The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP022658	Salmonella enterica subsp. enterica strain RM11060 chromosome, complete genome	4892239	968033	975346	4892239	protease	Dickeya_phage(16.67%)	7	NA	NA
WP_001201759.1|968033_969152_+	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	39.8	8.1e-09
WP_001748306.1|969148_971095_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	42.3	9.1e-40
WP_000447499.1|971224_971446_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_000520787.1|971769_972090_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	3.5e-13
WP_000934064.1|972120_974397_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
WP_001117984.1|974609_974807_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001531374.1|974968_975346_-	hypothetical protein	NA	A0A077KET4	Ralstonia_phage	40.2	1.7e-19
>prophage 2
NZ_CP022658	Salmonella enterica subsp. enterica strain RM11060 chromosome, complete genome	4892239	1076753	1123224	4892239	head,integrase,tail,lysis,protease	Salmonella_phage(25.0%)	65	1071874:1071889	1103621:1103636
1071874:1071889	attL	GCGCCAGACGCGGCGC	NA	NA	NA	NA
WP_000374046.1|1076753_1077413_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	52.4	2.7e-44
WP_097361317.1|1078000_1079023_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	51.9	3.5e-91
WP_024134793.1|1079006_1079243_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_097361318.1|1079322_1079739_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058645056.1|1079832_1080096_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_097361319.1|1080098_1080491_-	hypothetical protein	NA	A0A0M4RTV1	Salmonella_phage	42.4	6.6e-06
WP_057395058.1|1080487_1080757_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153789541.1|1080753_1080945_-	hypothetical protein	NA	NA	NA	NA	NA
WP_097361321.1|1080941_1081157_-	hypothetical protein	NA	NA	NA	NA	NA
WP_097361322.1|1081156_1081444_-	hypothetical protein	NA	I6RSM9	Salmonella_phage	94.7	5.1e-24
WP_097361323.1|1081440_1081755_-	hypothetical protein	NA	A0A222YY67	Escherichia_phage	57.3	2.0e-34
WP_097361324.1|1081790_1082606_-	hypothetical protein	NA	A0A2H4JAZ0	uncultured_Caudovirales_phage	64.7	1.9e-87
WP_097361325.1|1082611_1085206_-	exonuclease VIII	NA	V5UQJ3	Shigella_phage	56.3	9.6e-162
WP_097361326.1|1085346_1085679_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024153606.1|1085754_1085961_-	cell division inhibitor protein	NA	I6PBM9	Cronobacter_phage	45.6	3.0e-10
WP_097361327.1|1085964_1086240_-	hypothetical protein	NA	NA	NA	NA	NA
WP_097361328.1|1086265_1087117_-	transcriptional regulator	NA	A0A0P0ZE80	Stx2-converting_phage	57.4	5.5e-58
WP_058679873.1|1087425_1087668_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079816621.1|1087728_1087998_-	hypothetical protein	NA	NA	NA	NA	NA
WP_097361329.1|1088369_1088864_-	helix-turn-helix domain-containing protein	NA	A0A0R6PH50	Moraxella_phage	58.8	7.5e-15
WP_024153610.1|1088935_1089211_+	hypothetical protein	NA	H6WRX5	Salmonella_phage	39.2	1.3e-08
WP_097361330.1|1089207_1089702_+	hypothetical protein	NA	NA	NA	NA	NA
WP_097361331.1|1089749_1090757_+	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	69.6	1.0e-127
WP_097361332.1|1090749_1091211_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	76.2	3.2e-68
WP_097361333.1|1091225_1091621_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	37.4	1.5e-18
WP_097361334.1|1091617_1091890_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023220363.1|1092014_1092227_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	77.1	1.8e-18
WP_097361335.1|1092693_1093293_+	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	82.9	1.5e-97
WP_097361336.1|1093289_1093484_+	hypothetical protein	NA	S4TNP0	Salmonella_phage	61.5	7.9e-13
WP_097361337.1|1093480_1093762_+	DUF1364 family protein	NA	K7P7Q1	Enterobacteria_phage	79.1	1.7e-35
WP_097361338.1|1093758_1094295_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	66.3	1.1e-64
WP_157762331.1|1094945_1096256_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001525456.1|1096440_1096743_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_097361340.1|1096720_1097260_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	69.5	2.4e-75
WP_097361563.1|1097577_1098033_+|lysis	lysis protein	lysis	A0A0M4RD57	Salmonella_phage	81.9	1.9e-57
WP_070799731.1|1098258_1098447_+	DUF826 domain-containing protein	NA	NA	NA	NA	NA
WP_079828278.1|1098510_1099140_+	hypothetical protein	NA	A0A0M3ULJ9	Salmonella_phage	98.1	3.3e-108
WP_079953322.1|1099142_1100762_+	TerL protein	NA	A0A0M5M1R6	Salmonella_phage	80.1	1.7e-262
WP_097361341.1|1100761_1102270_+	DUF1073 domain-containing protein	NA	A0A2R3UAL5	Myoviridae_environmental_samples	42.7	1.4e-104
WP_097361342.1|1102310_1103000_+|head	phage head morphogenesis protein	head	H9C0V1	Aeromonas_phage	50.9	1.8e-59
WP_097361343.1|1102996_1104352_+	DUF2213 domain-containing protein	NA	A0A219YCD3	Aeromonas_phage	37.8	9.4e-68
1103621:1103636	attR	GCGCCGCGTCTGGCGC	NA	NA	NA	NA
WP_097361344.1|1104353_1104836_+	hypothetical protein	NA	A0A1X9SFC3	Acinetobacter_phage	49.4	1.4e-26
WP_079953317.1|1104835_1105864_+	DUF2184 domain-containing protein	NA	A0A219YBB0	Aeromonas_phage	49.1	1.7e-82
WP_097361345.1|1105867_1106215_+	hypothetical protein	NA	A0A1X9SFA9	Acinetobacter_phage	33.3	3.1e-07
WP_079953315.1|1106220_1106667_+	DUF4054 domain-containing protein	NA	H9C0W0	Aeromonas_phage	43.8	1.4e-15
WP_097361346.1|1106660_1107245_+	hypothetical protein	NA	H9C0W2	Aeromonas_phage	27.9	1.7e-13
WP_097361347.1|1107241_1107607_+	hypothetical protein	NA	A0A077KAW7	Edwardsiella_phage	40.5	5.1e-21
WP_097361348.1|1107591_1108137_+	hypothetical protein	NA	NA	NA	NA	NA
WP_097361349.1|1108117_1109602_+	DUF3383 domain-containing protein	NA	A0A077KGV4	Edwardsiella_phage	40.2	3.4e-95
WP_000016414.1|1109602_1110049_+	hypothetical protein	NA	Q2NPD1	Xanthomonas_phage	40.4	4.8e-21
WP_000101348.1|1110048_1110453_+	hypothetical protein	NA	H9C0W7	Aeromonas_phage	44.8	1.8e-19
WP_000228831.1|1110494_1110677_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000741779.1|1110660_1112832_+	transglycosylase SLT domain-containing protein	NA	A0A0M4REK7	Salmonella_phage	67.1	1.4e-49
WP_097361350.1|1112828_1113539_+	hypothetical protein	NA	A0A077KGW3	Edwardsiella_phage	34.6	2.5e-27
WP_000890115.1|1113538_1113841_+	hypothetical protein	NA	A0A077K9U4	Edwardsiella_phage	49.5	7.0e-24
WP_000122818.1|1113837_1114707_+	hypothetical protein	NA	A0A077KC17	Edwardsiella_phage	32.7	9.1e-32
WP_000068499.1|1114687_1115365_+	oxidoreductase	NA	A0A077KAY0	Edwardsiella_phage	36.4	5.4e-32
WP_001191865.1|1115377_1115734_+	hypothetical protein	NA	A0A077KCA1	Edwardsiella_phage	49.1	1.6e-19
WP_001293657.1|1115730_1116972_+	hypothetical protein	NA	A0A077KGW9	Edwardsiella_phage	49.9	1.2e-101
WP_097361351.1|1116973_1117576_+	DUF2612 domain-containing protein	NA	A0A2R3UAM9	Myoviridae_environmental_samples	38.9	4.3e-33
WP_097361352.1|1117565_1119017_+|tail	tail fiber protein	tail	E5G6P0	Salmonella_phage	72.8	1.7e-46
WP_097361353.1|1119517_1119823_+	hypothetical protein	NA	A0A0M4QWS3	Salmonella_phage	60.0	1.9e-29
WP_097361354.1|1119812_1120547_+	DUF4376 domain-containing protein	NA	A0A0M4RTP2	Salmonella_phage	76.1	1.7e-47
WP_097361355.1|1120601_1122719_+	sialate O-acetylesterase	NA	H6WZJ9	Escherichia_phage	53.7	2.4e-163
WP_057395107.1|1122849_1123224_+	DUF1353 domain-containing protein	NA	I1TQ41	Pseudomonas_phage	41.3	1.5e-15
>prophage 3
NZ_CP022658	Salmonella enterica subsp. enterica strain RM11060 chromosome, complete genome	4892239	1842483	1936875	4892239	head,transposase,tRNA,portal,integrase,capsid,tail,lysis,protease,terminase	Enterobacteria_phage(45.95%)	102	1834573:1834588	1932867:1932882
1834573:1834588	attL	CGCGTGAGCGCGATAT	NA	NA	NA	NA
WP_000173208.1|1842483_1843740_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_000174484.1|1844053_1844677_+	lipoprotein localization protein LolB	NA	NA	NA	NA	NA
WP_000988258.1|1844673_1845525_+	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
WP_001518537.1|1845790_1846738_+	ribose-phosphate pyrophosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.8	8.6e-44
WP_001037188.1|1846862_1848548_+	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	23.4	2.3e-23
WP_000823878.1|1848592_1848871_-	stress-induced protein YchH	NA	NA	NA	NA	NA
WP_000365078.1|1849121_1849730_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_001748456.1|1849846_1850938_+	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_001748457.1|1851096_1852362_-	DUF4427 domain-containing protein	NA	NA	NA	NA	NA
WP_001058311.1|1852861_1853980_+	hydrogenase 1 small subunit	NA	NA	NA	NA	NA
WP_000070986.1|1853976_1855770_+	Ni/Fe-hydrogenase large subunit	NA	NA	NA	NA	NA
WP_020438146.1|1855788_1856520_+	Ni/Fe-hydrogenase b-type cytochrome subunit	NA	NA	NA	NA	NA
WP_000993801.1|1856516_1857113_+|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
WP_001615886.1|1857102_1857507_+	hydrogenase-1 operon protein HyaE	NA	NA	NA	NA	NA
WP_000063377.1|1857503_1858352_+	hydrogenase expression/formation protein	NA	NA	NA	NA	NA
WP_000263613.1|1858426_1859971_+	cytochrome bd-II oxidase subunit 1	NA	NA	NA	NA	NA
WP_000888110.1|1859982_1861119_+	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_000270306.1|1861131_1861221_+	cytochrome bd-II oxidase subunit CbdX	NA	NA	NA	NA	NA
WP_001526439.1|1861615_1862890_+	Glu/Leu/Phe/Val dehydrogenase	NA	NA	NA	NA	NA
WP_020438149.1|1863103_1864816_+	alpha,alpha-trehalase	NA	NA	NA	NA	NA
WP_000511323.1|1864878_1865133_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_020438150.1|1865301_1866036_+	flagellar brake protein YcgR	NA	NA	NA	NA	NA
WP_000776974.1|1866049_1866661_-	membrane-bound lytic murein transglycosylase EmtA	NA	NA	NA	NA	NA
WP_020438151.1|1866830_1867745_+	muramoyltetrapeptide carboxypeptidase	NA	NA	NA	NA	NA
WP_000338376.1|1867841_1869575_+	potassium/proton antiporter	NA	NA	NA	NA	NA
WP_023197862.1|1869636_1870707_-	catabolic alanine racemase DadX	NA	NA	NA	NA	NA
WP_001266937.1|1870720_1872019_-	D-amino acid dehydrogenase	NA	NA	NA	NA	NA
WP_000190831.1|1872341_1873874_+	SpoVR family protein	NA	NA	NA	NA	NA
WP_000234826.1|1873920_1874640_-	fatty acid metabolism transcriptional regulator FadR	NA	NA	NA	NA	NA
WP_000406446.1|1874859_1876404_+	Na(+)/H(+) antiporter NhaB	NA	NA	NA	NA	NA
WP_000943475.1|1876545_1877076_+	disulfide bond formation protein DsbB	NA	NA	NA	NA	NA
WP_079952872.1|1877311_1877449_-	Hok/Gef family protein	NA	NA	NA	NA	NA
WP_079952870.1|1878008_1878389_-	DUF1353 domain-containing protein	NA	I1TQ41	Pseudomonas_phage	41.6	5.2e-16
WP_097361386.1|1880885_1881509_-	DUF4376 domain-containing protein	NA	Q9LA61	Enterobacterial_phage	37.8	2.2e-32
WP_097361387.1|1881520_1882717_-	hypothetical protein	NA	H6WZM9	Escherichia_phage	50.5	8.4e-20
WP_057393620.1|1882858_1883011_-	Hok/Gef family protein	NA	NA	NA	NA	NA
WP_097361388.1|1886831_1887536_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	61.2	2.0e-66
WP_097361389.1|1887433_1888171_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	75.2	1.4e-113
WP_097361390.1|1888180_1888876_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	69.3	1.1e-91
WP_097361391.1|1889030_1890194_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	55.6	5.3e-112
WP_079953114.1|1890331_1890664_-|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	61.1	7.0e-33
WP_097361392.1|1890660_1893756_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	51.8	1.9e-241
WP_079953116.1|1893739_1894042_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	59.4	7.5e-26
WP_057395189.1|1894062_1894452_-|tail	phage minor tail protein G	tail	A5LH36	Enterobacteria_phage	57.0	6.5e-30
WP_057395195.1|1894508_1895261_-|tail	phage tail protein	tail	A5LH35	Enterobacteria_phage	70.4	1.0e-95
WP_001643846.1|1895273_1895675_-|tail	phage tail protein	tail	A0A291AWY2	Escherichia_phage	60.6	9.6e-45
WP_057395188.1|1895674_1896274_-|tail	phage tail protein	tail	A0A291AWZ0	Escherichia_phage	69.7	9.9e-70
WP_097361393.1|1896290_1896647_-|tail	phage tail protein	tail	K7P6U9	Enterobacteria_phage	58.5	1.7e-32
WP_057395186.1|1896657_1897032_-	DNA breaking-rejoining protein	NA	NA	NA	NA	NA
WP_057395185.1|1897096_1898125_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	58.1	1.9e-108
WP_057395184.1|1898218_1898566_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	53.8	2.1e-19
WP_057395183.1|1898562_1900086_-	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	53.7	4.5e-103
WP_097361394.1|1900075_1901671_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.4	2.6e-186
WP_057395181.1|1901667_1901871_-|tail	phage tail protein	tail	K7PM10	Enterobacteria_phage	80.0	1.3e-18
WP_079953120.1|1901854_1903789_-|terminase	phage terminase large subunit family protein	terminase	E4WL19	Enterobacteria_phage	65.8	2.9e-256
WP_057395179.1|1903760_1904306_-|terminase	terminase small subunit	terminase	K7P7G0	Enterobacteria_phage	61.3	7.6e-53
WP_097361395.1|1904766_1905963_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_070809067.1|1906143_1906434_+	lipoprotein bor	NA	C6ZCX3	Enterobacteria_phage	62.9	8.2e-30
WP_097361565.1|1906465_1906900_-|lysis	lysis protein	lysis	A0A0M4RD57	Salmonella_phage	73.9	4.1e-49
WP_153789549.1|1907052_1907220_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079953123.1|1907537_1908023_-	lysozyme	NA	M9P0E5	Enterobacteria_phage	69.4	1.1e-58
WP_097361566.1|1908003_1908291_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_079953022.1|1908467_1908695_+	hypothetical protein	NA	Q38575	Escherichia_phage	42.5	2.4e-08
WP_097361396.1|1908684_1909065_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079953024.1|1909740_1910223_-	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
WP_079953025.1|1910442_1910697_+	type II toxin-antitoxin system HicA family toxin	NA	R4JMD3	Burkholderia_phage	42.9	5.0e-15
WP_079953026.1|1910693_1911035_+	type II toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_157762340.1|1911177_1911831_-	hypothetical protein	NA	NA	NA	NA	NA
WP_097361397.1|1911827_1912964_-	DUF968 domain-containing protein	NA	A0A1W6JP62	Morganella_phage	33.9	4.6e-52
WP_097361398.1|1912985_1913354_-	hypothetical protein	NA	NA	NA	NA	NA
WP_097361399.1|1913425_1915378_-	replication endonuclease	NA	F1BUS0	Erwinia_phage	33.4	7.6e-95
WP_097361400.1|1915456_1915684_-	derepression protein	NA	NA	NA	NA	NA
WP_057394489.1|1916177_1916441_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_097361402.1|1916443_1916866_-	hypothetical protein	NA	Q9G078	Enterobacteria_phage	56.6	3.8e-28
WP_097361403.1|1916869_1917343_-	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	77.5	5.2e-66
WP_058645051.1|1918403_1918652_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079953034.1|1918648_1919044_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	36.9	2.7e-15
WP_097361404.1|1919040_1921359_-	hypothetical protein	NA	A0A0U2I1R6	Escherichia_phage	27.1	1.6e-38
WP_153789550.1|1921316_1921559_-	hypothetical protein	NA	NA	NA	NA	NA
WP_097361405.1|1921848_1922106_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057395050.1|1922492_1922684_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057395049.1|1922680_1922875_-	hypothetical protein	NA	NA	NA	NA	NA
WP_097361406.1|1923028_1923607_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153789848.1|1924142_1924592_+	hypothetical protein	NA	NA	NA	NA	NA
WP_125468762.1|1924676_1924955_+	hypothetical protein	NA	NA	NA	NA	NA
WP_097361407.1|1924911_1925334_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079953039.1|1925361_1925862_-	hypothetical protein	NA	NA	NA	NA	NA
WP_097361408.1|1925974_1926316_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_058645046.1|1926386_1927376_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0F7LBR0	Escherichia_phage	54.0	1.7e-98
WP_000018967.1|1927567_1927909_+	DUF1971 domain-containing protein	NA	NA	NA	NA	NA
WP_001083582.1|1927980_1928154_-	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_001519337.1|1928345_1928483_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000785716.1|1928834_1929296_-	YcgN family cysteine cluster protein	NA	NA	NA	NA	NA
WP_001519895.1|1929373_1930033_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_001525604.1|1930082_1930376_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000072527.1|1930501_1931209_+	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_000101047.1|1931232_1932045_+	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_001185666.1|1932048_1932315_+	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
WP_097361409.1|1932436_1933564_-	ribonuclease D	NA	NA	NA	NA	NA
1932867:1932882	attR	ATATCGCGCTCACGCG	NA	NA	NA	NA
WP_000758418.1|1933636_1935322_-	long-chain-fatty-acid--CoA ligase FadD	NA	A0A2H4PQM9	Staphylococcus_phage	26.0	3.8e-34
WP_021294445.1|1935526_1936108_-	Slp family lipoprotein	NA	NA	NA	NA	NA
WP_001221014.1|1936179_1936875_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
>prophage 4
NZ_CP022658	Salmonella enterica subsp. enterica strain RM11060 chromosome, complete genome	4892239	1990512	1995902	4892239	integrase	uncultured_Caudovirales_phage(33.33%)	9	1990559:1990573	2001447:2001461
WP_097361410.1|1990512_1991046_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	50.0	2.4e-11
1990559:1990573	attL	CGTTCACACGTCATT	NA	NA	NA	NA
WP_001013467.1|1991099_1991330_-	hypothetical protein	NA	Q8HA86	Salmonella_phage	93.7	6.1e-28
WP_020438171.1|1991360_1992467_+	hypothetical protein	NA	Q9QF34	Lambdoid_phage	65.0	1.1e-53
WP_071602162.1|1992463_1992658_+	hypothetical protein	NA	A0A2H4IYC8	uncultured_Caudovirales_phage	59.5	5.9e-08
WP_072205508.1|1992686_1993541_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	50.0	1.2e-71
WP_000722368.1|1993913_1994267_-	YebY family protein	NA	NA	NA	NA	NA
WP_000979705.1|1994283_1995159_-	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000168393.1|1995159_1995534_-	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000856224.1|1995671_1995902_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	60.3	2.9e-14
2001447:2001461	attR	CGTTCACACGTCATT	NA	NA	NA	NA
>prophage 5
NZ_CP022658	Salmonella enterica subsp. enterica strain RM11060 chromosome, complete genome	4892239	2098574	2110010	4892239	integrase	Enterobacteria_phage(25.0%)	12	2092187:2092200	2112459:2112472
2092187:2092200	attL	ATAAGGGGAATATA	NA	NA	NA	NA
WP_097361412.1|2098574_2100005_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
WP_001748531.1|2100078_2100774_-	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.1	2.8e-07
WP_000107434.1|2100853_2101165_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017465542.1|2101816_2103028_+	porin	NA	Q1MVN1	Enterobacteria_phage	56.2	4.4e-109
WP_024131109.1|2103287_2103476_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000208509.1|2103486_2103699_-	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
WP_000457663.1|2104153_2105422_-	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	91.9	9.3e-227
WP_000394197.1|2105424_2105844_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
WP_001537372.1|2105970_2106132_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000598921.1|2106612_2107410_+	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_001683376.1|2107781_2108072_+	DUF4102 domain-containing protein	NA	B7SYF8	Stenotrophomonas_phage	52.6	2.1e-09
WP_023197851.1|2108735_2110010_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	34.3	3.1e-65
2112459:2112472	attR	TATATTCCCCTTAT	NA	NA	NA	NA
>prophage 6
NZ_CP022658	Salmonella enterica subsp. enterica strain RM11060 chromosome, complete genome	4892239	2232415	2242922	4892239		Enterobacteria_phage(37.5%)	10	NA	NA
WP_000126351.1|2232415_2233729_-	lipopolysaccharide biosynthesis protein RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	9.1e-52
WP_000565902.1|2233755_2234835_-	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.5	1.3e-16
WP_000648783.1|2234839_2235613_-	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_020437413.1|2235628_2236603_-	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
WP_000973714.1|2236608_2237160_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.0	1.0e-52
WP_000857530.1|2237160_2238039_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.8	5.1e-107
WP_001023659.1|2238086_2238986_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.0	5.1e-30
WP_000697840.1|2238985_2240071_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.2e-102
WP_000981471.1|2240447_2241341_-	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_001111837.1|2241518_2242922_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.5	3.1e-21
>prophage 7
NZ_CP022658	Salmonella enterica subsp. enterica strain RM11060 chromosome, complete genome	4892239	4284159	4350287	4892239	head,holin,portal,integrase,capsid,plate,tail,protease,terminase	Salmonella_phage(83.33%)	79	4287708:4287752	4320379:4320423
WP_000268248.1|4284159_4285056_-	sulfolactaldehyde 3-reductase	NA	D2K0C8	Staphylococcus_phage	100.0	1.5e-66
WP_023197766.1|4285220_4286117_+	sugar kinase	NA	NA	NA	NA	NA
WP_000059693.1|4286150_4286954_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.8	7.6e-25
WP_097361543.1|4287144_4287762_+	glucose-1-phosphatase	NA	NA	NA	NA	NA
4287708:4287752	attL	CACCATCCCTGTCTTCCCCCACATGATGTGGGGGTTTTTTTTATC	NA	NA	NA	NA
WP_079953016.1|4287859_4288840_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M4RTQ0	Salmonella_phage	97.9	1.5e-184
WP_099706372.1|4288909_4289263_-	helix-turn-helix transcriptional regulator	NA	A0A0M5M1I9	Salmonella_phage	100.0	1.2e-59
WP_024153929.1|4289334_4289796_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000422421.1|4289746_4290202_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031607754.1|4290340_4290622_+	hypothetical protein	NA	A0A0M4RCW1	Salmonella_phage	100.0	1.4e-50
WP_000078935.1|4290632_4290836_+	hypothetical protein	NA	A0A0M3ULI0	Salmonella_phage	98.5	1.2e-30
WP_000290619.1|4290846_4291053_+	DUF4761 family protein	NA	A0A0M5M1I3	Salmonella_phage	100.0	4.3e-33
WP_000543629.1|4291042_4291273_+	DUF2724 domain-containing protein	NA	A0A0M4S6M9	Salmonella_phage	76.0	1.2e-28
WP_000482341.1|4291367_4291802_+	tellurite resistance TerB family protein	NA	Q1MVI3	Enterobacteria_phage	91.0	5.1e-68
WP_000946669.1|4291801_4291984_+	DUF3927 family protein	NA	NA	NA	NA	NA
WP_000166617.1|4292027_4292240_+	hypothetical protein	NA	A0A0M4R514	Salmonella_phage	95.7	6.4e-32
WP_000620901.1|4292241_4293123_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A0M4QWR0	Salmonella_phage	82.3	6.6e-131
WP_097361544.1|4293122_4293320_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000128157.1|4293320_4294355_+	DNA cytosine methyltransferase	NA	A0A0M3ULA1	Salmonella_phage	61.9	5.6e-129
WP_058648989.1|4294351_4296712_+	replication endonuclease	NA	A0A0M4RTM8	Salmonella_phage	86.1	0.0e+00
WP_024153925.1|4296787_4297381_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024153924.1|4297394_4298507_+	ImmA/IrrE family metallo-endopeptidase	NA	B6SBZ6	Clostridium_virus	31.1	4.4e-31
WP_000014576.1|4298909_4299959_-|portal	phage portal protein	portal	A0A0M5M1H6	Salmonella_phage	100.0	6.7e-207
WP_024153923.1|4299959_4301672_-	oxidoreductase	NA	A0A0M4S6K7	Salmonella_phage	98.6	0.0e+00
WP_024153922.1|4301825_4302671_+|capsid	GPO family capsid scaffolding protein	capsid	A0A1J0I2E9	Salmonella_phage	98.2	1.4e-154
WP_001246220.1|4302711_4303758_+|capsid	phage major capsid protein, P2 family	capsid	A0A0M3ULA3	Salmonella_phage	99.7	3.7e-197
WP_044144072.1|4303800_4304649_+|terminase	terminase	terminase	A0A0M4R523	Salmonella_phage	96.5	4.7e-134
WP_024153920.1|4304751_4305240_+|head	head completion/stabilization protein	head	A0A0M4QWR7	Salmonella_phage	96.9	1.5e-84
WP_001102549.1|4305239_4305440_+|tail	tail protein	tail	A0A0M4RTN6	Salmonella_phage	100.0	1.8e-31
WP_000543937.1|4305450_4305786_+|holin	phage holin, lambda family	holin	A0A0M3ULH4	Salmonella_phage	98.2	2.1e-53
WP_024153919.1|4305769_4306210_+	lysozyme	NA	A0A0M5M782	Salmonella_phage	97.9	1.4e-76
WP_024153918.1|4306310_4306841_+	DUF2514 family protein	NA	A0A0M4S5V1	Salmonella_phage	93.8	7.4e-45
WP_000917105.1|4306840_4307335_+|tail	phage tail protein	tail	A0A0M4R2U5	Salmonella_phage	98.0	8.7e-80
WP_058648991.1|4307295_4307940_+	phage virion morphogenesis protein	NA	A0A0M4RCU1	Salmonella_phage	96.7	2.8e-115
WP_097361545.1|4308096_4308726_+|plate	phage baseplate assembly protein V	plate	A0A0M3ULA5	Salmonella_phage	97.6	9.3e-111
WP_000108899.1|4308722_4309085_+|plate	baseplate assembly protein	plate	A0A0M4S6L5	Salmonella_phage	99.2	3.3e-60
WP_024153915.1|4309081_4309993_+|plate	baseplate assembly protein	plate	A0A0M4REB7	Salmonella_phage	97.7	7.0e-160
WP_097361546.1|4309985_4310600_+|tail	phage tail protein I	tail	A0A1J0I2I4	Salmonella_phage	97.9	1.9e-108
WP_044144047.1|4310589_4312326_+|tail	phage tail protein	tail	A0A0M3ULH6	Salmonella_phage	74.8	3.6e-197
WP_024153912.1|4312325_4312895_+|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	95.2	6.0e-101
WP_024153911.1|4313099_4313549_-|tail	phage tail protein	tail	A0A1J0I2L5	Salmonella_phage	97.3	2.5e-78
WP_024153910.1|4313559_4316487_-|tail	phage tail tape measure protein	tail	A0A0M4R2V3	Salmonella_phage	92.5	0.0e+00
WP_000763324.1|4316487_4316604_-|tail	GpE family phage tail protein	tail	A0A0M3ULA8	Salmonella_phage	100.0	6.6e-15
WP_000047593.1|4316612_4316948_-	hypothetical protein	NA	A0A0M4RCV2	Salmonella_phage	99.1	3.0e-52
WP_001207579.1|4316962_4317478_-|tail	phage major tail tube protein	tail	A0A0M5M1I5	Salmonella_phage	95.9	3.9e-91
WP_000224787.1|4317490_4318684_-|tail	tail protein	tail	A0A0M4S6M1	Salmonella_phage	94.2	1.0e-214
WP_024153908.1|4318841_4319960_+	phage late control D family protein	NA	A0A0M4REC6	Salmonella_phage	99.5	3.8e-192
WP_001251454.1|4320008_4320251_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_001077320.1|4320501_4321404_+	CDF family cation-efflux transporter FieF	NA	NA	NA	NA	NA
4320379:4320423	attR	CACCATCCCTGTCTTCCCCCACATGATGTGGGGGTTTTTTTTATC	NA	NA	NA	NA
WP_000591793.1|4321588_4322551_+	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_000758711.1|4322754_4323744_+	sulfate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000750756.1|4323844_4324600_+	CDP-diacylglycerol diphosphatase	NA	NA	NA	NA	NA
WP_000777314.1|4324864_4326199_+	MFS transporter	NA	NA	NA	NA	NA
WP_021294116.1|4326209_4327169_+	aminoimidazole riboside kinase	NA	NA	NA	NA	NA
WP_000557881.1|4327178_4328219_+	ADP-ribosylglycohydrolase family protein	NA	NA	NA	NA	NA
WP_001535809.1|4328281_4329004_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000060999.1|4329101_4329272_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000621105.1|4329287_4329419_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001173083.1|4329508_4329859_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_000113085.1|4329872_4331465_-	autoinducer-2 kinase	NA	NA	NA	NA	NA
WP_023197763.1|4331551_4332511_-	transcriptional regulator LsrR	NA	NA	NA	NA	NA
WP_001167255.1|4332766_4334302_+	autoinducer 2 ABC transporter ATP-binding protein LsrA	NA	A0A2H4PQG7	Staphylococcus_phage	29.5	8.3e-20
WP_000911133.1|4334295_4335339_+	autoinducer 2 ABC transporter permease LsrC	NA	NA	NA	NA	NA
WP_000981826.1|4335335_4336337_+	autoinducer 2 ABC transporter permease LsrD	NA	NA	NA	NA	NA
WP_000090737.1|4336365_4337388_+	autoinducer 2 ABC transporter substrate-binding protein LsrB	NA	NA	NA	NA	NA
WP_000774146.1|4337416_4338292_+	3-hydroxy-5-phosphonooxypentane-2,4-dione thiolase	NA	NA	NA	NA	NA
WP_001738619.1|4338374_4338665_+	(4S)-4-hydroxy-5-phosphonooxypentane-2,3-dione isomerase	NA	NA	NA	NA	NA
WP_001088050.1|4338674_4339439_+	epimerase	NA	NA	NA	NA	NA
WP_001216335.1|4339530_4340298_-	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_000802241.1|4340410_4341007_-	YiiQ family protein	NA	NA	NA	NA	NA
WP_000155237.1|4341107_4341536_+	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_000796303.1|4341642_4342389_-	ferredoxin--NADP(+) reductase	NA	NA	NA	NA	NA
WP_001250624.1|4342485_4343496_-	class II fructose-bisphosphatase	NA	NA	NA	NA	NA
WP_000136809.1|4343607_4345116_-	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_000084285.1|4345136_4345982_-	aquaporin	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.6	2.0e-15
WP_000051370.1|4346380_4346620_+	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
WP_000872918.1|4346841_4347327_-	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_000139639.1|4347419_4348349_-	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_001293360.1|4348415_4349747_-	HslU--HslV peptidase ATPase subunit	NA	W6AS21	Erwinia_phage	28.3	2.4e-44
WP_000208240.1|4349756_4350287_-|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
>prophage 8
NZ_CP022658	Salmonella enterica subsp. enterica strain RM11060 chromosome, complete genome	4892239	4468907	4487059	4892239	plate,tail	Burkholderia_phage(40.0%)	23	NA	NA
WP_001177097.1|4468907_4469423_-|tail	tail fiber assembly protein	tail	A0A0U2QV64	Escherichia_phage	41.2	3.4e-34
WP_000368203.1|4469432_4470914_-|tail	tail fiber protein	tail	A0A0M3ULF6	Salmonella_phage	51.7	1.3e-51
WP_000359500.1|4470916_4471549_-|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	56.4	6.6e-24
WP_020437568.1|4471541_4472657_-|plate	phage baseplate	plate	Q6QI99	Burkholderia_phage	51.7	3.4e-100
WP_001093501.1|4472647_4473007_-|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	64.2	2.8e-35
WP_000632048.1|4473170_4474718_-	hypothetical protein	NA	B9UDL6	Salmonella_phage	29.9	2.5e-48
WP_020437570.1|4474717_4475647_-	glycosyltransferase family 2 protein	NA	S5FKN0	Shigella_phage	83.8	3.9e-150
WP_000593184.1|4475643_4476006_-	GtrA family protein	NA	U5P0S6	Shigella_phage	70.8	9.6e-44
WP_017465888.1|4476333_4477056_-|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	42.0	3.9e-12
WP_017465889.1|4477065_4478109_-	phage late control D family protein	NA	A4JWL3	Burkholderia_virus	45.9	6.5e-77
WP_001269716.1|4478096_4478306_-	membrane protein	NA	A4JWL2	Burkholderia_virus	60.3	9.8e-17
WP_020437572.1|4478305_4479259_-	hypothetical protein	NA	A4JWL1	Burkholderia_virus	51.5	1.0e-36
WP_020437573.1|4479258_4481610_-|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	31.3	3.6e-67
WP_001185655.1|4481706_4481835_-|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_020437574.1|4481794_4482112_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_020437575.1|4482163_4482688_-|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.5	3.6e-68
WP_000729853.1|4482687_4484115_-|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	70.9	1.4e-194
WP_097361551.1|4484104_4484302_-	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	51.0	5.6e-06
WP_000449439.1|4484298_4484754_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000777267.1|4484912_4485227_-	hypothetical protein	NA	Q6QIC4	Burkholderia_phage	48.2	8.3e-20
WP_020437576.1|4485239_4485845_-	transglycosylase SLT domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	59.9	1.4e-60
WP_001226439.1|4485847_4486135_-	membrane protein	NA	Q6QIC8	Burkholderia_phage	48.1	3.0e-16
WP_000615248.1|4486711_4487059_+	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	51.5	4.9e-21
>prophage 1
NZ_CP022659	Salmonella enterica subsp. enterica strain RM11060 plasmid pRM11060-1, complete sequence	70062	3258	62841	70062	plate,tRNA,tail,integrase,portal	Salmonella_phage(77.42%)	68	13926:13940	15403:15417
WP_000014576.1|3258_4308_+|portal	phage portal protein	portal	A0A0M5M1H6	Salmonella_phage	100.0	6.7e-207
WP_024153924.1|4710_5823_-	ImmA/IrrE family metallo-endopeptidase	NA	B6SBZ6	Clostridium_virus	31.1	4.4e-31
WP_024153925.1|5836_6430_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058648989.1|6505_8866_-	replication endonuclease	NA	A0A0M4RTM8	Salmonella_phage	86.1	0.0e+00
WP_000128157.1|8862_9897_-	DNA cytosine methyltransferase	NA	A0A0M3ULA1	Salmonella_phage	61.9	5.6e-129
WP_097361544.1|9897_10095_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000620901.1|10094_10976_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A0M4QWR0	Salmonella_phage	82.3	6.6e-131
WP_000166617.1|10977_11190_-	hypothetical protein	NA	A0A0M4R514	Salmonella_phage	95.7	6.4e-32
WP_000946669.1|11233_11416_-	DUF3927 family protein	NA	NA	NA	NA	NA
WP_000482341.1|11415_11850_-	tellurite resistance TerB family protein	NA	Q1MVI3	Enterobacteria_phage	91.0	5.1e-68
WP_000543629.1|11944_12175_-	DUF2724 domain-containing protein	NA	A0A0M4S6M9	Salmonella_phage	76.0	1.2e-28
WP_000290619.1|12164_12371_-	DUF4761 family protein	NA	A0A0M5M1I3	Salmonella_phage	100.0	4.3e-33
WP_000078935.1|12381_12585_-	hypothetical protein	NA	A0A0M3ULI0	Salmonella_phage	98.5	1.2e-30
WP_031607754.1|12595_12877_-	hypothetical protein	NA	A0A0M4RCW1	Salmonella_phage	100.0	1.4e-50
WP_000422421.1|13015_13471_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024153929.1|13421_13883_-	hypothetical protein	NA	NA	NA	NA	NA
13926:13940	attL	CTTGTAACTGCTTAT	NA	NA	NA	NA
WP_099706372.1|13954_14308_+	helix-turn-helix transcriptional regulator	NA	A0A0M5M1I9	Salmonella_phage	100.0	1.2e-59
WP_079953016.1|14377_15358_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M4RTQ0	Salmonella_phage	97.9	1.5e-184
WP_001233463.1|15534_16035_-	cell-envelope stress modulator CpxP	NA	NA	NA	NA	NA
15403:15417	attR	CTTGTAACTGCTTAT	NA	NA	NA	NA
WP_001033731.1|16185_16884_+	envelope stress response regulator transcription factor CpxR	NA	W8CYM9	Bacillus_phage	39.6	2.4e-35
WP_000580402.1|16880_18254_+	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.6	7.2e-15
WP_021294276.1|18304_18700_-	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_011233226.1|18711_19464_-	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_097361573.1|19470_20091_-	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	58.9	3.2e-63
WP_000812816.1|20419_21403_+	TRAP transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001091413.1|21421_21937_+	TRAP transporter small permease	NA	NA	NA	NA	NA
WP_000566800.1|21929_23237_+	TRAP transporter large permease	NA	NA	NA	NA	NA
WP_000378721.1|23394_24078_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000063541.1|24696_25731_+	L-rhamnose/proton symporter RhaT	NA	NA	NA	NA	NA
WP_000013291.1|25727_26576_-	HTH-type transcriptional activator RhaR	NA	NA	NA	NA	NA
WP_000217112.1|26728_27565_-	HTH-type transcriptional activator RhaS	NA	NA	NA	NA	NA
WP_023197765.1|27852_29322_+	rhamnulokinase	NA	NA	NA	NA	NA
WP_001661624.1|29318_30578_+	L-rhamnose isomerase	NA	NA	NA	NA	NA
WP_001179690.1|30720_31548_+	rhamnulose-1-phosphate aldolase	NA	NA	NA	NA	NA
WP_097361574.1|31674_32823_+	lactaldehyde reductase	NA	NA	NA	NA	NA
WP_000619475.1|32819_33134_+	L-rhamnose mutarotase	NA	NA	NA	NA	NA
WP_010989088.1|33222_33789_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000683586.1|33871_34531_+	AzlC family ABC transporter permease	NA	NA	NA	NA	NA
WP_000527677.1|34530_34854_+	AzlD domain-containing protein	NA	NA	NA	NA	NA
WP_000828039.1|35197_36298_-	DUF3829 domain-containing protein	NA	NA	NA	NA	NA
WP_000710966.1|36480_37512_+	YiiG family protein	NA	NA	NA	NA	NA
WP_001059740.1|37779_38616_-	formate dehydrogenase accessory sulfurtransferase FdhD	NA	NA	NA	NA	NA
WP_077248424.1|38810_41861_+	formate dehydrogenase-N subunit alpha	NA	A0A077SK27	Escherichia_phage	24.1	4.6e-06
WP_000331361.1|41873_42776_+	formate dehydrogenase subunit beta	NA	NA	NA	NA	NA
WP_000829025.1|42772_43408_+	formate dehydrogenase cytochrome b556 subunit	NA	NA	NA	NA	NA
WP_000027730.1|43404_44334_+	formate dehydrogenase accessory protein FdhE	NA	NA	NA	NA	NA
WP_000362050.1|44380_44671_-	DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_001159630.1|44671_44983_-	cytotoxic translational repressor of toxin-antitoxin stability system	NA	NA	NA	NA	NA
WP_021294279.1|45200_46130_+	alpha/beta hydrolase	NA	A0A167RJ59	Powai_lake_megavirus	34.4	4.5e-29
WP_000558166.1|46215_46527_+	type II toxin-antitoxin system HigB family toxin	NA	NA	NA	NA	NA
WP_001259012.1|46523_46970_+	type II toxin-antitoxin system HigA family antitoxin	NA	NA	NA	NA	NA
WP_001518251.1|46984_47926_-	fatty acid biosynthesis protein FabY	NA	NA	NA	NA	NA
WP_001621365.1|47970_48408_-|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_000921423.1|48404_49277_-	virulence factor BrkB family protein	NA	NA	NA	NA	NA
WP_001251454.1|49434_49677_-	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_024153908.1|49725_50844_-	phage late control D family protein	NA	A0A0M4REC6	Salmonella_phage	99.5	3.8e-192
WP_000224787.1|51001_52195_+|tail	tail protein	tail	A0A0M4S6M1	Salmonella_phage	94.2	1.0e-214
WP_001207579.1|52207_52723_+|tail	phage major tail tube protein	tail	A0A0M5M1I5	Salmonella_phage	95.9	3.9e-91
WP_000047593.1|52737_53073_+	hypothetical protein	NA	A0A0M4RCV2	Salmonella_phage	99.1	3.0e-52
WP_000763324.1|53081_53198_+|tail	GpE family phage tail protein	tail	A0A0M3ULA8	Salmonella_phage	100.0	6.6e-15
WP_024153910.1|53198_56126_+|tail	phage tail tape measure protein	tail	A0A0M4R2V3	Salmonella_phage	92.5	0.0e+00
WP_024153911.1|56136_56586_+|tail	phage tail protein	tail	A0A1J0I2L5	Salmonella_phage	97.3	2.5e-78
WP_024153912.1|56790_57360_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	95.2	6.0e-101
WP_044144047.1|57359_59096_-|tail	phage tail protein	tail	A0A0M3ULH6	Salmonella_phage	74.8	3.6e-197
WP_024153915.1|59691_60603_-|plate	baseplate assembly protein	plate	A0A0M4REB7	Salmonella_phage	97.7	7.0e-160
WP_000108899.1|60599_60962_-|plate	baseplate assembly protein	plate	A0A0M4S6L5	Salmonella_phage	99.2	3.3e-60
WP_097361545.1|60958_61588_-|plate	phage baseplate assembly protein V	plate	A0A0M3ULA5	Salmonella_phage	97.6	9.3e-111
WP_000917105.1|62346_62841_-|tail	phage tail protein	tail	A0A0M4R2U5	Salmonella_phage	98.0	8.7e-80
>prophage 1
NZ_CP022660	Salmonella enterica subsp. enterica strain RM11060 plasmid pRM11060-2, complete sequence	290957	24826	147224	290957	portal,head,bacteriocin,terminase,holin,plate,transposase,capsid,integrase,protease,lysis,tail	Salmonella_phage(36.07%)	100	25104:25120	71698:71714
WP_097361660.1|24826_25501_-|transposase	transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	30.1	5.2e-11
25104:25120	attL	AACAGCAGGTTATCATT	NA	NA	NA	NA
WP_057393574.1|26355_27252_+	antimicrobial resistance protein Mig-14	NA	NA	NA	NA	NA
WP_157762374.1|29091_30006_+	pyocin	NA	NA	NA	NA	NA
WP_057395147.1|30002_30275_+	hypothetical protein	NA	NA	NA	NA	NA
WP_139760136.1|30867_30981_+	hypothetical protein	NA	A0A1C9IHU6	Salmonella_phage	94.6	1.4e-09
WP_057395148.1|31016_31586_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	89.4	8.4e-95
WP_097361583.1|31585_32761_-|tail	tail fiber protein	tail	A0A0M3ULH6	Salmonella_phage	80.3	3.4e-50
WP_097361584.1|32747_33335_-	DUF2313 domain-containing protein	NA	A0A192Y5V3	Salmonella_phage	97.9	7.8e-112
WP_097361585.1|33337_34417_-|plate	baseplate J/gp47 family protein	plate	A0A192Y6E4	Salmonella_phage	95.8	1.2e-198
WP_000605053.1|34409_34823_-	hypothetical protein	NA	A0A192Y6D0	Salmonella_phage	94.9	3.3e-72
WP_097361586.1|34827_35361_-|plate	phage baseplate assembly protein	plate	Q8HAB9	Salmonella_phage	98.9	1.8e-94
WP_097361587.1|35360_36419_-|plate	baseplate protein	plate	A0A192Y7L7	Salmonella_phage	99.1	4.3e-201
WP_097361588.1|36415_37756_-	DNA circularization protein	NA	A0A192Y5U9	Salmonella_phage	98.9	5.3e-249
WP_097361589.1|37789_40933_-|tail	phage tail tape measure protein	tail	Q8HAC2	Salmonella_phage	95.4	7.0e-292
WP_000497739.1|40922_41087_-	DUF2635 domain-containing protein	NA	Q8HAC6	Salmonella_phage	100.0	1.0e-24
WP_000779212.1|41090_41651_-	hypothetical protein	NA	A0A192Y5U4	Salmonella_phage	97.3	3.7e-103
WP_079953067.1|41647_42160_-	hypothetical protein	NA	Q8HAC8	Salmonella_phage	96.5	8.1e-89
WP_000702382.1|42131_42536_-|head	phage head closure protein	head	A0A192Y6C2	Salmonella_phage	88.1	9.3e-64
WP_000927721.1|42532_42856_-|head,tail	phage gp6-like head-tail connector protein	head,tail	U5P072	Shigella_phage	97.2	2.4e-54
WP_000601365.1|42858_43059_-	hypothetical protein	NA	S5FNU1	Shigella_phage	100.0	3.4e-27
WP_079781928.1|43108_44314_-|capsid	phage major capsid protein	capsid	A0A192Y5T6	Salmonella_phage	98.5	1.1e-221
WP_153789523.1|44328_44979_-|head,protease	HK97 family phage prohead protease	head,protease	Q8HAD3	Salmonella_phage	96.3	1.5e-116
WP_000466255.1|44956_46198_-|portal	phage portal protein	portal	U5P411	Shigella_phage	99.8	2.0e-242
WP_097361591.1|46197_46380_-	hypothetical protein	NA	Q8HAD5	Salmonella_phage	98.3	5.0e-25
WP_153789524.1|46391_46532_-	hypothetical protein	NA	Q8HAD6	Salmonella_phage	97.8	1.7e-17
WP_153789525.1|46580_48125_-|terminase	terminase large subunit	terminase	Q8HAD6	Salmonella_phage	99.6	7.4e-311
WP_079953069.1|48121_48616_-|terminase	phage terminase small subunit P27 family	terminase	Q8HAD7	Salmonella_phage	99.4	7.8e-89
WP_001135222.1|48746_49097_-	HNH endonuclease	NA	Q8SBD7	Shigella_phage	96.6	1.0e-63
WP_001292891.1|49157_49460_-	hypothetical protein	NA	Q8HA83	Salmonella_phage	97.0	5.1e-51
WP_000501908.1|49536_49824_-	TonB family protein	NA	H6WZK5	Escherichia_phage	50.0	7.6e-20
WP_001050801.1|50001_50547_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	58.1	2.8e-07
WP_001527046.1|51160_51505_-|holin	phage holin, lambda family	holin	Q8HA87	Salmonella_phage	100.0	5.3e-44
WP_070801491.1|52426_53239_+	DUF3800 domain-containing protein	NA	Q19UP3	Mannheimia_phage	47.0	1.4e-63
WP_080198751.1|53530_54346_-	antitermination protein	NA	A0A1B5FPA5	Escherichia_phage	74.2	1.8e-106
WP_097361593.1|54342_55203_-	helix-turn-helix domain containing protein	NA	A0A1B5FPA6	Escherichia_phage	80.6	8.7e-128
WP_097361594.1|55202_56171_-	DNA primase	NA	A0A1B5FPA8	Escherichia_phage	87.9	7.0e-166
WP_097361595.1|56167_57772_-	DEAD/DEAH box helicase	NA	A0A1B5FPA4	Escherichia_phage	85.4	1.2e-274
WP_079953078.1|58831_59488_+	LexA family transcriptional regulator	NA	Q8W648	Enterobacteria_phage	74.3	1.8e-93
WP_000560246.1|59628_59826_+	hypothetical protein	NA	NA	NA	NA	NA
WP_097361596.1|59828_60020_+	hypothetical protein	NA	A0A1B5FPB5	Escherichia_phage	53.2	1.4e-09
WP_079953080.1|60093_60288_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000155900.1|60284_60470_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079916472.1|60657_60867_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079953081.1|60790_61207_+	hypothetical protein	NA	A0A1B5FPB3	Escherichia_phage	56.4	7.2e-27
WP_097361597.1|61206_61407_+	hypothetical protein	NA	A0A1B5FPB7	Escherichia_phage	71.7	1.9e-14
WP_079953083.1|61437_62343_+	ORF6N domain-containing protein	NA	F1C5A3	Cronobacter_phage	77.6	2.9e-129
WP_070801904.1|62339_62906_+	hypothetical protein	NA	A0A088C4R7	Shewanella_sp._phage	39.4	1.8e-28
WP_079953084.1|62902_63127_+	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	65.8	1.2e-17
WP_079953085.1|63123_63588_+	ATPase	NA	A0A1B5FPC7	Escherichia_phage	51.7	4.4e-41
WP_000202173.1|63587_63803_+	hypothetical protein	NA	A0A248XD10	Klebsiella_phage	43.1	1.6e-06
WP_070789913.1|63953_64196_+	excisionase family protein	NA	A0A286S2A4	Klebsiella_phage	68.4	1.1e-22
WP_097361598.1|64221_65547_+|integrase	site-specific integrase	integrase	Q20GI2	Phage_258-320	64.5	1.1e-164
WP_079953089.1|66038_67589_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	32.9	3.0e-09
WP_079953095.1|71574_71988_+|transposase	transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	38.5	5.8e-13
71698:71714	attR	AATGATAACCTGCTGTT	NA	NA	NA	NA
WP_079953096.1|71987_72308_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	65.6	2.3e-33
WP_097361599.1|73333_74239_+	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	58.8	6.2e-84
WP_058644812.1|74405_75494_+	quinol oxidase	NA	NA	NA	NA	NA
WP_097361600.1|76467_77670_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	72.5	8.9e-78
WP_079953100.1|77609_77894_-	hypothetical protein	NA	NA	NA	NA	NA
WP_097361601.1|77922_78678_-	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	41.8	3.8e-42
WP_097361602.1|81913_84115_-	ferric aerobactin receptor IutA	NA	NA	NA	NA	NA
WP_023247018.1|84140_85475_-	NADPH-dependent L-lysine N(6)-monooxygenase	NA	NA	NA	NA	NA
WP_097361603.1|85478_87212_-	aerobactin synthase IucC	NA	NA	NA	NA	NA
WP_097361604.1|87211_88159_-	N(6)-hydroxylysine O-acetyltransferase	NA	NA	NA	NA	NA
WP_153789526.1|88159_89884_-	aerobactin synthase IucA	NA	NA	NA	NA	NA
WP_097361605.1|90016_91228_+	MFS transporter	NA	NA	NA	NA	NA
WP_097361606.1|91243_92131_+	siderophore-interacting protein	NA	NA	NA	NA	NA
WP_023247011.1|93836_94373_+	fimbrial protein	NA	NA	NA	NA	NA
WP_079953106.1|94498_95161_+	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_097361607.1|95171_97718_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_097361662.1|97848_98901_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_097361608.1|99063_99516_+	C-lysozyme inhibitor	NA	NA	NA	NA	NA
WP_057394607.1|99655_100030_+	DUF1090 domain-containing protein	NA	NA	NA	NA	NA
WP_047643234.1|100213_100540_-	nucleoside transporter	NA	NA	NA	NA	NA
WP_077917243.1|100561_101188_-	ParB-like nuclease domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	50.5	4.1e-50
WP_097361454.1|101184_102414_-	DUF3440 domain-containing protein	NA	A0A068F1U8	Mycobacterium_phage	34.1	1.7e-60
WP_097361455.1|102407_103139_-	hypothetical protein	NA	NA	NA	NA	NA
WP_097361456.1|103128_103659_-	CaiF/GrlA family transcriptional regulator	NA	NA	NA	NA	NA
WP_000984349.1|104181_104652_-	DUF2919 family protein	NA	NA	NA	NA	NA
WP_097361609.1|113481_115278_-	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	NA	NA	NA	NA
WP_000493286.1|116414_116744_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A088CBP5	Shigella_phage	44.2	2.4e-09
WP_057394952.1|116724_117006_+	helix-turn-helix transcriptional regulator	NA	A0A2I6TC97	Escherichia_phage	39.1	5.9e-09
WP_097361610.1|117895_119647_+	colicin	NA	NA	NA	NA	NA
WP_057394954.1|119649_119913_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_057394955.1|119996_120143_+|lysis	colicin release lysis protein	lysis	NA	NA	NA	NA
WP_097361611.1|120666_123663_-|transposase	Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	64.2	0.0e+00
WP_057393714.1|123826_124399_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	86.8	8.2e-82
WP_057393711.1|124519_124972_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_097361612.1|125003_126536_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_079953337.1|126532_126802_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057394178.1|128454_128727_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057393724.1|130971_133074_+	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	34.6	8.1e-10
WP_057393723.1|133212_133821_+	recombinase family protein	NA	A0A1S5Y2X8	uncultured_archaeal_virus	33.9	1.2e-17
WP_057393721.1|134309_134654_+	hypothetical protein	NA	NA	NA	NA	NA
WP_097361613.1|135961_137109_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	92.2	4.3e-146
WP_097361614.1|137169_137442_-|bacteriocin	colicin-V (microcin-V bacteriocin)	bacteriocin	NA	NA	NA	NA
WP_139760163.1|137712_139827_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	27.8	2.7e-37
WP_097361615.1|139801_141043_-	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_097361663.1|141700_143251_-	MchC protein	NA	NA	NA	NA	NA
WP_057393929.1|146531_147224_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
