The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP021435	Halomonas beimenensis strain NTU-111 chromosome, complete genome	4053030	445087	453535	4053030	integrase,tRNA	uncultured_Mediterranean_phage(66.67%)	7	437579:437594	452276:452291
437579:437594	attL	GGTCGAGCAGAAGCTG	NA	NA	NA	NA
WP_097787960.1|445087_446011_-	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	40.6	4.2e-43
WP_097787961.1|446020_447871_-	protein translocase subunit SecD	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	22.3	5.7e-07
WP_097787962.1|448012_448351_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	40.2	2.0e-11
WP_097787963.1|448432_449569_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	46.3	4.0e-88
WP_097787964.1|449696_450737_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_097787965.1|451244_452246_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	45.6	8.7e-79
WP_097787966.1|452242_453535_-	hypothetical protein	NA	Q56VN8	Pseudomonas_phage	35.3	3.3e-70
452276:452291	attR	CAGCTTCTGCTCGACC	NA	NA	NA	NA
>prophage 2
NZ_CP021435	Halomonas beimenensis strain NTU-111 chromosome, complete genome	4053030	1053480	1103408	4053030	integrase,transposase,protease	Salmonella_phage(18.18%)	52	1085361:1085381	1097935:1097955
WP_097788478.1|1053480_1053918_-|protease	ATP-dependent zinc protease	protease	NA	NA	NA	NA
WP_097788479.1|1053922_1054966_-	DUF3549 family protein	NA	NA	NA	NA	NA
WP_097788480.1|1055295_1056054_+	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_097788481.1|1056072_1056747_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_097788482.1|1056743_1057499_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.5	9.9e-35
WP_097788483.1|1057565_1057898_+	YqcC family protein	NA	NA	NA	NA	NA
WP_097788484.1|1058122_1058623_+	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_097788485.1|1058686_1059325_-	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_097788486.1|1059498_1060113_-	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_097788487.1|1060386_1060671_+	hypothetical protein	NA	NA	NA	NA	NA
WP_097788488.1|1060739_1062218_-	sodium/proline symporter PutP	NA	NA	NA	NA	NA
WP_097788489.1|1062261_1065453_-	bifunctional proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase PutA	NA	NA	NA	NA	NA
WP_097788490.1|1065639_1066440_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_097788491.1|1066503_1066875_-	hypothetical protein	NA	NA	NA	NA	NA
WP_097788492.1|1067114_1067684_-	hypothetical protein	NA	NA	NA	NA	NA
WP_097788493.1|1068014_1068776_+	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_097788494.1|1069106_1069838_+	fumarate/nitrate reduction transcriptional regulator Fnr	NA	NA	NA	NA	NA
WP_153045759.1|1070451_1071012_-	DUF2703 domain-containing protein	NA	NA	NA	NA	NA
WP_097788496.1|1071491_1072379_-	glutathione-dependent reductase	NA	NA	NA	NA	NA
WP_097788497.1|1072856_1073759_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_097788498.1|1073949_1074420_+	isochorismatase	NA	NA	NA	NA	NA
WP_097788499.1|1074489_1075194_+	thioredoxin domain-containing protein	NA	NA	NA	NA	NA
WP_097791002.1|1075781_1076234_+	GFA family protein	NA	NA	NA	NA	NA
WP_153045760.1|1077623_1077998_+	hypothetical protein	NA	A0A1J0GUX5	Halomonas_phage	52.5	2.0e-28
WP_097788500.1|1078256_1079129_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_153045761.1|1080380_1081067_-	hypothetical protein	NA	NA	NA	NA	NA
WP_097788503.1|1081791_1082358_-	hypothetical protein	NA	NA	NA	NA	NA
WP_097788504.1|1082648_1083065_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_097788505.1|1083207_1084461_-|transposase	IS256 family transposase	transposase	A0A2P1JQX9	Mycobacterium_phage	48.2	1.3e-100
WP_153045762.1|1084776_1085211_-	hypothetical protein	NA	A0A2H4JAT5	uncultured_Caudovirales_phage	61.4	2.2e-23
1085361:1085381	attL	TGGAGCGGGTGAAGGGAATCG	NA	NA	NA	NA
WP_097788507.1|1085926_1086295_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_097788508.1|1086291_1086627_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_097788509.1|1086707_1088258_+|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	48.7	8.9e-123
WP_153045763.1|1088308_1088752_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153045764.1|1088876_1089641_+	hypothetical protein	NA	NA	NA	NA	NA
WP_097788511.1|1090087_1090717_+	recombinase family protein	NA	A0A222YWP5	Escherichia_phage	28.7	8.9e-05
WP_097788512.1|1091008_1091188_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153045765.1|1091450_1092032_+	hypothetical protein	NA	I6R977	Salmonella_phage	51.7	6.1e-16
WP_153045766.1|1092143_1092359_-	hypothetical protein	NA	NA	NA	NA	NA
WP_097788514.1|1092534_1093074_-	hypothetical protein	NA	NA	NA	NA	NA
WP_097788515.1|1093066_1093630_-	ribonuclease HI	NA	A0A2I7RL06	Vibrio_phage	45.3	2.7e-29
WP_097788516.1|1094403_1094751_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_097788517.1|1094814_1095291_-	KilA-N domain-containing protein	NA	Q9XJS9	Pseudomonas_phage	40.2	2.8e-11
WP_097788518.1|1095364_1095769_-	KilA-N domain-containing protein	NA	I6R977	Salmonella_phage	51.0	1.7e-20
WP_097788519.1|1095900_1096344_-	hypothetical protein	NA	L7TQW5	Rhizobium_phage	55.9	1.1e-36
WP_097788520.1|1096455_1097787_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_097788521.1|1098295_1098703_-	CBS domain-containing protein	NA	NA	NA	NA	NA
1097935:1097955	attR	TGGAGCGGGTGAAGGGAATCG	NA	NA	NA	NA
WP_097788522.1|1098990_1099512_+	YqaE/Pmp3 family membrane protein	NA	NA	NA	NA	NA
WP_097788523.1|1099578_1100448_+	DMT family transporter	NA	NA	NA	NA	NA
WP_097788524.1|1100512_1101394_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_097791003.1|1101410_1102397_+	serine/threonine protein phosphatase	NA	NA	NA	NA	NA
WP_097788525.1|1102562_1103408_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
>prophage 3
NZ_CP021435	Halomonas beimenensis strain NTU-111 chromosome, complete genome	4053030	1388597	1400515	4053030		Bacillus_phage(25.0%)	10	NA	NA
WP_097788768.1|1388597_1389344_-	DUF72 domain-containing protein	NA	A0A1V0CNL1	Kaumoebavirus	33.3	1.5e-22
WP_097788769.1|1389436_1390324_-	NAD(P)-dependent oxidoreductase	NA	A9NI29	Synechococcus_phage	29.4	1.1e-05
WP_097788770.1|1390820_1393184_+	DNA polymerase II	NA	A0A0P0YM26	Yellowstone_lake_phycodnavirus	26.5	2.1e-30
WP_097788771.1|1393195_1394986_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	31.5	3.0e-53
WP_097788772.1|1395113_1395551_+	thioredoxin TrxC	NA	A0A1J0GW78	Streptomyces_phage	42.3	1.2e-11
WP_097788773.1|1395560_1396784_-	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	32.9	4.4e-16
WP_097788774.1|1397058_1398060_-	nucleoid-associated protein YejK	NA	L7TI92	Pseudomonas_virus	49.5	7.9e-88
WP_097788775.1|1398147_1398735_-	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_097788776.1|1398803_1399565_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_097791019.1|1399561_1400515_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	31.1	1.9e-22
>prophage 4
NZ_CP021435	Halomonas beimenensis strain NTU-111 chromosome, complete genome	4053030	2489864	2560022	4053030	integrase,transposase,protease	Mycobacterium_phage(14.29%)	45	2497834:2497850	2565070:2565086
WP_097789698.1|2489864_2491148_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_097788505.1|2494661_2495915_+|transposase	IS256 family transposase	transposase	A0A2P1JQX9	Mycobacterium_phage	48.2	1.3e-100
WP_097789700.1|2496155_2497379_+	NADH:ubiquinone reductase (Na(+)-transporting) subunit F	NA	NA	NA	NA	NA
2497834:2497850	attL	GCTCATGATGGTGGCGG	NA	NA	NA	NA
WP_097788505.1|2498585_2499839_-|transposase	IS256 family transposase	transposase	A0A2P1JQX9	Mycobacterium_phage	48.2	1.3e-100
WP_097788508.1|2500723_2501059_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_097788507.1|2501055_2501424_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_097789701.1|2501494_2501668_-	hypothetical protein	NA	NA	NA	NA	NA
WP_097789702.1|2502005_2503709_-	sodium:solute symporter family protein	NA	NA	NA	NA	NA
WP_097789703.1|2504402_2505293_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_097789704.1|2505474_2505687_+	hypothetical protein	NA	NA	NA	NA	NA
WP_097789705.1|2505679_2507143_+	sodium:solute symporter family protein	NA	NA	NA	NA	NA
WP_097789706.1|2507161_2508460_+	amidohydrolase	NA	NA	NA	NA	NA
WP_097789707.1|2509084_2510275_+|integrase	site-specific integrase	integrase	A0A077KET4	Ralstonia_phage	49.6	6.7e-102
WP_097789708.1|2510416_2511487_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_153045788.1|2511804_2512200_-	hypothetical protein	NA	NA	NA	NA	NA
WP_097789710.1|2512897_2515771_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_097789711.1|2515770_2518194_-	DUF2357 domain-containing protein	NA	NA	NA	NA	NA
WP_097789712.1|2518200_2520717_-	AAA domain-containing protein	NA	NA	NA	NA	NA
WP_097789713.1|2520750_2521272_-	hypothetical protein	NA	NA	NA	NA	NA
WP_097789714.1|2521268_2522318_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_097789715.1|2522311_2523034_-	hypothetical protein	NA	NA	NA	NA	NA
WP_097789716.1|2523196_2525989_-	AAA family ATPase	NA	A0A1B1IUG5	uncultured_Mediterranean_phage	22.6	1.2e-16
WP_097789717.1|2526000_2528898_-	DUF1156 domain-containing protein	NA	K9MDJ7	Sulfolobus_virus	24.7	6.8e-23
WP_097789718.1|2528906_2532458_-	DUF3883 domain-containing protein	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	27.7	1.2e-53
WP_097791070.1|2532483_2533305_-	WYL domain-containing protein	NA	NA	NA	NA	NA
WP_097789719.1|2533530_2534865_-	inovirus-type Gp2 protein	NA	NA	NA	NA	NA
WP_153045789.1|2535197_2536001_+	hypothetical protein	NA	NA	NA	NA	NA
WP_097789720.1|2536026_2536227_-	AlpA family phage regulatory protein	NA	A0A1V0E8E5	Vibrio_phage	40.7	1.7e-05
WP_097789721.1|2536721_2537519_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	44.2	4.4e-57
WP_153045790.1|2539366_2541004_+	hypothetical protein	NA	NA	NA	NA	NA
WP_097789723.1|2542417_2543386_+	DUF932 domain-containing protein	NA	A0A0H4INH5	Stenotrophomonas_phage	43.0	4.2e-62
WP_097789724.1|2543678_2544416_+	single-stranded DNA-binding protein	NA	Q9MC70	Pseudomonas_phage	59.5	3.2e-62
WP_097789725.1|2544476_2545088_+	exonuclease	NA	A0A1B0VMB3	Pseudomonas_phage	69.8	1.3e-77
WP_097789726.1|2545099_2545597_+	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_097789727.1|2545824_2549127_-	DEAD/DEAH box helicase family protein	NA	Q77PS5	Streptococcus_phage	21.9	1.7e-06
WP_097789728.1|2549343_2550561_-	hypothetical protein	NA	NA	NA	NA	NA
WP_097789729.1|2551286_2551790_-	thioesterase	NA	NA	NA	NA	NA
WP_097789730.1|2551792_2552353_-	nitroreductase	NA	NA	NA	NA	NA
WP_097789731.1|2552414_2553251_-	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A2I7SAX1	Vibrio_phage	36.4	1.8e-40
WP_097789732.1|2553254_2554028_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_097789733.1|2554024_2554966_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	27.1	1.1e-17
WP_097789734.1|2556281_2556683_+	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_097789735.1|2556760_2557720_+	ribosome biogenesis GTPase YlqF	NA	NA	NA	NA	NA
WP_097789736.1|2557778_2559008_+	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_097789737.1|2559122_2560022_+|protease	protease HtpX	protease	NA	NA	NA	NA
2565070:2565086	attR	GCTCATGATGGTGGCGG	NA	NA	NA	NA
>prophage 5
NZ_CP021435	Halomonas beimenensis strain NTU-111 chromosome, complete genome	4053030	3343417	3354361	4053030	tRNA	Klosneuvirus(16.67%)	8	NA	NA
WP_097790374.1|3343417_3346024_-|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	38.2	1.5e-77
WP_097790375.1|3346153_3346615_-	regulatory protein RecX	NA	NA	NA	NA	NA
WP_097790376.1|3346618_3347677_-	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	61.6	6.8e-114
WP_097790377.1|3347824_3348322_-	CinA family protein	NA	B5TK85	Pseudomonas_phage	59.7	7.7e-36
WP_097790378.1|3348589_3351169_+	DNA mismatch repair protein MutS	NA	A0A1V0SC35	Catovirus	21.7	5.3e-27
WP_097790379.1|3351316_3351640_+	ferredoxin family protein	NA	NA	NA	NA	NA
WP_097790380.1|3352122_3353415_-	phosphopyruvate hydratase	NA	W6LP63	Streptococcus_phage	60.0	1.0e-135
WP_097790381.1|3353509_3354361_-	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	42.4	9.4e-50
