The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP023632	Mycobacterium tuberculosis strain TBDM2189 chromosome, complete genome	4411316	888980	947535	4411316	tRNA,protease,transposase,bacteriocin	Burkholderia_virus(16.67%)	52	NA	NA
WP_087902221.1|888980_890241_+|transposase	IS3-like element IS987 family transposase	transposase	Q8W6R2	Burkholderia_virus	59.1	9.6e-83
WP_009935676.1|890296_891391_+|transposase	IS110-like element IS1547 family transposase	transposase	NA	NA	NA	NA
WP_003404092.1|891380_892178_-|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
WP_003404098.1|892174_893182_-	Dyp-type peroxidase	NA	NA	NA	NA	NA
WP_003404103.1|893226_894528_+	M18 family aminopeptidase	NA	NA	NA	NA	NA
WP_003898592.1|894539_894887_+	VOC family protein	NA	NA	NA	NA	NA
WP_003404111.1|894880_895537_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003404114.1|895728_897993_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	64.3	8.1e-274
WP_003404117.1|897989_898619_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003404120.1|898739_899696_+	phosphodiesterase	NA	NA	NA	NA	NA
WP_003898594.1|899640_901239_-	exopolysaccharide phosphotransferase CpsY	NA	NA	NA	NA	NA
WP_003404127.1|901543_901933_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003404129.1|902019_903603_+	amidophosphoribosyltransferase	NA	A0A1B1ISH6	uncultured_Mediterranean_phage	30.6	2.6e-45
WP_003404132.1|903633_904728_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	37.3	2.3e-56
WP_003404135.1|904813_904996_-	DUF3073 domain-containing protein	NA	NA	NA	NA	NA
WP_003404137.1|905142_906249_-	folate-binding protein YgfZ	NA	NA	NA	NA	NA
WP_003404139.1|906331_907201_+	aminodeoxychorismate lyase	NA	NA	NA	NA	NA
WP_003898596.1|907246_907927_-	FABP family protein	NA	NA	NA	NA	NA
WP_003404278.1|908089_908392_-	DUF1416 domain-containing protein	NA	NA	NA	NA	NA
WP_003404293.1|908393_909227_-	sulfurtransferase	NA	NA	NA	NA	NA
WP_003898598.1|909519_909942_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_003404298.1|909938_910751_-	DUF2993 domain-containing protein	NA	NA	NA	NA	NA
WP_003898599.1|910880_911648_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	31.5	3.1e-15
WP_003404307.1|911644_912592_+	mycothiol synthase	NA	NA	NA	NA	NA
WP_003404312.1|912634_913411_+	phosphate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.1	1.6e-16
WP_003404314.1|913466_914108_-	phosphate signaling complex protein PhoU	NA	NA	NA	NA	NA
WP_003898600.1|914165_916220_-	LCP family protein	NA	NA	NA	NA	NA
WP_003898601.1|916385_917555_-|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_003404321.1|917642_918659_-	acyl-ACP desaturase	NA	NA	NA	NA	NA
WP_003404326.1|918820_919462_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003898602.1|919542_920598_+	DUF2236 domain-containing protein	NA	NA	NA	NA	NA
WP_003404335.1|920649_921042_-	Ni(II)/Co(II)-sensing metalloregulatory transcriptional repressor KmtR	NA	NA	NA	NA	NA
WP_003404336.1|921099_921522_-	nucleoside deaminase	NA	NA	NA	NA	NA
WP_003900218.1|921483_921774_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_003404349.1|921878_922784_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_003404352.1|922802_923618_-	TIGR04255 family protein	NA	NA	NA	NA	NA
WP_003404362.1|930844_931489_+	sensor domain-containing protein	NA	NA	NA	NA	NA
WP_003898607.1|931469_932021_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003906455.1|932170_932824_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003404368.1|932894_933923_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003898609.1|934611_935382_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003404373.1|935468_936281_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_003404376.1|936348_937209_-	proline-specific peptidase family protein	NA	NA	NA	NA	NA
WP_003404379.1|937484_937727_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003404382.1|938003_939296_+	MFS transporter	NA	NA	NA	NA	NA
WP_003404384.1|939279_940284_+	thiamine pyrophosphate-dependent dehydrogenase E1 component subunit alpha	NA	NA	NA	NA	NA
WP_003404388.1|940347_940998_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_003898611.1|941081_942359_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_003404392.1|942571_944086_-	multicopper oxidase MmcO	NA	NA	NA	NA	NA
WP_003901025.1|944234_944627_+	lipoprotein LpqS	NA	NA	NA	NA	NA
WP_003404395.1|944829_945948_+	PLP-dependent cysteine synthase family protein	NA	NA	NA	NA	NA
WP_003404404.1|947202_947535_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP023632	Mycobacterium tuberculosis strain TBDM2189 chromosome, complete genome	4411316	2941022	2976388	4411316	capsid,transposase,terminase,protease,integrase,tRNA,head	Tupanvirus(11.11%)	42	2969823:2969850	2980805:2980832
WP_003413486.1|2941022_2943101_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	34.9	2.5e-104
WP_003413487.1|2943209_2943437_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009938541.1|2943433_2944819_-	PE family protein	NA	NA	NA	NA	NA
WP_003413569.1|2945163_2945664_+	DUF1990 family protein	NA	NA	NA	NA	NA
WP_003413574.1|2945680_2946121_-	DoxX family membrane protein	NA	NA	NA	NA	NA
WP_003901437.1|2946267_2946945_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_003413583.1|2946929_2947283_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_003413586.1|2947295_2947721_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003413588.1|2947717_2948392_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_070890570.1|2948460_2949291_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_003413592.1|2949426_2950320_+	universal stress protein	NA	NA	NA	NA	NA
WP_003413594.1|2950322_2951141_-	universal stress protein	NA	NA	NA	NA	NA
WP_003899401.1|2951155_2952337_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_003413598.1|2952395_2952827_-	CBS domain-containing protein	NA	A0A2I6B2H4	Macacine_betaherpesvirus	100.0	1.9e-75
WP_003899402.1|2953340_2954582_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_003899403.1|2954891_2955254_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003413610.1|2955600_2956725_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003413614.1|2956726_2957266_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003413616.1|2957405_2958704_+	RNA-splicing ligase RtcB	NA	A2RQD0	Archaeal_BJ1_virus	43.3	3.8e-90
WP_003413619.1|2958742_2959024_-	DUF1876 domain-containing protein	NA	NA	NA	NA	NA
WP_003413625.1|2959168_2959654_-	hemerythrin domain-containing protein	NA	NA	NA	NA	NA
WP_003902325.1|2959680_2959938_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009938544.1|2959938_2962275_-	PE family protein	NA	NA	NA	NA	NA
WP_003899405.1|2962303_2962546_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003899406.1|2962546_2963224_+	membrane protein	NA	NA	NA	NA	NA
WP_003413654.1|2963419_2964076_+	DedA family protein	NA	NA	NA	NA	NA
WP_003413657.1|2964238_2964685_+	anti-sigma factor antagonist	NA	NA	NA	NA	NA
WP_003413663.1|2964859_2965192_-	YnfA family protein	NA	NA	NA	NA	NA
WP_003413665.1|2965311_2965671_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003413675.1|2965772_2966231_+	glyoxalase/bleomycin resistance/dioxygenase family protein	NA	NA	NA	NA	NA
WP_003899407.1|2966366_2966747_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003413686.1|2966743_2968240_+	ACR3 family arsenite efflux transporter	NA	A0A2H4PQT9	Staphylococcus_phage	39.7	5.1e-14
WP_085972563.1|2968429_2968666_+	antitoxin MazE family protein	NA	NA	NA	NA	NA
WP_128882533.1|2968738_2968912_+	hypothetical protein	NA	NA	NA	NA	NA
2969823:2969850	attL	ACTGGTTCAATCCCAGTATCGCGCACCA	NA	NA	NA	NA
WP_003899409.1|2969956_2970388_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003900538.1|2970384_2971383_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2D1G8E2	Mycobacterium_phage	47.8	7.4e-62
WP_003900539.1|2971396_2971861_+	ParB N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_096868035.1|2971993_2973254_+|transposase	IS3-like element IS987 family transposase	transposase	Q8W6R2	Burkholderia_virus	59.1	9.6e-83
WP_009935348.1|2973281_2973467_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003899411.1|2973628_2975068_-|capsid	phage major capsid protein	capsid	A0A1B3AYS4	Gordonia_phage	40.6	1.4e-66
WP_003899412.1|2975075_2975609_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	32.9	3.1e-06
WP_003899413.1|2975761_2976388_-|terminase	phage terminase small subunit P27 family	terminase	V9H0V4	Actinophage	47.2	1.6e-17
2980805:2980832	attR	ACTGGTTCAATCCCAGTATCGCGCACCA	NA	NA	NA	NA
