The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP030919	Escherichia coli strain KL53 chromosome, complete genome	4810511	355	59140	4810511	protease,tail,transposase,integrase,capsid	Enterobacteria_phage(16.67%)	57	16168:16181	60005:60018
WP_097360141.1|355_859_-|tail	tail fiber protein	tail	Q9MCR6	Enterobacteria_phage	66.4	3.0e-43
WP_085948620.1|1048_2262_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.3	1.4e-168
WP_097360142.1|2250_2757_+	recombinase family protein	NA	A0A1S6L009	Salmonella_phage	81.3	1.6e-65
WP_001310555.1|3148_4165_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.7	9.8e-187
WP_000246052.1|4689_5433_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_033801630.1|6647_6863_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033801631.1|6859_7219_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033801632.1|7235_8267_+|capsid	phage capsid E family protein	capsid	NA	NA	NA	NA
WP_033801633.1|8388_8586_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045148748.1|8578_10444_+	cell envelope integrity protein TolA	NA	A0A1D7XFE4	Escherichia_phage	31.7	2.5e-63
WP_033801635.1|10782_11061_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033801639.1|11096_12311_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_000854680.1|12850_13192_-	type IV toxin-antitoxin system toxin YkfI	NA	NA	NA	NA	NA
WP_000070396.1|13212_13530_-	type IV toxin-antitoxin system antitoxin YafW	NA	NA	NA	NA	NA
WP_000691994.1|13548_13770_-	DUF987 domain-containing protein	NA	NA	NA	NA	NA
WP_000811693.1|13778_14255_-	RadC family protein	NA	NA	NA	NA	NA
WP_000211838.1|14270_14729_-	antirestriction protein	NA	A9J566	Pseudomonas_phage	32.8	2.0e-14
WP_000194654.1|14826_15066_-	DUF905 domain-containing protein	NA	NA	NA	NA	NA
WP_057107658.1|15142_15610_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016239438.1|15633_16077_-	phage transcriptional regulator	NA	NA	NA	NA	NA
WP_057107659.1|16076_16313_-	hypothetical protein	NA	NA	NA	NA	NA
16168:16181	attL	GCAACACTGGCAGC	NA	NA	NA	NA
WP_023326104.1|16353_17055_-	WYL domain-containing protein	NA	NA	NA	NA	NA
WP_085381467.1|17271_18093_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	39.1	3.6e-46
WP_001065555.1|18184_19048_-	GTPase family protein	NA	NA	NA	NA	NA
WP_016156528.1|20963_22115_-|protease	trypsin-like serine protease	protease	A0A1B1IT49	uncultured_Mediterranean_phage	30.3	9.9e-26
WP_114161593.1|22139_23105_-|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_000843382.1|23082_23580_-	heat resistance protein PsiE-GI	NA	NA	NA	NA	NA
WP_001295706.1|23576_25292_-	heat resistance system K+/H+ antiporter KefB-GI	NA	NA	NA	NA	NA
WP_000786815.1|25295_25736_-	heat resistance system thioredoxin Trx-GI	NA	A0A1J0GW78	Streptomyces_phage	37.2	5.8e-11
WP_001090787.1|26951_27563_-	heat resistance membrane protein HdeD-GI	NA	NA	NA	NA	NA
WP_001005473.1|27652_28540_-	heat resistance protein YfdX2	NA	NA	NA	NA	NA
WP_001022485.1|28642_29557_-	heat resistance protein YfdX1	NA	NA	NA	NA	NA
WP_001275372.1|29579_30038_-	small heat shock protein sHSP20-GI	NA	NA	NA	NA	NA
WP_097360108.1|30125_31853_-	ATP-dependent metallopeptidase FtsH/Yme1/Tma family protein	NA	C7U047	Ostreococcus_tauri_virus	37.7	5.7e-86
WP_001295707.1|31913_32105_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001548197.1|32104_35020_-	heat shock survival AAA family ATPase ClpK	NA	K4FB40	Cronobacter_phage	41.2	1.2e-128
WP_057107661.1|35125_35695_-	small heat shock protein sHSP20	NA	NA	NA	NA	NA
WP_000643630.1|35729_36011_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001295708.1|36240_36504_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157108328.1|36518_36782_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_097360109.1|37108_38299_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	48.6	1.6e-47
WP_001254932.1|39220_40372_-|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
WP_000543446.1|41820_42774_+	3-carboxyethylcatechol 2,3-dioxygenase	NA	NA	NA	NA	NA
WP_000222149.1|42802_43669_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_000044265.1|44484_45435_+	acetaldehyde dehydrogenase (acetylating)	NA	E5EQ71	Micromonas_sp._RCC1109_virus	36.0	5.3e-33
WP_001013515.1|45431_46445_+	4-hydroxy-2-oxovalerate aldolase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	30.8	1.2e-43
WP_085381464.1|46514_47726_+	3-(3-hydroxy-phenyl)propionate transporter MhpT	NA	NA	NA	NA	NA
WP_057107709.1|48000_49404_+	S-methylmethionine permease	NA	NA	NA	NA	NA
WP_044864534.1|49390_50323_+	homocysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_000192349.1|50431_51478_-	ferric ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.7	1.5e-33
WP_000806869.1|53144_53354_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000996197.1|53353_53728_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000583449.1|53744_54773_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001091092.1|54925_55123_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000891724.1|55157_56999_+	hypothetical protein	NA	A0A140G5Z0	Enterobacteria_phage	27.0	2.7e-17
WP_001240677.1|57046_57724_+	hypothetical protein	NA	A0A1D7XFF4	Escherichia_phage	51.3	8.6e-46
WP_032165029.1|57805_59140_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
60005:60018	attR	GCAACACTGGCAGC	NA	NA	NA	NA
>prophage 2
NZ_CP030919	Escherichia coli strain KL53 chromosome, complete genome	4810511	664141	759324	4810511	plate,tRNA,protease,capsid,tail,portal,holin,lysis,head,integrase,terminase	Escherichia_phage(45.76%)	88	669436:669453	737230:737247
WP_000520781.1|664141_664462_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_000934041.1|664492_666769_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
WP_001040187.1|667453_667672_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_001241678.1|667956_668661_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001202175.1|668702_670424_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	25.4	9.9e-22
669436:669453	attL	TGGGTATCAGGAAAGGTG	NA	NA	NA	NA
WP_001043598.1|670424_672191_-	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.3	7.0e-23
WP_000537418.1|672313_673279_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	8.5e-63
WP_000228473.1|673823_674318_+	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_000077038.1|674452_678442_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
WP_001295343.1|678600_679212_+	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_044864092.1|679222_680566_+	replication-associated recombination protein RarA	NA	G3MBE0	Bacillus_virus	40.8	1.6e-80
WP_000886683.1|680656_681949_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
WP_000850303.1|682187_684632_+	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.8	6.6e-221
WP_000213098.1|684642_685260_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	60.6	5.0e-77
WP_097359997.1|685261_686125_+	dimethyl sulfoxide reductase anchor subunit DmsC	NA	NA	NA	NA	NA
WP_000165879.1|686159_686786_-	hydrolase	NA	NA	NA	NA	NA
WP_000109259.1|687099_688248_+	MFS transporter	NA	NA	NA	NA	NA
WP_000067979.1|689631_690429_-	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.6	1.3e-21
WP_000023390.1|690460_691456_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0F7LBR0	Escherichia_phage	100.0	5.4e-190
WP_001389238.1|691549_691849_-	helix-turn-helix transcriptional regulator	NA	Q1JS29	Enterobacteria_phage	100.0	3.0e-51
WP_001389237.1|691957_692314_+	hypothetical protein	NA	Q1JS28	Enterobacteria_phage	99.2	1.5e-62
WP_000217671.1|692491_692992_+	hypothetical protein	NA	S4TTB7	Salmonella_phage	99.4	1.7e-91
WP_000557703.1|693055_693280_+	DUF2732 family protein	NA	S4TP68	Salmonella_phage	100.0	4.7e-33
WP_097360090.1|693279_693582_+	DUF5405 family protein	NA	A0A0F7LDT6	Escherichia_phage	96.0	5.5e-45
WP_001113264.1|693581_693806_+	TraR/DksA family transcriptional regulator	NA	S4TRY6	Salmonella_phage	100.0	2.9e-35
WP_021540634.1|693802_694078_+	DUF5405 family protein	NA	M1TAP2	Escherichia_phage	98.9	8.6e-45
WP_097360089.1|694067_696353_+	replication endonuclease	NA	A0A0F7LBQ2	Escherichia_phage	98.7	0.0e+00
WP_001563630.1|696709_698215_+	hypothetical protein	NA	Q858T2	Yersinia_virus	28.3	1.5e-05
WP_097320728.1|698284_699169_+	DNA adenine methylase	NA	NA	NA	NA	NA
WP_000038182.1|699504_700539_-|portal	phage portal protein	portal	Q858W8	Yersinia_virus	99.7	2.4e-201
WP_000156861.1|700538_702311_-|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCK3	Escherichia_phage	99.8	0.0e+00
WP_001085948.1|702484_703339_+|capsid	GPO family capsid scaffolding protein	capsid	Q94MB7	Escherichia_virus	89.4	1.7e-139
WP_001774099.1|703397_704471_+|capsid	phage major capsid protein, P2 family	capsid	Q94MC7	Enterobacteria_phage	99.7	3.0e-202
WP_089079259.1|704474_705218_+|terminase	terminase endonuclease subunit	terminase	A0A0F7LBP7	Escherichia_phage	98.8	6.0e-125
WP_097360088.1|705317_705827_+|head	head completion/stabilization protein	head	A0A0F7LDJ1	Escherichia_phage	99.4	2.5e-90
WP_000846409.1|705826_706030_+|tail	tail protein X	tail	A0A0F7LCN2	Escherichia_phage	100.0	3.0e-31
WP_000123123.1|706033_706315_+|holin	holin	holin	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
WP_001144101.1|706314_706812_+	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	100.0	3.1e-93
WP_080066273.1|706826_707252_+	protein lysA	NA	A0A0F7LBP4	Escherichia_phage	96.5	8.6e-60
WP_078214776.1|707239_707665_+|lysis	LysB family phage lysis regulatory protein	lysis	U5N3W5	Enterobacteria_phage	97.2	9.4e-67
WP_001119522.1|707651_707810_+	hypothetical protein	NA	A0A0F7LCN5	Escherichia_phage	100.0	2.6e-22
WP_000917180.1|707772_708240_+|tail	phage tail protein	tail	Q7Y4E0	Escherichia_virus	98.7	4.3e-81
WP_001001782.1|708232_708685_+	phage virion morphogenesis protein	NA	A0A0F7LBV9	Escherichia_phage	99.3	4.1e-76
WP_089079261.1|708751_709387_+|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	96.7	4.6e-110
WP_000127158.1|709383_709731_+|plate	baseplate assembly protein	plate	A0A0F7L9X3	Escherichia_phage	99.1	5.0e-58
WP_001735425.1|709735_710644_+|plate	baseplate assembly protein	plate	U5N3T9	Enterobacteria_phage	99.7	4.4e-162
WP_001285340.1|710636_711248_+|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	100.0	1.7e-117
WP_097360087.1|711244_712429_+|tail	phage tail protein	tail	A0A0F7LBW5	Escherichia_phage	77.2	2.2e-161
WP_001174919.1|712431_712872_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	66.7	1.5e-51
WP_114161594.1|712843_713437_-|tail	tail fiber assembly protein	tail	Q9MCR5	Enterobacteria_phage	62.9	1.3e-58
WP_097320612.1|713436_714006_-|tail	phage tail protein	tail	K7PH60	Enterobacterial_phage	58.1	1.0e-44
WP_000905100.1|714036_714630_+	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	98.0	1.2e-104
WP_001286716.1|714689_715880_+|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	100.0	1.6e-225
WP_001251405.1|715892_716411_+|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	99.4	5.5e-93
WP_001031303.1|716467_716743_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
WP_000785970.1|716775_716895_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_097360001.1|716887_719335_+|tail	phage tail tape measure protein	tail	M1T2S3	Escherichia_phage	94.6	0.0e+00
WP_085440879.1|719349_719829_+|tail	phage tail protein	tail	O64315	Escherichia_phage	97.5	1.3e-83
WP_097360002.1|719828_720992_+	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	99.5	5.4e-205
WP_139508511.1|721073_721292_+	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	98.6	1.0e-37
WP_001292822.1|721610_723893_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.5	1.0e-162
WP_000642546.1|723947_724805_-	formate transporter FocA	NA	NA	NA	NA	NA
WP_097360004.1|725210_726971_-	30S ribosomal protein S12 methylthiotransferase accessory protein YcaO	NA	NA	NA	NA	NA
WP_000642849.1|727100_727793_+	DUF421 domain-containing protein	NA	NA	NA	NA	NA
WP_000057138.1|727991_729080_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	46.8	3.5e-81
WP_000445231.1|729150_730434_+	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_001295345.1|730602_731367_+	metallopeptidase YcaL	NA	NA	NA	NA	NA
WP_000125016.1|731539_732223_+	(d)CMP kinase	NA	NA	NA	NA	NA
WP_000140327.1|732333_734007_+	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_000167336.1|734166_734451_+	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	3.2e-10
WP_000705764.1|734658_736923_+	ComEC family protein	NA	NA	NA	NA	NA
WP_000551270.1|736959_738708_+	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	29.8	2.5e-57
737230:737247	attR	TGGGTATCAGGAAAGGTG	NA	NA	NA	NA
WP_000570539.1|738704_739691_+	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_085381373.1|739727_740960_+	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000350058.1|741011_741194_+	protein YcaR	NA	NA	NA	NA	NA
WP_000011603.1|741190_741937_+	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000436922.1|742090_742984_+	YcbJ family phosphotransferase	NA	NA	NA	NA	NA
WP_000899600.1|742960_743740_-	envelope biogenesis factor ElyC	NA	NA	NA	NA	NA
WP_001298300.1|743875_744661_+|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
WP_001288850.1|744657_745980_+	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_001295347.1|745960_746665_+	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_085381374.1|746664_751125_+	chromosome partition protein MukB	NA	NA	NA	NA	NA
WP_000925985.1|751385_753233_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_001295932.1|753413_753962_+	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	7.0e-06
WP_001109486.1|753988_754636_+	hydroxyacylglutathione hydrolase GloC	NA	NA	NA	NA	NA
WP_000462687.1|754857_756048_-	aspartate transaminase	NA	NA	NA	NA	NA
WP_000977920.1|756232_757321_-	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	54.3	1.8e-98
WP_085381376.1|757923_759324_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	35.9	2.6e-81
>prophage 3
NZ_CP030919	Escherichia coli strain KL53 chromosome, complete genome	4810511	1064701	1150713	4810511	protease,tRNA,tail,portal,holin,transposase,integrase,terminase	Enterobacteria_phage(49.18%)	99	1060638:1060652	1091184:1091198
1060638:1060652	attL	CTGTTCTGGAGGGGA	NA	NA	NA	NA
WP_096912110.1|1064701_1065895_+|integrase	site-specific integrase	integrase	K7PGY1	Enterobacteria_phage	99.5	2.5e-234
WP_008322518.1|1065887_1066088_-	hypothetical protein	NA	K7PM28	Enterobacteria_phage	82.5	1.9e-25
WP_016247081.1|1066133_1066376_-	DUF4060 family protein	NA	K7PHF4	Enterobacteria_phage	87.3	6.6e-33
WP_016247082.1|1066362_1066566_-	hypothetical protein	NA	A0A1B0VN94	Pseudomonas_phage	66.7	1.7e-10
WP_048998009.1|1066558_1066903_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016247084.1|1066937_1068029_-	recombinase RecT	NA	K7PKR8	Enterobacteria_phage	59.5	7.4e-116
WP_001548445.1|1068041_1071431_-	hypothetical protein	NA	K7P6V4	Enterobacteria_phage	94.0	0.0e+00
WP_001568763.1|1071743_1071950_-	hypothetical protein	NA	K7PM31	Enterobacteria_phage	100.0	1.5e-33
WP_000878219.1|1072603_1073470_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	2.3e-51
WP_000169527.1|1073466_1073766_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_001767223.1|1074194_1074476_-	hypothetical protein	NA	A4KWR2	Enterobacteria_phage	75.3	2.2e-32
WP_001472166.1|1074540_1074960_-	helix-turn-helix domain-containing protein	NA	A0A0M4R5D1	Salmonella_phage	77.1	3.1e-46
WP_001568772.1|1075032_1075251_+	hypothetical protein	NA	A0A0M4QX15	Salmonella_phage	64.8	1.5e-20
WP_001472167.1|1075262_1075820_+	hypothetical protein	NA	K7PJT7	Enterobacteria_phage	41.1	6.4e-23
WP_000072106.1|1075904_1076813_+	replication protein	NA	K7PGZ0	Enterobacteria_phage	100.0	1.2e-159
WP_000838082.1|1076809_1077499_+	Replication protein 14	NA	K7P7B6	Enterobacteria_phage	100.0	6.8e-131
WP_016066204.1|1077500_1077845_+	winged helix-turn-helix transcriptional regulator	NA	K7PHG5	Enterobacteria_phage	100.0	1.3e-58
WP_016066205.1|1077841_1078039_+	hypothetical protein	NA	K7PKS4	Enterobacteria_phage	100.0	2.6e-27
WP_016236990.1|1078035_1078581_+	ead/Ea22-like family protein	NA	K7P6V8	Enterobacteria_phage	93.3	1.5e-37
WP_016236991.1|1078582_1078786_+	hypothetical protein	NA	NA	NA	NA	NA
WP_097360119.1|1078789_1079239_+	DUF550 domain-containing protein	NA	S4TSR6	Salmonella_phage	89.5	4.8e-45
WP_016236993.1|1079292_1079613_+	hypothetical protein	NA	NA	NA	NA	NA
WP_097360118.1|1079868_1080519_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016236995.1|1080499_1081603_+	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_016236996.1|1081893_1082127_+	DinI family protein	NA	K7PM44	Enterobacteria_phage	98.7	6.6e-38
WP_016066207.1|1082244_1082493_+	hypothetical protein	NA	K7PHG9	Enterobacteria_phage	100.0	2.1e-42
WP_016066208.1|1082527_1083127_+	DUF1367 family protein	NA	K7PKS6	Enterobacteria_phage	100.0	5.7e-110
WP_077767420.1|1083132_1083333_+	hypothetical protein	NA	H6WRY8	Salmonella_phage	63.6	4.1e-20
WP_032160589.1|1083323_1083617_+	DUF1364 family protein	NA	K7P7Q1	Enterobacteria_phage	100.0	9.7e-47
WP_016063446.1|1083613_1083970_+	RusA family crossover junction endodeoxyribonuclease	NA	K7P6W0	Enterobacteria_phage	100.0	1.1e-65
WP_000801961.1|1083966_1084104_+	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	76.3	3.2e-08
WP_096912104.1|1084103_1084919_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	98.2	4.1e-143
WP_001568784.1|1085425_1085704_+|holin	holin	holin	K7PGZ9	Enterobacteria_phage	97.8	5.1e-45
WP_024192364.1|1085681_1086248_+	lysozyme	NA	K7P7Q3	Enterobacteria_phage	92.0	2.1e-98
WP_001568785.1|1086247_1086784_+	hypothetical protein	NA	K7P6W1	Enterobacteria_phage	93.3	2.6e-74
WP_001568787.1|1087358_1088261_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001704125.1|1088541_1089030_+	DUF1441 family protein	NA	K7PJY2	Enterobacterial_phage	100.0	3.1e-82
WP_001704124.1|1089029_1091132_+|terminase	phage terminase large subunit family protein	terminase	K7PH52	Enterobacterial_phage	98.7	0.0e+00
WP_001704123.1|1091128_1091344_+	hypothetical protein	NA	K7PMB5	Enterobacterial_phage	98.6	1.4e-31
1091184:1091198	attR	CTGTTCTGGAGGGGA	NA	NA	NA	NA
WP_001704122.1|1091340_1092840_+|portal	phage portal protein	portal	K7PHM5	Enterobacterial_phage	99.8	3.8e-288
WP_157918918.1|1092784_1094800_+|protease	Clp protease ClpP	protease	K7PKX4	Enterobacterial_phage	99.3	0.0e+00
WP_001704120.1|1094882_1095209_+	DUF2190 family protein	NA	K7PJY3	Enterobacterial_phage	98.1	3.9e-52
WP_032315004.1|1095201_1095477_+	DNA breaking-rejoining protein	NA	K7PH55	Enterobacterial_phage	96.2	5.9e-38
WP_020884618.1|1095486_1096065_+|tail	phage tail protein	tail	K7PMB7	Enterobacterial_phage	99.0	4.5e-96
WP_001704117.1|1096061_1096463_+|tail	tail protein	tail	K7PHM6	Enterobacterial_phage	100.0	4.1e-72
WP_032620582.1|1096472_1097216_+|tail	phage tail protein	tail	K7PKX6	Enterobacterial_phage	98.4	3.9e-132
WP_032620580.1|1097226_1097667_+|tail	phage minor tail protein G	tail	K7PJY4	Enterobacterial_phage	93.8	3.8e-71
WP_071842901.1|1097675_1097990_+|tail	phage tail assembly protein T	tail	E4WL32	Enterobacteria_phage	95.2	9.8e-53
WP_061353091.1|1097973_1101234_+|tail	phage tail tape measure protein	tail	K7PMB9	Enterobacterial_phage	96.5	0.0e+00
WP_001704112.1|1101230_1101569_+|tail	tail protein	tail	E4WL34	Enterobacteria_phage	100.0	2.3e-60
WP_001704111.1|1101625_1102363_+|tail	phage minor tail protein L	tail	M9NYX1	Enterobacteria_phage	99.6	1.2e-146
WP_001704110.1|1102365_1103085_+	C40 family peptidase	NA	K7PJY5	Enterobacterial_phage	99.2	1.8e-142
WP_001704109.1|1103077_1103695_+|tail	tail assembly protein	tail	M9NZA3	Enterobacteria_phage	99.5	1.5e-105
WP_081178102.1|1103737_1107229_+	host specificity protein J	NA	M9P0D8	Enterobacteria_phage	95.2	0.0e+00
WP_000323235.1|1107230_1107533_+	hypothetical protein	NA	K7PJT3	Enterobacteria_phage	100.0	5.7e-50
WP_081178100.1|1107532_1108207_+	hypothetical protein	NA	K7P7N1	Enterobacteria_phage	99.6	1.0e-123
WP_081178326.1|1108595_1109879_+	hypothetical protein	NA	K7P6I4	Enterobacteria_phage	49.5	2.9e-103
WP_081178098.1|1109987_1110227_+	hypothetical protein	NA	I6PD82	Cronobacter_phage	43.0	3.7e-12
WP_081178096.1|1110228_1110558_+	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	50.5	2.5e-22
WP_000891620.1|1110815_1111382_-	hydrolase	NA	NA	NA	NA	NA
WP_097359989.1|1111691_1113464_+|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_001300367.1|1113581_1114034_+	dihydroneopterin triphosphate diphosphatase	NA	NA	NA	NA	NA
WP_000907248.1|1114062_1114803_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_001295503.1|1114837_1115359_+	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.0e-10
WP_001024907.1|1115360_1115963_-	YebB family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_072094247.1|1116033_1116099_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000580323.1|1116237_1116849_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_000568519.1|1116857_1117868_+	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.5	5.6e-09
WP_000571480.1|1118208_1118994_-	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_000202990.1|1118990_1119746_-	zinc ABC transporter ATP-binding protein ZnuC	NA	G3M9Y6	Bacillus_virus	28.3	1.3e-18
WP_001300644.1|1119824_1120757_+	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_001184045.1|1120772_1122095_+	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	40.9	1.2e-14
WP_000448381.1|1122214_1123186_+	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
WP_000091148.1|1123316_1124759_-	pyruvate kinase	NA	NA	NA	NA	NA
WP_097359988.1|1124886_1125756_-	DNA-binding transcriptional regulator HexR	NA	NA	NA	NA	NA
WP_000301727.1|1126093_1127569_+	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	37.5	4.4e-79
WP_097359987.1|1127803_1129615_+	phosphogluconate dehydratase	NA	NA	NA	NA	NA
WP_000800512.1|1129651_1130293_+	bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase	NA	NA	NA	NA	NA
WP_000173449.1|1130348_1131527_-	formate-dependent phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
WP_000257738.1|1131660_1131951_+	DNA damage-inducible protein YebG	NA	NA	NA	NA	NA
WP_001295500.1|1132017_1132374_+	protein YebF	NA	NA	NA	NA	NA
WP_000024745.1|1132700_1133360_+	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_057107388.1|1133568_1135629_+	oligopeptidase B	NA	NA	NA	NA	NA
WP_000944256.1|1135625_1136288_-	exodeoxyribonuclease X	NA	Q6UAU3	Klebsiella_phage	41.6	2.0e-07
WP_000011660.1|1136311_1136968_-	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_000916763.1|1137069_1137300_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	1.3e-14
WP_000168738.1|1137438_1137813_+	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000879286.1|1137816_1138689_+	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000976472.1|1138701_1139043_+	YebY family protein	NA	NA	NA	NA	NA
WP_057107450.1|1139438_1140095_+	protein-serine/threonine phosphatase	NA	A0A2D1GLI5	Escherichia_phage	49.5	4.9e-54
WP_000929526.1|1140095_1140371_-	YebW family protein	NA	NA	NA	NA	NA
WP_001295499.1|1140391_1140628_-	DUF1480 family protein	NA	NA	NA	NA	NA
WP_024176540.1|1140745_1142185_-	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
WP_097359986.1|1142264_1144898_-	lipid-binding membrane homeostasis protein YebT	NA	NA	NA	NA	NA
WP_001207283.1|1144866_1146150_-	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
WP_001043882.1|1146279_1146777_+	L-methionine (R)-S-oxide reductase	NA	NA	NA	NA	NA
WP_000431370.1|1146873_1147572_+	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_001055778.1|1147591_1149640_+	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.5	1.2e-85
WP_000984517.1|1149831_1150713_+|protease	protease HtpX	protease	NA	NA	NA	NA
>prophage 4
NZ_CP030919	Escherichia coli strain KL53 chromosome, complete genome	4810511	1397194	1448107	4810511	protease,tail,lysis,transposase,integrase	Enterobacteria_phage(26.47%)	63	1391545:1391560	1424535:1424550
1391545:1391560	attL	TTCATAAAAATAATCC	NA	NA	NA	NA
WP_001260857.1|1397194_1398016_-|protease	serine protease	protease	NA	NA	NA	NA
WP_000233090.1|1398115_1398199_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000743952.1|1398291_1398627_-	acid shock protein	NA	NA	NA	NA	NA
WP_000091829.1|1399023_1400277_-	MFS transporter	NA	NA	NA	NA	NA
WP_001019531.1|1400383_1401277_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000225276.1|1401411_1402632_+	DNA-binding transcriptional repressor Mlc	NA	NA	NA	NA	NA
WP_000919231.1|1402756_1403452_+	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_072048910.1|1403404_1404697_-	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
WP_000148710.1|1404855_1405470_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
WP_000526503.1|1405512_1406367_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000213028.1|1406368_1406986_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_001340362.1|1406996_1409420_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	1.7e-208
WP_097360006.1|1409480_1411907_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.2	2.9e-213
WP_001300836.1|1412105_1412411_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_085947917.1|1412592_1413866_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.4e-177
WP_071586746.1|1413884_1414565_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001138581.1|1414567_1415128_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_044864500.1|1415162_1415504_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_000598292.1|1415638_1415965_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_001295394.1|1416170_1417385_+	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_000836064.1|1417396_1418416_+	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	26.2	5.7e-17
WP_001360138.1|1418473_1418584_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000876958.1|1418603_1419884_-|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	62.1	3.3e-155
WP_001296941.1|1419918_1420155_-	excisionase family protein	NA	S4TND0	Salmonella_phage	50.7	6.1e-15
WP_000048342.1|1420242_1422714_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.7	8.5e-59
WP_001083297.1|1422806_1422998_-|lysis	lysis protein YdfD	lysis	NA	NA	NA	NA
WP_000854559.1|1422994_1423183_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_085381401.1|1423278_1423620_+	hypothetical protein	NA	U5P0A0	Shigella_phage	56.1	8.2e-37
WP_001151262.1|1423660_1424083_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	92.0	4.4e-64
WP_001310834.1|1424079_1424436_+	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	69.6	1.6e-38
WP_072096395.1|1425549_1425768_+	hypothetical protein	NA	NA	NA	NA	NA
1424535:1424550	attR	GGATTATTTTTATGAA	NA	NA	NA	NA
WP_000955178.1|1425742_1425925_-	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	74.5	6.3e-12
WP_000589005.1|1426102_1427416_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_001301033.1|1427852_1428185_-	protein FlxA	NA	NA	NA	NA	NA
WP_001326990.1|1428387_1428693_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000534858.1|1428717_1428957_+	type II toxin-antitoxin system antitoxin RelB	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	54.4	1.6e-18
WP_000323025.1|1428956_1429244_+	type II toxin-antitoxin system mRNA interferase RelE	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	66.0	1.4e-29
WP_000813254.1|1429315_1429471_+	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_097360105.1|1429687_1429939_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012304870.1|1430005_1430284_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085948620.1|1430939_1432153_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.3	1.4e-168
WP_001047135.1|1432661_1433414_+	antitermination protein	NA	A0A192Y5X6	Salmonella_phage	92.8	7.1e-134
WP_120795389.1|1433691_1433781_-	Qin prophage; protein YnfS	NA	NA	NA	NA	NA
WP_000087756.1|1433835_1434048_-	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_000066484.1|1434348_1434564_+	cold shock-like protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	3.4e-25
WP_000839590.1|1435317_1435533_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	1.1e-31
WP_000189916.1|1435537_1435849_+	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	64.6	2.0e-26
WP_001092971.1|1435845_1436379_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.2	6.4e-97
WP_028985485.1|1436375_1436873_+	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	28.8	6.4e-06
WP_000066495.1|1437235_1437448_+	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_071524604.1|1437458_1437647_+	cold-shock protein	NA	NA	NA	NA	NA
WP_120795388.1|1437649_1437715_+	Qin prophage; protein YnfR	NA	NA	NA	NA	NA
WP_001309517.1|1437794_1437950_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001019606.1|1438121_1438295_+	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_000373090.1|1438446_1438857_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	79.4	2.5e-56
WP_001368374.1|1438914_1439148_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	84.1	2.5e-21
WP_064761842.1|1441832_1442678_+|tail	tail fiber protein	tail	K7PHC9	Enterobacteria_phage	66.5	2.3e-48
WP_000885611.1|1442677_1443253_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.3	6.5e-103
WP_000086522.1|1443350_1443941_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	39.3	1.5e-25
WP_000836768.1|1444257_1444491_-	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_120795384.1|1444559_1444673_-	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000347482.1|1445274_1446558_+	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_000527753.1|1446646_1448107_+	mannitol dehydrogenase family protein	NA	G8DCZ3	Micromonas_pusilla_virus	29.8	4.3e-42
>prophage 5
NZ_CP030919	Escherichia coli strain KL53 chromosome, complete genome	4810511	1732450	1805768	4810511	protease,tRNA,tail,portal,integrase,transposase,holin,terminase	Enterobacteria_phage(50.0%)	85	1726460:1726476	1798638:1798654
1726460:1726476	attL	TGGCAAATGCCTGTGCC	NA	NA	NA	NA
WP_000422045.1|1732450_1733500_-|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
WP_000559286.1|1733719_1734478_+	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.9	4.4e-06
WP_001278906.1|1734474_1735065_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_001291217.1|1735104_1735980_-	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001326916.1|1736190_1738086_-	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
WP_001295575.1|1738113_1738734_-	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001285661.1|1738730_1739612_-	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001700591.1|1739749_1739794_+	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001194582.1|1739885_1741448_+	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_000763511.1|1741447_1743043_+	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	3.8e-52
WP_001340286.1|1743046_1744405_+	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.7	3.3e-36
WP_000209520.1|1744416_1745610_+	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_000443067.1|1745609_1746416_+	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000807651.1|1746796_1746976_+	general stress protein	NA	NA	NA	NA	NA
WP_001079505.1|1748384_1748891_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000737226.1|1748950_1749589_-	outer membrane protein OmpW	NA	NA	NA	NA	NA
WP_000028545.1|1749945_1750689_+	UPF0259 family protein	NA	NA	NA	NA	NA
WP_000808667.1|1750718_1751258_+	septation protein A	NA	NA	NA	NA	NA
WP_000108160.1|1751362_1751761_+	acyl-CoA thioester hydrolase YciA	NA	NA	NA	NA	NA
WP_001360141.1|1751800_1752520_-	TonB system transport protein TonB	NA	NA	NA	NA	NA
WP_000967595.1|1752743_1753040_+	YciI family protein	NA	NA	NA	NA	NA
WP_114161595.1|1753486_1754770_-|tail	phage tail protein	tail	K7P6I4	Enterobacteria_phage	49.5	7.2e-102
WP_001228569.1|1754815_1755049_-	hypothetical protein	NA	E4WL42	Enterobacteria_phage	100.0	2.3e-38
WP_097360074.1|1755160_1755835_-	hypothetical protein	NA	K7PGX6	Enterobacteria_phage	99.6	1.5e-122
WP_000323235.1|1755834_1756137_-	hypothetical protein	NA	K7PJT3	Enterobacteria_phage	100.0	5.7e-50
WP_081178102.1|1756138_1759630_-	host specificity protein J	NA	M9P0D8	Enterobacteria_phage	95.2	0.0e+00
WP_001704109.1|1759672_1760290_-|tail	tail assembly protein	tail	M9NZA3	Enterobacteria_phage	99.5	1.5e-105
WP_001704110.1|1760282_1761002_-	C40 family peptidase	NA	K7PJY5	Enterobacterial_phage	99.2	1.8e-142
WP_001704111.1|1761004_1761742_-|tail	phage minor tail protein L	tail	M9NYX1	Enterobacteria_phage	99.6	1.2e-146
WP_001704112.1|1761798_1762137_-|tail	tail protein	tail	E4WL34	Enterobacteria_phage	100.0	2.3e-60
WP_061353091.1|1762133_1765394_-|tail	phage tail tape measure protein	tail	K7PMB9	Enterobacterial_phage	96.5	0.0e+00
WP_071842901.1|1765377_1765692_-|tail	phage tail assembly protein T	tail	E4WL32	Enterobacteria_phage	95.2	9.8e-53
WP_032620580.1|1765700_1766141_-|tail	phage minor tail protein G	tail	K7PJY4	Enterobacterial_phage	93.8	3.8e-71
WP_032620582.1|1766151_1766895_-|tail	phage tail protein	tail	K7PKX6	Enterobacterial_phage	98.4	3.9e-132
WP_001704117.1|1766904_1767306_-|tail	tail protein	tail	K7PHM6	Enterobacterial_phage	100.0	4.1e-72
WP_020884618.1|1767302_1767881_-|tail	phage tail protein	tail	K7PMB7	Enterobacterial_phage	99.0	4.5e-96
WP_032315004.1|1767890_1768166_-	DNA breaking-rejoining protein	NA	K7PH55	Enterobacterial_phage	96.2	5.9e-38
WP_001704120.1|1768158_1768485_-	DUF2190 family protein	NA	K7PJY3	Enterobacterial_phage	98.1	3.9e-52
WP_157918918.1|1768567_1770583_-|protease	Clp protease ClpP	protease	K7PKX4	Enterobacterial_phage	99.3	0.0e+00
WP_001704122.1|1770527_1772027_-|portal	phage portal protein	portal	K7PHM5	Enterobacterial_phage	99.8	3.8e-288
WP_001704123.1|1772023_1772239_-	hypothetical protein	NA	K7PMB5	Enterobacterial_phage	98.6	1.4e-31
WP_001704124.1|1772235_1774338_-|terminase	phage terminase large subunit family protein	terminase	K7PH52	Enterobacterial_phage	98.7	0.0e+00
WP_001704125.1|1774337_1774826_-	DUF1441 family protein	NA	K7PJY2	Enterobacterial_phage	100.0	3.1e-82
WP_001568787.1|1775106_1776009_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001568785.1|1776583_1777120_-	hypothetical protein	NA	K7P6W1	Enterobacteria_phage	93.3	2.6e-74
WP_024192364.1|1777119_1777686_-	lysozyme	NA	K7P7Q3	Enterobacteria_phage	92.0	2.1e-98
WP_001568784.1|1777663_1777942_-|holin	holin	holin	K7PGZ9	Enterobacteria_phage	97.8	5.1e-45
WP_077628410.1|1778149_1778320_+	DUF2116 family Zn-ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_001568783.1|1778795_1779221_-	HNH endonuclease	NA	S5YNW3	Mycobacterium_phage	52.0	2.3e-12
WP_097360075.1|1779423_1779912_-	antiterminator	NA	M1FPN0	Enterobacteria_phage	99.4	5.9e-89
WP_016063210.1|1779902_1780097_-	NinH protein	NA	K7PMJ0	Enterobacteria_phage	100.0	6.0e-29
WP_097360076.1|1780093_1780456_-	RusA family crossover junction endodeoxyribonuclease	NA	K7PM48	Enterobacteria_phage	85.0	7.8e-54
WP_054626104.1|1780452_1780743_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	91.7	4.8e-46
WP_054626103.1|1780735_1780906_-	hypothetical protein	NA	G8C7V4	Escherichia_phage	60.0	2.9e-11
WP_032180568.1|1780905_1781343_-	recombination protein NinB	NA	G8C7V3	Escherichia_phage	77.9	2.6e-59
WP_023306327.1|1781711_1782149_+	hypothetical protein	NA	A0A222YWI5	Escherichia_phage	41.1	2.8e-13
WP_087934211.1|1782150_1782768_-	DUF551 domain-containing protein	NA	K7P7E4	Enterobacteria_phage	86.5	1.1e-68
WP_016063169.1|1782767_1782968_-	hypothetical protein	NA	K7P6F8	Enterobacteria_phage	100.0	5.6e-30
WP_089565375.1|1782960_1783356_-	hypothetical protein	NA	K7P7J4	Enterobacteria_phage	100.0	6.8e-27
WP_089565376.1|1783352_1783697_-	winged helix-turn-helix transcriptional regulator	NA	K7P7J0	Enterobacteria_phage	90.9	1.3e-50
WP_000838082.1|1783698_1784388_-	Replication protein 14	NA	K7P7B6	Enterobacteria_phage	100.0	6.8e-131
WP_000072106.1|1784384_1785293_-	replication protein	NA	K7PGZ0	Enterobacteria_phage	100.0	1.2e-159
WP_047400406.1|1785378_1785921_-	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	87.2	1.7e-81
WP_047400408.1|1785950_1786172_-	helix-turn-helix domain-containing protein	NA	K7P6H5	Enterobacteria_phage	98.6	2.3e-32
WP_047400870.1|1786289_1787000_+	helix-turn-helix transcriptional regulator	NA	M9NZE3	Enterobacteria_phage	98.7	1.5e-133
WP_001339175.1|1787543_1788752_+|transposase	IS4-like element ISVsa5 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	99.8	2.3e-235
WP_016063143.1|1789080_1790013_+	hypothetical protein	NA	K7PGT0	Enterobacteria_phage	100.0	9.0e-171
WP_023294195.1|1790148_1790346_-	hypothetical protein	NA	G8C7T7	Escherichia_phage	87.5	5.0e-23
WP_032180615.1|1791128_1791422_+	hypothetical protein	NA	M9P0E2	Enterobacteria_phage	99.0	2.0e-47
WP_021571179.1|1791706_1791904_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_097360031.1|1792234_1792906_+	hypothetical protein	NA	R9VWB9	Serratia_phage	36.6	5.5e-29
WP_097360029.1|1792868_1793108_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_059364219.1|1793104_1793347_+	hypothetical protein	NA	G8C7S3	Escherichia_phage	78.8	4.0e-30
WP_047400036.1|1793669_1793816_+	hypothetical protein	NA	A0A1B5FPC2	Escherichia_phage	79.2	8.0e-18
WP_023277208.1|1793825_1794062_+	excisionase family protein	NA	Q8W657	Enterobacteria_phage	92.3	2.1e-39
WP_023277209.1|1794120_1795434_+|integrase	site-specific integrase	integrase	Q8W658	Enterobacteria_phage	89.9	4.3e-235
WP_050581710.1|1795412_1796186_+	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	98.4	3.0e-71
WP_000252980.1|1796238_1796634_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000019585.1|1796674_1797418_+	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	3.5e-24
WP_085381418.1|1797414_1798386_+|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_057107358.1|1798550_1800980_-	trimethylamine N-oxide reductase TorZ	NA	NA	NA	NA	NA
1798638:1798654	attR	GGCACAGGCATTTGCCA	NA	NA	NA	NA
WP_097360030.1|1801004_1802105_-	cytochrome C	NA	NA	NA	NA	NA
WP_001556664.1|1802492_1803239_-	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_001295504.1|1803252_1803819_-	VOC family protein	NA	NA	NA	NA	NA
WP_001025326.1|1804034_1805768_+|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.7	8.8e-87
>prophage 6
NZ_CP030919	Escherichia coli strain KL53 chromosome, complete genome	4810511	1891466	1943675	4810511	integrase,transposase	Enterobacteria_phage(28.57%)	37	1891425:1891484	1941679:1942989
1891425:1891484	attL	TGAACCGCCCCGGGTTTCCTGGAGAGTGTTTTATCTGTGAACTCAGGCTGCCAGATCATC	NA	NA	NA	NA
WP_085948620.1|1891466_1892680_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.3	1.4e-168
WP_057107736.1|1899538_1900591_-	glycosyltransferase family 9 protein	NA	NA	NA	NA	NA
WP_001060231.1|1902034_1903489_+	AMP nucleosidase	NA	NA	NA	NA	NA
WP_001339197.1|1904011_1905220_-|transposase	IS4-like element ISVsa5 family transposase	transposase	Q9E8P4	Bluetongue_virus	100.0	3.0e-235
WP_001011466.1|1906738_1907656_+	nitrogen assimilation transcriptional regulator	NA	NA	NA	NA	NA
WP_001011017.1|1907757_1908708_+	HTH-type transcriptional regulator Cbl	NA	NA	NA	NA	NA
WP_122452224.1|1908921_1910565_-	toxic metabolite efflux MATE transporter YeeO	NA	NA	NA	NA	NA
WP_097360059.1|1910825_1912100_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	38.5	4.2e-70
WP_097360060.1|1912146_1913535_-	SpnT protein	NA	NA	NA	NA	NA
WP_097360061.1|1913729_1915616_+	site-specific DNA-methyltransferase	NA	A0A2K5B2C1	Erysipelothrix_phage	44.4	1.2e-137
WP_097360062.1|1915625_1918586_+	DEAD/DEAH box helicase family protein	NA	A0A2K5B2C2	Erysipelothrix_phage	38.7	3.8e-162
WP_097360063.1|1918712_1920245_-	shufflon system plasmid conjugative transfer pilus tip adhesin PilV	NA	NA	NA	NA	NA
WP_097360064.1|1920544_1920868_-	conjugal transfer protein TraD	NA	NA	NA	NA	NA
WP_097360065.1|1920951_1921467_-	hypothetical protein	NA	NA	NA	NA	NA
WP_097360066.1|1921493_1921808_-	hypothetical protein	NA	NA	NA	NA	NA
WP_097360067.1|1923418_1924930_+	MobA/MobL family protein	NA	NA	NA	NA	NA
WP_097360068.1|1925005_1925650_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000129503.1|1926443_1926737_+	hypothetical protein	NA	NA	NA	NA	NA
WP_097360069.1|1926833_1927229_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049121561.1|1927341_1927635_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001567678.1|1927725_1928013_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048234408.1|1928029_1928416_-	hypothetical protein	NA	NA	NA	NA	NA
WP_097360070.1|1928430_1928742_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000250489.1|1928771_1928987_-	AlpA family transcriptional regulator	NA	A0A2H4J8C8	uncultured_Caudovirales_phage	50.0	6.5e-08
WP_001515479.1|1929173_1930037_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072146233.1|1930494_1931430_-	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_057107701.1|1931491_1932571_-	nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001297350.1|1932582_1933326_-	adenosylcobinamide-GDP ribazoletransferase	NA	NA	NA	NA	NA
WP_000973159.1|1933322_1933868_-	bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase	NA	NA	NA	NA	NA
WP_000169527.1|1936175_1936475_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_001344112.1|1939316_1939493_-	hemolysin activation protein	NA	NA	NA	NA	NA
WP_000840364.1|1939793_1940060_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001329787.1|1940128_1940407_+	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_151303468.1|1940501_1941074_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001131665.1|1941073_1941175_+	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_085948620.1|1941720_1942934_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.3	1.4e-168
WP_077249349.1|1943285_1943675_+|transposase	transposase	transposase	NA	NA	NA	NA
1941679:1942989	attR	TGAACCGCCCCGGGTTTCCTGGAGAGTGTTTTATCTGTGAACTCAGGCTGCCAGATCATCGTTTCCGATGGAAGCATAATAAGCTTTTTCTGCTTCTGCCGGAGGAGTATGGCCCAGCCTTTCCAGCAATCGTCGATTGTTATACCAGTCCACCCACGTGAGTGTGGCCAGTTCCACTTCTGCACGGTTTTTCCAGCTCTTACGGTGTATTACCTCCGCTTTGTAAAGACCATTGATGCTCTCCGCCATCGCGTTGTCATACGAGTCGCCTGTACTTCCTGTTGATGCCAGTAATCCGGCTTCCTTAAGCCGCTGTGTGTAGGCCAGCGATACATACTGAGAACCTTTATCACTGTGATGGACCGTGCCGGACGGTCGACGGGCCCATAACGCCTGCTCCAGTGCATCCAGCACGAATGTCGTTTCCATGGACGATGAGACCCGCCACCCCACGATGTATCCGGCAAACACATCAATGATGAACGCCACATAGACGAAGCCCCGCCATGTGCTGACGTAAGTAAAATCAGCCACCCACAGCTGGTCAGGTCGTTCTGCCACGAACTGACGGTTTACGCGGTCGCCTGCGGCAACGGCTTTCCGGCTGATGGTCGTACGGACCTTTTTACCCCGGAGAACACCGGCAAGTCCCATAACCGCCATGAGACGTGCCACAGTGCATCTGGCCACTCTGATACCTTCCCGTAACAACTGACGCCAGACTTTACGCACACCGTATACCTTGTGATTTTCATCGTATACGCGCTGTATCTCTTTCTTCAGCCAGTCATCGCGCTGCGCACGGGCACTGCGTTTATCCGGATGATGTCGCTGTTGCTGACAGTGGTAATACGTTGACGGGGCAATATGCAGTTCGCTGCATAGCGGTCCGACCCCGTACTGCTCACGCAGCTTATCCAGCAGTGGCATCATTTTTTCCAGAGGCGGTCGAACTCCGCCTTCGCAAAATAAGCGGAAGCCTGGCGAAGGATATCGTTACTGCGGCGCAGTTCACGATTTTCACGTTCCAGCTCTTTCAGACGCTGACGTTCAGCGGTGGTGAGCCCTCCATCACCGCCCCCGGTATCCCGCTCATGCTGGCGAACCCAGACACGCAGAGTCTCCGGCGTACAGCCAATCTTTGGAGCAATGGAACAAATTGTCGCCCATTGTGAGTCATATTCGCTCTGACTTTCCAGAACCATACGGACTGCCCGTTGACGGACTTCGGGGGAAAAACGAGTATTTTTAGTCATCCTGTTTACCTCTTTCTCAGGAAGTTTAGTCTCCAGGATTCCCGGGGCGGTTCAG	NA	NA	NA	NA
>prophage 7
NZ_CP030919	Escherichia coli strain KL53 chromosome, complete genome	4810511	1975482	1981800	4810511		Enterobacteria_phage(50.0%)	6	NA	NA
WP_001100779.1|1975482_1976040_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	56.1	7.3e-51
WP_057107516.1|1976044_1976923_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	63.8	1.5e-106
WP_057107517.1|1976980_1977880_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.8	2.2e-28
WP_085381428.1|1977879_1978965_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.8	2.3e-101
WP_000183060.1|1979337_1980231_-	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	1.0e-46
WP_040079809.1|1980405_1981800_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	31.8	2.8e-19
>prophage 8
NZ_CP030919	Escherichia coli strain KL53 chromosome, complete genome	4810511	2071777	2081218	4810511		Enterobacteria_phage(85.71%)	10	NA	NA
WP_001300968.1|2071777_2072914_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.4	3.2e-162
WP_001370558.1|2072910_2074911_+	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	95.7	0.0e+00
WP_001295429.1|2075035_2075497_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_000950409.1|2075536_2076007_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	5.2e-82
WP_000598641.1|2076053_2076773_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295431.1|2076769_2078455_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_001240401.1|2078676_2079408_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001216963.1|2079467_2079575_+	protein YohO	NA	NA	NA	NA	NA
WP_000783120.1|2079555_2080287_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_000569357.1|2080291_2081218_-	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	1.7e-23
>prophage 9
NZ_CP030919	Escherichia coli strain KL53 chromosome, complete genome	4810511	2596549	2612772	4810511	integrase,portal,terminase	Salmonella_phage(85.0%)	20	2597565:2597602	2613949:2613986
WP_000162574.1|2596549_2597032_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
2597565:2597602	attL	ATGTAGGAATTTCGGACGCGGGTTCAACTCCCGCCAGC	NA	NA	NA	NA
WP_000391794.1|2597732_2598215_+	hypothetical protein	NA	Q19UP0	Mannheimia_phage	34.3	1.6e-17
WP_000980501.1|2598241_2598460_-	transcriptional regulator	NA	Q53ZE7	Salmonella_virus	77.8	7.5e-28
WP_162815987.1|2598528_2598903_-	late control protein	NA	A0A1S6KZZ5	Salmonella_phage	95.5	6.2e-54
WP_097360080.1|2599196_2600963_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.5	0.0e+00
WP_001737414.1|2600962_2602003_+|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	88.9	1.8e-172
WP_097359982.1|2603654_2604395_+	DUF4145 domain-containing protein	NA	A0A1S6L018	Salmonella_phage	91.1	2.3e-132
WP_001217562.1|2604523_2604757_-	DinI family protein	NA	E5G6M1	Salmonella_phage	98.7	2.3e-35
WP_001154434.1|2604767_2604956_-	hypothetical protein	NA	E5G6M0	Salmonella_phage	98.4	5.5e-27
WP_097359981.1|2605109_2607500_-	replication endonuclease	NA	E5G6L9	Salmonella_phage	96.1	0.0e+00
WP_001420002.1|2607499_2608321_-	hypothetical protein	NA	A0A0M4RCP6	Salmonella_phage	75.7	1.1e-122
WP_097359980.1|2608326_2609181_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	89.8	6.4e-147
WP_000752619.1|2609177_2609405_-	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	98.7	3.5e-36
WP_001244230.1|2609404_2609638_-	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	97.4	1.1e-32
WP_000963472.1|2609705_2610047_-	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	98.2	1.3e-55
WP_000956182.1|2610010_2610211_-	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	98.5	7.1e-33
WP_001676486.1|2610218_2610728_-	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	94.1	1.9e-82
WP_000102105.1|2610760_2611003_-	Rha family transcriptional regulator	NA	A0A1S6KZZ6	Salmonella_phage	97.5	6.8e-38
WP_001748164.1|2611119_2611752_+	phage repressor protein cI	NA	A0A1S6KZZ7	Salmonella_phage	57.6	7.7e-65
WP_097359979.1|2611755_2612772_+|integrase	site-specific integrase	integrase	E5G6L0	Salmonella_phage	92.9	7.5e-187
2613949:2613986	attR	ATGTAGGAATTTCGGACGCGGGTTCAACTCCCGCCAGC	NA	NA	NA	NA
>prophage 10
NZ_CP030919	Escherichia coli strain KL53 chromosome, complete genome	4810511	2711394	2726078	4810511	integrase	Escherichia_phage(45.45%)	13	2706785:2706798	2723003:2723016
2706785:2706798	attL	TCCAGCAACGCCAG	NA	NA	NA	NA
WP_032333284.1|2711394_2712678_-|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	23.7	3.1e-12
WP_061300951.1|2712895_2715457_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	2.3e-30
WP_001141341.1|2715562_2716219_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	45.3	5.2e-48
WP_001272547.1|2716269_2717067_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.0	1.3e-69
WP_000847974.1|2717232_2718141_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.9e-118
WP_000590392.1|2718137_2719400_+	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	1.3e-135
WP_001278994.1|2719396_2720035_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_001136918.1|2720039_2720816_+	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_000104441.1|2720904_2722269_+	GntP family transporter	NA	NA	NA	NA	NA
WP_000081550.1|2722362_2723355_-	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
2723003:2723016	attR	TCCAGCAACGCCAG	NA	NA	NA	NA
WP_001272590.1|2723417_2724557_-	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
WP_000254708.1|2724696_2725323_-	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
WP_001295182.1|2725316_2726078_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	3.4e-59
>prophage 11
NZ_CP030919	Escherichia coli strain KL53 chromosome, complete genome	4810511	3727722	3737241	4810511	integrase	Enterobacteria_phage(100.0%)	10	3727541:3727562	3737539:3737560
3727541:3727562	attL	ACTCCTGTGATCTTCCGCCAAA	NA	NA	NA	NA
WP_021563881.1|3727722_3728886_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	93.3	5.0e-211
WP_021563882.1|3728900_3730904_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_003827213.1|3731434_3732001_-	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	62.7	7.7e-56
WP_003827212.1|3732017_3732263_-	transcriptional regulator	NA	Q7M294	Enterobacteria_phage	76.5	8.2e-31
WP_021563883.1|3732259_3732997_-	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	63.9	3.4e-80
WP_003827209.1|3733537_3733804_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	71.6	2.0e-30
WP_024228213.1|3733800_3734352_+	ash family protein	NA	Q7M2A7	Enterobacteria_phage	60.2	7.0e-30
WP_003827205.1|3734348_3734576_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021563885.1|3734572_3734893_+	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_021563886.1|3734907_3737241_+	hypothetical protein	NA	Q7M2A8	Enterobacteria_phage	83.9	0.0e+00
3737539:3737560	attR	ACTCCTGTGATCTTCCGCCAAA	NA	NA	NA	NA
>prophage 12
NZ_CP030919	Escherichia coli strain KL53 chromosome, complete genome	4810511	4389253	4394016	4810511	transposase	Enterobacteria_phage(57.14%)	8	NA	NA
WP_001149161.1|4389253_4389520_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	98.9	1.8e-44
WP_064455212.1|4389516_4390107_+	ash family protein	NA	Q7M2A7	Enterobacteria_phage	99.3	1.3e-69
WP_001244670.1|4390099_4390387_+	hypothetical protein	NA	Q7M2A0	Enterobacteria_phage	96.8	2.5e-47
WP_085381488.1|4390379_4390835_+	hypothetical protein	NA	Q7M298	Enterobacteria_phage	98.2	1.0e-63
WP_001547737.1|4390982_4391333_-|transposase	transposase	transposase	Q716C1	Shigella_phage	97.7	5.2e-39
WP_000177057.1|4391477_4391735_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000175457.1|4392291_4393059_-	Fe(3+) dicitrate ABC transporter ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	24.8	6.4e-13
WP_000684852.1|4393059_4394016_-	Fe(3+) dicitrate ABC transporter permease subunit FecD	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.1	8.2e-18
>prophage 1
NZ_CP030920	Escherichia coli strain KL53 plasmid pKL53-L, complete sequence	259094	1708	69649	259094	integrase,transposase	Salmonella_phage(33.33%)	54	NA	NA
WP_001515717.1|1708_2449_-|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	58.6	5.4e-25
WP_085948620.1|3884_5098_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.3	1.4e-168
WP_004118212.1|7108_8182_-	FUSC family protein	NA	NA	NA	NA	NA
WP_102596111.1|8716_9685_+|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	99.1	1.8e-185
WP_003032093.1|10826_11639_-	PfkB domain-containing protein	NA	NA	NA	NA	NA
WP_003032095.1|11651_12626_-	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_003032097.1|12630_13416_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_032192077.1|13642_14407_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003032103.1|15256_15781_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071845418.1|15804_16332_-	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_077762110.1|17040_18009_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	91.0	1.9e-171
WP_032192052.1|18272_19184_+	acetamidase/formamidase family protein	NA	A0A1V0S8X7	Catovirus	41.9	2.8e-07
WP_032192047.1|19180_20524_+	APC family permease	NA	NA	NA	NA	NA
WP_032192045.1|21845_22946_+	NADH:flavin oxidoreductase/NADH oxidase	NA	NA	NA	NA	NA
WP_105966327.1|23026_23278_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032192044.1|23313_23730_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_001261283.1|23726_23957_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_016240352.1|24556_24775_+	type II toxin-antitoxin system antitoxin CcdA	NA	NA	NA	NA	NA
WP_016240353.1|24776_25082_+	type II toxin-antitoxin system toxin CcdB	NA	NA	NA	NA	NA
WP_016240356.1|26464_27259_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	87.8	1.2e-51
WP_085947917.1|28383_29656_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.4e-177
WP_097451083.1|30638_31484_-|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	28.9	1.4e-16
WP_161989521.1|32343_32556_-	hypothetical protein	NA	NA	NA	NA	NA
WP_097360110.1|32484_32652_+|integrase	integrase	integrase	NA	NA	NA	NA
WP_097360111.1|32936_34064_+	transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004118229.1|34060_34654_+	ANTAR domain-containing protein	NA	NA	NA	NA	NA
WP_097360112.1|34650_35499_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_004118227.1|35498_36419_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_004152278.1|36431_38036_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_097360113.1|38080_39028_+	acetamidase/formamidase family protein	NA	A0A1V0S8X7	Catovirus	22.9	1.3e-10
WP_004118832.1|39035_40769_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.6	6.9e-15
WP_105966097.1|42009_42576_+	DUF2913 family protein	NA	NA	NA	NA	NA
WP_000427614.1|42757_43762_-|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_000379506.1|43949_44558_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_016236501.1|44554_45706_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_000624215.1|45702_46908_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_004393997.1|46909_47620_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.3	3.7e-31
WP_016236502.1|47648_48122_+	cytochrome c	NA	NA	NA	NA	NA
WP_011784757.1|48108_49596_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_016236504.1|49725_50283_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	82.1	2.6e-48
WP_097360117.1|50285_51506_+	DUF4158 domain-containing protein	NA	A0A1B0V7H9	Salmonella_phage	56.4	1.7e-116
WP_000427614.1|51584_52589_+|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_001137910.1|53048_53369_+	DUF134 domain-containing protein	NA	NA	NA	NA	NA
WP_097360125.1|53343_53805_+	dinitrogenase iron-molybdenum cofactor	NA	NA	NA	NA	NA
WP_016241611.1|53965_54403_+	PaaI family thioesterase	NA	NA	NA	NA	NA
WP_000043177.1|54517_54994_+	DNA starvation/stationary phase protection protein	NA	G0X506	Salmonella_phage	28.7	6.7e-05
WP_000928911.1|55298_55649_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000706606.1|55810_57469_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_001243598.1|57714_58179_+	isoprenylcysteine carboxylmethyltransferase family protein	NA	NA	NA	NA	NA
WP_001084040.1|59753_61817_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_000085085.1|61813_63205_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001196201.1|63281_63863_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	48.9	5.5e-41
WP_000770127.1|67169_67526_+	hypothetical protein	NA	NA	NA	NA	NA
WP_097360096.1|68302_69649_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP030920	Escherichia coli strain KL53 plasmid pKL53-L, complete sequence	259094	82093	153921	259094	transposase,protease	Stx2-converting_phage(25.0%)	51	NA	NA
WP_000624622.1|82093_82441_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_097360126.1|82440_83118_-|transposase	transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	46.0	4.3e-21
WP_001000409.1|83221_84757_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	87.7	2.0e-260
WP_000609174.1|84806_85154_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	95.7	2.7e-59
WP_001201739.1|85150_85534_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	36.3	4.1e-13
WP_000723069.1|85714_86149_-	copper resistance system metallochaperone PcoE	NA	NA	NA	NA	NA
WP_001211180.1|86366_87767_-	copper resistance membrane spanning protein PcoS	NA	W8CYF6	Bacillus_phage	26.6	3.2e-18
WP_040221025.1|87763_88444_-	copper response regulator transcription factor PcoR	NA	W8CYM9	Bacillus_phage	34.8	3.9e-30
WP_049190279.1|88498_89428_-	copper resistance inner membrane protein PcoD	NA	NA	NA	NA	NA
WP_000025662.1|89432_89813_-	copper resistance system metallochaperone PcoC	NA	NA	NA	NA	NA
WP_001242438.1|89852_90749_-	copper resistance outer membrane transporter PcoB	NA	NA	NA	NA	NA
WP_000925242.1|90748_92566_-	multicopper oxidase PcoA	NA	NA	NA	NA	NA
WP_001023257.1|92800_93250_+	copper resistance protein	NA	NA	NA	NA	NA
WP_000287501.1|93538_94276_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A2H4JAF5	uncultured_Caudovirales_phage	31.9	1.3e-10
WP_000843497.1|94309_94507_-	DUF2933 domain-containing protein	NA	NA	NA	NA	NA
WP_097360104.1|94547_96995_-	Ag(+)-translocating P-type ATPase SilP	NA	A0A218MNH6	uncultured_virus	35.6	2.9e-83
WP_000758228.1|97121_97562_-	hypothetical protein	NA	NA	NA	NA	NA
WP_097360103.1|97648_100795_-	Cu(+)/Ag(+) efflux RND transporter permease subunit SilA	NA	S5VTK5	Leptospira_phage	22.5	1.8e-61
WP_112015358.1|100805_102098_-	Cu(+)/Ag(+) efflux RND transporter periplasmic adaptor subunit SilB	NA	NA	NA	NA	NA
WP_001246153.1|102211_102565_-	cation efflux system protein CusF	NA	NA	NA	NA	NA
WP_114161600.1|102593_103979_-	Cu(+)/Ag(+) efflux RND transporter outer membrane channel SilC	NA	NA	NA	NA	NA
WP_000697966.1|104168_104849_+	copper/silver response regulator transcription factor SilR	NA	W8CYM9	Bacillus_phage	35.1	6.0e-31
WP_001572350.1|104841_106323_+	copper/silver sensor histidine kinase SilS	NA	W8CYF6	Bacillus_phage	30.1	1.8e-27
WP_000790485.1|106567_106999_+	silver-binding protein SilE	NA	NA	NA	NA	NA
WP_001549799.1|107146_107497_+	DUF305 domain-containing protein	NA	A0A218MND9	uncultured_virus	50.5	2.3e-18
WP_114161601.1|109717_123139_+	tandem-95 repeat protein	NA	NA	NA	NA	NA
WP_000989158.1|123215_125135_+	TolC family protein	NA	NA	NA	NA	NA
WP_001549866.1|125149_126031_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_023157484.1|126027_127377_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_001192442.1|127378_129511_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_114161602.1|130328_131309_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.5	3.4e-184
WP_001426317.1|132538_132919_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000490638.1|132976_133642_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001572344.1|133701_134157_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000175476.1|134198_134435_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001572343.1|134932_135337_+	H-NS histone family protein	NA	NA	NA	NA	NA
WP_000784387.1|135943_136801_-	HNH endonuclease	NA	G0X580	Salmonella_phage	34.2	3.9e-11
WP_097360102.1|136816_137125_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001043843.1|137673_138099_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001572439.1|138352_139168_-	HNH endonuclease	NA	G0X580	Salmonella_phage	36.5	1.1e-15
WP_000985911.1|139180_139591_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000134171.1|139692_139899_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000156887.1|141071_142094_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_064645518.1|142178_145166_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	53.9	3.3e-299
WP_001567361.1|145333_145975_+	recombinase family protein	NA	NA	NA	NA	NA
WP_000167917.1|146231_147155_-	cation transporter	NA	NA	NA	NA	NA
WP_001515348.1|147354_147927_-	cytochrome b/b6 domain-containing protein	NA	NA	NA	NA	NA
WP_000219087.1|148402_149641_-|transposase	IS110 family transposase	transposase	A0A0U3ULR1	Bacillus_phage	23.1	2.5e-11
WP_001515743.1|149939_150935_-|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	28.6	1.4e-20
WP_087934283.1|151779_152931_-|protease	trypsin-like serine protease	protease	A0A1B1IT49	uncultured_Mediterranean_phage	30.3	7.5e-26
WP_114161593.1|152955_153921_-|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
>prophage 3
NZ_CP030920	Escherichia coli strain KL53 plasmid pKL53-L, complete sequence	259094	168574	208055	259094	integrase,transposase,protease	Caulobacter_phage(22.22%)	39	170227:170241	208513:208527
WP_001446199.1|168574_168838_+|transposase	transposase	transposase	A0A218MNG9	uncultured_virus	41.7	6.3e-05
WP_001324682.1|169430_171053_-	hypothetical protein	NA	NA	NA	NA	NA
170227:170241	attL	GGGTGATGGAAAAAA	NA	NA	NA	NA
WP_000273850.1|171045_172548_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_000133967.1|172549_174160_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_001324683.1|174152_176213_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_000017067.1|176226_177054_-|transposase	heteromeric transposase endonuclease subunit TnsA	transposase	NA	NA	NA	NA
WP_000493077.1|177953_178157_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000341066.1|178569_178962_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001371937.1|179304_179676_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000398480.1|179767_179959_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000077926.1|180008_180290_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001053338.1|180852_182094_-	tellurium resistance protein TerF	NA	NA	NA	NA	NA
WP_000301242.1|182522_183098_-	TerD family protein	NA	K4JRX3	Caulobacter_phage	41.6	8.7e-31
WP_000116677.1|183165_183744_-	tellurium resistance membrane protein TerD	NA	A0A2P1N0L4	Streptomyces_phage	40.0	3.3e-06
WP_000255079.1|183792_184833_-	tellurium resistance membrane protein TerC	NA	K7QKE8	Escherichia_phage	48.0	2.2e-77
WP_000007448.1|184855_185311_-	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_001054787.1|185333_186491_-	tellurium resistance protein TerA	NA	NA	NA	NA	NA
WP_032491471.1|186490_187072_-	TerZ protein	NA	K4JRX3	Caulobacter_phage	29.6	1.8e-12
WP_001035162.1|187394_188453_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001285478.1|188462_189605_+	hypothetical protein	NA	A0A172Q0Y1	Acinetobacter_phage	35.4	1.7e-30
WP_001040059.1|189597_190371_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001182411.1|190372_191452_+|protease	cysteine protease StiP family protein	protease	A0A172Q0S8	Acinetobacter_phage	33.8	8.1e-38
WP_000797366.1|191451_192408_+	HpcH/HpaI aldolase/citrate lyase family protein	NA	NA	NA	NA	NA
WP_000506887.1|192418_193627_+	DUF4236 domain-containing protein	NA	NA	NA	NA	NA
WP_001176767.1|193644_194112_+	tellurium resistance protein TerW	NA	NA	NA	NA	NA
WP_001388628.1|194574_195213_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_000116681.1|195235_195877_+	TerD family protein	NA	NA	NA	NA	NA
WP_001253658.1|195876_196515_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_001253653.1|196600_197641_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_000081622.1|197640_199278_+	protein phosphatase 2C domain-containing protein	NA	NA	NA	NA	NA
WP_001284313.1|199303_200803_+	kinase	NA	NA	NA	NA	NA
WP_001232449.1|200969_202052_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001285422.1|202412_202625_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000795947.1|202795_203971_+|integrase	tyrosine-type recombinase/integrase	integrase	I3WEY3	Macacine_betaherpesvirus	26.9	4.2e-16
WP_001424615.1|203992_204196_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001198594.1|204272_205178_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012006603.1|205187_206168_-	DNA replication protein	NA	NA	NA	NA	NA
WP_001424628.1|206240_206624_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001328751.1|207038_208055_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.4	3.7e-186
208513:208527	attR	TTTTTTCCATCACCC	NA	NA	NA	NA
>prophage 1
NZ_CP030921	Escherichia coli strain KL53 plasmid pKL53-M, complete sequence	109118	3983	52774	109118	transposase,integrase	Escherichia_phage(15.79%)	55	18475:18491	57629:57645
WP_001339175.1|3983_5192_+|transposase	IS4-like element ISVsa5 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	99.8	2.3e-235
WP_000599533.1|5557_6763_-	sodium/glutamate symporter	NA	NA	NA	NA	NA
WP_000562370.1|7206_7527_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_000460651.1|7519_7906_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001284954.1|7913_8600_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000088605.1|8577_9201_-	tetracycline resistance transcriptional repressor TetR(B)	NA	NA	NA	NA	NA
WP_001089068.1|9282_10488_+	tetracycline efflux MFS transporter Tet(B)	NA	NA	NA	NA	NA
WP_000428546.1|10600_11194_-	tetracyline resistance-associated transcriptional repressor TetC	NA	NA	NA	NA	NA
WP_001339197.1|11707_12916_-|transposase	IS4-like element ISVsa5 family transposase	transposase	Q9E8P4	Bluetongue_virus	100.0	3.0e-235
WP_085967404.1|12985_14115_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.1	8.7e-51
WP_000904897.1|14145_14769_-	recombinase family protein	NA	E5FFF9	Burkholderia_phage	48.6	2.3e-37
WP_001138082.1|14894_17780_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	39.9	1.1e-190
WP_001579760.1|17852_18845_+	hypothetical protein	NA	NA	NA	NA	NA
18475:18491	attL	ATCAGGCATGCCGTCTG	NA	NA	NA	NA
WP_000521604.1|18903_19521_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001579759.1|19715_21272_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_000194568.1|21536_22127_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000371888.1|22126_22384_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001127573.1|22712_23816_+	nucleotide-binding protein	NA	NA	NA	NA	NA
WP_000542417.1|23845_24976_+	DUF4238 domain-containing protein	NA	NA	NA	NA	NA
WP_001229373.1|24975_25266_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000215655.1|25262_25460_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000545983.1|25784_26918_+	DUF3800 domain-containing protein	NA	NA	NA	NA	NA
WP_000642771.1|26937_27222_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000074712.1|27392_28040_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000628093.1|28027_28363_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000139427.1|28542_29124_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000493380.1|29693_30044_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000715519.1|30113_30722_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001372173.1|30789_31572_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	92.0	5.4e-52
WP_000239529.1|31709_31985_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000633913.1|31978_32623_-	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	43.0	1.9e-39
WP_001103690.1|32851_33823_+	hypothetical protein	NA	A0A222YXF2	Escherichia_phage	42.9	7.4e-67
WP_000340829.1|33827_34220_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000457496.1|34224_35496_-	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	60.5	1.4e-142
WP_000109071.1|35495_35933_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	48.4	8.3e-26
WP_000618110.1|35929_36178_-	DinI-like family protein	NA	Q2A098	Sodalis_phage	48.0	1.9e-14
WP_000273912.1|36595_37498_+	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
WP_139593123.1|37494_37806_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087050374.1|37881_38565_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.9	1.1e-29
WP_001104885.1|38565_38787_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061089206.1|38799_39234_+	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_014653258.1|40593_40896_+	antirestriction protein	NA	NA	NA	NA	NA
WP_058647586.1|40942_41365_+	DUF1380 family protein	NA	NA	NA	NA	NA
WP_001027516.1|41361_41553_+	hypothetical protein	NA	NA	NA	NA	NA
WP_097360037.1|41830_43498_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	53.0	4.3e-163
WP_001276120.1|44664_45192_+	single-stranded DNA-binding protein	NA	I3PGW4	Xanthomonas_phage	73.5	1.6e-47
WP_052895272.1|45249_45483_+	DUF905 domain-containing protein	NA	A0A096XUX0	Cronobacter_phage	51.1	2.3e-06
WP_097360036.1|45541_47500_+	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	29.9	5.6e-21
WP_024187268.1|47554_47989_+	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
WP_001276270.1|47985_48705_+	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
WP_000977995.1|48701_49298_+	hypothetical protein	NA	A0A0N7KZV3	Escherichia_phage	56.6	9.0e-15
WP_000117611.1|49759_50260_+	antirestriction protein ArdA	NA	G9FHQ1	Rhodococcus_virus	27.3	2.4e-05
WP_000218863.1|50988_51423_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001247862.1|51516_51783_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000038402.1|51847_52774_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	53.4	3.5e-66
57629:57645	attR	ATCAGGCATGCCGTCTG	NA	NA	NA	NA
>prophage 1
NZ_CP030922	Escherichia coli strain KL53 plasmid pKL53-S, complete sequence	77405	0	4633	77405		Morganella_phage(50.0%)	5	NA	NA
WP_097360130.1|953_1283_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001548790.1|1447_2206_-	hypothetical protein	NA	A0A192YA72	Morganella_phage	34.5	8.5e-26
WP_001548788.1|2368_3217_-	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
WP_001548787.1|3771_4266_-	type II toxin-antitoxin system YhaV family toxin	NA	NA	NA	NA	NA
WP_001548786.1|4288_4633_-	type II toxin-antitoxin system PrlF family antitoxin	NA	K4FB87	Cronobacter_phage	50.0	2.9e-05
>prophage 2
NZ_CP030922	Escherichia coli strain KL53 plasmid pKL53-S, complete sequence	77405	10070	10763	77405		unidentified_phage(100.0%)	1	NA	NA
WP_025737365.1|10070_10763_-	N-6 DNA methylase	NA	H7BVT3	unidentified_phage	32.4	8.6e-09
>prophage 3
NZ_CP030922	Escherichia coli strain KL53 plasmid pKL53-S, complete sequence	77405	14173	15271	77405		Salmonella_phage(100.0%)	1	NA	NA
WP_001548868.1|14173_15271_-	DGQHR domain-containing protein	NA	T1SBJ4	Salmonella_phage	40.7	2.9e-67
>prophage 4
NZ_CP030922	Escherichia coli strain KL53 plasmid pKL53-S, complete sequence	77405	51597	62879	77405	integrase	Salmonella_phage(16.67%)	15	57186:57205	59196:59215
WP_001548817.1|51597_52980_-	replicative DNA helicase	NA	A0A1B0VG30	Salmonella_phage	66.1	6.9e-167
WP_001548816.1|53054_53579_-	DUF2726 domain-containing protein	NA	NA	NA	NA	NA
WP_001548815.1|54558_54771_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001548814.1|54826_55342_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001548813.1|55356_56583_+	3'-5' exonuclease	NA	A0A1D9C9N8	Salinivibrio_phage	37.9	6.2e-18
WP_001548812.1|56594_56885_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001548811.1|56949_57186_+	hypothetical protein	NA	NA	NA	NA	NA
57186:57205	attL	ATTTGCGCATGCGCAAATTC	NA	NA	NA	NA
WP_001548810.1|57225_57864_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001548809.1|57884_58667_+|integrase	tyrosine-type recombinase/integrase	integrase	I3WFA4	Macacine_betaherpesvirus	54.4	2.1e-19
WP_001548808.1|58822_59056_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001548807.1|59353_59791_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A218MND2	uncultured_virus	55.8	1.0e-28
59196:59215	attR	GAATTTGCGCATGCGCAAAT	NA	NA	NA	NA
WP_001548806.1|59777_61040_+	translesion error-prone DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	48.2	6.8e-105
WP_001548805.1|61178_61589_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_001548804.1|61585_62032_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001548803.1|62162_62879_+	lytic transglycosylase domain-containing protein	NA	A0A0B5A4P3	Achromobacter_phage	40.4	1.3e-28
