The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP023630	Mycobacterium tuberculosis strain MDRMA2441 chromosome, complete genome	4411454	889015	947565	4411454	transposase,tRNA,bacteriocin,protease	Burkholderia_virus(16.67%)	54	NA	NA
WP_087902221.1|889015_890276_+|transposase	IS3-like element IS987 family transposase	transposase	Q8W6R2	Burkholderia_virus	59.1	9.6e-83
WP_009935676.1|890331_891426_+|transposase	IS110-like element IS1547 family transposase	transposase	NA	NA	NA	NA
WP_003404092.1|891415_892213_-|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
WP_003404098.1|892209_893217_-	Dyp-type peroxidase	NA	NA	NA	NA	NA
WP_003404103.1|893261_894563_+	M18 family aminopeptidase	NA	NA	NA	NA	NA
WP_003898592.1|894574_894922_+	VOC family protein	NA	NA	NA	NA	NA
WP_003404111.1|894915_895572_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003404114.1|895763_898028_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	64.3	8.1e-274
WP_003404117.1|898024_898654_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003404120.1|898774_899731_+	phosphodiesterase	NA	NA	NA	NA	NA
WP_003898594.1|899675_901274_-	exopolysaccharide phosphotransferase CpsY	NA	NA	NA	NA	NA
WP_003404127.1|901578_901968_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003404129.1|902054_903638_+	amidophosphoribosyltransferase	NA	A0A1B1ISH6	uncultured_Mediterranean_phage	30.6	2.6e-45
WP_003404132.1|903668_904763_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	37.3	2.3e-56
WP_003404135.1|904848_905031_-	DUF3073 domain-containing protein	NA	NA	NA	NA	NA
WP_003404137.1|905177_906284_-	folate-binding protein YgfZ	NA	NA	NA	NA	NA
WP_003404139.1|906366_907236_+	aminodeoxychorismate lyase	NA	NA	NA	NA	NA
WP_003898596.1|907281_907962_-	FABP family protein	NA	NA	NA	NA	NA
WP_003404278.1|908124_908427_-	DUF1416 domain-containing protein	NA	NA	NA	NA	NA
WP_003404293.1|908428_909262_-	sulfurtransferase	NA	NA	NA	NA	NA
WP_003898598.1|909554_909977_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_003404298.1|909973_910786_-	DUF2993 domain-containing protein	NA	NA	NA	NA	NA
WP_003898599.1|910915_911683_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	31.5	3.1e-15
WP_003404307.1|911679_912627_+	mycothiol synthase	NA	NA	NA	NA	NA
WP_003404312.1|912669_913446_+	phosphate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.1	1.6e-16
WP_003404314.1|913501_914143_-	phosphate signaling complex protein PhoU	NA	NA	NA	NA	NA
WP_003898600.1|914200_916255_-	LCP family protein	NA	NA	NA	NA	NA
WP_003898601.1|916420_917590_-|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_003404321.1|917654_918671_-	acyl-ACP desaturase	NA	NA	NA	NA	NA
WP_003404326.1|918832_919474_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003898602.1|919554_920610_+	DUF2236 domain-containing protein	NA	NA	NA	NA	NA
WP_003404335.1|920661_921054_-	Ni(II)/Co(II)-sensing metalloregulatory transcriptional repressor KmtR	NA	NA	NA	NA	NA
WP_003404336.1|921111_921534_-	nucleoside deaminase	NA	NA	NA	NA	NA
WP_003900218.1|921495_921786_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_003404349.1|921890_922796_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_003404352.1|922814_923630_-	TIGR04255 family protein	NA	NA	NA	NA	NA
WP_010886090.1|927757_930406_-	PE family protein	NA	NA	NA	NA	NA
WP_003404362.1|930873_931518_+	sensor domain-containing protein	NA	NA	NA	NA	NA
WP_003898607.1|931498_932050_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003906455.1|932199_932853_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003404368.1|932923_933952_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003898609.1|934640_935411_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003404373.1|935497_936310_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_003404376.1|936377_937238_-	proline-specific peptidase family protein	NA	NA	NA	NA	NA
WP_003404379.1|937513_937756_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003404382.1|938032_939325_+	MFS transporter	NA	NA	NA	NA	NA
WP_003404384.1|939308_940313_+	thiamine pyrophosphate-dependent dehydrogenase E1 component subunit alpha	NA	NA	NA	NA	NA
WP_003404388.1|940376_941027_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_003898611.1|941110_942388_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_003404392.1|942600_944115_-	multicopper oxidase MmcO	NA	NA	NA	NA	NA
WP_003901025.1|944263_944656_+	lipoprotein LpqS	NA	NA	NA	NA	NA
WP_023637361.1|944858_945977_+	PLP-dependent cysteine synthase family protein	NA	NA	NA	NA	NA
WP_003404402.1|945976_947236_+	MFS transporter	NA	NA	NA	NA	NA
WP_003404404.1|947232_947565_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP023630	Mycobacterium tuberculosis strain MDRMA2441 chromosome, complete genome	4411454	2941130	2976470	4411454	integrase,tRNA,capsid,transposase,head,terminase,protease	Tupanvirus(11.11%)	41	2969905:2969932	2980887:2980914
WP_003413486.1|2941130_2943209_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	34.9	2.5e-104
WP_003413487.1|2943317_2943545_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009938541.1|2943541_2944927_-	PE family protein	NA	NA	NA	NA	NA
WP_003413569.1|2945271_2945772_+	DUF1990 family protein	NA	NA	NA	NA	NA
WP_003413574.1|2945788_2946229_-	DoxX family membrane protein	NA	NA	NA	NA	NA
WP_003901437.1|2946375_2947053_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_003413583.1|2947037_2947391_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_003413586.1|2947403_2947829_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003413588.1|2947825_2948500_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_003413589.1|2948577_2949399_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_003413592.1|2949534_2950428_+	universal stress protein	NA	NA	NA	NA	NA
WP_078441640.1|2950430_2951231_-	universal stress protein	NA	NA	NA	NA	NA
WP_003899401.1|2951237_2952419_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_003413598.1|2952477_2952909_-	CBS domain-containing protein	NA	A0A2I6B2H4	Macacine_betaherpesvirus	100.0	1.9e-75
WP_003899402.1|2953422_2954664_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_003899403.1|2954973_2955336_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003413610.1|2955682_2956807_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003413614.1|2956808_2957348_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003413616.1|2957487_2958786_+	RNA-splicing ligase RtcB	NA	A2RQD0	Archaeal_BJ1_virus	43.3	3.8e-90
WP_003413619.1|2958824_2959106_-	DUF1876 domain-containing protein	NA	NA	NA	NA	NA
WP_003413625.1|2959250_2959736_-	hemerythrin domain-containing protein	NA	NA	NA	NA	NA
WP_003902325.1|2959762_2960020_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009938544.1|2960020_2962357_-	PE family protein	NA	NA	NA	NA	NA
WP_003899405.1|2962385_2962628_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003899406.1|2962628_2963306_+	membrane protein	NA	NA	NA	NA	NA
WP_003413654.1|2963501_2964158_+	DedA family protein	NA	NA	NA	NA	NA
WP_003413657.1|2964320_2964767_+	anti-sigma factor antagonist	NA	NA	NA	NA	NA
WP_003413663.1|2964941_2965274_-	YnfA family protein	NA	NA	NA	NA	NA
WP_003413665.1|2965393_2965753_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003413675.1|2965854_2966313_+	glyoxalase/bleomycin resistance/dioxygenase family protein	NA	NA	NA	NA	NA
WP_003899407.1|2966448_2966829_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_023637465.1|2966825_2968322_+	ACR3 family arsenite efflux transporter	NA	A0A2H4PQT9	Staphylococcus_phage	39.7	5.1e-14
WP_085972563.1|2968511_2968748_+	antitoxin MazE family protein	NA	NA	NA	NA	NA
WP_077365235.1|2968820_2968994_+	hypothetical protein	NA	NA	NA	NA	NA
2969905:2969932	attL	ACTGGTTCAATCCCAGTATCGCGCACCA	NA	NA	NA	NA
WP_003899409.1|2970038_2970470_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003900538.1|2970466_2971465_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2D1G8E2	Mycobacterium_phage	47.8	7.4e-62
WP_003900539.1|2971478_2971943_+	ParB N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_087902221.1|2972075_2973336_+|transposase	IS3-like element IS987 family transposase	transposase	Q8W6R2	Burkholderia_virus	59.1	9.6e-83
WP_003899411.1|2973710_2975150_-|capsid	phage major capsid protein	capsid	A0A1B3AYS4	Gordonia_phage	40.6	1.4e-66
WP_003899412.1|2975157_2975691_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	32.9	3.1e-06
WP_003899413.1|2975843_2976470_-|terminase	phage terminase small subunit P27 family	terminase	V9H0V4	Actinophage	47.2	1.6e-17
2980887:2980914	attR	ACTGGTTCAATCCCAGTATCGCGCACCA	NA	NA	NA	NA
