The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP023625	Mycobacterium tuberculosis strain MDRMA863 chromosome, complete genome	4411432	889008	947572	4411432	bacteriocin,tRNA,protease,transposase	Burkholderia_virus(16.67%)	54	NA	NA
WP_087902221.1|889008_890269_+|transposase	IS3-like element IS987 family transposase	transposase	Q8W6R2	Burkholderia_virus	59.1	9.6e-83
WP_009935676.1|890324_891419_+|transposase	IS110-like element IS1547 family transposase	transposase	NA	NA	NA	NA
WP_003404092.1|891408_892206_-|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
WP_003404098.1|892202_893210_-	Dyp-type peroxidase	NA	NA	NA	NA	NA
WP_003404103.1|893254_894556_+	M18 family aminopeptidase	NA	NA	NA	NA	NA
WP_003898592.1|894567_894915_+	VOC family protein	NA	NA	NA	NA	NA
WP_003404111.1|894908_895565_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_010924301.1|895756_898021_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	64.2	1.8e-273
WP_003404117.1|898017_898647_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003404120.1|898767_899724_+	phosphodiesterase	NA	NA	NA	NA	NA
WP_003898594.1|899668_901267_-	exopolysaccharide phosphotransferase CpsY	NA	NA	NA	NA	NA
WP_003404127.1|901571_901961_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003900214.1|902047_903631_+	amidophosphoribosyltransferase	NA	A0A1B1ISH6	uncultured_Mediterranean_phage	30.6	2.6e-45
WP_003404132.1|903661_904756_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	37.3	2.3e-56
WP_003404135.1|904841_905024_-	DUF3073 domain-containing protein	NA	NA	NA	NA	NA
WP_003404137.1|905170_906277_-	folate-binding protein YgfZ	NA	NA	NA	NA	NA
WP_003404139.1|906359_907229_+	aminodeoxychorismate lyase	NA	NA	NA	NA	NA
WP_003898596.1|907274_907955_-	FABP family protein	NA	NA	NA	NA	NA
WP_003404278.1|908117_908420_-	DUF1416 domain-containing protein	NA	NA	NA	NA	NA
WP_003404293.1|908421_909255_-	sulfurtransferase	NA	NA	NA	NA	NA
WP_003900215.1|909547_909970_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_003404298.1|909966_910779_-	DUF2993 domain-containing protein	NA	NA	NA	NA	NA
WP_003898599.1|910908_911676_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	31.5	3.1e-15
WP_003404307.1|911672_912620_+	mycothiol synthase	NA	NA	NA	NA	NA
WP_003404312.1|912662_913439_+	phosphate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.1	1.6e-16
WP_003404314.1|913494_914136_-	phosphate signaling complex protein PhoU	NA	NA	NA	NA	NA
WP_003898600.1|914193_916248_-	LCP family protein	NA	NA	NA	NA	NA
WP_003898601.1|916413_917583_-|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_003404321.1|917670_918687_-	acyl-ACP desaturase	NA	NA	NA	NA	NA
WP_003404326.1|918848_919490_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003898602.1|919570_920626_+	DUF2236 domain-containing protein	NA	NA	NA	NA	NA
WP_003404335.1|920677_921070_-	Ni(II)/Co(II)-sensing metalloregulatory transcriptional repressor KmtR	NA	NA	NA	NA	NA
WP_003404336.1|921127_921550_-	nucleoside deaminase	NA	NA	NA	NA	NA
WP_003900218.1|921511_921802_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_003404349.1|921906_922812_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_003404352.1|922830_923646_-	TIGR04255 family protein	NA	NA	NA	NA	NA
WP_015345040.1|927773_930413_-	PE family protein	NA	NA	NA	NA	NA
WP_003404362.1|930880_931525_+	sensor domain-containing protein	NA	NA	NA	NA	NA
WP_003898607.1|931505_932057_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003906455.1|932206_932860_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003404368.1|932930_933959_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003898609.1|934647_935418_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003404373.1|935504_936317_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_003404376.1|936384_937245_-	proline-specific peptidase family protein	NA	NA	NA	NA	NA
WP_003404379.1|937520_937763_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003404382.1|938039_939332_+	MFS transporter	NA	NA	NA	NA	NA
WP_003404384.1|939315_940320_+	thiamine pyrophosphate-dependent dehydrogenase E1 component subunit alpha	NA	NA	NA	NA	NA
WP_003404388.1|940383_941034_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_003898611.1|941117_942395_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_003404392.1|942607_944122_-	multicopper oxidase MmcO	NA	NA	NA	NA	NA
WP_003901025.1|944270_944663_+	lipoprotein LpqS	NA	NA	NA	NA	NA
WP_003404395.1|944865_945984_+	PLP-dependent cysteine synthase family protein	NA	NA	NA	NA	NA
WP_003404402.1|945983_947243_+	MFS transporter	NA	NA	NA	NA	NA
WP_003404404.1|947239_947572_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP023625	Mycobacterium tuberculosis strain MDRMA863 chromosome, complete genome	4411432	2941129	2976495	4411432	integrase,tRNA,head,capsid,terminase,transposase,protease	Tupanvirus(11.11%)	41	2969930:2969957	2980912:2980939
WP_003413486.1|2941129_2943208_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	34.9	2.5e-104
WP_003413487.1|2943316_2943544_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009938541.1|2943540_2944926_-	PE family protein	NA	NA	NA	NA	NA
WP_003413569.1|2945270_2945771_+	DUF1990 family protein	NA	NA	NA	NA	NA
WP_003413574.1|2945787_2946228_-	DoxX family membrane protein	NA	NA	NA	NA	NA
WP_003901437.1|2946374_2947052_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_003413583.1|2947036_2947390_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_003413586.1|2947402_2947828_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003900535.1|2947824_2948499_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_003413589.1|2948576_2949398_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_003413592.1|2949533_2950427_+	universal stress protein	NA	NA	NA	NA	NA
WP_003413594.1|2950429_2951248_-	universal stress protein	NA	NA	NA	NA	NA
WP_003899401.1|2951262_2952444_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_003413598.1|2952502_2952934_-	CBS domain-containing protein	NA	A0A2I6B2H4	Macacine_betaherpesvirus	100.0	1.9e-75
WP_003899402.1|2953447_2954689_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_003899403.1|2954998_2955361_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003413610.1|2955707_2956832_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003413614.1|2956833_2957373_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010924557.1|2957512_2958811_+	RNA-splicing ligase RtcB	NA	A2RQD0	Archaeal_BJ1_virus	43.3	3.8e-90
WP_003413619.1|2958849_2959131_-	DUF1876 domain-containing protein	NA	NA	NA	NA	NA
WP_003413625.1|2959275_2959761_-	hemerythrin domain-containing protein	NA	NA	NA	NA	NA
WP_003902325.1|2959787_2960045_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009938544.1|2960045_2962382_-	PE family protein	NA	NA	NA	NA	NA
WP_003899405.1|2962410_2962653_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003899406.1|2962653_2963331_+	membrane protein	NA	NA	NA	NA	NA
WP_003413654.1|2963526_2964183_+	DedA family protein	NA	NA	NA	NA	NA
WP_003413657.1|2964345_2964792_+	anti-sigma factor antagonist	NA	NA	NA	NA	NA
WP_003413663.1|2964966_2965299_-	YnfA family protein	NA	NA	NA	NA	NA
WP_003413665.1|2965418_2965778_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003413675.1|2965879_2966338_+	glyoxalase/bleomycin resistance/dioxygenase family protein	NA	NA	NA	NA	NA
WP_003899407.1|2966473_2966854_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003413686.1|2966850_2968347_+	ACR3 family arsenite efflux transporter	NA	A0A2H4PQT9	Staphylococcus_phage	39.7	5.1e-14
WP_085972563.1|2968536_2968773_+	antitoxin MazE family protein	NA	NA	NA	NA	NA
WP_077365235.1|2968845_2969019_+	hypothetical protein	NA	NA	NA	NA	NA
2969930:2969957	attL	ACTGGTTCAATCCCAGTATCGCGCACCA	NA	NA	NA	NA
WP_003899409.1|2970063_2970495_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003900538.1|2970491_2971490_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2D1G8E2	Mycobacterium_phage	47.8	7.4e-62
WP_003900539.1|2971503_2971968_+	ParB N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_087902221.1|2972100_2973361_+|transposase	IS3-like element IS987 family transposase	transposase	Q8W6R2	Burkholderia_virus	59.1	9.6e-83
WP_003899411.1|2973735_2975175_-|capsid	phage major capsid protein	capsid	A0A1B3AYS4	Gordonia_phage	40.6	1.4e-66
WP_003899412.1|2975182_2975716_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	32.9	3.1e-06
WP_003899413.1|2975868_2976495_-|terminase	phage terminase small subunit P27 family	terminase	V9H0V4	Actinophage	47.2	1.6e-17
2980912:2980939	attR	ACTGGTTCAATCCCAGTATCGCGCACCA	NA	NA	NA	NA
