_+	type II toxin-antitoxin system death-on-curing family toxin	NA	A0A077SK56	Escherichia_phage	100.0	1.1e-63
WP_001513661.1|63130_63310_+	hypothetical protein	NA	Q71TH5	Escherichia_phage	96.6	3.5e-23
WP_001513660.1|63337_63697_+	hypothetical protein	NA	A0A077SLM1	Escherichia_phage	98.9	5.0e-45
WP_000361610.1|64829_65807_+	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	59.2	1.4e-100
WP_001066942.1|66091_66832_-	site-specific recombinase	NA	I3WFA4	Macacine_betaherpesvirus	57.6	2.0e-24
WP_032156742.1|66952_67078_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001072355.1|68277_69447_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086258557.1|69642_69837_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001322387.1|70688_71315_-	tetracycline resistance transcriptional repressor TetR(B)	NA	NA	NA	NA	NA
WP_001089068.1|71393_72599_+	tetracycline efflux MFS transporter Tet(B)	NA	NA	NA	NA	NA
WP_000428546.1|72711_73305_-	tetracyline resistance-associated transcriptional repressor TetC	NA	NA	NA	NA	NA
WP_001067858.1|74599_75304_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_023144756.1|76022_76157_+	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_000083850.1|76453_76708_+	replication regulatory protein RepA	NA	NA	NA	NA	NA
WP_001016257.1|76867_77614_-	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	48.5	5.0e-55
WP_002431311.1|77628_79170_-|transposase	IS21-like element ISEc12 family transposase	transposase	K4I413	Acidithiobacillus_phage	46.4	1.3e-129
WP_031943482.1|79531_79606_+	RepA leader peptide Tap	NA	NA	NA	NA	NA
WP_000130640.1|79598_80456_+	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
WP_000616807.1|81395_82049_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000557619.1|82141_82399_+	type II toxin-antitoxin system antitoxin PemI	NA	NA	NA	NA	NA
WP_001398199.1|82331_82733_+	type II toxin-antitoxin system toxin endoribonuclease PemK	NA	NA	NA	NA	NA
WP_001553819.1|82869_85767_-|transposase	Tn3-like element Tn5403 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	37.8	4.2e-182
>prophage 2
NZ_CP023816	Escherichia coli strain IMT16316 plasmid pEcIMT16316, complete sequence	145883	92540	99030	145883	transposase	Escherichia_phage(50.0%)	7	NA	NA
WP_001067855.1|92540_93245_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_098944979.1|93278_93521_-	class A beta-lactamase	NA	Q38212	Enterobacteria_phage	100.0	5.4e-35
WP_001235713.1|93703_94261_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	100.0	7.0e-94
WP_001067855.1|95589_96294_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000027057.1|96878_97739_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_001347546.1|97888_98314_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_001067855.1|98325_99030_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
