The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP023769	Streptococcus pyogenes strain HarveyGAS chromosome, complete genome	1852980	36321	48634	1852980		Synechococcus_phage(28.57%)	8	NA	NA
WP_002987703.1|36321_40047_+	phosphoribosylformylglycinamidine synthase	NA	A6N228	Microbacterium_phage	26.3	1.1e-38
WP_021340854.1|40207_41662_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	32.7	2.8e-54
WP_011284404.1|41689_42712_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	R9TMC7	Synechococcus_phage	42.1	2.4e-63
WP_002987709.1|42879_43434_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	35.6	6.8e-25
WP_002987711.1|43617_45165_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	E3SNU8	Prochlorococcus_phage	52.4	3.4e-45
WP_002987712.1|45222_46347_-	SH3 domain-containing protein	NA	F8HGP2	Streptococcus_phage	28.6	7.7e-07
WP_021340857.1|46599_47865_+	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_002987716.1|48142_48634_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	42.3	3.2e-18
>prophage 2
NZ_CP023769	Streptococcus pyogenes strain HarveyGAS chromosome, complete genome	1852980	336029	397348	1852980	tRNA,bacteriocin,protease	Streptococcus_phage(33.33%)	60	NA	NA
WP_011284532.1|336029_336620_+|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	55.7	2.6e-54
WP_011284533.1|337114_337390_+	YlbG family protein	NA	NA	NA	NA	NA
WP_002990917.1|337638_338274_+	dTMP kinase	NA	M1PSC7	Streptococcus_phage	63.4	2.7e-65
WP_002985844.1|338291_339167_+	DNA polymerase III subunit delta'	NA	M1NSC1	Streptococcus_phage	46.6	2.1e-68
WP_002985838.1|339669_339993_+	DNA replication initiation control protein YabA	NA	M1PFV3	Streptococcus_phage	59.4	1.3e-28
WP_002985836.1|339997_340861_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	75.0	1.7e-115
WP_002985833.1|340887_341280_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011284535.1|341326_341956_-	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_011284536.1|342254_342611_+	arsenate reductase family protein	NA	M1PLC0	Streptococcus_phage	65.8	6.3e-40
WP_021340916.1|342684_343512_-	exodeoxyribonuclease III	NA	M1PSC0	Streptococcus_phage	79.9	1.7e-128
WP_021340918.1|343745_344927_+	L-lactate oxidase	NA	NA	NA	NA	NA
WP_011284539.1|345192_350130_+|protease	CXC chemokine-degrading serine protease SpyCEP	protease	NA	NA	NA	NA
WP_011284541.1|350902_351610_+	DUF1275 domain-containing protein	NA	NA	NA	NA	NA
WP_011284542.1|351849_353850_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SHR2	Klosneuvirus	35.0	5.1e-86
WP_011284544.1|354340_355354_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	52.7	1.6e-96
WP_011284545.1|355357_355846_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	R4JF54	Bacillus_phage	37.5	1.3e-11
WP_011054229.1|355812_357993_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	43.2	1.2e-170
WP_021340763.1|358197_358950_-	ADP-ribosyltransferase	NA	NA	NA	NA	NA
WP_021340731.1|359406_359859_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021340725.1|361873_362347_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021340750.1|362599_362851_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011284552.1|363223_363724_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011284554.1|363991_364690_-	streptococcal pyrogenic exotoxin SpeJ	NA	NA	NA	NA	NA
WP_021340726.1|364891_365029_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011284555.1|365717_366299_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021340747.1|366958_367195_+	DUF2829 domain-containing protein	NA	NA	NA	NA	NA
WP_011284557.1|367187_367886_+	3-oxoacyl-ACP reductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	25.2	1.2e-10
WP_021340734.1|367961_368921_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_002993065.1|369253_370591_+	MFS transporter	NA	NA	NA	NA	NA
WP_011284560.1|370763_372146_+	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A2K9L4K9	Tupanvirus	36.0	8.5e-32
WP_011184238.1|372176_372731_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_021340729.1|372730_372982_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011284562.1|373001_373697_+	5'-methylthioadenosine/adenosylhomocysteine nucleosidase	NA	NA	NA	NA	NA
WP_011284563.1|373847_374189_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002990820.1|374286_374934_-	metal-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_004218965.1|375078_376011_+	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002985780.1|376074_376800_+	metal ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	32.6	1.4e-17
WP_002990814.1|376800_377655_+	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_002985776.1|377801_378608_-	peptidylprolyl isomerase	NA	A0A2H4UTF4	Bodo_saltans_virus	36.6	1.5e-20
WP_011284566.1|378824_381230_+	DNA translocase FtsK	NA	S5VNE3	Mycobacterium_phage	51.4	2.2e-88
WP_002990803.1|381299_381653_-	DUF3397 domain-containing protein	NA	NA	NA	NA	NA
WP_002990800.1|381896_382322_+	50S ribosomal protein L11	NA	NA	NA	NA	NA
WP_002985768.1|382427_383117_+	50S ribosomal protein L1	NA	NA	NA	NA	NA
WP_002985765.1|383438_384167_+	UMP kinase	NA	NA	NA	NA	NA
WP_011284568.1|384195_384753_+	ribosome recycling factor	NA	NA	NA	NA	NA
WP_011284569.1|384861_385719_+	S1 RNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_011284570.1|385791_386301_+	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_021340760.1|386297_386513_+	YozE family protein	NA	NA	NA	NA	NA
WP_011284572.1|386668_387850_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A0E3XB61	Gordonia_phage	39.6	2.1e-15
WP_023079722.1|388164_389937_+	oleate hydratase	NA	NA	NA	NA	NA
WP_010921967.1|390095_391148_+	PhoH family protein	NA	W8D063	Erwinia_phage	50.0	1.2e-46
WP_011284574.1|391193_391769_+	uracil-DNA glycosylase family protein	NA	NA	NA	NA	NA
WP_021340735.1|391927_392425_+	rRNA maturation RNase YbeY	NA	NA	NA	NA	NA
WP_002985746.1|392405_392813_+	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_002985743.1|392932_393829_+	GTPase Era	NA	NA	NA	NA	NA
WP_002985741.1|393848_394325_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_011284576.1|395282_395516_+|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
WP_002987564.1|395530_395713_+|bacteriocin	class IIb bacteriocin, lactobin A/cerein 7B family	bacteriocin	NA	NA	NA	NA
WP_002992018.1|396907_397135_+|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
WP_002985729.1|397147_397348_+|bacteriocin	class IIb bacteriocin, lactobin A/cerein 7B family	bacteriocin	NA	NA	NA	NA
>prophage 3
NZ_CP023769	Streptococcus pyogenes strain HarveyGAS chromosome, complete genome	1852980	621921	632525	1852980		Streptococcus_phage(57.14%)	9	NA	NA
WP_030126548.1|621921_624132_-	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	68.8	2.5e-267
WP_011284674.1|624239_625403_+	class I SAM-dependent rRNA methyltransferase	NA	W6LLI2	Streptococcus_phage	64.9	4.5e-143
WP_002985140.1|625399_626086_+	type I 3-dehydroquinate dehydratase	NA	W6LP76	Streptococcus_phage	68.9	7.0e-88
WP_002990262.1|626179_627346_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	32.8	4.5e-34
WP_002990260.1|627406_627748_+	YlbF/YmcA family competence regulator	NA	A0A1X9I5Y8	Streptococcus_phage	41.1	2.6e-19
WP_011284677.1|627969_629322_+	glutathione-disulfide reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	24.7	1.0e-29
WP_002990257.1|629409_630678_-	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_014407485.1|630707_631148_-	membrane protein	NA	NA	NA	NA	NA
WP_011184383.1|631382_632525_+	cysteine desulfurase	NA	A0A1X6WFP1	Pacmanvirus	27.3	1.4e-24
>prophage 4
NZ_CP023769	Streptococcus pyogenes strain HarveyGAS chromosome, complete genome	1852980	952350	1035336	1852980	tail,capsid,tRNA,integrase,head,portal,terminase	Streptococcus_phage(41.79%)	101	985703:985762	1031875:1031970
WP_011284826.1|952350_953235_-|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
WP_011284827.1|953350_954691_-	DUF2130 domain-containing protein	NA	NA	NA	NA	NA
WP_002989673.1|954787_955744_-	aromatic acid exporter family protein	NA	NA	NA	NA	NA
WP_011284828.1|955754_956351_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_011284829.1|956442_959079_-	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_002989664.1|959093_959795_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.0	4.9e-36
WP_002984482.1|959912_960455_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002984480.1|960597_961239_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_021340922.1|961401_961890_-	Asp23/Gls24 family envelope stress response protein	NA	NA	NA	NA	NA
WP_002984476.1|961900_962101_-	CsbD family protein	NA	J7KJ36	Streptococcus_phage	50.0	1.8e-07
WP_002984475.1|962141_962681_-	Asp23/Gls24 family envelope stress response protein	NA	NA	NA	NA	NA
WP_002984473.1|962693_962882_-	DUF2273 domain-containing protein	NA	NA	NA	NA	NA
WP_002984470.1|962892_963504_-	alkaline shock response membrane anchor protein AmaP	NA	NA	NA	NA	NA
WP_002984469.1|963540_963789_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_011284831.1|964151_966470_-	DNA helicase PcrA	NA	A7KV33	Bacillus_phage	41.2	2.7e-131
WP_002984465.1|966998_968321_+	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_011284832.1|968440_969676_+	cation diffusion facilitator family transporter	NA	NA	NA	NA	NA
WP_002984462.1|970045_970819_-	CAMP factor pore-forming toxin Cfa	NA	NA	NA	NA	NA
WP_002992413.1|971188_972025_-	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002992415.1|972040_972670_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.5	9.8e-28
WP_002992417.1|972679_973321_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_002989626.1|973427_973763_-	alkylphosphonate utilization protein	NA	NA	NA	NA	NA
WP_011284834.1|973958_975773_-	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	38.7	1.2e-97
WP_002984449.1|975948_976506_-	signal peptidase I	NA	NA	NA	NA	NA
WP_011284835.1|976723_978226_-	pyruvate kinase	NA	NA	NA	NA	NA
WP_002984444.1|978288_979302_-	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_011284836.1|979381_982492_-	DNA polymerase III subunit alpha	NA	A0A2L1IZ23	Streptomyces_phage	29.7	5.4e-119
WP_002989617.1|982676_983048_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002984437.1|983047_983746_+	ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	27.3	6.6e-09
WP_002984433.1|983755_984541_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002989607.1|984667_985282_-	TVP38/TMEM64 family protein	NA	M1Q152	Streptococcus_phage	52.3	6.2e-51
985703:985762	attL	ACTCCCACCAGCTCCATCAATGCTTACCGTAAGTAATCATAACTTACTAAAACCTTGTTA	NA	NA	NA	NA
WP_002993136.1|985872_986061_-	hypothetical protein	NA	A3F673	Streptococcus_phage	76.3	2.1e-18
WP_011184727.1|986300_987059_+	DNase Mf2	NA	NA	NA	NA	NA
WP_002985327.1|987169_987877_+	streptococcal pyrogenic exotoxin SpeC	NA	A0A097PAT7	Streptococcus_pyogenes_phage	27.1	3.9e-09
WP_011284838.1|987952_989287_-	lysin	NA	Q5MY96	Streptococcus_phage	93.0	1.3e-247
WP_011284839.1|989398_989584_-	hypothetical protein	NA	Q938J5	Temperate_phage	96.7	6.6e-25
WP_002990012.1|989580_989877_-	hypothetical protein	NA	Q938J6	Temperate_phage	98.0	3.7e-46
WP_011284840.1|989887_990505_-	hypothetical protein	NA	A3F662	Streptococcus_phage	94.6	9.8e-89
WP_002988795.1|990507_990669_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011284841.1|990682_992578_-	gp58-like family protein	NA	Q938J9	Temperate_phage	52.5	5.9e-76
WP_011284842.1|992588_992918_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011284843.1|992904_994119_-	hypothetical protein	NA	A3F657	Streptococcus_phage	49.5	5.0e-44
WP_011284844.1|994115_996170_-|tail	phage tail protein	tail	A3F656	Streptococcus_phage	84.1	0.0e+00
WP_011284845.1|996166_996946_-|tail	phage tail family protein	tail	A3F655	Streptococcus_phage	54.0	1.9e-65
WP_011284846.1|996977_1000613_-	tape measure protein	NA	C5IUK3	Streptococcus_phage	41.4	1.2e-85
WP_021340179.1|1000627_1000924_-	hypothetical protein	NA	A0A0S2MYH1	Enterococcus_phage	42.2	1.3e-09
WP_002990023.1|1000998_1001352_-	hypothetical protein	NA	Q77RZ7	Lactococcus_phage	48.6	5.5e-20
WP_030126608.1|1001405_1002029_-|tail	phage major tail protein, TP901-1 family	tail	D7RWD5	Brochothrix_phage	50.5	3.2e-39
WP_011284850.1|1002083_1002473_-	hypothetical protein	NA	B5SP36	Lactococcus_phage	68.2	4.2e-45
WP_030126607.1|1002469_1002835_-	HK97 gp10 family phage protein	NA	A0A097BY98	Enterococcus_phage	46.3	5.9e-17
WP_011284852.1|1002815_1003124_-	hypothetical protein	NA	A0A2P1JTW8	Anoxybacillus_phage	40.2	7.4e-13
WP_002984392.1|1003120_1003474_-|head,tail	phage head-tail connector protein	head,tail	A0A2H4J002	uncultured_Caudovirales_phage	49.6	9.7e-25
WP_011284854.1|1003487_1003730_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011284855.1|1003739_1004822_-|capsid	major capsid protein	capsid	A0A2H4J022	uncultured_Caudovirales_phage	57.1	3.4e-105
WP_011284856.1|1004824_1005205_-|head	head decoration protein	head	A0A0K2CNR0	Brevibacillus_phage	32.5	1.8e-05
WP_023079765.1|1005214_1005748_-	DUF4355 domain-containing protein	NA	A0A141E0S7	Streptococcus_phage	80.7	6.8e-14
WP_011284858.1|1005891_1006158_-	hypothetical protein	NA	A0A097PAR8	Streptococcus_pyogenes_phage	70.5	1.9e-25
WP_011284859.1|1006160_1006475_-	hypothetical protein	NA	M1PLI3	Streptococcus_phage	72.8	6.8e-38
WP_002988389.1|1006544_1006730_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011284860.1|1006733_1008296_-|head	phage head morphogenesis protein	head	U6E9F1	Streptococcus_phage	44.2	2.5e-48
WP_002984369.1|1008276_1009779_-|portal	phage portal protein	portal	C9W9H5	Streptococcus_virus	54.5	1.9e-141
WP_020833530.1|1009790_1011098_-|terminase	PBSX family phage terminase large subunit	terminase	A0A2H4IYR5	uncultured_Caudovirales_phage	75.7	2.0e-184
WP_044564892.1|1011075_1011543_-|terminase	terminase small subunit	terminase	A0A141E1Y3	Streptococcus_phage	70.8	1.1e-52
WP_001132273.1|1011605_1011791_+	type II toxin-antitoxin system HicA family toxin	NA	D6PSW1	Lactobacillus_phage	54.0	1.7e-09
WP_002987543.1|1011842_1012220_+	type II toxin-antitoxin system HicB family antitoxin	NA	I3NLB2	Bifidobacterium_phage	44.0	3.3e-15
WP_002990048.1|1012535_1012748_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011284864.1|1012837_1013752_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011284866.1|1014329_1014764_-	ArpU family transcriptional regulator	NA	J7KDQ1	Streptococcus_phage	97.9	6.2e-74
WP_011888686.1|1015212_1015692_-	DUF1642 domain-containing protein	NA	A0A141E0J6	Streptococcus_phage	41.9	6.5e-24
WP_011888685.1|1015696_1016329_-	SAM-dependent DNA methyltransferase	NA	L0P368	Streptococcus_phage	68.6	5.1e-85
WP_011284869.1|1016330_1016615_-	hypothetical protein	NA	A0A097PAV1	Streptococcus_pyogenes_phage	86.2	2.6e-36
WP_002995952.1|1016611_1016782_-	hypothetical protein	NA	Q938M0	Temperate_phage	87.1	7.9e-09
WP_002995955.1|1016778_1017015_-	DUF3310 domain-containing protein	NA	A0A097PAQ7	Streptococcus_pyogenes_phage	100.0	2.4e-40
WP_011284873.1|1017256_1017613_-	hypothetical protein	NA	A0A097PAU4	Streptococcus_pyogenes_phage	100.0	2.9e-61
WP_023079767.1|1017596_1017947_-	VRR-NUC domain-containing protein	NA	A0A1P8VVL5	Streptococcus_phage	88.5	9.9e-46
WP_014635521.1|1017900_1018770_-	bifunctional DNA primase/polymerase	NA	A0A1P8BME8	Lactococcus_phage	65.6	5.8e-103
WP_011284875.1|1019038_1020592_-	hypothetical protein	NA	A0A1P8BM51	Lactococcus_phage	70.6	5.7e-210
WP_002984328.1|1020609_1021092_-	DUF669 domain-containing protein	NA	A0A1P8BM40	Lactococcus_phage	70.7	9.7e-60
WP_075340263.1|1021096_1022500_-	DEAD/DEAH box helicase	NA	A0A1P8BMH7	Lactococcus_phage	72.3	2.3e-194
WP_002984321.1|1022535_1023219_-	AAA family ATPase	NA	J7KC09	Streptococcus_phage	99.1	9.4e-125
WP_011284877.1|1023215_1023500_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002984315.1|1023496_1023691_-	hypothetical protein	NA	J7KK69	Streptococcus_phage	54.2	3.9e-12
WP_011284878.1|1023690_1024020_-	hypothetical protein	NA	J7KBZ0	Streptococcus_phage	41.8	7.9e-13
WP_011017881.1|1024100_1024238_-	hypothetical protein	NA	A0A097PAR2	Streptococcus_pyogenes_phage	100.0	3.4e-18
WP_011017882.1|1024234_1024531_-	hypothetical protein	NA	A0A097PAT8	Streptococcus_pyogenes_phage	98.0	3.1e-48
WP_011054585.1|1024609_1024795_-	helix-turn-helix transcriptional regulator	NA	A0A1X9I6I3	Streptococcus_phage	72.1	3.3e-16
WP_011284879.1|1024961_1025201_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002984292.1|1025350_1025560_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047298031.1|1025818_1026328_+	hypothetical protein	NA	H9A0R0	Staphylococcus_phage	30.6	4.4e-10
WP_002984281.1|1026435_1026663_-	hypothetical protein	NA	A0A141E1R7	Streptococcus_phage	57.3	2.9e-14
WP_011054589.1|1026736_1027123_+	hypothetical protein	NA	A0A097PAT1	Streptococcus_pyogenes_phage	100.0	1.2e-65
WP_011284881.1|1027111_1027321_-	hypothetical protein	NA	A0A097PAQ9	Streptococcus_pyogenes_phage	100.0	1.7e-32
WP_011284882.1|1027374_1027974_+	hypothetical protein	NA	A0A097PAT4	Streptococcus_pyogenes_phage	100.0	3.1e-108
WP_011284883.1|1028003_1028162_-	hypothetical protein	NA	J7KH24	Streptococcus_phage	90.4	8.4e-21
WP_021341080.1|1028220_1028436_+	hypothetical protein	NA	J7KBX0	Streptococcus_phage	95.7	2.5e-28
WP_021340643.1|1028421_1028571_-	hypothetical protein	NA	J7KH12	Streptococcus_phage	91.8	4.3e-19
WP_011284884.1|1028928_1029672_+	helix-turn-helix domain-containing protein	NA	A0A1S5S8T5	Streptococcus_phage	62.9	2.5e-75
WP_023079768.1|1029684_1030494_+	type II toxin-antitoxin system PemK/MazF family toxin	NA	J7KDP1	Streptococcus_phage	35.8	2.9e-24
WP_023079773.1|1030743_1031832_+|integrase	site-specific integrase	integrase	Q38159	Streptococcus_phage	98.6	3.0e-202
WP_002989605.1|1032194_1032815_+	DUF3862 domain-containing protein	NA	NA	NA	NA	NA
1031875:1031970	attR	ACTCCCACCAGCTCCATCAATGCTTACCGTAAGTAATCATAACTTACTAAAACCTTGTTACATCAAGGTTTTTTCTTTTTGTCTTGTTCATGAGTT	NA	NA	NA	NA
WP_011284887.1|1033071_1035336_-	glycogen/starch/alpha-glucan family phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	43.7	1.2e-11
>prophage 5
NZ_CP023769	Streptococcus pyogenes strain HarveyGAS chromosome, complete genome	1852980	1759178	1779403	1852980	holin,integrase	Streptococcus_phage(56.25%)	27	1762377:1762397	1776704:1776724
WP_011285269.1|1759178_1760399_-	MFS transporter	NA	A0A2H4PQR6	Staphylococcus_phage	23.8	1.6e-05
WP_021340699.1|1760409_1762392_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	30.1	1.3e-62
1762377:1762397	attL	CAATAATGTTTGTCATAATTT	NA	NA	NA	NA
WP_003058754.1|1762486_1763638_-|integrase	site-specific integrase	integrase	A0A1X9I5Y5	Streptococcus_phage	44.9	3.6e-84
WP_011185066.1|1763886_1764030_+|holin	putative holin-like toxin	holin	NA	NA	NA	NA
WP_003058809.1|1764891_1765659_-	helix-turn-helix domain-containing protein	NA	Q76TK4	Streptococcus_pyogenes_phage	83.1	3.6e-72
WP_002992503.1|1765812_1766019_+	helix-turn-helix transcriptional regulator	NA	X2KUC2	Streptococcus_phage	47.0	2.4e-07
WP_002992502.1|1766052_1766253_+	helix-turn-helix transcriptional regulator	NA	A0A1S5SE31	Streptococcus_phage	56.7	3.4e-11
WP_002992501.1|1766273_1766681_+	hypothetical protein	NA	A0A1X9I5V7	Streptococcus_phage	69.4	1.3e-49
WP_011185071.1|1767092_1767620_+	Rha family transcriptional regulator	NA	R9QNB1	Lactococcus_phage	40.2	9.7e-21
WP_000132665.1|1767867_1768041_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000074663.1|1768258_1768432_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000916926.1|1768572_1769025_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011285276.1|1769126_1769459_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021340709.1|1769458_1769650_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003058810.1|1769661_1769991_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010922766.1|1769993_1770266_+	hypothetical protein	NA	A0A1X9I5U9	Streptococcus_phage	60.0	3.6e-19
WP_011285278.1|1770266_1771133_+	primase C-terminal domain-containing protein	NA	A0A1X9I6L2	Streptococcus_phage	73.8	6.1e-121
WP_011285279.1|1771144_1772539_+	phage protein	NA	A0A1W6JQD6	Staphylococcus_phage	38.1	1.3e-48
WP_011285280.1|1772832_1773087_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011285281.1|1773083_1773257_+	hypothetical protein	NA	A0A1X9I5U0	Streptococcus_phage	59.6	8.6e-11
WP_011285282.1|1773262_1773436_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011285283.1|1773437_1773947_+	hypothetical protein	NA	A0A1X9I5U4	Streptococcus_phage	63.5	1.9e-29
WP_002992480.1|1774020_1774509_+	hypothetical protein	NA	A0A1X9I5V2	Streptococcus_phage	54.9	1.4e-45
WP_011285284.1|1774912_1775275_+	DUF1492 domain-containing protein	NA	NA	NA	NA	NA
WP_011285285.1|1775249_1775633_+	ArpU family transcriptional regulator	NA	Q938L8	Temperate_phage	41.7	3.7e-14
WP_011285286.1|1775797_1776451_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011285287.1|1776847_1779403_-	DNA mismatch repair protein MutS	NA	A0A1V0SGG8	Hokovirus	22.8	6.8e-43
1776704:1776724	attR	CAATAATGTTTGTCATAATTT	NA	NA	NA	NA
>prophage 6
NZ_CP023769	Streptococcus pyogenes strain HarveyGAS chromosome, complete genome	1852980	1805817	1815805	1852980	integrase	Streptococcus_phage(75.0%)	15	1805391:1805405	1812953:1812967
1805391:1805405	attL	AATCCTTGAAGCTGT	NA	NA	NA	NA
WP_000694580.1|1805817_1805991_-	hypothetical protein	NA	A0A1X9I5U0	Streptococcus_phage	59.6	1.9e-10
WP_011285313.1|1806277_1807891_-	hypothetical protein	NA	A0A1P8BMF9	Lactococcus_phage	53.1	2.4e-147
WP_011285314.1|1807880_1808402_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011285315.1|1808411_1808780_-	hypothetical protein	NA	A0A1X9I6M4	Streptococcus_phage	47.1	2.6e-12
WP_021340713.1|1808688_1808880_-	hypothetical protein	NA	NA	NA	NA	NA
WP_098187672.1|1808879_1809212_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011285318.1|1809223_1809406_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014407970.1|1809626_1809869_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011285320.1|1809925_1810492_-	hypothetical protein	NA	A0A0A7S0G2	Clostridium_phage	42.9	5.0e-23
WP_011285321.1|1810507_1810696_-	helix-turn-helix transcriptional regulator	NA	A0A1X9I5U7	Streptococcus_phage	59.7	1.7e-12
WP_011285322.1|1810864_1811308_+	helix-turn-helix transcriptional regulator	NA	A0A1X9I723	Streptococcus_phage	48.6	1.8e-07
WP_011285323.1|1811487_1812651_+|integrase	site-specific integrase	integrase	A0A1X9I6A9	Streptococcus_phage	70.5	2.8e-161
WP_002982092.1|1812807_1813419_-	30S ribosomal protein S4	NA	NA	NA	NA	NA
1812953:1812967	attR	ACAGCTTCAAGGATT	NA	NA	NA	NA
WP_002991405.1|1814148_1814421_-	Veg family protein	NA	NA	NA	NA	NA
WP_009880645.1|1814437_1815805_-	replicative DNA helicase	NA	A0A1P8VVQ6	Streptococcus_phage	63.7	1.0e-154
