The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP023623	Mycobacterium tuberculosis strain MDRMA203 chromosome, complete genome	4411290	889026	947579	4411290	bacteriocin,tRNA,transposase,protease	Burkholderia_virus(16.67%)	54	NA	NA
WP_087902221.1|889026_890287_+|transposase	IS3-like element IS987 family transposase	transposase	Q8W6R2	Burkholderia_virus	59.1	9.6e-83
WP_009935676.1|890331_891426_+|transposase	IS110-like element IS1547 family transposase	transposase	NA	NA	NA	NA
WP_003404092.1|891415_892213_-|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
WP_003404098.1|892209_893217_-	Dyp-type peroxidase	NA	NA	NA	NA	NA
WP_096874596.1|893261_894563_+	M18 family aminopeptidase	NA	NA	NA	NA	NA
WP_003898592.1|894574_894922_+	VOC family protein	NA	NA	NA	NA	NA
WP_003404111.1|894915_895572_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_010924301.1|895763_898028_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	64.2	1.8e-273
WP_003404117.1|898024_898654_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003404120.1|898774_899731_+	phosphodiesterase	NA	NA	NA	NA	NA
WP_003898594.1|899675_901274_-	exopolysaccharide phosphotransferase CpsY	NA	NA	NA	NA	NA
WP_003404127.1|901578_901968_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003404129.1|902054_903638_+	amidophosphoribosyltransferase	NA	A0A1B1ISH6	uncultured_Mediterranean_phage	30.6	2.6e-45
WP_003404132.1|903668_904763_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	37.3	2.3e-56
WP_003404135.1|904848_905031_-	DUF3073 domain-containing protein	NA	NA	NA	NA	NA
WP_003404137.1|905177_906284_-	folate-binding protein YgfZ	NA	NA	NA	NA	NA
WP_003404139.1|906366_907236_+	aminodeoxychorismate lyase	NA	NA	NA	NA	NA
WP_003898596.1|907281_907962_-	FABP family protein	NA	NA	NA	NA	NA
WP_003404278.1|908124_908427_-	DUF1416 domain-containing protein	NA	NA	NA	NA	NA
WP_003404293.1|908428_909262_-	sulfurtransferase	NA	NA	NA	NA	NA
WP_003898598.1|909554_909977_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_003404298.1|909973_910786_-	DUF2993 domain-containing protein	NA	NA	NA	NA	NA
WP_003898599.1|910915_911683_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	31.5	3.1e-15
WP_003404307.1|911679_912627_+	mycothiol synthase	NA	NA	NA	NA	NA
WP_003404312.1|912669_913446_+	phosphate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.1	1.6e-16
WP_003404314.1|913501_914143_-	phosphate signaling complex protein PhoU	NA	NA	NA	NA	NA
WP_096874597.1|914200_916255_-	LCP family protein	NA	NA	NA	NA	NA
WP_003898601.1|916420_917590_-|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_003404321.1|917677_918694_-	acyl-ACP desaturase	NA	NA	NA	NA	NA
WP_003404326.1|918855_919497_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003898602.1|919577_920633_+	DUF2236 domain-containing protein	NA	NA	NA	NA	NA
WP_003404335.1|920684_921077_-	Ni(II)/Co(II)-sensing metalloregulatory transcriptional repressor KmtR	NA	NA	NA	NA	NA
WP_003404336.1|921134_921557_-	nucleoside deaminase	NA	NA	NA	NA	NA
WP_003900218.1|921518_921809_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_003404349.1|921913_922819_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_003404352.1|922837_923653_-	TIGR04255 family protein	NA	NA	NA	NA	NA
WP_015345040.1|927780_930420_-	PE family protein	NA	NA	NA	NA	NA
WP_003404362.1|930887_931532_+	sensor domain-containing protein	NA	NA	NA	NA	NA
WP_003898607.1|931512_932064_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003906455.1|932213_932867_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003404368.1|932937_933966_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003898609.1|934654_935425_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003404373.1|935511_936324_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_003404376.1|936391_937252_-	proline-specific peptidase family protein	NA	NA	NA	NA	NA
WP_003404379.1|937527_937770_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003404382.1|938046_939339_+	MFS transporter	NA	NA	NA	NA	NA
WP_003404384.1|939322_940327_+	thiamine pyrophosphate-dependent dehydrogenase E1 component subunit alpha	NA	NA	NA	NA	NA
WP_003404388.1|940390_941041_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_003898611.1|941124_942402_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_003404392.1|942614_944129_-	multicopper oxidase MmcO	NA	NA	NA	NA	NA
WP_003901025.1|944277_944670_+	lipoprotein LpqS	NA	NA	NA	NA	NA
WP_003404395.1|944872_945991_+	PLP-dependent cysteine synthase family protein	NA	NA	NA	NA	NA
WP_003404402.1|945990_947250_+	MFS transporter	NA	NA	NA	NA	NA
WP_003404404.1|947246_947579_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP023623	Mycobacterium tuberculosis strain MDRMA203 chromosome, complete genome	4411290	2941080	2976446	4411290	capsid,transposase,integrase,terminase,head,tRNA,protease	Tupanvirus(11.11%)	41	2969881:2969908	2980863:2980890
WP_003413486.1|2941080_2943159_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	34.9	2.5e-104
WP_003413487.1|2943267_2943495_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009938541.1|2943491_2944877_-	PE family protein	NA	NA	NA	NA	NA
WP_003413569.1|2945221_2945722_+	DUF1990 family protein	NA	NA	NA	NA	NA
WP_003413574.1|2945738_2946179_-	DoxX family membrane protein	NA	NA	NA	NA	NA
WP_003901437.1|2946325_2947003_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_003413583.1|2946987_2947341_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_003413586.1|2947353_2947779_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003413588.1|2947775_2948450_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_003413589.1|2948527_2949349_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_003413592.1|2949484_2950378_+	universal stress protein	NA	NA	NA	NA	NA
WP_003413594.1|2950380_2951199_-	universal stress protein	NA	NA	NA	NA	NA
WP_003899401.1|2951213_2952395_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_003413598.1|2952453_2952885_-	CBS domain-containing protein	NA	A0A2I6B2H4	Macacine_betaherpesvirus	100.0	1.9e-75
WP_003899402.1|2953398_2954640_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_003899403.1|2954949_2955312_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003413610.1|2955658_2956783_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003413614.1|2956784_2957324_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010924557.1|2957463_2958762_+	RNA-splicing ligase RtcB	NA	A2RQD0	Archaeal_BJ1_virus	43.3	3.8e-90
WP_003413619.1|2958800_2959082_-	DUF1876 domain-containing protein	NA	NA	NA	NA	NA
WP_003413625.1|2959226_2959712_-	hemerythrin domain-containing protein	NA	NA	NA	NA	NA
WP_003902325.1|2959738_2959996_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009938544.1|2959996_2962333_-	PE family protein	NA	NA	NA	NA	NA
WP_003899405.1|2962361_2962604_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003899406.1|2962604_2963282_+	membrane protein	NA	NA	NA	NA	NA
WP_003413654.1|2963477_2964134_+	DedA family protein	NA	NA	NA	NA	NA
WP_003413657.1|2964296_2964743_+	anti-sigma factor antagonist	NA	NA	NA	NA	NA
WP_003413663.1|2964917_2965250_-	YnfA family protein	NA	NA	NA	NA	NA
WP_003413665.1|2965369_2965729_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003413675.1|2965830_2966289_+	glyoxalase/bleomycin resistance/dioxygenase family protein	NA	NA	NA	NA	NA
WP_003899407.1|2966424_2966805_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003413686.1|2966801_2968298_+	ACR3 family arsenite efflux transporter	NA	A0A2H4PQT9	Staphylococcus_phage	39.7	5.1e-14
WP_085972563.1|2968487_2968724_+	antitoxin MazE family protein	NA	NA	NA	NA	NA
WP_077365235.1|2968796_2968970_+	hypothetical protein	NA	NA	NA	NA	NA
2969881:2969908	attL	ACTGGTTCAATCCCAGTATCGCGCACCA	NA	NA	NA	NA
WP_003899409.1|2970014_2970446_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003900538.1|2970442_2971441_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2D1G8E2	Mycobacterium_phage	47.8	7.4e-62
WP_003900539.1|2971454_2971919_+	ParB N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_087902221.1|2972051_2973312_+|transposase	IS3-like element IS987 family transposase	transposase	Q8W6R2	Burkholderia_virus	59.1	9.6e-83
WP_003899411.1|2973686_2975126_-|capsid	phage major capsid protein	capsid	A0A1B3AYS4	Gordonia_phage	40.6	1.4e-66
WP_003899412.1|2975133_2975667_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	32.9	3.1e-06
WP_003899413.1|2975819_2976446_-|terminase	phage terminase small subunit P27 family	terminase	V9H0V4	Actinophage	47.2	1.6e-17
2980863:2980890	attR	ACTGGTTCAATCCCAGTATCGCGCACCA	NA	NA	NA	NA
