The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP023619	Mycobacterium tuberculosis strain LN1100 chromosome, complete genome	4411392	889000	947568	4411392	tRNA,bacteriocin,transposase,protease	Burkholderia_virus(16.67%)	54	NA	NA
WP_087902221.1|889000_890261_+|transposase	IS3-like element IS987 family transposase	transposase	Q8W6R2	Burkholderia_virus	59.1	9.6e-83
WP_009935676.1|890320_891415_+|transposase	IS110-like element IS1547 family transposase	transposase	NA	NA	NA	NA
WP_003404092.1|891404_892202_-|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
WP_003404098.1|892198_893206_-	Dyp-type peroxidase	NA	NA	NA	NA	NA
WP_003404103.1|893250_894552_+	M18 family aminopeptidase	NA	NA	NA	NA	NA
WP_003898592.1|894563_894911_+	VOC family protein	NA	NA	NA	NA	NA
WP_003404111.1|894904_895561_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_010924301.1|895752_898017_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	64.2	1.8e-273
WP_003404117.1|898013_898643_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003404120.1|898763_899720_+	phosphodiesterase	NA	NA	NA	NA	NA
WP_003898594.1|899664_901263_-	exopolysaccharide phosphotransferase CpsY	NA	NA	NA	NA	NA
WP_003404127.1|901567_901957_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003900214.1|902043_903627_+	amidophosphoribosyltransferase	NA	A0A1B1ISH6	uncultured_Mediterranean_phage	30.6	2.6e-45
WP_003404132.1|903657_904752_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	37.3	2.3e-56
WP_003404135.1|904837_905020_-	DUF3073 domain-containing protein	NA	NA	NA	NA	NA
WP_003404137.1|905166_906273_-	folate-binding protein YgfZ	NA	NA	NA	NA	NA
WP_003404139.1|906355_907225_+	aminodeoxychorismate lyase	NA	NA	NA	NA	NA
WP_003898596.1|907270_907951_-	FABP family protein	NA	NA	NA	NA	NA
WP_003404278.1|908113_908416_-	DUF1416 domain-containing protein	NA	NA	NA	NA	NA
WP_003404293.1|908417_909251_-	sulfurtransferase	NA	NA	NA	NA	NA
WP_003900215.1|909543_909966_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_003404298.1|909962_910775_-	DUF2993 domain-containing protein	NA	NA	NA	NA	NA
WP_003898599.1|910904_911672_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	31.5	3.1e-15
WP_003404307.1|911668_912616_+	mycothiol synthase	NA	NA	NA	NA	NA
WP_003404312.1|912658_913435_+	phosphate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.1	1.6e-16
WP_003404314.1|913490_914132_-	phosphate signaling complex protein PhoU	NA	NA	NA	NA	NA
WP_003898600.1|914189_916244_-	LCP family protein	NA	NA	NA	NA	NA
WP_003898601.1|916409_917579_-|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_003404321.1|917666_918683_-	acyl-ACP desaturase	NA	NA	NA	NA	NA
WP_003404326.1|918844_919486_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003898602.1|919566_920622_+	DUF2236 domain-containing protein	NA	NA	NA	NA	NA
WP_003404335.1|920673_921066_-	Ni(II)/Co(II)-sensing metalloregulatory transcriptional repressor KmtR	NA	NA	NA	NA	NA
WP_003404336.1|921123_921546_-	nucleoside deaminase	NA	NA	NA	NA	NA
WP_003900218.1|921507_921798_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_003404349.1|921902_922808_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_003404352.1|922826_923642_-	TIGR04255 family protein	NA	NA	NA	NA	NA
WP_015345040.1|927769_930409_-	PE family protein	NA	NA	NA	NA	NA
WP_003404362.1|930876_931521_+	sensor domain-containing protein	NA	NA	NA	NA	NA
WP_003898607.1|931501_932053_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003906455.1|932202_932856_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003404368.1|932926_933955_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003898609.1|934643_935414_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003404373.1|935500_936313_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_003404376.1|936380_937241_-	proline-specific peptidase family protein	NA	NA	NA	NA	NA
WP_003404379.1|937516_937759_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003404382.1|938035_939328_+	MFS transporter	NA	NA	NA	NA	NA
WP_003404384.1|939311_940316_+	thiamine pyrophosphate-dependent dehydrogenase E1 component subunit alpha	NA	NA	NA	NA	NA
WP_003404388.1|940379_941030_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_003898611.1|941113_942391_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_003404392.1|942603_944118_-	multicopper oxidase MmcO	NA	NA	NA	NA	NA
WP_003901025.1|944266_944659_+	lipoprotein LpqS	NA	NA	NA	NA	NA
WP_003404395.1|944861_945980_+	PLP-dependent cysteine synthase family protein	NA	NA	NA	NA	NA
WP_003404402.1|945979_947239_+	MFS transporter	NA	NA	NA	NA	NA
WP_003404404.1|947235_947568_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP023619	Mycobacterium tuberculosis strain LN1100 chromosome, complete genome	4411392	2941125	2976491	4411392	capsid,transposase,terminase,tRNA,integrase,protease,head	Tupanvirus(11.11%)	41	2969926:2969953	2980908:2980935
WP_003413486.1|2941125_2943204_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	34.9	2.5e-104
WP_003413487.1|2943312_2943540_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009938541.1|2943536_2944922_-	PE family protein	NA	NA	NA	NA	NA
WP_003413569.1|2945266_2945767_+	DUF1990 family protein	NA	NA	NA	NA	NA
WP_003413574.1|2945783_2946224_-	DoxX family membrane protein	NA	NA	NA	NA	NA
WP_003901437.1|2946370_2947048_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_003413583.1|2947032_2947386_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_003413586.1|2947398_2947824_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003900535.1|2947820_2948495_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_003413589.1|2948572_2949394_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_003413592.1|2949529_2950423_+	universal stress protein	NA	NA	NA	NA	NA
WP_003413594.1|2950425_2951244_-	universal stress protein	NA	NA	NA	NA	NA
WP_003899401.1|2951258_2952440_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_003413598.1|2952498_2952930_-	CBS domain-containing protein	NA	A0A2I6B2H4	Macacine_betaherpesvirus	100.0	1.9e-75
WP_003899402.1|2953443_2954685_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_003899403.1|2954994_2955357_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003413610.1|2955703_2956828_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003413614.1|2956829_2957369_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010924557.1|2957508_2958807_+	RNA-splicing ligase RtcB	NA	A2RQD0	Archaeal_BJ1_virus	43.3	3.8e-90
WP_003413619.1|2958845_2959127_-	DUF1876 domain-containing protein	NA	NA	NA	NA	NA
WP_003413625.1|2959271_2959757_-	hemerythrin domain-containing protein	NA	NA	NA	NA	NA
WP_003902325.1|2959783_2960041_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009938544.1|2960041_2962378_-	PE family protein	NA	NA	NA	NA	NA
WP_003899405.1|2962406_2962649_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003899406.1|2962649_2963327_+	membrane protein	NA	NA	NA	NA	NA
WP_003413654.1|2963522_2964179_+	DedA family protein	NA	NA	NA	NA	NA
WP_003413657.1|2964341_2964788_+	anti-sigma factor antagonist	NA	NA	NA	NA	NA
WP_003413663.1|2964962_2965295_-	YnfA family protein	NA	NA	NA	NA	NA
WP_003413665.1|2965414_2965774_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003413675.1|2965875_2966334_+	glyoxalase/bleomycin resistance/dioxygenase family protein	NA	NA	NA	NA	NA
WP_003899407.1|2966469_2966850_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003413686.1|2966846_2968343_+	ACR3 family arsenite efflux transporter	NA	A0A2H4PQT9	Staphylococcus_phage	39.7	5.1e-14
WP_085972563.1|2968532_2968769_+	antitoxin MazE family protein	NA	NA	NA	NA	NA
WP_077365235.1|2968841_2969015_+	hypothetical protein	NA	NA	NA	NA	NA
2969926:2969953	attL	ACTGGTTCAATCCCAGTATCGCGCACCA	NA	NA	NA	NA
WP_003899409.1|2970059_2970491_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003900538.1|2970487_2971486_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2D1G8E2	Mycobacterium_phage	47.8	7.4e-62
WP_003900539.1|2971499_2971964_+	ParB N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_087902221.1|2972096_2973357_+|transposase	IS3-like element IS987 family transposase	transposase	Q8W6R2	Burkholderia_virus	59.1	9.6e-83
WP_003899411.1|2973731_2975171_-|capsid	phage major capsid protein	capsid	A0A1B3AYS4	Gordonia_phage	40.6	1.4e-66
WP_003899412.1|2975178_2975712_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	32.9	3.1e-06
WP_003899413.1|2975864_2976491_-|terminase	phage terminase small subunit P27 family	terminase	V9H0V4	Actinophage	47.2	1.6e-17
2980908:2980935	attR	ACTGGTTCAATCCCAGTATCGCGCACCA	NA	NA	NA	NA
