The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP023729	Bacillus licheniformis strain ATCC 9789 chromosome, complete genome	4260287	694266	704190	4260287		Synechococcus_phage(50.0%)	9	NA	NA
WP_003179530.1|694266_695562_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	27.1	5.9e-19
WP_003179531.1|695636_696353_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3G7P8	Synechococcus_phage	42.4	2.4e-46
WP_003179532.1|696354_696609_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	M4QPE7	Synechococcus_phage	33.3	8.0e-05
WP_003179533.1|696605_697289_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_003179534.1|697272_699501_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	41.5	4.2e-158
WP_003179536.1|699476_700907_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	32.9	4.5e-52
WP_011197613.1|701030_702071_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	46.3	2.7e-62
WP_003179538.1|702067_702655_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	41.1	1.4e-28
WP_003179539.1|702651_704190_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	52.0	4.3e-77
>prophage 2
NZ_CP023729	Bacillus licheniformis strain ATCC 9789 chromosome, complete genome	4260287	737084	748938	4260287		Streptococcus_phage(42.86%)	9	NA	NA
WP_009329129.1|737084_740243_+	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	24.3	9.5e-71
WP_009329128.1|740389_740590_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009329127.1|740679_741222_-	GNAT family N-acetyltransferase	NA	D0R097	Streptococcus_phage	26.0	3.9e-09
WP_009329126.1|741235_742189_-	nucleoside hydrolase	NA	NA	NA	NA	NA
WP_003179624.1|742388_743303_+	diacylglycerol kinase	NA	A0A1V0SBJ0	Catovirus	31.3	2.3e-25
WP_061578655.1|743351_744746_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	48.8	6.8e-122
WP_064505134.1|744908_746012_-	DNA (cytosine-5-)-methyltransferase	NA	M1PSQ0	Streptococcus_phage	26.3	1.5e-26
WP_095240262.1|746075_747134_-	DNA cytosine methyltransferase	NA	A0A191SB20	Nostoc_phage	29.9	1.1e-28
WP_095324297.1|747396_748938_+	AAA family ATPase	NA	M1NSM1	Streptococcus_phage	33.7	2.9e-49
>prophage 3
NZ_CP023729	Bacillus licheniformis strain ATCC 9789 chromosome, complete genome	4260287	1284342	1355357	4260287	capsid,portal,tail,terminase,holin,coat,plate	Bacillus_phage(28.95%)	85	NA	NA
WP_009328811.1|1284342_1284792_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_011197778.1|1284942_1285431_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_009328809.1|1285562_1286075_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_009328808.1|1286145_1286544_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009328807.1|1286592_1286979_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_011197779.1|1287125_1287482_+	DUF1360 domain-containing protein	NA	NA	NA	NA	NA
WP_009328806.1|1287768_1287978_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011197781.1|1288057_1288189_+	YjcZ family sporulation protein	NA	NA	NA	NA	NA
WP_009328805.1|1288318_1288576_+	stage VI sporulation protein F	NA	NA	NA	NA	NA
WP_011197782.1|1288614_1290897_-	ATP-dependent helicase	NA	A0A068EQC7	Bacillus_phage	35.6	1.0e-90
WP_016885900.1|1291018_1291276_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009328801.1|1291315_1291903_-	DedA family protein	NA	NA	NA	NA	NA
WP_011197784.1|1291998_1292985_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	38.4	1.6e-53
WP_161620988.1|1292981_1293878_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	55.6	1.2e-84
WP_061578468.1|1293894_1294275_-	GtrA family protein	NA	NA	NA	NA	NA
WP_009328797.1|1294455_1294875_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_009328796.1|1294884_1295394_-	2'-5' RNA ligase family protein	NA	NA	NA	NA	NA
WP_009328793.1|1295458_1296181_-	esterase family protein	NA	NA	NA	NA	NA
WP_011197787.1|1296697_1297186_-	DinB family protein	NA	NA	NA	NA	NA
WP_009328787.1|1297266_1298214_-	YafY family transcriptional regulator	NA	NA	NA	NA	NA
WP_061578466.1|1298522_1299647_+	methionine biosynthesis PLP-dependent protein	NA	A0A0B5JD48	Pandoravirus	25.6	5.3e-16
WP_009328782.1|1299636_1300812_+	cystathionine beta-lyase	NA	A0A0B5JD48	Pandoravirus	29.3	6.7e-22
WP_011197789.1|1300857_1302048_-	DUF819 domain-containing protein	NA	NA	NA	NA	NA
WP_011197790.1|1302221_1302791_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_009328774.1|1302780_1303065_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021837286.1|1304917_1305904_-	glycoside hydrolase family 43 protein	NA	NA	NA	NA	NA
WP_011197793.1|1307028_1307208_+	hypothetical protein	NA	NA	NA	NA	NA
WP_097366381.1|1307242_1307821_+	acetyltransferase	NA	NA	NA	NA	NA
WP_035333938.1|1307912_1308200_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003180759.1|1308407_1309298_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_061578464.1|1309618_1311448_+	assimilatory sulfite reductase (NADPH) flavoprotein subunit	NA	NA	NA	NA	NA
WP_061578463.1|1311475_1313194_+	assimilatory sulfite reductase (NADPH) hemoprotein subunit	NA	NA	NA	NA	NA
WP_003180765.1|1313251_1314139_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_009328760.1|1314230_1315103_+	DMT family transporter	NA	NA	NA	NA	NA
WP_097366382.1|1315150_1315528_+	VOC family protein	NA	NA	NA	NA	NA
WP_009328757.1|1315571_1316120_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061578462.1|1316572_1317307_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A217ER34	Bacillus_phage	60.8	4.2e-30
WP_011197798.1|1317362_1318787_-	DHA2 family efflux MFS transporter permease subunit	NA	A0A0M3UL24	Mycobacterium_phage	24.6	5.1e-16
WP_003180775.1|1318802_1319381_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003180778.1|1319393_1319729_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003180779.1|1319757_1320171_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003180781.1|1320526_1321009_-	DUF600 family protein	NA	NA	NA	NA	NA
WP_061578461.1|1321012_1323061_-	DNA/RNA non-specific endonuclease	NA	O64023	Bacillus_phage	25.0	4.3e-24
WP_009328749.1|1323281_1323929_+	poly-gamma-glutamate hydrolase family protein	NA	A0A0Y0AJU6	Bacillus_phage	47.5	3.1e-45
WP_003180785.1|1323942_1324599_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A2H4JA43	uncultured_Caudovirales_phage	49.7	4.0e-40
WP_003180787.1|1324787_1325141_-	helix-turn-helix transcriptional regulator	NA	A0A2H4J6F9	uncultured_Caudovirales_phage	49.6	2.7e-19
WP_021837294.1|1325313_1325574_+	helix-turn-helix transcriptional regulator	NA	S5MA07	Brevibacillus_phage	41.2	2.3e-07
WP_003180790.1|1325563_1325860_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003180792.1|1325860_1326691_+	hypothetical protein	NA	S6BFM4	Thermus_phage	31.0	1.3e-27
WP_011197802.1|1326590_1327391_+	ATP-binding protein	NA	A6XMI1	Bacillus_virus	48.1	3.6e-59
WP_003180796.1|1327390_1327561_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009328744.1|1327661_1328003_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003180800.1|1327999_1328203_+	hypothetical protein	NA	A0A2H4J4M6	uncultured_Caudovirales_phage	54.7	1.9e-12
WP_003180803.1|1328323_1328827_+	sigma-70 family RNA polymerase sigma factor	NA	A0A0K2CNQ1	Brevibacillus_phage	38.7	1.4e-21
WP_003180804.1|1328969_1329770_+|terminase	terminase small subunit	terminase	A0A0S2MVB6	Bacillus_phage	51.4	5.7e-65
WP_009328741.1|1329766_1331065_+|terminase	PBSX family phage terminase large subunit	terminase	M4ZRM5	Bacillus_phage	60.2	7.2e-150
WP_003180808.1|1331068_1332583_+|portal	phage portal protein	portal	A0A1B1P7C8	Bacillus_phage	55.5	3.4e-143
WP_009328740.1|1332590_1333439_+|portal	phage portal protein	portal	A0A1B1P7E4	Bacillus_phage	62.8	2.1e-57
WP_009328739.1|1333456_1334392_+|capsid	phage major capsid protein	capsid	A0A1B1P7E3	Bacillus_phage	64.1	1.1e-102
WP_003180816.1|1334485_1334860_+	DUF3199 family protein	NA	NA	NA	NA	NA
WP_003180819.1|1334856_1335213_+	YqbH/XkdH family protein	NA	NA	NA	NA	NA
WP_003180822.1|1335209_1335698_+	HK97 gp10 family phage protein	NA	A0A249XXA4	Clostridium_phage	44.6	1.9e-34
WP_003180824.1|1335710_1336151_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003180826.1|1336151_1336376_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003180828.1|1336375_1337722_+|tail	phage tail sheath subtilisin-like domain-containing protein	tail	S5MNC1	Brevibacillus_phage	40.2	2.6e-78
WP_003180830.1|1337723_1338167_+|tail	phage tail tube protein	tail	A0A0K2CNG3	Brevibacillus_phage	44.7	2.1e-24
WP_003180832.1|1338349_1338799_+|portal	phage portal protein	portal	A0A0A7RTY8	Clostridium_phage	38.7	4.1e-12
WP_003180833.1|1338840_1338978_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061578460.1|1338981_1342764_+	transglycosylase SLT domain-containing protein	NA	A0A1L2JY60	Aeribacillus_phage	45.3	1.7e-42
WP_003180838.1|1342756_1343413_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A090DBR9	Clostridium_phage	32.6	4.0e-24
WP_009328734.1|1343469_1344450_+	hypothetical protein	NA	H7BV96	unidentified_phage	32.3	9.2e-41
WP_003180843.1|1344446_1344755_+	DUF2577 domain-containing protein	NA	S6C459	Thermus_phage	37.3	1.0e-06
WP_003180844.1|1344773_1345199_+	DUF2634 domain-containing protein	NA	A0A2H4J6K5	uncultured_Caudovirales_phage	39.0	5.4e-14
WP_003180847.1|1345191_1346235_+|plate	baseplate J/gp47 family protein	plate	S6AVU3	Thermus_phage	44.3	9.7e-73
WP_009328731.1|1346221_1347142_+	YmfQ family protein	NA	A0A0A7RTT8	Clostridium_phage	28.3	5.0e-12
WP_003180850.1|1347155_1347542_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_003180851.1|1347557_1348763_+	hypothetical protein	NA	A0A2H4J4R1	uncultured_Caudovirales_phage	48.3	9.3e-27
WP_003180853.1|1348800_1349832_+	hypothetical protein	NA	A0A1P8CWR7	Bacillus_phage	48.2	1.0e-18
WP_003180856.1|1349934_1350204_+	hemolysin XhlA family protein	NA	A0A2H4JD40	uncultured_Caudovirales_phage	64.0	1.6e-24
WP_003180859.1|1350218_1350482_+|holin	phage holin	holin	A0A2H4J6M0	uncultured_Caudovirales_phage	67.8	5.3e-28
WP_009328730.1|1350532_1351597_+	N-acetylmuramoyl-L-alanine amidase	NA	S6BFI4	Thermus_phage	50.8	2.0e-44
WP_003180863.1|1351698_1352376_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003180865.1|1352398_1353415_+	zinc-binding alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_003180867.1|1353435_1354533_+	mannonate dehydratase	NA	NA	NA	NA	NA
WP_009328728.1|1354508_1355357_+	SDR family oxidoreductase	NA	M1NMS3	Moumouvirus	33.3	5.6e-10
>prophage 4
NZ_CP023729	Bacillus licheniformis strain ATCC 9789 chromosome, complete genome	4260287	1429155	1483993	4260287	protease,portal,head,tail,terminase,integrase,holin,coat,transposase	Bacillus_phage(32.5%)	78	1422924:1422939	1478360:1478375
1422924:1422939	attL	TTTTTCAAGCGCTTCA	NA	NA	NA	NA
WP_016885874.1|1429155_1430295_-|integrase	site-specific integrase	integrase	S6C485	Thermus_phage	40.5	4.6e-68
WP_016885873.1|1430325_1430805_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A2H4JA43	uncultured_Caudovirales_phage	41.9	2.3e-29
WP_025805709.1|1430917_1431568_-	DUF4352 domain-containing protein	NA	A0A2H4PQN2	Staphylococcus_phage	48.9	1.7e-30
WP_016885871.1|1431647_1431914_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025805711.1|1431970_1432336_-	helix-turn-helix transcriptional regulator	NA	A0A0B5CYL9	Listeria_phage	36.2	2.6e-12
WP_016885869.1|1432499_1432742_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_011197842.1|1432754_1433081_+	hypothetical protein	NA	S6C476	Thermus_phage	53.2	2.8e-18
WP_016885868.1|1433081_1433855_+	phage antirepressor Ant	NA	A0A290FZK7	Caldibacillus_phage	72.6	4.6e-104
WP_016885866.1|1433929_1434448_+	transcriptional regulator	NA	A0A290FZK9	Caldibacillus_phage	47.6	1.8e-35
WP_061578453.1|1434444_1434711_+	hypothetical protein	NA	Q9ZXC9	Bacillus_phage	52.3	3.7e-21
WP_061578452.1|1434853_1435375_+	HNH endonuclease	NA	A0A220GJG3	Streptococcus_phage	36.5	1.8e-11
WP_061578451.1|1435625_1436210_+	host-nuclease inhibitor Gam family protein	NA	A0A0S2SXP9	Bacillus_phage	46.9	1.8e-15
WP_061578450.1|1436209_1436842_+	ERF family protein	NA	A0A1J0MFT8	Staphylococcus_phage	32.3	1.7e-27
WP_016885859.1|1436866_1437004_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016885858.1|1437019_1437160_+	hypothetical protein	NA	A0A2H4JCE7	uncultured_Caudovirales_phage	64.4	5.3e-11
WP_016885857.1|1437191_1437425_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054287410.1|1438194_1439019_+	ATP-binding protein	NA	A6XMI1	Bacillus_virus	49.6	2.5e-63
WP_009328666.1|1439102_1439306_+	hypothetical protein	NA	A0A2H4J4M6	uncultured_Caudovirales_phage	57.6	1.3e-13
WP_162840066.1|1439320_1439485_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061578449.1|1439484_1439703_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095240189.1|1439776_1439986_+	IDEAL domain-containing protein	NA	NA	NA	NA	NA
WP_157769125.1|1439982_1440159_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061578447.1|1440333_1440789_+	hypothetical protein	NA	A0A0A7RWK2	Clostridium_phage	34.8	4.3e-09
WP_009328659.1|1440785_1441208_+	RusA family crossover junction endodeoxyribonuclease	NA	M4ZS69	Bacillus_phage	56.5	2.5e-35
WP_009328658.1|1441186_1441393_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009328657.1|1441450_1441666_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011197858.1|1441655_1441931_+	single-stranded DNA-binding protein	NA	A0A290GHL8	Caldibacillus_phage	66.1	4.4e-17
WP_011197859.1|1442096_1442414_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011197860.1|1442446_1442884_+	hypothetical protein	NA	A0A2H4J8A0	uncultured_Caudovirales_phage	75.0	1.3e-55
WP_016885836.1|1442919_1443336_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016885834.1|1443554_1444088_+	HNH endonuclease	NA	A0A2P1JTY0	Anoxybacillus_phage	60.3	7.7e-58
WP_016885833.1|1444080_1444527_+	hypothetical protein	NA	A0A1D6Z235	Staphylococcus_phage	35.6	1.1e-12
WP_107026739.1|1444865_1445015_-	KTSC domain-containing protein	NA	NA	NA	NA	NA
WP_016885832.1|1445603_1445828_+|coat	spore coat protein	coat	NA	NA	NA	NA
WP_029327027.1|1446143_1446686_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016885829.1|1447243_1448062_+|terminase	terminase small subunit	terminase	Q5YA77	Bacillus_phage	64.7	1.6e-78
WP_044790075.1|1448048_1449314_+|terminase	PBSX family phage terminase large subunit	terminase	S5MC58	Brevibacillus_phage	73.2	3.8e-180
WP_100224394.1|1449344_1450817_+|portal	phage portal protein	portal	A0A1Q1PVT0	Bacillus_phage	51.8	2.8e-134
WP_016885826.1|1450803_1451718_+|head	head protein	head	A0A1Q1PVS0	Bacillus_phage	54.8	1.1e-91
WP_016885825.1|1451719_1452043_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016885823.1|1452496_1453153_+	phage scaffolding protein	NA	A0A1Z1LZK8	Bacillus_phage	37.6	2.0e-15
WP_016885822.1|1453168_1454137_+	hypothetical protein	NA	D2J006	Enterococcus_phage	36.5	4.5e-48
WP_016885820.1|1454401_1454569_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025807718.1|1454631_1454940_+|head,tail	phage head-tail connector protein	head,tail	A0A1W6JQJ1	Staphylococcus_phage	39.8	7.9e-15
WP_016885818.1|1454939_1455281_+|head	phage head closure protein	head	NA	NA	NA	NA
WP_016885817.1|1455280_1455685_+	HK97 gp10 family phage protein	NA	O48447	Bacillus_phage	62.5	3.2e-40
WP_009328634.1|1455681_1456095_+	DUF3168 domain-containing protein	NA	A0A0C5AEH4	Paenibacillus_phage	39.3	5.5e-11
WP_011197876.1|1456107_1456653_+|tail	phage major tail protein, TP901-1 family	tail	Q597U9	Lactobacillus_virus	30.9	3.6e-18
WP_016885816.1|1456576_1456915_+	fibronectin type III domain-containing protein	NA	R4JF61	Bacillus_phage	71.1	2.2e-26
WP_011197878.1|1456983_1457481_+	hypothetical protein	NA	O48453	Bacillus_phage	30.3	1.3e-06
WP_011197879.1|1457609_1457840_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011197880.1|1457844_1460907_+	hypothetical protein	NA	Q4ZC60	Staphylococcus_virus	28.8	5.3e-50
WP_011197881.1|1460903_1461707_+|tail	phage tail family protein	tail	NA	NA	NA	NA
WP_016885814.1|1465063_1465459_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016885813.1|1465445_1465595_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016885812.1|1465609_1465780_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016885811.1|1465793_1466090_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009328626.1|1466152_1466422_+	hemolysin XhlA family protein	NA	A0A2H4JD40	uncultured_Caudovirales_phage	58.4	3.8e-21
WP_009328625.1|1466437_1466701_+|holin	phage holin	holin	A0A2H4J6M0	uncultured_Caudovirales_phage	75.9	3.6e-32
WP_029327025.1|1466758_1467643_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A142F1B8	Bacillus_phage	49.0	4.9e-57
WP_009328623.1|1467676_1468012_-	hypothetical protein	NA	NA	NA	NA	NA
WP_097366384.1|1468037_1469552_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_061578444.1|1469815_1470529_+	DUF3800 domain-containing protein	NA	Q71TB8	Escherichia_phage	47.2	6.7e-57
WP_061578443.1|1470531_1471158_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003181020.1|1471652_1471985_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003181024.1|1472177_1472333_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003181025.1|1472439_1472619_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003181027.1|1472792_1473254_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003181029.1|1473259_1475110_-	DNA ligase D	NA	NA	NA	NA	NA
WP_003181033.1|1475113_1475986_-	Ku protein	NA	A0A218M9C0	Mycobacterium_phage	34.4	1.3e-38
WP_061578442.1|1476139_1477792_-	diguanylate cyclase	NA	NA	NA	NA	NA
WP_003181037.1|1478081_1478723_+	DedA family protein	NA	NA	NA	NA	NA
1478360:1478375	attR	TGAAGCGCTTGAAAAA	NA	NA	NA	NA
WP_003181039.1|1478994_1479762_+	TerC family protein	NA	A0A068EP98	Bacillus_phage	43.4	5.2e-31
WP_009328616.1|1480054_1480810_+	RNA polymerase sigma factor SigI	NA	NA	NA	NA	NA
WP_003181042.1|1480806_1481898_+	anti-sigma factor domain-containing protein	NA	NA	NA	NA	NA
WP_003181044.1|1481910_1482108_-	alpha/beta-type small acid-soluble spore protein	NA	A0A1P8CX76	Bacillus_phage	62.1	2.3e-12
WP_003181046.1|1482238_1482958_-	DUF1836 domain-containing protein	NA	NA	NA	NA	NA
WP_003181048.1|1483099_1483993_+|protease	protease HtpX	protease	NA	NA	NA	NA
>prophage 5
NZ_CP023729	Bacillus licheniformis strain ATCC 9789 chromosome, complete genome	4260287	2385333	2397513	4260287		Staphylococcus_phage(55.56%)	15	NA	NA
WP_003183104.1|2385333_2385927_-	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	37.6	3.4e-14
WP_009327962.1|2385916_2386672_-	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	23.6	1.4e-07
WP_003183108.1|2386854_2386950_+	YjcZ family sporulation protein	NA	NA	NA	NA	NA
WP_003183111.1|2387070_2387592_+	DUF309 domain-containing protein	NA	NA	NA	NA	NA
WP_003183113.1|2387602_2387977_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003183115.1|2388078_2388543_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	70.7	1.7e-45
WP_003183117.1|2388577_2389774_-	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	53.9	2.1e-116
WP_017473932.1|2389795_2390443_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	41.5	5.7e-39
WP_017473931.1|2390454_2391543_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	37.8	6.6e-64
WP_003183123.1|2391903_2392248_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011198084.1|2392510_2394697_-	metallophosphoesterase	NA	A0A220BYT7	Staphylococcus_phage	41.3	1.4e-150
WP_003183127.1|2394823_2395261_-	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
WP_003183128.1|2395419_2395725_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009327959.1|2395714_2396845_-	tetratricopeptide repeat protein	NA	A0A1P8CWN8	Bacillus_phage	43.3	1.4e-77
WP_003183133.1|2397075_2397513_-	peptidylprolyl isomerase	NA	A0A2H4UTF4	Bodo_saltans_virus	44.6	5.4e-17
>prophage 6
NZ_CP023729	Bacillus licheniformis strain ATCC 9789 chromosome, complete genome	4260287	2791040	2887728	4260287	capsid,protease,portal,tail,head,plate,terminase,holin,coat,tRNA,transposase	Bacillus_phage(66.67%)	106	NA	NA
WP_003183980.1|2791040_2792186_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	43.2	5.5e-85
WP_061578550.1|2792214_2793243_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_003183984.1|2793283_2793484_-	DUF2905 domain-containing protein	NA	NA	NA	NA	NA
WP_003183985.1|2793476_2794481_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	30.3	1.2e-06
WP_061578551.1|2794490_2795096_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_003183987.1|2795218_2795740_-	BofC C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_003183988.1|2795982_2796633_+	serine/threonine protein kinase	NA	NA	NA	NA	NA
WP_003183990.1|2796910_2797090_-	small acid-soluble spore protein H	NA	NA	NA	NA	NA
WP_003183991.1|2797185_2797650_-	DinB family protein	NA	NA	NA	NA	NA
WP_003183992.1|2797710_2798421_-	poly-gamma-glutamate hydrolase family protein	NA	F8WQ53	Bacillus_phage	55.9	3.0e-49
WP_003183993.1|2798834_2799014_+	hypothetical protein	NA	A0A1P8CWV7	Bacillus_phage	76.3	1.5e-21
WP_061578552.1|2799105_2799432_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003183995.1|2799573_2800296_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_080626953.1|2800422_2801058_-	YhcN/YlaJ family sporulation lipoprotein	NA	NA	NA	NA	NA
WP_003184005.1|2801230_2802283_-|coat	SafA/ExsA family spore coat assembly protein	coat	NA	NA	NA	NA
WP_003184007.1|2802398_2803508_-	quinolinate synthase NadA	NA	NA	NA	NA	NA
WP_009327769.1|2803529_2804369_-	carboxylating nicotinate-nucleotide diphosphorylase	NA	NA	NA	NA	NA
WP_003184010.1|2804349_2805924_-	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_009327768.1|2806024_2807203_+	IscS subfamily cysteine desulfurase	NA	A0A1X7QGF3	Faustovirus	25.3	1.2e-31
WP_003184015.1|2807171_2807714_+	transcription repressor NadR	NA	NA	NA	NA	NA
WP_025805050.1|2807757_2808609_-	prephenate dehydratase	NA	NA	NA	NA	NA
WP_003184018.1|2808635_2809079_-	ACT domain-containing protein	NA	NA	NA	NA	NA
WP_003184021.1|2809192_2810479_-	GTPase ObgE	NA	NA	NA	NA	NA
WP_003184022.1|2810511_2811090_-	Spo0B domain-containing protein	NA	NA	NA	NA	NA
WP_003184023.1|2811315_2811597_-	50S ribosomal protein L27	NA	NA	NA	NA	NA
WP_003184025.1|2811609_2811951_-|protease	ribosomal-processing cysteine protease Prp	protease	NA	NA	NA	NA
WP_003184027.1|2811963_2812272_-	50S ribosomal protein L21	NA	NA	NA	NA	NA
WP_003184028.1|2812428_2813295_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_003184030.1|2813287_2814079_-	M23 family metallopeptidase	NA	NA	NA	NA	NA
WP_003184032.1|2814224_2814653_+	SRPBCC domain-containing protein	NA	NA	NA	NA	NA
WP_061578553.1|2814652_2814973_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003184035.1|2815017_2815824_-	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_011198163.1|2815826_2816507_-	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_003184039.1|2816561_2817080_-	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_003184040.1|2817076_2817985_-	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_097366406.1|2818015_2819026_-	rod shape-determining protein	NA	NA	NA	NA	NA
WP_009327765.1|2819625_2820438_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081112712.1|2820527_2820896_+	YolD-like family protein	NA	O64030	Bacillus_phage	40.4	2.7e-17
WP_035338316.1|2821118_2822240_-	tetratricopeptide repeat protein	NA	A0A1P8CWN8	Bacillus_phage	35.1	2.4e-53
WP_097366407.1|2822495_2824013_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017474559.1|2824042_2824381_+	hypothetical protein	NA	NA	NA	NA	NA
WP_097366468.1|2826020_2826413_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_097366408.1|2826394_2826871_+	DUF2202 domain-containing protein	NA	NA	NA	NA	NA
WP_003185315.1|2827026_2827620_+	cupin domain-containing protein	NA	Q2I8C5	Bacillus_phage	67.6	6.4e-53
WP_097366409.1|2827740_2828694_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A141HSE6	Bacillus_phage	41.7	2.5e-59
WP_097366410.1|2828741_2829005_-|holin	phage holin	holin	A0A2H4J6M0	uncultured_Caudovirales_phage	75.9	3.9e-31
WP_003185322.1|2829020_2829290_-	hemolysin XhlA family protein	NA	A0A2H4JD40	uncultured_Caudovirales_phage	62.9	4.3e-25
WP_097366411.1|2829352_2829535_-	XkdX family protein	NA	A0EWM9	Staphylococcus_virus	45.8	4.0e-06
WP_097366412.1|2829531_2829855_-	hypothetical protein	NA	M4ZR44	Bacillus_phage	45.4	1.3e-12
WP_061578557.1|2829867_2831217_-|plate	phage baseplate upper protein	plate	D6R402	Bacillus_phage	42.1	1.5e-65
WP_075213875.1|2831230_2833876_-	peptidase G2	NA	D6R401	Bacillus_phage	56.8	2.0e-292
WP_097366413.1|2833912_2835625_-|tail	phage tail protein	tail	D6R400	Bacillus_phage	68.4	6.2e-226
WP_097366414.1|2835637_2836474_-|tail	phage tail family protein	tail	D6R3Z9	Bacillus_phage	69.0	3.2e-111
WP_097366415.1|2836473_2840943_-|tail	phage tail tape measure protein	tail	A6M961	Geobacillus_virus	41.5	2.5e-69
WP_097366416.1|2841151_2841514_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043054228.1|2841567_2842185_-|tail	tail protein	tail	NA	NA	NA	NA
WP_075621838.1|2842199_2842583_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075752646.1|2842579_2842978_-	HK97 gp10 family phage protein	NA	NA	NA	NA	NA
WP_075752648.1|2842977_2843286_-|head	phage head closure protein	head	A0A2H4JCB1	uncultured_Caudovirales_phage	38.6	2.8e-12
WP_097366417.1|2843275_2843578_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0S2GLH6	Bacillus_phage	46.3	9.5e-13
WP_075752652.1|2843598_2844024_-	collagen-like protein	NA	D6R3Z0	Bacillus_phage	59.1	1.7e-07
WP_097366418.1|2844047_2845328_-|capsid	phage major capsid protein	capsid	Q2I8F7	Bacillus_phage	43.3	4.4e-75
WP_097366419.1|2845368_2846100_-|protease	Clp protease ClpP	protease	A0A2I7SCY8	Paenibacillus_phage	56.9	1.8e-57
WP_097366420.1|2846044_2847355_-|portal	phage portal protein	portal	D6R3Y6	Bacillus_phage	46.1	1.2e-104
WP_003185361.1|2847355_2847547_-	DUF1056 family protein	NA	NA	NA	NA	NA
WP_003185362.1|2847558_2849268_-|terminase	terminase large subunit	terminase	A0A0S2GLF0	Bacillus_phage	62.0	2.7e-205
WP_097366421.1|2849264_2849780_-|terminase	phage terminase small subunit P27 family	terminase	A6M947	Geobacillus_virus	45.8	9.8e-34
WP_097366422.1|2850008_2850383_-	HNH endonuclease	NA	A0A1U7Q1S7	Geobacillus_virus	51.7	4.0e-29
WP_097366423.1|2850409_2850718_-	hypothetical protein	NA	NA	NA	NA	NA
WP_097366424.1|2850940_2851951_-	DUF4433 domain-containing protein	NA	NA	NA	NA	NA
WP_097366425.1|2851925_2852885_-	macro domain-containing protein	NA	A0A0B4N0V6	Escherichia_phage	48.6	5.9e-32
WP_003185369.1|2853429_2853810_-	ArpU family transcriptional regulator	NA	Q9ZXB9	Bacillus_phage	83.7	3.0e-48
WP_097366426.1|2854100_2854271_-	Fur-regulated basic protein FbpA	NA	A0A0S2SXY0	Bacillus_phage	54.7	7.4e-07
WP_061578362.1|2854267_2854807_-	ERCC4 domain-containing protein	NA	Q9ZXC2	Bacillus_phage	89.9	2.9e-89
WP_097366427.1|2854803_2855241_-	hypothetical protein	NA	Q9ZXC3	Bacillus_phage	75.9	7.2e-62
WP_097366428.1|2855218_2855482_-	hypothetical protein	NA	NA	NA	NA	NA
WP_097366429.1|2855758_2858191_-	DNA primase	NA	D6R422	Bacillus_phage	80.1	0.0e+00
WP_095266839.1|2858251_2858689_-	DUF669 domain-containing protein	NA	Q9ZXC5	Bacillus_phage	89.7	4.1e-73
WP_097366430.1|2858688_2859621_-	AAA family ATPase	NA	Q9ZXC7	Bacillus_phage	87.1	2.7e-151
WP_088272689.1|2859624_2860182_-	host-nuclease inhibitor Gam family protein	NA	Q9ZXC8	Bacillus_phage	70.8	8.3e-71
WP_061578421.1|2860383_2860650_-	hypothetical protein	NA	Q9ZXC9	Bacillus_phage	53.5	1.3e-18
WP_009329273.1|2860646_2860838_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009329275.1|2860988_2861228_-	helix-turn-helix transcriptional regulator	NA	D6R414	Bacillus_phage	62.0	1.1e-16
WP_009329277.1|2861475_2861919_+	helix-turn-helix transcriptional regulator	NA	Q786F1	Bacillus_phage	63.3	6.4e-42
WP_106070692.1|2862024_2862432_+	ImmA/IrrE family metallo-endopeptidase	NA	Q9T201	Bacillus_phage	59.7	1.1e-35
WP_009329281.1|2862471_2863860_+	recombinase family protein	NA	Q9T200	Bacillus_phage	60.6	2.0e-158
WP_009329283.1|2863872_2864259_-	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_003184048.1|2864313_2864886_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_097366431.1|2865039_2866071_-	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_003184052.1|2866274_2867024_-	prepilin peptidase	NA	NA	NA	NA	NA
WP_003184054.1|2867166_2868471_-	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_003184055.1|2868546_2871189_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0S951	Catovirus	42.3	2.8e-161
WP_003184058.1|2871650_2871842_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016885545.1|2871861_2872884_-|coat	spore coat protein YsxE	coat	NA	NA	NA	NA
WP_063906779.1|2872911_2874369_-	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_009329296.1|2874517_2875813_-	glutamate-1-semialdehyde 2,1-aminomutase	NA	NA	NA	NA	NA
WP_003184063.1|2875838_2876813_-	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_061578420.1|2876816_2877608_-	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
WP_003184068.1|2877597_2878539_-	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
WP_003184070.1|2878578_2879409_-	cytochrome c biogenesis protein CcsA	NA	NA	NA	NA	NA
WP_017474375.1|2879414_2880776_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_003184074.1|2880964_2881450_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003184076.1|2881497_2882085_-	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_016885551.1|2882081_2884406_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	45.2	1.0e-186
WP_003184080.1|2884624_2886280_-|protease	ATP-dependent protease LonB	protease	A0A0R6PGP8	Moraxella_phage	35.7	1.4e-17
WP_003184083.1|2886462_2887728_-|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	63.5	7.2e-147
>prophage 7
NZ_CP023729	Bacillus licheniformis strain ATCC 9789 chromosome, complete genome	4260287	3227913	3266066	4260287	capsid,protease,portal,tail,head,terminase,integrase,holin,coat,plate	Bacillus_phage(85.71%)	54	3226910:3226969	3266160:3266235
3226910:3226969	attL	CAAACGCTTCTCAAGCTCTGCTTTTTTCTCTTCGAAGCCAGGCTTGCCGAGAAGGGCGAA	NA	NA	NA	NA
WP_172911540.1|3227913_3228282_+	YolD-like family protein	NA	A0A2H4JAP8	uncultured_Caudovirales_phage	40.0	3.1e-18
WP_011198296.1|3228305_3228536_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_021837703.1|3228790_3228934_-	hypothetical protein	NA	NA	NA	NA	NA
WP_097366439.1|3229086_3230196_+	DUF4917 family protein	NA	NA	NA	NA	NA
WP_157769126.1|3230296_3230443_-	hypothetical protein	NA	NA	NA	NA	NA
WP_097366440.1|3230450_3231293_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1P8CWN6	Bacillus_phage	53.3	2.2e-46
WP_057957865.1|3231344_3231608_-|holin	phage holin	holin	A0A2H4J6M0	uncultured_Caudovirales_phage	75.9	1.8e-31
WP_071583811.1|3231623_3231893_-	hemolysin XhlA family protein	NA	A0A2H4JD40	uncultured_Caudovirales_phage	62.9	3.3e-25
WP_097366441.1|3231968_3232139_-	XkdX family protein	NA	NA	NA	NA	NA
WP_097366442.1|3232135_3232435_-	hypothetical protein	NA	M4ZR44	Bacillus_phage	76.0	1.1e-37
WP_097366469.1|3232450_3233638_-|plate	BppU family phage baseplate upper protein	plate	M4ZRP1	Bacillus_phage	73.2	7.7e-159
WP_073358672.1|3233694_3234249_-	hypothetical protein	NA	NA	NA	NA	NA
WP_097366443.1|3235775_3237482_-|tail	phage tail protein	tail	D6R400	Bacillus_phage	69.1	4.0e-217
WP_017475032.1|3237494_3238331_-|tail	phage tail family protein	tail	D6R3Z9	Bacillus_phage	72.2	1.4e-114
WP_017475033.1|3238330_3242221_-|tail	phage tail tape measure protein	tail	D6R3Z8	Bacillus_phage	60.6	0.0e+00
WP_009329201.1|3242233_3242395_-	hypothetical protein	NA	D6R3Z7	Bacillus_phage	68.5	1.1e-12
WP_009329202.1|3242418_3242754_-	hypothetical protein	NA	Q9ZXE8	Bacillus_phage	58.9	5.0e-31
WP_009329203.1|3242814_3243423_-|tail	major tail protein	tail	Q9ZXE9	Bacillus_phage	54.6	8.2e-56
WP_009329204.1|3243422_3243803_-	DUF3168 domain-containing protein	NA	Q9ZXF0	Bacillus_phage	55.6	3.0e-32
WP_009329205.1|3243799_3244183_-	HK97 gp10 family phage protein	NA	Q9ZXF1	Bacillus_phage	70.9	4.1e-45
WP_009329206.1|3244175_3244550_-|head	phage head closure protein	head	Q9ZXF2	Bacillus_phage	63.9	1.2e-36
WP_017475035.1|3244479_3244830_-|head,tail	phage gp6-like head-tail connector protein	head,tail	Q9ZXF3	Bacillus_phage	57.4	1.4e-31
WP_009329208.1|3244845_3245295_-	collagen-like protein	NA	D6R3Z0	Bacillus_phage	53.3	4.0e-15
WP_017475036.1|3245320_3246637_-|capsid	phage major capsid protein	capsid	A0A0A7RTL2	Clostridium_phage	50.0	7.9e-96
WP_009330413.1|3246677_3247307_-|head,protease	HK97 family phage prohead protease	head,protease	Q9ZXF7	Bacillus_phage	81.8	6.0e-94
WP_009330396.1|3247296_3248541_-|portal	phage portal protein	portal	D6R3Y6	Bacillus_phage	83.4	6.1e-207
WP_009330395.1|3248546_3248717_-	hypothetical protein	NA	Q9ZXF9	Bacillus_phage	72.7	3.4e-12
WP_017475037.1|3248728_3250438_-|terminase	terminase large subunit	terminase	D6R3Y4	Bacillus_phage	87.7	9.1e-302
WP_017475038.1|3250437_3250971_-|terminase	phage terminase small subunit P27 family	terminase	Q9ZXG2	Bacillus_phage	80.2	2.8e-68
WP_009330415.1|3251352_3251727_-	HNH endonuclease	NA	Q38456	Bacillus_phage	80.6	2.6e-60
WP_017475040.1|3251886_3252531_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003185368.1|3252749_3252974_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_009329244.1|3253723_3254104_-	ArpU family transcriptional regulator	NA	Q9ZXB9	Bacillus_phage	82.9	8.8e-48
WP_025807623.1|3254216_3254594_-	hypothetical protein	NA	R4JMS5	Bacillus_phage	57.9	4.3e-31
WP_009329249.1|3254609_3255125_-	hypothetical protein	NA	D6R425	Bacillus_phage	83.6	1.1e-82
WP_017695850.1|3255128_3255299_-	Fur-regulated basic protein FbpA	NA	A0A0S2SXY0	Bacillus_phage	56.6	5.1e-08
WP_017474566.1|3255295_3255835_-	ERCC4 domain-containing protein	NA	Q9ZXC2	Bacillus_phage	89.9	1.1e-88
WP_080626964.1|3255831_3256269_-	hypothetical protein	NA	Q9ZXC3	Bacillus_phage	75.9	1.5e-62
WP_080626965.1|3256246_3256618_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080626966.1|3256839_3259272_-	DNA primase	NA	D6R422	Bacillus_phage	80.0	0.0e+00
WP_017474381.1|3259332_3259773_-	DUF669 domain-containing protein	NA	Q9ZXC5	Bacillus_phage	89.0	2.9e-71
WP_017474382.1|3259791_3260145_-	hypothetical protein	NA	Q9ZXC6	Bacillus_phage	56.6	3.9e-26
WP_025807635.1|3260134_3261070_-	AAA family ATPase	NA	Q9ZXC7	Bacillus_phage	90.7	7.2e-160
WP_025807637.1|3261073_3261631_-	host-nuclease inhibitor Gam family protein	NA	Q9ZXC8	Bacillus_phage	73.0	3.7e-71
WP_011198322.1|3261723_3261966_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011198324.1|3262053_3262320_-	hypothetical protein	NA	Q9ZXC9	Bacillus_phage	53.5	7.8e-19
WP_011198325.1|3262379_3262760_+	DUF2513 domain-containing protein	NA	A0A2I7SCV0	Paenibacillus_phage	41.6	2.0e-20
WP_011198326.1|3262751_3262922_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017474700.1|3262954_3263119_-	hypothetical protein	NA	NA	NA	NA	NA
WP_073461388.1|3263284_3263554_-	group-specific protein	NA	S5MC08	Brevibacillus_phage	49.4	4.9e-21
WP_026587143.1|3263559_3263745_-	helix-turn-helix transcriptional regulator	NA	A0A1C8E998	Bacillus_phage	70.5	1.5e-16
WP_087634984.1|3264013_3264442_+	helix-turn-helix transcriptional regulator	NA	Q5YAA4	Bacillus_phage	66.0	4.2e-46
WP_017474834.1|3264450_3264873_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A0S2SXM3	Bacillus_phage	62.3	9.1e-46
WP_017474835.1|3264917_3266066_+|integrase	site-specific integrase	integrase	A0A0M5M609	Bacillus_phage	34.6	3.4e-50
3266160:3266235	attR	CAAACGCTTCTCAAGCTCTGCTTTTTTCTCTTCGAAGCCAGGCTTGCCGAGAAGGGCGAACATGTTGACTTTGTAT	NA	NA	NA	NA
