The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP052766	Alteromonas pelagimontana strain 5.12 chromosome, complete genome	4314189	324789	423361	4314189	head,tail,terminase,portal,integrase,transposase,capsid	Vibrio_phage(22.73%)	81	323918:323964	390717:390763
323918:323964	attL	ATGGTGCGTCTAGCCTGATTCGAACAGGCGACCTCTACCATGTCAAG	NA	NA	NA	NA
WP_097349138.1|324789_325957_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	41.5	1.1e-56
WP_097349226.1|327164_328363_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	60.5	1.5e-109
WP_097349266.1|328425_329988_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075609115.1|329992_333142_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_075609113.1|333783_335826_-	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_075609112.1|335818_337384_-	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_075609111.1|337538_337805_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075609110.1|337949_343859_-	DEAD/DEAH box helicase	NA	A0A1B1IUF6	uncultured_Mediterranean_phage	23.8	3.6e-87
WP_075609109.1|343851_347196_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075609108.1|347443_348436_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075609107.1|348442_350092_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075609106.1|350125_353212_-	DEAD/DEAH box helicase	NA	A0A2H4J643	uncultured_Caudovirales_phage	24.6	2.2e-40
WP_097349265.1|353651_354158_+	BrxE family protein	NA	NA	NA	NA	NA
WP_075609104.1|354160_354937_+	DUF1819 family protein	NA	NA	NA	NA	NA
WP_075609103.1|354923_355118_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075607115.1|355224_356205_-|transposase	IS5 family transposase	transposase	Q38213	Escherichia_phage	82.2	5.1e-156
WP_075609102.1|356213_356705_+	DUF1788 domain-containing protein	NA	NA	NA	NA	NA
WP_075609101.1|360281_362345_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075609100.1|362344_364291_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083638402.1|364284_366837_+	PglZ domain-containing protein	NA	NA	NA	NA	NA
WP_075609099.1|368962_370534_-	NERD domain-containing protein	NA	NA	NA	NA	NA
WP_075609098.1|370537_372076_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075609097.1|372072_373278_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075609096.1|373277_375122_-	DUF1998 domain-containing protein	NA	NA	NA	NA	NA
WP_170669097.1|375118_377584_-	helicase	NA	NA	NA	NA	NA
WP_075609094.1|378605_379211_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075609093.1|379449_380100_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075609092.1|380117_380819_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075609091.1|380907_381411_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075609090.1|381559_382600_+	WYL domain-containing protein	NA	NA	NA	NA	NA
WP_075609089.1|382596_383682_-	cell division protein FtsZ	NA	NA	NA	NA	NA
WP_170668998.1|384006_384174_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075609088.1|384249_385101_-	HD domain-containing protein	NA	NA	NA	NA	NA
WP_075609087.1|385174_386395_-	DUF3596 domain-containing protein	NA	A0A1W6JTA0	Pseudomonas_phage	27.9	2.0e-32
WP_061485455.1|386387_386624_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083638399.1|386723_386945_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_075609085.1|387020_388220_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075609084.1|388850_389429_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075609083.1|389645_390470_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075609082.1|391085_391280_+	hypothetical protein	NA	NA	NA	NA	NA
390717:390763	attR	ATGGTGCGTCTAGCCTGATTCGAACAGGCGACCTCTACCATGTCAAG	NA	NA	NA	NA
WP_075609081.1|391411_392029_+	PEP-CTERM sorting domain-containing protein	NA	NA	NA	NA	NA
WP_075609080.1|392074_393112_-	DUF5011 domain-containing protein	NA	NA	NA	NA	NA
WP_075609079.1|393104_394745_-	DUF5011 domain-containing protein	NA	NA	NA	NA	NA
WP_075609078.1|394748_395660_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075609077.1|395754_396330_+	PEP-CTERM sorting domain-containing protein	NA	NA	NA	NA	NA
WP_075609076.1|396415_396880_-	type II toxin-antitoxin system death-on-curing family toxin	NA	NA	NA	NA	NA
WP_075609075.1|396906_397182_-	hypothetical protein	NA	NA	NA	NA	NA
WP_170668999.1|397376_397685_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075609073.1|397761_401910_-	hypothetical protein	NA	J9QGS3	Pectobacterium_phage	24.1	5.7e-07
WP_075609072.1|401913_402546_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075609071.1|402542_403133_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075609070.1|403129_405616_-	hypothetical protein	NA	A0A2H4PI09	Pseudomonas_phage	28.2	4.9e-46
WP_170669000.1|405608_405755_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075609069.1|405901_406198_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075609068.1|406206_407127_-	hypothetical protein	NA	G8EY04	Synechococcus_phage	32.8	2.0e-37
WP_075609067.1|407269_407704_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075609066.1|407696_407984_-	hypothetical protein	NA	NA	NA	NA	NA
WP_170669001.1|407986_408151_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075609065.1|408191_409223_-|capsid	major capsid protein	capsid	K7PGW9	Enterobacteria_phage	46.7	2.9e-77
WP_075609064.1|409234_409594_-|head	head decoration protein	head	NA	NA	NA	NA
WP_075609063.1|409593_410865_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	38.2	1.5e-59
WP_075610038.1|410882_412457_-|portal	phage portal protein	portal	A0A2D1GMV5	Marinobacter_phage	59.9	1.1e-176
WP_075609062.1|412492_412708_-	hypothetical protein	NA	A0A2D1GN20	Marinobacter_phage	47.5	1.6e-06
WP_083638397.1|412694_414644_-|terminase	phage terminase large subunit family protein	terminase	A0A1B0Z2K0	Pseudomonas_phage	45.9	5.2e-152
WP_075609061.1|414609_415125_-|terminase	terminase small subunit	terminase	O64316	Escherichia_phage	35.0	1.0e-22
WP_075609060.1|415315_415927_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_075609059.1|415939_416284_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075609058.1|416315_416837_-	hypothetical protein	NA	A0A2I7RSZ4	Vibrio_phage	41.4	1.4e-16
WP_075609057.1|416833_417070_-	hypothetical protein	NA	A0A2I7RFR7	Vibrio_phage	39.1	1.0e-06
WP_075609056.1|417066_417504_-	peptidase	NA	A0A1B1IPM8	uncultured_Mediterranean_phage	46.0	8.6e-31
WP_075609055.1|417684_418326_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139316235.1|418345_418783_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075609053.1|418721_419009_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_075609052.1|419024_419594_-	recombination protein NinG	NA	A0A2I7RR86	Vibrio_phage	48.1	1.8e-44
WP_075609051.1|419594_419813_-	hypothetical protein	NA	A0A2I7RXB3	Vibrio_phage	45.9	6.6e-08
WP_139316234.1|419805_420261_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139316233.1|420233_420911_-	hypothetical protein	NA	NA	NA	NA	NA
WP_170669002.1|420907_421084_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083638395.1|421080_421659_-	adenine methylase	NA	A0A2I7RGA2	Vibrio_phage	63.2	9.8e-67
WP_075609047.1|421640_421925_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075609046.1|421921_423361_-	replicative DNA helicase	NA	A0A077SK18	Escherichia_phage	44.3	2.4e-90
>prophage 2
NZ_CP052766	Alteromonas pelagimontana strain 5.12 chromosome, complete genome	4314189	430041	435990	4314189		uncultured_Caudovirales_phage(50.0%)	10	NA	NA
WP_170669004.1|430041_431043_+	hypothetical protein	NA	A0A0U4B0I3	Pseudomonas_phage	54.3	8.3e-29
WP_083638393.1|431039_431468_+	hypothetical protein	NA	K7PMJ0	Enterobacteria_phage	45.9	1.1e-06
WP_075609033.1|431464_431677_+	hypothetical protein	NA	NA	NA	NA	NA
WP_139316231.1|431683_431866_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075609031.1|431948_432236_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075609030.1|432228_432987_+	recombinase RecT	NA	A0A2H4IZU8	uncultured_Caudovirales_phage	43.7	6.4e-50
WP_075609029.1|432983_434675_+	YqaJ viral recombinase family protein	NA	A0A2H4J6P1	uncultured_Caudovirales_phage	45.2	4.7e-85
WP_075609028.1|434674_434950_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_075609027.1|434959_435202_+	hypothetical protein	NA	A0A2H4JB60	uncultured_Caudovirales_phage	51.9	7.6e-13
WP_075610035.1|435447_435990_+	HNH endonuclease	NA	A0A1S5SAI9	Streptococcus_phage	40.5	5.5e-27
>prophage 3
NZ_CP052766	Alteromonas pelagimontana strain 5.12 chromosome, complete genome	4314189	3129035	3137439	4314189		Escherichia_phage(28.57%)	9	NA	NA
WP_075610690.1|3129035_3130055_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	48.6	3.6e-88
WP_075610825.1|3130057_3130354_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075610689.1|3130460_3131978_-	peptide MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	41.2	1.1e-96
WP_075610824.1|3132205_3133294_-	dTDP-glucose 4,6-dehydratase	NA	A0A291LAD7	Escherichia_phage	44.4	3.7e-83
WP_075610688.1|3133311_3134172_-	dTDP-4-dehydrorhamnose reductase	NA	A0A1D8EQE2	Escherichia_phage	33.1	1.1e-26
WP_075610687.1|3134190_3134739_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	53.3	1.8e-49
WP_075610686.1|3134741_3135626_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	58.4	6.5e-94
WP_075610685.1|3135635_3136748_-	capsule biosynthesis protein	NA	NA	NA	NA	NA
WP_075610684.1|3136779_3137439_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.9	4.8e-09
>prophage 4
NZ_CP052766	Alteromonas pelagimontana strain 5.12 chromosome, complete genome	4314189	3907601	3968657	4314189	bacteriocin,holin,protease,tRNA,transposase	uncultured_Mediterranean_phage(25.0%)	54	NA	NA
WP_075609639.1|3907601_3908579_+|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
WP_075609638.1|3908696_3908966_+	30S ribosomal protein S15	NA	NA	NA	NA	NA
WP_075609637.1|3909373_3910156_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075609636.1|3910469_3912020_-	bifunctional GNAT family N-acetyltransferase/carbon-nitrogen hydrolase family protein	NA	M1HHT1	Paramecium_bursaria_Chlorella_virus	25.0	4.7e-07
WP_075609635.1|3912311_3912986_+	2OG-Fe(II) oxygenase	NA	NA	NA	NA	NA
WP_075609634.1|3913366_3914308_+	diguanylate cyclase	NA	NA	NA	NA	NA
WP_075609633.1|3914883_3915447_+	alkyl hydroperoxide reductase subunit C	NA	NA	NA	NA	NA
WP_075609632.1|3915531_3917124_+	alkyl hydroperoxide reductase subunit F	NA	G3MA85	Bacillus_virus	34.3	8.8e-41
WP_083638473.1|3917588_3918683_+	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_075609631.1|3918859_3921058_-	YgiQ family radical SAM protein	NA	M1QSD9	Pseudomonas_phage	72.1	1.2e-101
WP_075609630.1|3921255_3921726_+	EVE domain-containing protein	NA	NA	NA	NA	NA
WP_075609629.1|3921840_3924252_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075609628.1|3924484_3925120_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075609627.1|3925116_3925926_+	DUF3307 domain-containing protein	NA	NA	NA	NA	NA
WP_075609626.1|3925974_3926481_-|protease	retroviral-like aspartic protease family protein	protease	NA	NA	NA	NA
WP_097349239.1|3926775_3927150_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075609625.1|3927520_3928708_-	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_075609624.1|3928724_3929885_-	NnrS family protein	NA	NA	NA	NA	NA
WP_083638469.1|3929887_3930127_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075609622.1|3930278_3931847_+	nitric oxide reductase transcriptional regulator NorR	NA	NA	NA	NA	NA
WP_075610087.1|3932171_3932579_+	azurin	NA	NA	NA	NA	NA
WP_075609621.1|3933509_3933824_-	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_075609620.1|3934266_3934671_-	SRPBCC family protein	NA	NA	NA	NA	NA
WP_075609619.1|3934933_3936190_+	2,4-dienoyl-CoA reductase	NA	NA	NA	NA	NA
WP_075610086.1|3936214_3936691_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.1	2.4e-26
WP_075609618.1|3936864_3937293_+	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_075609617.1|3937292_3937637_+	RnfH family protein	NA	NA	NA	NA	NA
WP_075609616.1|3937639_3938119_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_075609615.1|3938152_3940162_-|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	26.3	1.3e-25
WP_075609614.1|3940453_3943093_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_075609613.1|3943360_3945325_+	sulfotransferase	NA	NA	NA	NA	NA
WP_075609612.1|3945361_3946174_-	kinase/pyrophosphorylase	NA	NA	NA	NA	NA
WP_075610085.1|3946367_3948740_+	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	38.1	3.7e-176
WP_139316247.1|3948920_3949100_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083638468.1|3949148_3949274_-|bacteriocin	class IIb bacteriocin, lactobin A/cerein 7B family	bacteriocin	NA	NA	NA	NA
WP_083638466.1|3949295_3949445_-|bacteriocin	class IIb bacteriocin, lactobin A/cerein 7B family	bacteriocin	NA	NA	NA	NA
WP_075610083.1|3949764_3952809_+	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_075609611.1|3953063_3953306_+	twin-arginine translocase TatA/TatE family subunit	NA	A0A1B1IVR9	uncultured_Mediterranean_phage	53.1	2.8e-07
WP_075609610.1|3953308_3953725_+	preprotein translocase subunit TatB	NA	NA	NA	NA	NA
WP_075609609.1|3953721_3954513_+	twin-arginine translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	43.3	2.1e-51
WP_075609608.1|3954686_3956120_+	DUF839 domain-containing protein	NA	NA	NA	NA	NA
WP_075609607.1|3956193_3956757_+	PEP-CTERM sorting domain-containing protein	NA	NA	NA	NA	NA
WP_075609606.1|3956877_3957297_+	DUF4826 family protein	NA	NA	NA	NA	NA
WP_075609605.1|3957313_3957772_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_075610082.1|3957852_3958998_-	hypothetical protein	NA	NA	NA	NA	NA
WP_170669086.1|3959049_3960258_-	adenylate/guanylate cyclase domain-containing protein	NA	NA	NA	NA	NA
WP_075609603.1|3960321_3961695_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	45.3	5.0e-109
WP_075609602.1|3961709_3962336_-	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_075609601.1|3962335_3963457_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_075609600.1|3963632_3964181_-	rRNA large subunit pseudouridine synthase E	NA	NA	NA	NA	NA
WP_075609599.1|3964613_3966839_+	NADP-dependent isocitrate dehydrogenase	NA	NA	NA	NA	NA
WP_075609268.1|3967287_3967722_-|transposase	IS200/IS605 family transposase	transposase	A0A0H3UZM0	Geobacillus_virus	28.8	6.8e-12
WP_075609597.1|3967912_3968131_-	cold shock domain-containing protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.5	2.7e-17
WP_075609596.1|3968336_3968657_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	46.9	3.8e-12
