The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP023631	Mycobacterium tuberculosis strain TBDM1506 chromosome, complete genome	4411157	2940971	2976338	4411157	head,tRNA,protease,integrase,transposase,terminase,capsid	Tupanvirus(12.5%)	39	2969773:2969800	2980755:2980782
WP_003413486.1|2940971_2943050_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	34.9	2.5e-104
WP_003413487.1|2943158_2943386_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009938541.1|2943382_2944768_-	PE family protein	NA	NA	NA	NA	NA
WP_003413569.1|2945112_2945613_+	DUF1990 family protein	NA	NA	NA	NA	NA
WP_003413574.1|2945629_2946070_-	DoxX family membrane protein	NA	NA	NA	NA	NA
WP_010924555.1|2946216_2946894_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_003413583.1|2946878_2947232_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_003413586.1|2947244_2947670_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003413588.1|2947666_2948341_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_003413589.1|2948418_2949240_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_003413592.1|2949375_2950269_+	universal stress protein	NA	NA	NA	NA	NA
WP_003413594.1|2950271_2951090_-	universal stress protein	NA	NA	NA	NA	NA
WP_003899401.1|2951104_2952286_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_003413598.1|2952344_2952776_-	CBS domain-containing protein	NA	A0A2I6B2H4	Macacine_betaherpesvirus	100.0	1.9e-75
WP_003899402.1|2953289_2954531_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_003899403.1|2954840_2955203_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003413610.1|2955549_2956674_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072464607.1|2956675_2957215_+	archease	NA	NA	NA	NA	NA
WP_070889717.1|2957354_2958653_+	RtcB family protein	NA	A2RQD0	Archaeal_BJ1_virus	43.3	2.2e-90
WP_003413619.1|2958691_2958973_-	DUF1876 domain-containing protein	NA	NA	NA	NA	NA
WP_003413625.1|2959117_2959603_-	hemerythrin domain-containing protein	NA	NA	NA	NA	NA
WP_003902325.1|2959629_2959887_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003899405.1|2962253_2962496_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003899406.1|2962496_2963174_+	membrane protein	NA	NA	NA	NA	NA
WP_003413654.1|2963369_2964026_+	DedA family protein	NA	NA	NA	NA	NA
WP_003413657.1|2964188_2964635_+	anti-sigma factor antagonist	NA	NA	NA	NA	NA
WP_003413663.1|2964809_2965142_-	YnfA family protein	NA	NA	NA	NA	NA
WP_003413665.1|2965261_2965621_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003413675.1|2965722_2966181_+	glyoxalase/bleomycin resistance/dioxygenase family protein	NA	NA	NA	NA	NA
WP_003899407.1|2966316_2966697_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003900537.1|2968316_2968634_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077365235.1|2968688_2968862_+	hypothetical protein	NA	NA	NA	NA	NA
2969773:2969800	attL	ACTGGTTCAATCCCAGTATCGCGCACCA	NA	NA	NA	NA
WP_003899409.1|2969906_2970338_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003900538.1|2970334_2971333_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2D1G8E2	Mycobacterium_phage	47.8	7.4e-62
WP_003900539.1|2971346_2971811_+	ParB N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_096867877.1|2971943_2973204_+|transposase	IS3-like element IS987 family transposase	transposase	Q8W6R2	Burkholderia_virus	58.8	6.2e-82
WP_003899411.1|2973578_2975018_-|capsid	phage major capsid protein	capsid	A0A1B3AYS4	Gordonia_phage	40.6	1.4e-66
WP_003899412.1|2975025_2975559_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	32.9	3.1e-06
WP_003899413.1|2975711_2976338_-|terminase	phage terminase small subunit P27 family	terminase	V9H0V4	Actinophage	47.2	1.6e-17
2980755:2980782	attR	ACTGGTTCAATCCCAGTATCGCGCACCA	NA	NA	NA	NA
