The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP023628	Mycobacterium tuberculosis strain MDRMA2082 chromosome, complete genome	4411479	889044	947608	4411479	tRNA,transposase,bacteriocin,protease	Burkholderia_virus(16.67%)	54	NA	NA
WP_087902221.1|889044_890305_+|transposase	IS3-like element IS987 family transposase	transposase	Q8W6R2	Burkholderia_virus	59.1	9.6e-83
WP_009935676.1|890360_891455_+|transposase	IS110-like element IS1547 family transposase	transposase	NA	NA	NA	NA
WP_003404092.1|891444_892242_-|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
WP_003404098.1|892238_893246_-	Dyp-type peroxidase	NA	NA	NA	NA	NA
WP_003404103.1|893290_894592_+	M18 family aminopeptidase	NA	NA	NA	NA	NA
WP_003898592.1|894603_894951_+	VOC family protein	NA	NA	NA	NA	NA
WP_003404111.1|894944_895601_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_010924301.1|895792_898057_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	64.2	1.8e-273
WP_003404117.1|898053_898683_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003404120.1|898803_899760_+	phosphodiesterase	NA	NA	NA	NA	NA
WP_003898594.1|899704_901303_-	exopolysaccharide phosphotransferase CpsY	NA	NA	NA	NA	NA
WP_003404127.1|901607_901997_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003900214.1|902083_903667_+	amidophosphoribosyltransferase	NA	A0A1B1ISH6	uncultured_Mediterranean_phage	30.6	2.6e-45
WP_003404132.1|903697_904792_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	37.3	2.3e-56
WP_003404135.1|904877_905060_-	DUF3073 domain-containing protein	NA	NA	NA	NA	NA
WP_003404137.1|905206_906313_-	folate-binding protein YgfZ	NA	NA	NA	NA	NA
WP_003404139.1|906395_907265_+	aminodeoxychorismate lyase	NA	NA	NA	NA	NA
WP_003898596.1|907310_907991_-	FABP family protein	NA	NA	NA	NA	NA
WP_003404278.1|908153_908456_-	DUF1416 domain-containing protein	NA	NA	NA	NA	NA
WP_003404293.1|908457_909291_-	sulfurtransferase	NA	NA	NA	NA	NA
WP_003900215.1|909583_910006_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_003404298.1|910002_910815_-	DUF2993 domain-containing protein	NA	NA	NA	NA	NA
WP_003898599.1|910944_911712_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	31.5	3.1e-15
WP_003404307.1|911708_912656_+	mycothiol synthase	NA	NA	NA	NA	NA
WP_003404312.1|912698_913475_+	phosphate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.1	1.6e-16
WP_003404314.1|913530_914172_-	phosphate signaling complex protein PhoU	NA	NA	NA	NA	NA
WP_003898600.1|914229_916284_-	LCP family protein	NA	NA	NA	NA	NA
WP_003898601.1|916449_917619_-|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_003404321.1|917706_918723_-	acyl-ACP desaturase DesA1	NA	NA	NA	NA	NA
WP_003404326.1|918884_919526_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003898602.1|919606_920662_+	DUF2236 domain-containing protein	NA	NA	NA	NA	NA
WP_003404335.1|920713_921106_-	Ni(II)/Co(II)-sensing metalloregulatory transcriptional repressor KmtR	NA	NA	NA	NA	NA
WP_003404336.1|921163_921586_-	nucleoside deaminase	NA	NA	NA	NA	NA
WP_003900218.1|921547_921838_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_003404349.1|921942_922848_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_003404352.1|922866_923682_-	TIGR04255 family protein	NA	NA	NA	NA	NA
WP_015345040.1|927809_930449_-	PE family protein	NA	NA	NA	NA	NA
WP_003404362.1|930916_931561_+	sensor domain-containing protein	NA	NA	NA	NA	NA
WP_003898607.1|931541_932093_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003906455.1|932242_932896_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003404368.1|932966_933995_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003898609.1|934683_935454_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003404373.1|935540_936353_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_003404376.1|936420_937281_-	proline-specific peptidase family protein	NA	NA	NA	NA	NA
WP_003404379.1|937556_937799_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003404382.1|938075_939368_+	MFS transporter	NA	NA	NA	NA	NA
WP_003404384.1|939351_940356_+	thiamine pyrophosphate-dependent dehydrogenase E1 component subunit alpha	NA	NA	NA	NA	NA
WP_003404388.1|940419_941070_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_003898611.1|941153_942431_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_070892544.1|942643_944158_-	multicopper oxidase MmcO	NA	NA	NA	NA	NA
WP_003901025.1|944306_944699_+	lipoprotein LpqS	NA	NA	NA	NA	NA
WP_003404395.1|944901_946020_+	PLP-dependent cysteine synthase family protein	NA	NA	NA	NA	NA
WP_003404402.1|946019_947279_+	MFS transporter	NA	NA	NA	NA	NA
WP_003404404.1|947275_947608_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP023628	Mycobacterium tuberculosis strain MDRMA2082 chromosome, complete genome	4411479	2941155	2976521	4411479	integrase,tRNA,head,protease,terminase,transposase,capsid	Tupanvirus(11.11%)	41	2969956:2969983	2980938:2980965
WP_003413486.1|2941155_2943234_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	34.9	2.5e-104
WP_003413487.1|2943342_2943570_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009938541.1|2943566_2944952_-	PE family protein	NA	NA	NA	NA	NA
WP_003413569.1|2945296_2945797_+	DUF1990 family protein	NA	NA	NA	NA	NA
WP_003413574.1|2945813_2946254_-	DoxX family membrane protein	NA	NA	NA	NA	NA
WP_003901437.1|2946400_2947078_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_003413583.1|2947062_2947416_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_003413586.1|2947428_2947854_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003900535.1|2947850_2948525_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_003413589.1|2948602_2949424_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_003413592.1|2949559_2950453_+	universal stress protein	NA	NA	NA	NA	NA
WP_003413594.1|2950455_2951274_-	universal stress protein	NA	NA	NA	NA	NA
WP_003899401.1|2951288_2952470_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_003413598.1|2952528_2952960_-	CBS domain-containing protein	NA	A0A2I6B2H4	Macacine_betaherpesvirus	100.0	1.9e-75
WP_003899402.1|2953473_2954715_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_003899403.1|2955024_2955387_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003413610.1|2955733_2956858_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003413614.1|2956859_2957399_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010924557.1|2957538_2958837_+	RNA-splicing ligase RtcB	NA	A2RQD0	Archaeal_BJ1_virus	43.3	3.8e-90
WP_003413619.1|2958875_2959157_-	DUF1876 domain-containing protein	NA	NA	NA	NA	NA
WP_003413625.1|2959301_2959787_-	hemerythrin domain-containing protein	NA	NA	NA	NA	NA
WP_003902325.1|2959813_2960071_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009938544.1|2960071_2962408_-	PE family protein	NA	NA	NA	NA	NA
WP_003899405.1|2962436_2962679_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003899406.1|2962679_2963357_+	membrane protein	NA	NA	NA	NA	NA
WP_003413654.1|2963552_2964209_+	DedA family protein	NA	NA	NA	NA	NA
WP_003413657.1|2964371_2964818_+	anti-sigma factor antagonist	NA	NA	NA	NA	NA
WP_003413663.1|2964992_2965325_-	YnfA family protein	NA	NA	NA	NA	NA
WP_003413665.1|2965444_2965804_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003413675.1|2965905_2966364_+	glyoxalase/bleomycin resistance/dioxygenase family protein	NA	NA	NA	NA	NA
WP_003899407.1|2966499_2966880_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003413686.1|2966876_2968373_+	ACR3 family arsenite efflux transporter	NA	A0A2H4PQT9	Staphylococcus_phage	39.7	5.1e-14
WP_085972563.1|2968562_2968799_+	antitoxin MazE family protein	NA	NA	NA	NA	NA
WP_077365235.1|2968871_2969045_+	hypothetical protein	NA	NA	NA	NA	NA
2969956:2969983	attL	ACTGGTTCAATCCCAGTATCGCGCACCA	NA	NA	NA	NA
WP_003899409.1|2970089_2970521_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003900538.1|2970517_2971516_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2D1G8E2	Mycobacterium_phage	47.8	7.4e-62
WP_003900539.1|2971529_2971994_+	ParB N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_087902221.1|2972126_2973387_+|transposase	IS3-like element IS987 family transposase	transposase	Q8W6R2	Burkholderia_virus	59.1	9.6e-83
WP_003899411.1|2973761_2975201_-|capsid	phage major capsid protein	capsid	A0A1B3AYS4	Gordonia_phage	40.6	1.4e-66
WP_003899412.1|2975208_2975742_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	32.9	3.1e-06
WP_003899413.1|2975894_2976521_-|terminase	phage terminase small subunit P27 family	terminase	V9H0V4	Actinophage	47.2	1.6e-17
2980938:2980965	attR	ACTGGTTCAATCCCAGTATCGCGCACCA	NA	NA	NA	NA
