The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP023752	Listeria monocytogenes strain AT3E chromosome, complete genome	3057808	120335	126860	3057808	tail	Listeria_phage(33.33%)	10	NA	NA
WP_003721739.1|120335_120788_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A059T7S0	Listeria_phage	47.9	4.0e-31
WP_003721740.1|120793_121129_-	helix-turn-helix transcriptional regulator	NA	A0A2H4JAR9	uncultured_Caudovirales_phage	52.5	4.0e-20
WP_003732219.1|121345_121774_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003721742.1|121785_122202_+	hypothetical protein	NA	A8ASQ1	Listeria_phage	39.3	1.3e-20
WP_009930418.1|122479_122869_+	DUF5072 domain-containing protein	NA	NA	NA	NA	NA
WP_003721744.1|122881_123394_+|tail	phage major tail protein, TP901-1 family	tail	A0A097PBF4	Streptococcus_pyogenes_phage	62.7	1.2e-47
WP_003721745.1|123441_123744_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009930419.1|123785_124190_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010989347.1|124176_126045_+	membrane protein	NA	A0A097PAU2	Streptococcus_pyogenes_phage	45.8	3.5e-20
WP_009911828.1|126041_126860_+|tail	phage tail family protein	tail	A0A060AFE1	Staphylococcus_phage	35.0	7.2e-39
>prophage 2
NZ_CP023752	Listeria monocytogenes strain AT3E chromosome, complete genome	3057808	675994	731207	3057808	protease,tail,head,transposase,terminase,portal,capsid,integrase,holin	Listeria_phage(41.18%)	65	685182:685199	720209:720226
WP_023552234.1|675994_677146_-|integrase	site-specific integrase	integrase	A8ATX2	Listeria_phage	46.3	3.4e-87
WP_023552237.1|677167_677881_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014930667.1|677935_678436_-	hypothetical protein	NA	A0A1S7FYX8	Listeria_phage	31.9	1.9e-13
WP_012951299.1|678448_678775_-	helix-turn-helix transcriptional regulator	NA	Q0H244	Geobacillus_phage	47.1	1.6e-13
WP_023552239.1|678948_679140_+	helix-turn-helix transcriptional regulator	NA	Q0H243	Geobacillus_phage	57.6	4.7e-10
WP_012951301.1|679237_679564_+	DUF771 domain-containing protein	NA	A0A2H4J474	uncultured_Caudovirales_phage	41.1	4.9e-15
WP_023552243.1|679736_680651_+	hypothetical protein	NA	A0A1W6JNI1	Staphylococcus_phage	51.5	7.8e-58
WP_023552245.1|680652_681009_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061671600.1|681005_681422_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023552251.1|681609_682329_+	DUF2786 domain-containing protein	NA	A0A1U9WR73	Streptococcus_virus	29.7	3.5e-21
WP_023552253.1|682332_682635_+	hypothetical protein	NA	A0A059T695	Listeria_phage	96.2	3.8e-22
WP_061671601.1|682631_683033_+	hypothetical protein	NA	A8ASP1	Listeria_phage	58.2	1.7e-38
WP_014601510.1|683029_683431_+	hypothetical protein	NA	A8ATD9	Listeria_phage	100.0	2.6e-74
WP_014601509.1|683427_683637_+	hypothetical protein	NA	A8ATE0	Listeria_phage	100.0	1.7e-32
WP_014601398.1|683801_684263_+	hypothetical protein	NA	D9J0I6	Brochothrix_phage	29.9	5.5e-12
WP_003733723.1|684441_684696_+	hypothetical protein	NA	A0A059T5G2	Listeria_phage	92.8	3.4e-40
WP_061671602.1|684696_685176_+	single-stranded DNA-binding protein	NA	A8ASP5	Listeria_phage	79.4	1.4e-66
685182:685199	attL	AAAGGAGCGATGAAAATG	NA	NA	NA	NA
WP_023552274.1|685196_685436_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031694735.1|685426_685612_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023552279.1|685682_686201_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023552281.1|686197_686740_+|integrase	tyrosine-type recombinase/integrase	integrase	H0USV4	Bacillus_phage	53.3	2.5e-48
WP_061114108.1|686755_687088_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031694737.1|687358_687685_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049961622.1|687681_688041_+	HNH endonuclease	NA	A0A075M5R4	Enterococcus_phage	46.2	5.4e-15
WP_012951321.1|688139_688667_+|terminase	phage terminase small subunit P27 family	terminase	J7KC46	Streptococcus_phage	46.7	6.1e-31
WP_012951322.1|688635_690387_+|terminase	terminase large subunit	terminase	A0A2H4JCI4	uncultured_Caudovirales_phage	50.7	4.1e-156
WP_023552290.1|690393_690594_+	DUF1056 family protein	NA	NA	NA	NA	NA
WP_012951323.1|690596_691832_+|portal	phage portal protein	portal	A0A2H4JAR2	uncultured_Caudovirales_phage	42.1	3.6e-82
WP_012951324.1|691828_692395_+|head,protease	HK97 family phage prohead protease	head,protease	A0A1D6Z2A7	Staphylococcus_phage	52.2	1.0e-44
WP_012951325.1|692458_693628_+|capsid	phage major capsid protein	capsid	A0A060AI54	Enterococcus_phage	38.1	2.1e-44
WP_012951326.1|693676_694015_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4JB77	uncultured_Caudovirales_phage	37.8	8.1e-13
WP_012951327.1|693984_694305_+|head	phage head closure protein	head	NA	NA	NA	NA
WP_012951328.1|694298_694664_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014930680.1|694666_695065_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012951330.1|695085_695661_+|tail	major tail protein	tail	M1PRQ7	Streptococcus_phage	42.4	1.2e-32
WP_012951331.1|695750_696098_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014930682.1|696294_700494_+|tail	phage tail tape measure protein	tail	J7KDT4	Streptococcus_phage	33.0	1.2e-12
WP_014930683.1|700486_702730_+|tail	phage tail component protein	tail	A0A059T682	Listeria_phage	29.4	1.2e-56
WP_031694739.1|702735_705027_+	phage minor structural protein	NA	A0A059T7Y6	Listeria_phage	37.9	4.4e-134
WP_023552297.1|705019_706081_+	hypothetical protein	NA	A0A059T7R4	Listeria_phage	51.0	1.2e-94
WP_003722523.1|706119_706485_+	hypothetical protein	NA	Q9T1A0	Listeria_phage	100.0	7.4e-12
WP_031694741.1|706497_706782_+|holin	holin	holin	A8ASL4	Listeria_phage	94.6	3.5e-41
WP_009912342.1|708879_709509_+	hypothetical protein	NA	A8ASL7	Listeria_phage	90.4	1.9e-100
WP_010989534.1|710148_710682_+	DUF3267 domain-containing protein	NA	NA	NA	NA	NA
WP_003732615.1|710745_711663_+	aldo/keto reductase family oxidoreductase	NA	NA	NA	NA	NA
WP_003722840.1|711928_713809_+	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	38.4	6.4e-107
WP_009930760.1|713904_714633_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003732614.1|714775_715426_+	transaldolase	NA	A0A0E3HJ81	Synechococcus_phage	27.6	3.4e-15
WP_009931059.1|715468_717289_-	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	28.4	2.2e-48
WP_003732612.1|717523_718915_+	amino acid permease	NA	NA	NA	NA	NA
WP_010989536.1|719004_719844_+	VOC family protein	NA	NA	NA	NA	NA
WP_003721764.1|719926_720211_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003721765.1|720308_721259_+	magnesium transporter CorA family protein	NA	NA	NA	NA	NA
720209:720226	attR	CATTTTCATCGCTCCTTT	NA	NA	NA	NA
WP_003721766.1|721282_721924_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010989537.1|721966_724657_+	YhgE/Pip domain-containing protein	NA	NA	NA	NA	NA
WP_003721768.1|724702_725350_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003721769.1|725358_725895_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003733993.1|725881_726802_-	DUF975 family protein	NA	NA	NA	NA	NA
WP_003721771.1|726991_727201_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010989538.1|727268_727976_+	serine/threonine protein phosphatase	NA	A0A249Y183	Enterococcus_phage	27.8	2.5e-19
WP_003721773.1|728019_728583_-	DUF420 domain-containing protein	NA	NA	NA	NA	NA
WP_009931746.1|728702_729119_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009925179.1|729170_729806_+	endonuclease III domain-containing protein	NA	NA	NA	NA	NA
WP_010989540.1|729795_730692_-	Rgg/GadR/MutR family transcriptional regulator	NA	NA	NA	NA	NA
WP_009931745.1|730922_731207_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP023752	Listeria monocytogenes strain AT3E chromosome, complete genome	3057808	1154483	1161906	3057808		Hokovirus(33.33%)	8	NA	NA
WP_003721506.1|1154483_1154867_+	glycerol-3-phosphate cytidylyltransferase	NA	A0A1V0SGE7	Hokovirus	40.7	1.4e-16
WP_010989659.1|1154888_1155872_+	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	34.6	4.1e-12
WP_010989660.1|1155886_1156900_+	glycosyltransferase	NA	A0A1V0SAH6	Catovirus	32.0	7.9e-11
WP_003721509.1|1157108_1158599_+	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	49.7	9.5e-114
WP_009931487.1|1158610_1159435_+	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	52.6	7.4e-68
WP_009931485.1|1159447_1159756_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_009931483.1|1159816_1160221_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_010989661.1|1160349_1161906_+	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	28.1	2.3e-17
>prophage 4
NZ_CP023752	Listeria monocytogenes strain AT3E chromosome, complete genome	3057808	1275955	1356258	3057808	protease,tail,terminase,tRNA,portal,capsid,integrase,holin	Listeria_phage(78.95%)	95	1275839:1275859	1318556:1318576
1275839:1275859	attL	AATCCCTCTCAGGACGTAATA	NA	NA	NA	NA
WP_039153598.1|1275955_1277110_-|integrase	site-specific integrase	integrase	A8ATC7	Listeria_phage	92.4	3.4e-204
WP_014930257.1|1277240_1278104_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026747145.1|1278155_1278608_-	ImmA/IrrE family metallo-endopeptidase	NA	R4IBK9	Listeria_phage	87.3	9.1e-76
WP_012951519.1|1278624_1278948_-	helix-turn-helix transcriptional regulator	NA	R4IDX0	Listeria_phage	75.7	6.3e-39
WP_003730994.1|1279348_1279552_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003730995.1|1279618_1279810_+	helix-turn-helix transcriptional regulator	NA	A0A059T5F8	Listeria_phage	87.1	5.4e-22
WP_061105177.1|1279831_1280074_+	hypothetical protein	NA	A8ATD2	Listeria_phage	92.5	1.5e-40
WP_009931094.1|1280785_1281076_+	hypothetical protein	NA	A0A059T7V3	Listeria_phage	89.4	1.8e-40
WP_031659545.1|1281093_1281276_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014930119.1|1281469_1281745_+	hypothetical protein	NA	R4ICD2	Listeria_phage	94.3	3.4e-41
WP_009931089.1|1281741_1282185_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014930120.1|1282201_1282510_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014930121.1|1282506_1283070_+	DUF1642 domain-containing protein	NA	A8ATD8	Listeria_phage	61.5	1.6e-58
WP_014930122.1|1283128_1283641_+	pentapeptide repeat-containing protein	NA	M4H0V1	Listeria_phage	86.9	1.0e-30
WP_009932944.1|1283641_1284271_+	hypothetical protein	NA	A0A191KBJ8	Streptococcus_virus	57.9	2.4e-66
WP_003722554.1|1284289_1284457_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045131531.1|1284560_1284737_+	hypothetical protein	NA	A0A076G7F4	Listeria_phage	86.2	5.5e-21
WP_014930124.1|1284733_1285135_+	hypothetical protein	NA	A8ATD9	Listeria_phage	95.5	7.8e-71
WP_025283119.1|1285131_1285338_+	hypothetical protein	NA	A0A059T6C7	Listeria_phage	92.6	1.7e-29
WP_154079741.1|1285364_1285535_+	hypothetical protein	NA	A0A059T654	Listeria_phage	92.3	2.4e-21
WP_023548953.1|1285531_1285966_+	hypothetical protein	NA	A8ATS7	Listeria_phage	52.8	2.5e-38
WP_015987318.1|1286168_1286552_+	hypothetical protein	NA	A8ATE8	Listeria_phage	100.0	2.5e-66
WP_039153573.1|1286553_1287033_+	siphovirus Gp157 family protein	NA	R4IBM0	Listeria_phage	97.5	1.9e-76
WP_039153570.1|1287045_1287735_+	AAA family ATPase	NA	R4IDY8	Listeria_phage	91.7	6.8e-123
WP_072215795.1|1287813_1289055_+	DEAD/DEAH box helicase	NA	A8ATF1	Listeria_phage	95.8	1.5e-213
WP_039153564.1|1289077_1289560_+	DUF669 domain-containing protein	NA	A8ATF2	Listeria_phage	98.8	9.3e-87
WP_098188691.1|1289582_1291856_+	DNA primase	NA	A8ATF3	Listeria_phage	94.3	0.0e+00
WP_014601407.1|1292193_1292511_+	VRR-NUC domain-containing protein	NA	A8ATF4	Listeria_phage	95.1	9.2e-51
WP_003731659.1|1292512_1292725_+	hypothetical protein	NA	NA	NA	NA	NA
WP_098188692.1|1293314_1293845_+	DUF3310 domain-containing protein	NA	A8ATF5	Listeria_phage	77.7	8.4e-73
WP_003747244.1|1294039_1294465_+	DUF722 domain-containing protein	NA	A8ATF6	Listeria_phage	97.2	2.2e-71
WP_031669127.1|1294558_1295302_+	DUF559 domain-containing protein	NA	NA	NA	NA	NA
WP_026749920.1|1295857_1296184_+	hypothetical protein	NA	A0A059T5G5	Listeria_phage	98.1	8.3e-55
WP_009928009.1|1296183_1296498_+	HNH endonuclease	NA	A8ATF8	Listeria_phage	99.0	3.8e-57
WP_031646261.1|1296546_1296903_+	hypothetical protein	NA	A8AT94	Listeria_phage	98.0	2.6e-46
WP_061105129.1|1296899_1298543_+|terminase	terminase large subunit	terminase	A8AT95	Listeria_phage	98.9	0.0e+00
WP_023548926.1|1298554_1299685_+|portal	phage portal protein	portal	A8AT96	Listeria_phage	93.1	1.7e-203
WP_077295892.1|1300515_1301667_+|capsid	phage major capsid protein	capsid	A0A059T678	Listeria_phage	98.7	5.9e-212
WP_009934007.1|1301853_1302153_+	hypothetical protein	NA	A8ATA0	Listeria_phage	98.0	9.9e-47
WP_009934006.1|1302136_1302502_+	hypothetical protein	NA	A0A059T6F2	Listeria_phage	96.7	1.6e-62
WP_012951550.1|1302498_1302900_+	hypothetical protein	NA	A0A059T5F3	Listeria_phage	100.0	2.1e-68
WP_009931623.1|1302896_1303280_+	hypothetical protein	NA	A0A059T681	Listeria_phage	96.1	6.1e-65
WP_009931624.1|1303300_1303888_+|tail	phage tail protein	tail	A0A059T7Y4	Listeria_phage	100.0	4.0e-108
WP_014930131.1|1303958_1304291_+	hypothetical protein	NA	A0A059T7R2	Listeria_phage	97.3	1.1e-51
WP_061105138.1|1304506_1309426_+|tail	phage tail tape measure protein	tail	A0A059T5F4	Listeria_phage	93.4	0.0e+00
WP_023553822.1|1309418_1311068_+|tail	phage tail protein	tail	A0A059T682	Listeria_phage	99.6	0.0e+00
WP_061105326.1|1311080_1313375_+	hypothetical protein	NA	A0A059T7Y6	Listeria_phage	98.4	0.0e+00
WP_098188693.1|1313364_1314456_+	carbohydrate-binding protein CenC	NA	A0A059T7R4	Listeria_phage	91.2	1.2e-187
WP_058831691.1|1314507_1314810_+	hypothetical protein	NA	A0A059T5E6	Listeria_phage	94.0	7.7e-39
WP_012951558.1|1314809_1315067_+|holin	phage holin	holin	A8ATB7	Listeria_phage	69.0	3.2e-25
WP_014930134.1|1315066_1315909_+	peptidase M15	NA	A0A059T7Y8	Listeria_phage	81.6	9.5e-127
WP_012951560.1|1316012_1317011_+	DUF3644 domain-containing protein	NA	A0A0N9RUA4	Staphylococcus_phage	44.8	3.9e-71
WP_003769913.1|1317225_1317432_-	hypothetical protein	NA	A0A059T7Z0	Listeria_phage	82.8	1.3e-16
WP_009933529.1|1318022_1318256_+	hypothetical protein	NA	R4IDW6	Listeria_phage	78.9	2.8e-28
WP_009933528.1|1318252_1318444_+	hypothetical protein	NA	R4IBI5	Listeria_phage	88.9	8.9e-25
WP_010989715.1|1318937_1320296_+	DUF1254 domain-containing protein	NA	NA	NA	NA	NA
1318556:1318576	attR	AATCCCTCTCAGGACGTAATA	NA	NA	NA	NA
WP_010989716.1|1320337_1320931_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009914084.1|1321084_1321492_-	glyoxalase/bleomycin resistance/extradiol dioxygenase family protein	NA	NA	NA	NA	NA
WP_009924169.1|1321656_1322256_+	histidine phosphatase family protein	NA	A0A1X9IGJ2	Lactococcus_phage	41.0	5.8e-30
WP_003723543.1|1322287_1322548_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010989717.1|1322671_1324084_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	31.8	8.3e-51
WP_003723545.1|1324108_1324372_+	DUF3116 domain-containing protein	NA	NA	NA	NA	NA
WP_003723546.1|1324538_1325015_+	8-oxo-dGTP diphosphatase	NA	NA	NA	NA	NA
WP_003723547.1|1325052_1325298_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003723548.1|1325294_1326500_-	MFS transporter	NA	NA	NA	NA	NA
WP_003723549.1|1326704_1327364_+	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_003723550.1|1327405_1327600_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003723551.1|1327666_1328515_-	YitT family protein	NA	NA	NA	NA	NA
WP_009931701.1|1329133_1329847_+	trehalose operon repressor	NA	NA	NA	NA	NA
WP_010989718.1|1329877_1331524_-	alpha,alpha-phosphotrehalase	NA	NA	NA	NA	NA
WP_003723556.1|1331542_1333027_-	PTS system trehalose-specific EIIBC component	NA	NA	NA	NA	NA
WP_003723557.1|1333142_1333595_+	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_003723558.1|1333641_1334106_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003723559.1|1334294_1335215_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_009932313.1|1335234_1336482_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	51.8	1.2e-106
WP_003723561.1|1336465_1337296_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	42.4	4.3e-47
WP_003723562.1|1337431_1338571_-|protease	PrsW family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003723563.1|1338651_1339047_-	helix-turn-helix transcriptional regulator	NA	A9D9J6	Lactobacillus_prophage	57.4	1.3e-14
WP_003727524.1|1339197_1339413_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_010989719.1|1339531_1340065_+|protease	matrixin family metalloprotease	protease	NA	NA	NA	NA
WP_003732795.1|1340082_1340748_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003732796.1|1341009_1341948_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003723884.1|1342062_1343346_+	trigger factor	NA	NA	NA	NA	NA
WP_003723886.1|1343531_1344791_+|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	63.2	1.4e-145
WP_003723887.1|1344909_1345476_+	type I signal peptidase SipX	NA	NA	NA	NA	NA
WP_003723888.1|1345510_1346080_+	type I signal peptidase SipY	NA	NA	NA	NA	NA
WP_003723889.1|1346181_1346724_+	type I signal peptidase SipZ	NA	NA	NA	NA	NA
WP_003723890.1|1346733_1347597_+	ribosome biogenesis GTPase YlqF	NA	NA	NA	NA	NA
WP_003723891.1|1347593_1348379_+	ribonuclease HII	NA	G4YAY0	Emiliania_huxleyi_virus	39.2	3.0e-26
WP_010989720.1|1348512_1349373_+	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_009924617.1|1349644_1351723_+	type I DNA topoisomerase	NA	A0A1V0SB35	Catovirus	37.7	1.4e-107
WP_010989721.1|1351785_1353090_+|tRNA	FADH(2)-oxidizing methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))- methyltransferase TrmFO	tRNA	NA	NA	NA	NA
WP_009911635.1|1353372_1354275_+	tyrosine recombinase XerC	NA	A0A097EYL9	Mycobacterium_phage	28.6	1.2e-13
WP_014601431.1|1354295_1354835_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_010989722.1|1354848_1356258_+|protease	ATP-dependent protease ATPase subunit HslU	protease	W6AS21	Erwinia_phage	27.7	4.9e-43
>prophage 5
NZ_CP023752	Listeria monocytogenes strain AT3E chromosome, complete genome	3057808	1827724	1860590	3057808	protease,tail,head,terminase,portal,capsid,holin	Erysipelothrix_phage(67.74%)	38	NA	NA
WP_014929970.1|1827724_1828639_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1D8ETE4	Propionibacterium_phage	44.0	3.9e-33
WP_025186379.1|1828628_1829042_-|holin	phage holin family protein	holin	A0A2K5B2A2	Erysipelothrix_phage	57.0	1.5e-37
WP_003731143.1|1829090_1829510_-	DUF1617 family protein	NA	A0A1S5RCP5	Lactobacillus_phage	26.5	2.4e-06
WP_003731141.1|1829670_1833735_-	hypothetical protein	NA	A0A1B1P770	Bacillus_phage	41.8	8.7e-85
WP_003731140.1|1833719_1834412_-	hypothetical protein	NA	A0A1L2BYA2	Clostridium_phage	29.0	1.7e-20
WP_003731139.1|1834427_1836989_-	hypothetical protein	NA	A0A2K5B297	Erysipelothrix_phage	74.1	3.9e-83
WP_003731138.1|1837056_1837701_-	DUF1643 domain-containing protein	NA	NA	NA	NA	NA
WP_003731137.1|1837952_1838336_-	hypothetical protein	NA	A0A2K5B295	Erysipelothrix_phage	64.2	5.4e-37
WP_003731136.1|1838345_1838936_-|tail	phage tail protein	tail	A0A2K5B294	Erysipelothrix_phage	72.2	4.1e-76
WP_029645088.1|1838937_1839246_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003731135.1|1839272_1839704_-	HK97 gp10 family phage protein	NA	A0A2K5B292	Erysipelothrix_phage	59.4	7.6e-40
WP_003731134.1|1839696_1840035_-|head,tail	head-tail adaptor protein	head,tail	A0A2K5B291	Erysipelothrix_phage	54.7	1.7e-23
WP_003731133.1|1840031_1840343_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2K5B290	Erysipelothrix_phage	74.0	2.2e-36
WP_003731132.1|1840353_1841571_-|capsid	phage major capsid protein	capsid	A0A2I4R671	Erysipelothrix_phage	48.0	1.1e-102
WP_095591263.1|1841574_1842327_-|protease	Clp protease ClpP	protease	M1PLE5	Streptococcus_phage	55.7	1.9e-62
WP_014929974.1|1842223_1843585_-|portal	phage portal protein	portal	A0A2K5B287	Erysipelothrix_phage	74.0	2.7e-179
WP_100066221.1|1843652_1843913_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088518322.1|1844044_1845637_-|terminase	terminase large subunit	terminase	A0A2K5B285	Erysipelothrix_phage	84.8	7.2e-269
WP_003731127.1|1845697_1845922_-	hypothetical protein	NA	A0A2K5B284	Erysipelothrix_phage	48.6	2.0e-15
WP_003731126.1|1845911_1846109_-	DUF5049 domain-containing protein	NA	NA	NA	NA	NA
WP_003731125.1|1846083_1846278_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003731124.1|1846280_1846670_-	DUF4314 domain-containing protein	NA	E4ZFL7	Streptococcus_phage	71.0	3.1e-16
WP_003731123.1|1846758_1848009_-	site-specific DNA-methyltransferase	NA	A0A2I4R670	Erysipelothrix_phage	62.0	7.4e-144
WP_003731122.1|1847998_1848601_-	HNH endonuclease	NA	A0A0B5HE03	Vibrio_phage	37.6	1.1e-12
WP_014929977.1|1848600_1849383_-	S-adenosylmethionine synthetase	NA	NA	NA	NA	NA
WP_031641527.1|1849387_1849966_-|terminase	terminase	terminase	A0A2K5B277	Erysipelothrix_phage	52.8	1.2e-53
WP_031641526.1|1850098_1850464_-	HNH endonuclease	NA	A0A2K5B276	Erysipelothrix_phage	56.9	1.4e-31
WP_003731117.1|1850631_1851060_-	DUF1492 domain-containing protein	NA	A0A2K5B275	Erysipelothrix_phage	45.8	1.5e-27
WP_014929979.1|1851056_1852409_-	DEAD/DEAH box helicase	NA	A0A2K5B273	Erysipelothrix_phage	69.0	6.8e-159
WP_003731115.1|1852408_1852693_-	VRR-NUC domain-containing protein	NA	A0A2K5B272	Erysipelothrix_phage	60.2	3.5e-25
WP_003731114.1|1852689_1852899_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003731113.1|1853036_1855280_-	hypothetical protein	NA	A0A1B0RXC5	Streptococcus_phage	49.7	4.8e-210
WP_014929980.1|1855272_1855617_-	hypothetical protein	NA	A0A2K5B270	Erysipelothrix_phage	51.4	4.1e-28
WP_014929981.1|1855609_1856380_-	phage antirepressor KilAC domain-containing protein	NA	A0A1Q1PVU2	Staphylococcus_phage	50.8	2.7e-64
WP_003731110.1|1856590_1858528_-	DNA polymerase	NA	A0A2K5B2B0	Erysipelothrix_phage	68.6	7.7e-265
WP_003731109.1|1858588_1859131_-	DUF2815 family protein	NA	A0A2K5B2A9	Erysipelothrix_phage	77.2	8.9e-78
WP_003731108.1|1859132_1860275_-	DUF2800 domain-containing protein	NA	M1Q218	Streptococcus_phage	57.8	1.5e-122
WP_010821424.1|1860275_1860590_-	hypothetical protein	NA	A0A2K5B2A7	Erysipelothrix_phage	41.5	6.6e-09
>prophage 6
NZ_CP023752	Listeria monocytogenes strain AT3E chromosome, complete genome	3057808	1944773	1953059	3057808		Synechococcus_phage(33.33%)	8	NA	NA
WP_003722243.1|1944773_1945340_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	35.9	7.0e-25
WP_009933235.1|1945336_1946386_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	43.2	1.0e-61
WP_010989807.1|1946404_1947832_-	amidophosphoribosyltransferase	NA	A0A1B1ISH6	uncultured_Mediterranean_phage	31.9	8.1e-54
WP_010989808.1|1947816_1950036_-	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	41.2	2.0e-160
WP_003733240.1|1950028_1950712_-	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_003722248.1|1950715_1950961_-	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_010989809.1|1950972_1951686_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3F9V5	Synechococcus_phage	38.3	2.3e-41
WP_003733238.1|1951766_1953059_-	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	32.6	7.2e-17
>prophage 7
NZ_CP023752	Listeria monocytogenes strain AT3E chromosome, complete genome	3057808	2467947	2505866	3057808	terminase,holin,tail	Listeria_phage(92.0%)	55	NA	NA
WP_014601489.1|2467947_2468379_+	helix-turn-helix transcriptional regulator	NA	A8ATJ2	Listeria_phage	81.7	2.4e-25
WP_014601490.1|2468375_2468876_+	AP2 domain-containing protein	NA	A8ATW6	Listeria_phage	72.4	3.2e-66
WP_012951560.1|2469081_2470080_-	DUF3644 domain-containing protein	NA	A0A0N9RUA4	Staphylococcus_phage	44.8	3.9e-71
WP_014930186.1|2470182_2471028_-	peptidase M15	NA	A0A059T7Y8	Listeria_phage	86.9	7.2e-135
WP_003733521.1|2471027_2471294_-|holin	phage holin	holin	A0A059T684	Listeria_phage	93.1	9.8e-38
WP_014930187.1|2471293_2471596_-	hypothetical protein	NA	A0A059T5E6	Listeria_phage	92.0	2.2e-38
WP_014601493.1|2471646_2473812_-	hypothetical protein	NA	A8ATW1	Listeria_phage	94.5	0.0e+00
WP_014930188.1|2473824_2475393_-	hypothetical protein	NA	A8ATW0	Listeria_phage	99.0	2.0e-303
WP_060562966.1|2475389_2480189_-|tail	phage tail tape measure protein	tail	A8ATV9	Listeria_phage	90.6	0.0e+00
WP_072215797.1|2480193_2480505_-	hypothetical protein	NA	A0A0B5D116	Listeria_phage	93.4	2.5e-40
WP_003725062.1|2480501_2480933_-	hypothetical protein	NA	A0A0B5D0B8	Listeria_phage	98.6	1.1e-73
WP_014930190.1|2480988_2481675_-	Ig domain-containing protein	NA	A0A0B5CYK8	Listeria_phage	98.2	5.2e-115
WP_003745007.1|2481679_2482051_-	hypothetical protein	NA	A0A0B5CTY4	Listeria_phage	100.0	1.1e-63
WP_014930191.1|2482047_2482365_-	HK97 gp10 family phage protein	NA	A0A0B5CTS1	Listeria_phage	99.0	4.4e-53
WP_014930192.1|2482354_2482720_-	hypothetical protein	NA	A0A0B5D114	Listeria_phage	100.0	1.5e-65
WP_003745003.1|2482719_2483073_-	hypothetical protein	NA	A8ATV2	Listeria_phage	97.4	2.4e-60
WP_014930193.1|2483073_2483253_-	hypothetical protein	NA	A8ATV1	Listeria_phage	94.1	1.5e-10
WP_014930194.1|2483266_2484139_-	hypothetical protein	NA	A8ATV0	Listeria_phage	99.3	4.7e-161
WP_003744996.1|2484161_2484716_-	hypothetical protein	NA	A8ATU9	Listeria_phage	99.5	1.1e-88
WP_014930195.1|2484811_2485855_-	hypothetical protein	NA	A0A0B5D111	Listeria_phage	96.8	7.7e-195
WP_014601502.1|2485859_2487416_-	hypothetical protein	NA	A0A0B5D0A6	Listeria_phage	98.8	7.7e-300
WP_014930196.1|2487430_2488750_-|terminase	PBSX family phage terminase large subunit	terminase	A0A0B5CYJ6	Listeria_phage	82.8	8.7e-220
WP_014601504.1|2488685_2489555_-|terminase	terminase	terminase	A8ATU5	Listeria_phage	57.4	2.6e-10
WP_014930197.1|2489743_2490034_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014601506.1|2490366_2490819_-	hypothetical protein	NA	A8ASQ1	Listeria_phage	73.4	4.4e-54
WP_003733720.1|2490883_2491381_-	Holliday junction resolvase RecU	NA	A0A1L2JY30	Aeribacillus_phage	49.3	1.8e-32
WP_003733721.1|2491370_2491553_-	hypothetical protein	NA	A8ASP6	Listeria_phage	79.4	1.1e-16
WP_014601507.1|2491571_2492054_-	single-stranded DNA-binding protein	NA	A0A059T5E0	Listeria_phage	66.9	1.1e-52
WP_014601509.1|2492281_2492491_-	hypothetical protein	NA	A8ATE0	Listeria_phage	100.0	1.7e-32
WP_014601510.1|2492487_2492889_-	hypothetical protein	NA	A8ATD9	Listeria_phage	100.0	2.6e-74
WP_014601511.1|2492947_2493508_-	DUF1642 domain-containing protein	NA	A8ATY9	Listeria_phage	100.0	9.4e-107
WP_039188046.1|2493504_2493969_-	class I SAM-dependent methyltransferase	NA	A0A059T693	Listeria_phage	97.4	1.4e-87
WP_031660000.1|2493965_2494889_-	DnaD domain-containing protein	NA	A0A0B5D175	Listeria_phage	79.8	1.9e-120
WP_009930473.1|2494902_2495541_-	ERF family protein	NA	A8ASN3	Listeria_phage	74.3	3.0e-77
WP_009930471.1|2495545_2496022_-	siphovirus Gp157 family protein	NA	A8ASN2	Listeria_phage	94.9	2.0e-57
WP_009930470.1|2496018_2496213_-	hypothetical protein	NA	A0A059T6E8	Listeria_phage	95.3	1.8e-28
WP_003769989.1|2496514_2496703_-	hypothetical protein	NA	A8ATY3	Listeria_phage	95.2	2.5e-27
WP_003769990.1|2496810_2497026_-	hypothetical protein	NA	Q9T176	Listeria_phage	73.2	6.1e-22
WP_009930464.1|2497022_2497556_-	hypothetical protein	NA	A0A059T5F0	Listeria_phage	84.4	1.1e-75
WP_003747301.1|2497676_2498450_-	phage repressor protein/antirepressor Ant	NA	A8ATY0	Listeria_phage	99.6	2.4e-140
WP_003725092.1|2498513_2498717_+	KTSC domain-containing protein	NA	A0A1S5S8T9	Streptococcus_phage	56.7	2.0e-14
WP_031660002.1|2498881_2499118_-	hypothetical protein	NA	A0A059T5E9	Listeria_phage	94.9	1.8e-35
WP_003735007.1|2499129_2499324_-	hypothetical protein	NA	A0A059T6E5	Listeria_phage	100.0	1.3e-26
WP_015967158.1|2499390_2499558_+	hypothetical protein	NA	Q9T182	Listeria_phage	100.0	5.6e-23
WP_031645989.1|2499972_2500230_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014930211.1|2500226_2500448_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014930212.1|2500468_2500702_-	helix-turn-helix transcriptional regulator	NA	A8ASM3	Listeria_phage	97.3	5.4e-32
WP_014930213.1|2500864_2501341_+	helix-turn-helix transcriptional regulator	NA	A8ASM2	Listeria_phage	80.3	4.5e-57
WP_003733638.1|2501498_2501666_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009930458.1|2501721_2501940_+	hypothetical protein	NA	A0A059T6E3	Listeria_phage	81.9	1.9e-26
WP_003770013.1|2501955_2502678_+	hypothetical protein	NA	A0A059T7P9	Listeria_phage	84.6	7.4e-88
WP_003770015.1|2502699_2503575_+	hypothetical protein	NA	A0A0B5D0D1	Listeria_phage	94.5	2.2e-150
WP_003733644.1|2503638_2504997_+	recombinase family protein	NA	Q8LTD8	Listeria_phage	98.5	2.5e-254
WP_009930453.1|2504987_2505464_+	competence protein ComK	NA	NA	NA	NA	NA
WP_003739618.1|2505518_2505866_-	helix-turn-helix transcriptional regulator	NA	A0A0A7RTK4	Clostridium_phage	40.7	9.9e-06
>prophage 8
NZ_CP023752	Listeria monocytogenes strain AT3E chromosome, complete genome	3057808	2649158	2657002	3057808		Streptococcus_phage(50.0%)	7	NA	NA
WP_003722604.1|2649158_2650130_-	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	39.4	5.2e-52
WP_003722605.1|2650137_2651106_-	YvcK family protein	NA	A1IMD5	Streptococcus_phage	43.3	6.7e-68
WP_010990001.1|2651107_2651983_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	29.7	3.2e-08
WP_010990002.1|2652090_2653821_-	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	54.0	1.3e-175
WP_009930954.1|2653862_2654924_-	galactose mutarotase	NA	NA	NA	NA	NA
WP_009924988.1|2654940_2655924_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	37.2	2.6e-51
WP_003722610.1|2656042_2657002_-	thioredoxin-disulfide reductase	NA	G3MA85	Bacillus_virus	53.7	2.0e-88
>prophage 1
NZ_CP023753	Listeria monocytogenes strain AT3E plasmid pLM58, complete sequence	58523	40551	49634	58523	transposase	Streptococcus_phage(33.33%)	9	NA	NA
WP_003728469.1|40551_43467_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	36.7	1.9e-174
WP_003728468.1|43470_44025_-	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	53.4	7.0e-38
WP_003728467.1|44304_44664_+	Cd(II)-sensing metalloregulatory transcriptional repressor CadC	NA	E4ZFI8	Streptococcus_phage	50.0	3.1e-26
WP_003728466.1|44663_46799_+	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	64.5	1.6e-247
WP_012952127.1|47290_47836_+	YdhK family protein	NA	NA	NA	NA	NA
WP_003728511.1|48211_48820_+	recombinase family protein	NA	A0A1W5LU24	Ralstonia_phage	42.9	1.0e-21
WP_003728510.1|48809_49037_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003731679.1|49156_49435_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003728509.1|49397_49634_+	helix-turn-helix transcriptional regulator	NA	A0A097PBE6	Streptococcus_pyogenes_phage	53.4	6.7e-14
